- Email: [email protected]
Molecular cloning and characterization of phenylalanine ammonia-lyase, cinnamate 4-hydroxylase and genes involved in flavone biosynthesis in Scutellaria baicalensis
Bioresource Technology 101 (2010) 9715–9722
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Molecular cloning and characterization of phenylalanine ammonia-lyase, cinnamate 4-hydroxylase and genes involved in flavone biosynthesis in Scutellaria baicalensis Hui Xu a,1, Nam Il Park a,1, Xiaohua Li a, Yong Kyoung Kim a, Sook Young Lee b, Sang Un Park a,* a b
Department of Crop Science, Chungnam National University, 79 Daehangno, Yuseong-Gu, Daejeon 305-764, South Korea Medical Device Clinical Center, Chosun University Dental Hospital, Chosun University, 375 Seosuk-Dong, Dong-Gu, Gwangju 501-759, South Korea
a r t i c l e
i n f o
Article history: Received 20 April 2010 Received in revised form 16 July 2010 Accepted 20 July 2010 Available online 24 July 2010 Keywords: Scutellaria baicalensis Phenylalanine ammonia-lyase Cinnamate 4-hydroxylase Flavone
a b s t r a c t The involvement of genes in flavones biosynthesis was investigated in different organs and suspension cells obtained from Scutellaria baicalensis. Three full-length cDNAs encoding phenylalanine ammonialyase isoforms (SbPAL1, SbPAL2, and SbAPL3) and one gene encoding cinnamate 4-hydroxylase (SbC4H) from S. baicalensis were isolated using rapid amplification of cDNA ends (RACE)–PCR. These cDNAs were used together with previously-isolated clones for 4-coumaroyl CoA ligase (4CL) and chalcone synthase (CHS) to show the expression level in different organs of S. baicalensis. These genes were upregulated in suspension cells of S. baicalensis with biotic/abiotic stress factors. The baicalin and baicalein contents in roots were 22 and 107 times higher than those in flowers, respectively. The treatment of suspension cells with methyl jasmonate (MeJa) enhanced the major flavones in S. baicalensis. Cumulatively, the results of this study should advance ability to biosynthesize important and useful medicinal compounds from a variety of plant species. Ó 2010 Elsevier Ltd. All rights reserved.
1. Introduction Scutellaria baicalensis Georgi, golden root, is a species of flowering plant in the Lamiaceae family. It is one of the 50 fundamental herbs used in traditional Chinese medicine, for treatment of fever, cold, and vomiting of blood. In Western medicine, it has been used to treat inflammation, respiratory tract infections, diarrhea, dysentery, jaundice/liver disorders, hypertension, hemorrhaging, and insomnia (Li-Weber, 2009). S. baicalensis root is rich in flavones, a class of flavonoids produced by plants. These compounds exhibit biological and pharmacological properties, including antioxidative activity, and have been used for cancer prevention and the treatment and prevention of coronary heart disease (Martens and Mithöfer, 2005). Because it has long been important in traditional medicine, S. baicalenesis is a good model for assessing the possible applications of biotechnology in improving medicinal plants. Previous works have investigated potentially useful techniques such as in vitro mass-propagation (Li et al., 2000), selection of elite germplasm using breeding programs and mutagens (Gao et al.,
Abbreviations: NAA, a-naphthalene acetic acid; 2,4-D, 2,4-dichlorophenoxy acetic acid; MeJa, methyl jasmonate; PAL, phenylalanine ammonia-lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4-coumaroyl CoA ligase; CHS, chalcone synthase. * Corresponding author. Tel.: +82 42 821 5730; fax: +82 42 822 2631. E-mail address: [email protected] (S.U. Park). 1 These authors contributed equally to the paper. 0960-8524/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.biortech.2010.07.083
2002; Murch et al., 2004), and genetic modification using Agrobacterium (Kovács et al., 2004; Kuzovkina et al., 2005). However, almost no information has been collected on the molecular properties of flavone biosynthetic genes, which could be used to improve the medicinal properties of S. baicalenesis. Baicalin, baicalein and wogonin are the most commonly studied flavone constituents of Scutellariae radix (Supplementary Fig. S1a) (Gao et al., 2000; Horvath et al., 2005). They are known to provide a variety of health benefits; for instance, wogonin (WOG) has been shown to exert anti-inflammatory (Chi et al., 2003), anti-viral (Guo et al., 2007), neuroprotection (Son et al., 2004) activities. Recently it has been shown to have a potential for therapeutic use in the treatment of antitumor and chemoprophylaxis (Zhao et al., 2010). S. baicalesis has also been shown to contain high concentrations of melatonin, a potent antioxidant (Murch et al., 2004). The main compounds of S. baicalensis are important sources for the development of anti-cancer, anti-inflammatory, and neuroprotective drugs. In higher plants, the phenylpropanoid pathway, a secondary metabolism pathway, is responsible for producing flavonoids (as well as a variety of other physiologically important metabolites, including lignins, coumarins, phytoalexins, and stilbenes, which play important roles in plant development, mechanical support, and disease resistance) (Harakava, 2005; Lau et al., 2007). Phenylalanine ammonia-lyase (PAL, EC 4.3.1.5) is the first key enzyme of the phenylpropanoid pathway; it catalyzes L-phenylalanine to trans-cinnamic acid. PAL has been extensively studied in
9716
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
plants because of its decisive function in the biosynthesis of various secondary metabolites (Liu et al., 2006). PAL is thought to be responsible for many essential functions, including establishing mechanical support, pigments like anthocyanins, and signaling with flavonoid nodulation factors (Weisshaar and Jenkins, 1998). PAL also induces phenylpropanoid biosynthesis in response to biotic and abiotic stressors, such as pathogen attacks, UV irradiation, mechanical wounding, and light (Dixon and Paiva, 1995). Cinnamate 4-hydroxylase (C4H, EC 1.14.13.11) is the second key enzyme of the phenylpropanoid pathway; it catalyzes the hydroxylation of trans-cinnamic acid to p-coumaric acid (Weisshaar and Jenkins, 1998). C4H constitutes the CYP73 family of cytochrome P450, which catalyzes monooxygenase reactions which, in plants, are often involved in the biosynthesis of diverse metabolites (Chapple, 1998). C4H controls the carbon flux for many phytoalexins that are synthesized when plants are challenged by pathogens (Teutsch et al., 1993). In addition to PAL and C4H, 4-coumarate:CoA ligase (4CL; EC 6.2.1.12) and chalcone synthase (CHS; EC 2.3.1.74) are also important compounds involved in regulating biosynthesis and flux control in the S. baicalensis flavone pathway (Supplementary Fig. S1b). 4CL converts p-coumarate to its coenzyme-A ester, which is a precursor for a variety of phenylpropanoid biosynthetic derivatives, including lignins, flavonoids, and phytoalexins. CHS operates the first dedicated reaction of the flavonoid pathway in higher plants; it catalyzes the condensation of one molecule of 4coumaroyl-CoA and three molecules of malonyl-CoA, yielding naringenin chalcone. CHS cDNA has been isolated from S. baicalensis hairy roots, and external stresses have been reported to repress CHS gene expression (Zhou et al., 2003). The phenylpropanoid pathway produces various secondary metabolites, most of which have beneficial effects on human health. PAL, C4H, 4CL, and CHS are important enzymes in this pathway, facilitating biosynthesis of flavonoids and other important secondary metabolites from phenylalanine. An improved understanding of these enzymes is vital for identifying targets for biotechnological manipulation of product accumulation (Singh et al., 2009). This paper describes, for the first time, full-length cloning of S. baicalenesis PALs (SbPAL1, SbPAL2, and SbPAL3) and C4H (SbC4H) (GenBank Accession numbers: HM062775, HM062776, HM062777, and HM062778, respectively) using rapid amplification of cDNA ends (RACE)–PCR. Using these genes (PALs and C4H) and previously-isolated clones (4CL and CHS), we characterized each gene and correlated gene expression with flavone biosynthesis in response to biotic and abiotic stress in S. baicalensis.
on a gyratory shaker (120 rpm) in a growth chamber with a 16-h photoperiod. Suspension cells of S. baicalensis were grown in MS liquid medium containing 2 mg L1 2,4-D and 0.1 mg L1 NAA, and were sub-cultured every 2 weeks. All experiments were conducted in triplicate and repeated at least three times. 2.2. Methyl jasmonate (MeJa) treatment and wounding of cell suspension cultures MeJa, a compound that elicits the activation of secondary metabolism genes in response to stress, was dissolved in 100% ethanol. MeJa elicitor solutions were added to the culture medium immediately afterward, for 24 h (or 72 h, for HPLC analysis), at concentrations of 0, 10, 50, 100, 200, or 300 lM, for real-time quantitative RT-PCR analysis. To examine how gene expression in response to MeJa changed over time, suspension cells were examined in a single elicitor treatment (100 lM MeJa), at multiple time points (0, 1, 3, 6, 12, 24, 48, 72, and 96 h). Wounding of cell suspension cultures was performed by collecting cells in sterile Petri dishes (50 10 mm), withdrawing most of the medium, and repeatedly cutting into the cellular mass with a sharp scalpel. Treated cells were collected and frozen in sealed clear polyethylene plastic bags at 80 °C until they were used. Each treatment consisted of three flasks and the experiment was repeated in triplicate. 2.3. RNA extraction and quantitative real-time PCR Total RNA was isolated from S. baicalensis suspension cells using an RNeasy Plant Mini Kit (QIAGEN, Valencia, CA, USA). For quantitative real-time PCR, 3 lg of total RNA was reverse-transcribed using a Superscript II First Strand Synthesis Kit and an oligo(dT)20 primer, according to the manufacturer’s protocols (Invitrogen, Carlsbad, CA, USA). The resulting cDNA mixtures were used as templates for RT-PCR. For transcription-level analysis by RT-PCR, RNAs from different organs of S. baicalensis were harvested and single-stranded cDNAs were synthesized from the isolated total RNA using the aforementioned protocols and gene-specific primer sets designed for realtime PCR (Table 1). Specific primers for Sb4CL and SbCHS genes were obtained from previously-isolated clones (Sb4CL1, Sb4CL2, and SbCHS; Accession numbers: AB166767, AB166768 and Table 1 Primers used in this study. Reaction
Oligo name
Sequences (50 to 30 )
RACE PCR
PAL1-5 nested PAL1-3 nested PAL2-5 nested PAL2-3 nested PAL3-5 nested PAL3-3 nested C4H-5 nested C4H-3 nested PAL-con-F PAL-con-R1 C4H-con-F C4H-con-R
AAAGCCGGAGTCGATGCCGGCCA GAATTTCCAGGGCACCCCTATTGA GCCAAGAG GCAAGAACATTGGCC GGCCATACATGGTGGCA TTTCC GGCCATACATGGTGGCAATTTCC GGACCGGTATGCGCTTCGTACGTCTCCACA CCATTCGGAGACGAAGGGTTTCCTTG AGGTCGAGGCCAATGGCAATGACT TMCARGGMTACTCHGGCATMMG GCGCTYTNSACRTGGTTNGTVA TCGATCGAGTGGGGCATTGC AAGTCATTGCCATTGGCCTC
Real-time PCR
SbPAL1-F SbPAL1-R SbPAL2-F SbPAL21-R SbPAL3-F SbPAL3-R SbC4H-F SbC4H-R Sb4CL-F Sb4CL-R SbCHS-F SbCHS-R
GCGAATAGTGTTCATGATGAGGAT CAATGGCTGCCTTTCCAGTT GATTCTGCGTCCAACTCAGTGA GCGTCGGCATTATCCCTG GGCCACCAAGATGATCGA CAATGGCCAATCTTGCATTG GCCGATTCTCTGTATCACTATC ATGATTAAAATGATCTTGGCTTT ATAATCAAATACAAAGGGTTCCA ACCTGTTTGGATATAAATTGCTT GCAGTCCACTTATGCTGATTAC GTGAAGTTGTCGTTCTCCTTC
2. Methods 2.1. Callus induction and cell suspension culture Seeds of S. baicalensis were surface-sterilized with 70% ethanol for 30 s and 2% sodium hypochlorite solution for 10 min, then rinsed three times in sterile water. Ten seeds were placed on agar-solidified culture medium, which consisted of salts and vitamins of MS medium (Murashige and Skoog, 1962) solidified with 0.7% agar. The seeds were germinated at 25 °C in a growth chamber with a 16-h photoperiod. For callus induction, leaf explants were cut aseptically at the ends, into approximately 7 7 mm2 sections, and placed on the medium. The basal medium was supplemented with 2.0 mg L1 2,4-dichlorophenoxy acetic acid (2,4-D), 0.1 mg L1 a-naphthalene acetic acid (NAA) and 30 g L1 of sucrose. After 3–4 weeks, calli were sub-cultured onto medium consisting of MS salts and vitamins and containing 2.0 mg L1 2,4-D. Calli were then transferred to 30 mL of MS liquid medium containing 3% sucrose. Suspension cultures were maintained at 25 °C
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
AB008748, respectively). PCR reactions were carried out in triplicate for 40 cycles on a MiniOpticon (Bio-Rad Laboratories, Hercules, CA, USA) using a QIAGEN Quantitect SYBR Green PCR Kit. PCR protocols were as follows: one cycle of 5 min at 95 °C; 30 cycles with a denaturing time of 30 s at 95 °C, an annealing time of 30 s at 56 °C, and an elongation time of 30 s at 72 °C; and a final elongation step of 10 min at 72 °C. Identical PCR conditions were used for all targets.
9717
(Table 1). All PCRs were initiated with the hot start method using the RACE cDNA template. All products were cloned and subcloned into TOPO TA vectors and sequenced using the aforementioned protocols. Full-length PAL and C4H sequences were aligned using MultAlin (http://bioinfo.genotoul.fr/multalin/ multalin.html). 2.5. High performance liquid chromatography (HPLC) analysis
2.4. Isolation of cDNA encoding PAL and C4H GeneRacerTM Kits (Invitrogen) were used to synthesize single strand cDNA, according to the manufacturer’s protocols. SbPAL and SbC4H conserved fragments were PCR-amplified with PALcon-F, PAL-con-R, C4H-con-F, and C4H-con-R. PCR products were subcloned into a TOPO TA vector (Invitrogen) and sequenced. Sequence data were used to design new primer pairs for RACE–PCR
Suspension cells (0.05 g) were frozen in liquid nitrogen, ground to a fine powder using a mortar and pestle, and extracted with 10 mL of 70% ethanol for 1 h at 60 °C. After centrifugation, the supernatant was filtered through a 0.45-lm poly filter and analyzed by HPLC. The analysis was monitored at 275 nm and performed using a C18 column (250 mm 4.6 mm, 5 lm; RStech, Daejon, Korea). The mobile phase was a gradient prepared from
Fig. 1. Protein sequence alignment. (a) Alignment of amino acid sequences for SbPAL1, SbPAL2, and SbPAL3 from Scutellaria baicalensis with PALs from Arabidopsis thaliana (AtPAL1, AtPAL2, and AtPAL3), Camellia sinensis (CsPAL), Brassica rapa (BrPAL), Agastache rugosa (ArPAL), Nicotiana tabacum (NtPALA and NtPALB), and Salvia miltiorrhiza (SmPAL). (b) Alignment of amino acid sequences for SbC4H from S. baicalensis with C4Hs from A. rugosa (ArC4H), A. thaliana (AtC4H), Citrus sinensis (CsC4H2), Ginko biloba (GbC4H), Allium cepa (AcC4H), Populus trichocarpa (PtC4G1), and Populus tremuloides (PtC4H2-2).
9718
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
Fig. 1 (continued)
mixtures of acetonitrile, methanol, and 0.2% acetic acid; the column was maintained at 30 °C. The flow rate was set at 1.0 mL min1, and the injection volume was 20 lL. Results were calculated using a standard curve. 3. Results and discussion 3.1. Isolation and sequence analysis of PAL and C4H from S. baicalensis SbPAL1 was 2124 bp long with an open reading frame, and encoded 708 amino acids. SbPAL2 was 2136 bp long with an open reading frame, and encoded 712 amino acids. SbPAL3 was 2127 bp long with an open reading frame, and encoded 709 amino acids. Alignments showed that there is high amino acid sequence identity and similarity (89% and 94%, respectively) between SbPAL2 and SbPAL3, and these have fairly high identity and similarity with SbPAL1 (81% and 88%, respectively) (Fig. 2a). Alignment with PAL family sequences from Arabidopsis thaliana (NM129260, NM115186, NM120505), Camellia sinensis (AY694188), Brassica
rapa (EU402423), Agastache rugosa (AF326116), Nicotiana tabacum (AB008199, AB008200), and Salvia miltiorrhiza (EF462460) also showed high identity and similarity (81–82% and 87–89%, respectively) with SbPAL1. Results were similar for SbPAL2 (81–90% identity and 89–94% similarity) and SbPAL3 (81–82% identity and 87–89% similarity). All three PALs had only moderate identity and similarity with AtPAL3 from A. thaliana (73% and 81% for SbPAL1; 74% and 83% for SbPAL2; 73% and 81% for SbPAL3, respectively). A phylogenetic tree constructed from the deduced amino acid sequences of plant PALs showed that SbPAL1 formed a distinct group, whereas SbPAL2 and SbPAL3 clustered together (data not shown) (Fig. 1a). The SbC4H cDNA was a 1524-bp long with an open reading frame encoding 508 amino acids. SbC4H shares only 80% identity (90% similarity) with CsC4H from Citrus sinensis (AF255014), but 85–89% identity (93–95% similarity) with other C4Hs from A. rugosa (AY616436), A. thaliana (U71081), Ginko biloba (AY748324), Allium cepa (AY541032), Populus trichocarpa (EU603304), and Populus tremuloides (DQ522295) (Fig. 1b).
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
3.2. Expression of flavone biosynthetic genes in different organs of S. baicalensis Different flavone biosynthetic genes were expressed in different S. baicalensis tissues (Supplementary Fig. S2). In flowers the expression levels of SbC4H and SbCHS genes were high, and in stems those of SbPAL1, SbC4H, and Sb4CL were higher than other
9719
genes. Three PALs genes showed different expression pattern in different organs. In flowers their expression was similar each other, however the transcript level of SbPAL1 was highest in stems, one of SbPAL3 was in roots, and one of SbPAL2 was in leaves. In leaves, the expression of SbCHS was highest. In roots, nearly all flavone biosynthetic genes except SbPAL1 showed increased levels of expression.
Fig. 2. Accumulation of genes for flavonoid biosynthesis in S. baicalenesis cell suspensions treated with methyl jasmonate. (a) Induction of flavonoid biosynthetic genes in S. baicalensis cell suspensions in response to treatment with different concentrations of methyl jasmonate. (b) Time course of induction of flavonoid biosynthetic genes in methyl jasmonate (100 lM)-treated cell suspension cultures of S. baicalensis. Each value is the mean of three replicates ± SD.
9720
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
Fig. 3. Time course of the effect of wounding on the expression of flavonoid biosynthetic genes in S. baicalensis suspension cells. Each value is the mean of three replicates ± SD.
3.3. Inducible expression of flavone biosynthetic genes in S. baicalensis All flavone biosynthetic genes measured in this study were upregulated in response to elicitor (MeJa) treatment. Transcript accumulation was apparent for all genes (Fig. 2a), particularly SbPAL3 increased up to 24-fold comparison to without MeJa treatment. Although SbPAL1, SbC4H, and Sb4CL transcripts were clearly induced treatment with 100 lM MeJa, expression levels of other genes involved in flavone biosynthesis was induced in treatment with 200 lM MeJa. SbPAL1 and Sb4CL transcripts were induced within 48 h, whereas levels of SbC4H and SbCHS transcripts increased within 24 h of treatment with 100 lM MeJa (Fig. 2b). This result is similar to previous works, for instance, MeJa initiates PAL gene transcription in Glycine max (Gundlach et al., 1992), improves ginsenoside content in cell (Lu et al., 2001) and hairy root (Palazon et al., 2003) cultures of Panax ginseng, enhances the production of sesquiterpenes and lipoxygenase metabolites in hairy root cultures of Solanum tuberosum (Komaraiah et al., 2003), and stimulates soyasaponin biosynthesis and accumulation of related secondary metabolite genes in Glycyrrhiza glabra (common licorice) cultures (Hayashi et al., 2003). S. baicalensis suspension cells responded to wounding with obvious transcriptional accumulation of flavonoid biosynthetic genes (Fig. 3). SbPAL1, SbC4H, and Sb4CL transcript levels transiently increased within 1–3 h after wounding, then returned to near-control levels. Transcripts of SbPAL2, SbPAL3, and SbCHS accumulated to maximum levels within 24 h of wounding, before returning to previous levels. This result was not surprising, as increased gene expression after wounding has been described in soybean and alfalfa (Creelman et al., 1992; Junghans et al., 1993); similarly, in white spruce, wounding has resulted in the accumulation of CHS mRNA (Richard et al., 2000).
3.4. HPLC analysis of flavonoid contents in S. baicalensis Using HPLC analysis, we demonstrated that flavones—specifically, baicalin, baicalein and wogonin—accumulated in different
tissues of S. baicalensis. Furthermore, of the analyzed compounds, baiclain had the highest concentration. The baicalin and baicalein contents in roots were 22 and 107 times higher than those in flowers, respectively (Table 2). Treatment with MeJa for 72 h increased flavone contents in cell suspensions. After treatment with 200 lM of MeJa, baicalin increased 4.5-time, baicalein increased 1.4-time, and wogonin increased 3.1-time (Table 3). Recent work has shown that the activity of elicitors such as MeJa, enhances major flavones in hairy roots of S. baicalensis (Hwang, 2006; Kuzovkina et al., 2005). Hwang, (2006) observed the baicalin content of the roots increased up to 3-fold after treatment with 10 mM MeJa. (Kuzovkina et al., 2005) showed the treatment of 3-week-old cultured roots with MeJa doubled the total concentration of major flavones in roots.
Table 2 Production levels of baicalin, baicalein, and wogonin in different organs of S. baicalenesis. Organs
Flower Stem Leaf Root
Flavones (lg/g DW) Baicalin
Baicalein
Wogonin
3859.33 839.63 1490.40 84212.30
78.49 – 71.78 8386.90
– – – 1496.03
Table 3 Induction of baicalin, baicalein, and wogonin in S. baicalensis cell suspensions in response to different concentrations of MeJa. MeJA conc. (lM)
0 10 50 100 200 300
Flavones (lg/g) Baicalin
Baicalein
Wogonin
2696.98 5575.97 4601.38 4462.56 12028.00 1990.73
63.49 63.86 65.14 64.14 88.93 62.28
– – – – 3.16 1.02
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
Wounded suspension cells upregulated expression of SbPAL1, SbC4H, and Sb4CL within 1–3 h after wounding, however, the transcript levels of SbPAL2, SbPAL3 and SbCHS increased 24 h later (Fig. 3). However, the contents of flavones in wounded suspension cells were decreased. This might be explained that the suspension cells after wounding treatment were not healthful or dead although expression levels flavones synthetic genes were upregulated (data not shown). These results indicated that the expression of flavones biosynthetic genes measured in this study was mostly induced by treatment with 100–200 lM of MeJa and also the contents of major flavones in S. baicalenesis increased with same treatment. Consistent with flavones accumulation, we might analogize the expression of flavone biosynthetic genes associated with the production of major flavones in S. baicalenesis. The overexpression of biosynthetic genes like SbPALs, SbC4H, Sb4CL, and SbCHS genes might have the effect of increasing the secondary metabolite contents of this plant. This study suggests the potential of producing more secondary metabolites using hairy root cultures of S. baicalenesis. Transformed hairy root cultures have attracted considerable attention owing to their genetic and biochemical stability, rapid growth rate, and ability to synthesize secondary products at levels comparable to wild-type roots (Georgiev et al., 2007; Rahman et al., 2009; Srivastava and Srivastava, 2007). The isolation of genes encoding biosynthetic enzymes coupled with hairy root culture will provide a powerful model system for investigating molecular regulation and for evaluating the potential of metabolic engineering. 4. Conclusions The phytochemicals examined here—baicalin, baicalein, and wogonin—are only some of the many compounds produced by S. baicalensis; its rich supply of secondary metabolites and its importance as a medicinal plant make it an excellent model system for continued research of useful medicinal compounds. Having determined that SbPALs and SbC4H are key enzymes in the S. baicalensis flavone biosynthetic pathway, we are currently focusing our efforts on producing transgenic hairy roots via the introduction of flavone biosynthetic genes. Cumulatively, we hope that this and related work will develop and improve technologies for producing useful medicinal compounds. Acknowledgements This study was financially supported by research fund of Chungnam National University in 2009. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.biortech.2010.07.083. References Chapple, C., 1998. Molecular-genetic analysis of plant cytochrome P450dependent monooxygenases. Annual Review of Plant Physiology and Plant Molecular Biology 49, 311–343. Chi, Y.S., Lim, H., Park, H., Kim, H.P., 2003. Effects of wogonin, a plant flavone from Scutellaria radix, on skin inflammation: in vivo regulation of inflammationassociated gene expression. Biochemical Pharmacology 66, 1271–1278. Creelman, R.A., Tierney, M.L., Mullet, J.E., 1992. Jasmonic acid/methyl jasmonate accumulate in wounded soybean hypocotyls and modulate wound gene expression. Proceedings of the National Academy of Sciences of the United States of America 89, 4938–4941. Dixon, R.A., Paiva, N.L., 1995. Stress-induced phenylpropanoid metabolism. Plant Cell 7, 1085–1097. Gao, S.L., Chen, B.J., Zhu, D.N., 2002. In vitro production and identification of autotetraploids of Scutellaria baicalensis. Plant Cell, Tissue and Organ Culture 70, 289–293.
9721
Gao, Z., Yang, X., Huang, K., Xu, H., 2000. Free-radical scavenging and mechanism study of flavonoids extracted from the radix of Scutellaria baicalensis Georgi. Applied Magnetic Resonance 19, 35–44. Georgiev, M.I., Pavlov, A.I., Bley, T., 2007. Hairy root type plant in vitro systems as sources of bioactive substances. Applied Microbiology and Biotechnology 74, 1175–1185. Gundlach, H., Muller, M.J., Kutchan, T.M., Zenk, M.H., 1992. Jasmonic acid is a signal transducer in elicitor-induced plant cell cultures. Proceedings of the National Academy of Sciences USA 89, 2389–2393. Guo, Q., Zhao, L., You, Q., Yang, Y., Gu, H., Song, G., Lu, N., Xin, J., 2007. Anti-hepatitis B virus activity of wogonin in vitro and in vivo. Antiviral Research 74, 16–24. Harakava, R., 2005. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus. Genetics and Molecular Biology 28, 601–607. Hayashi, H., Huang, P., Inoue, K., 2003. Up-regulation of soyasaponin biosynthesis by methyl jasmonate in cultured cells of Glycyrrhiza glabra. Plant Cell Physiology 44, 404–411. Horvath, C.R., Martos, P.A., Saxena, P.K., 2005. Identification and quantification of eight flavones in root and shoot tissues of the medicinal plant Huang-qin (Scutellaria baicalensis Georgi) using high-performance liquid chromatography with diode array and mass spectrometric detection. Journal of Chromatography A 1062, 199–207. Hwang, S., 2006. Baicalin production in transformed hairy root clones of Scutellaria baicalensis. Biotechnology and Bioprocess Engineering 11, 105–109. Junghans, H., Dalkin, K., Dixon, R.A., 1993. Stress responses In alfalfa (MedicagoSativa L). 15. Characterization and expression patterns of members of a subset of the chalcone synthase Multigene Family. Plant Molecular Biology 22, 239– 253. Komaraiah, P., Reddy, G.V., Reddy, P.S., Raghavendra, A.S., Ramakrishna, S.V., Reddanna, P., 2003. Enhanced production of antimicrobial sesquiterpenes and lipoxygenase metabolites in elicitor-treated hairy root cultures of Solanum tuberosum. Biotechnology Letters 25, 593–597. Kovács, G., Kuzovkina, I.N., Szoke, É., Kursinszki, L., 2004. HPLC determination of flavonoids in hairy-root cultures of Scutellaria baicalensis Georgi. Chromatographia 60, S81–85. Kuzovkina, I.N., Guseva, A.V., Kovács, D., Szöke, É., Vdovitchenko, M.Y., 2005. Flavones in genetically transformed Scutellaria baicalensis roots and induction of their synthesis by elicitation with methyl jasmonate. Russian Journal of Plant Physiology 52, 77–82. Lau, C.S., Carrier, D.J., Beitle, R.R., Bransby, D.I., Howard, L.R., Lay, J.J.O., Liyanage, R., Clausen, E.C., 2007. Identification and quantification of glycoside flavonoids in the energy crop Albizia julibrissin. Bioresource Technology 98, 429–435. Li-Weber, M., 2009. New therapeutic aspects of flavones: the anticancer properties of Scutellaria and its main active constituents Wogonin, Baicalein and Baicalin. Cancer Treatment Reviews 35, 57–68. Li, H., Murch, S., Saxena, P., 2000. Thidiazuron-induced de novo shoot organogenesis on seedlings, etiolated hypocotyls and stem segments of Huang-qin. Plant Cell, Tissue and Organ Culture 62, 169–173. Liu, R., Xu, S., Li, J., Hu, Y., Lin, Z., 2006. Expression profile of a PAL gene from Astragalus membranaceus var Mongholicus and its crucial role in flux into flavonoid biosynthesis. Plant Cell Reports 25, 705–710. Lu, M.B., Wong, H.L., Teng, W.L., 2001. Effects of elicitation on the production of saponin in cell culture of Panax ginseng. Plant Cell Reports 20, 674–677. Martens, S., Mithöfer, A., 2005. Flavones and flavone synthases. Phytochemistry 66, 2399–2407. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum 15, 473–497. Murch, S.J., Rupasinghe, H.P.V., Goodenowe, D., Saxena, P.K., 2004. A metabolomic analysis of medicinal diversity in Huang-qin (Scutellaria baicalensis Georgi) genotypes: discovery of novel compounds. Plant Cell Reports 23, 419–425. Palazon, J., Cusido Rosa, M., Bonfill, M., Mallol, A., Moyano, E., Morales, C., Pinol, M.T., 2003. Elicitation of different Panax ginseng transformed root phenotypes for an improved ginsenoside production. Plant Physiology and Biochemistry 41, 1019– 1025. Rahman, L.u., Kouno, H., Hashiguchi, Y., Yamamoto, H., Narbad, A., Parr, A., Walton, N., Ikenaga, T., Kitamura, Y., 2009. HCHL expression in hairy roots of Beta vulgaris yields a high accumulation of p-hydroxybenzoic acid (pHBA) glucose ester, and linkage of pHBA into cell walls. Bioresource Technology 100, 4836– 4842. Richard, S., Lapointe, G., Rutledge, R.G., Seguin, A., 2000. Induction of chalcone synthase expression in white spruce by wounding and jasmonate. Plant Cell Physiology 41, 982–987. Singh, K., Kumar, S., Rani, A., Gulati, A., Ahuja, P., 2009. Phenylalanine ammonialyase (PAL) and cinnamate 4-hydroxylase (C4H) and catechins (flavan-3-ols) accumulation in tea. Functional & Integrative Genomics 9, 125–134. Son, D., Lee, P., Lee, J., Kim, H., Kim, S.Y., 2004. Neuroprotective effect of wogonin in hippocampal slice culture exposed to oxygen and glucose deprivation. European Journal of Pharmacology 493, 99–102. Srivastava, S., Srivastava, A.K., 2007. Hairy root culture for mass-production of highvalue secondary metabolites. Critical Reviews in Biotechnology 27, 29–43. Teutsch, H.G., Hasenfratz, M.P., Lesot, A., Stoltz, C., Garnier, J.M., Jeltsch, J.M., Durst, F., Werch-Reichhart, D., 1993. Isolation and sequence of a cDNA encoding the Jerusalem artichoke cinnamate-4-hydroxylase, a major plant cytochrome P450 involved in the general phenylpropanoid pathway. Proceedings of the National Academy of Sciences USA 90, 4102–4106. Weisshaar, B., Jenkins, G.I., 1998. Phenylpropanoid biosynthesis and its regulation. Current Opinion in Plant Biology 1, 251–257.
9722
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
Zhao, Q., Wang, J., Zou, M.-J., Hu, R., Zhao, L., Qiang, L., Rong, J.-J., You, Q.-D., Guo, Q.L., 2010. Wogonin potentiates the antitumor effects of low dose 5-fluorouracil against gastric cancer through induction of apoptosis by down-regulation of NF-kappaB and regulation of its metabolism. Toxicology Letters 197, 201–210.
Zhou, Y., Nagashima, S., Hirotani, M., Suzuki, H., Yoshikawa, T., 2003. Expression of the chalcone synthase gene in Scutellaria baicalensis hairy root cultures was unusually reduced by environmental stresses. Plant Biotechnology 20, 207–214.
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Molecular cloning and characterization of phenylalanine ammonia-lyase, cinnamate 4-hydroxylase and genes involved in flavone biosynthesis in Scutellaria baicalensis Hui Xu a,1, Nam Il Park a,1, Xiaohua Li a, Yong Kyoung Kim a, Sook Young Lee b, Sang Un Park a,* a b
Department of Crop Science, Chungnam National University, 79 Daehangno, Yuseong-Gu, Daejeon 305-764, South Korea Medical Device Clinical Center, Chosun University Dental Hospital, Chosun University, 375 Seosuk-Dong, Dong-Gu, Gwangju 501-759, South Korea
a r t i c l e
i n f o
Article history: Received 20 April 2010 Received in revised form 16 July 2010 Accepted 20 July 2010 Available online 24 July 2010 Keywords: Scutellaria baicalensis Phenylalanine ammonia-lyase Cinnamate 4-hydroxylase Flavone
a b s t r a c t The involvement of genes in flavones biosynthesis was investigated in different organs and suspension cells obtained from Scutellaria baicalensis. Three full-length cDNAs encoding phenylalanine ammonialyase isoforms (SbPAL1, SbPAL2, and SbAPL3) and one gene encoding cinnamate 4-hydroxylase (SbC4H) from S. baicalensis were isolated using rapid amplification of cDNA ends (RACE)–PCR. These cDNAs were used together with previously-isolated clones for 4-coumaroyl CoA ligase (4CL) and chalcone synthase (CHS) to show the expression level in different organs of S. baicalensis. These genes were upregulated in suspension cells of S. baicalensis with biotic/abiotic stress factors. The baicalin and baicalein contents in roots were 22 and 107 times higher than those in flowers, respectively. The treatment of suspension cells with methyl jasmonate (MeJa) enhanced the major flavones in S. baicalensis. Cumulatively, the results of this study should advance ability to biosynthesize important and useful medicinal compounds from a variety of plant species. Ó 2010 Elsevier Ltd. All rights reserved.
1. Introduction Scutellaria baicalensis Georgi, golden root, is a species of flowering plant in the Lamiaceae family. It is one of the 50 fundamental herbs used in traditional Chinese medicine, for treatment of fever, cold, and vomiting of blood. In Western medicine, it has been used to treat inflammation, respiratory tract infections, diarrhea, dysentery, jaundice/liver disorders, hypertension, hemorrhaging, and insomnia (Li-Weber, 2009). S. baicalensis root is rich in flavones, a class of flavonoids produced by plants. These compounds exhibit biological and pharmacological properties, including antioxidative activity, and have been used for cancer prevention and the treatment and prevention of coronary heart disease (Martens and Mithöfer, 2005). Because it has long been important in traditional medicine, S. baicalenesis is a good model for assessing the possible applications of biotechnology in improving medicinal plants. Previous works have investigated potentially useful techniques such as in vitro mass-propagation (Li et al., 2000), selection of elite germplasm using breeding programs and mutagens (Gao et al.,
Abbreviations: NAA, a-naphthalene acetic acid; 2,4-D, 2,4-dichlorophenoxy acetic acid; MeJa, methyl jasmonate; PAL, phenylalanine ammonia-lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4-coumaroyl CoA ligase; CHS, chalcone synthase. * Corresponding author. Tel.: +82 42 821 5730; fax: +82 42 822 2631. E-mail address: [email protected] (S.U. Park). 1 These authors contributed equally to the paper. 0960-8524/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.biortech.2010.07.083
2002; Murch et al., 2004), and genetic modification using Agrobacterium (Kovács et al., 2004; Kuzovkina et al., 2005). However, almost no information has been collected on the molecular properties of flavone biosynthetic genes, which could be used to improve the medicinal properties of S. baicalenesis. Baicalin, baicalein and wogonin are the most commonly studied flavone constituents of Scutellariae radix (Supplementary Fig. S1a) (Gao et al., 2000; Horvath et al., 2005). They are known to provide a variety of health benefits; for instance, wogonin (WOG) has been shown to exert anti-inflammatory (Chi et al., 2003), anti-viral (Guo et al., 2007), neuroprotection (Son et al., 2004) activities. Recently it has been shown to have a potential for therapeutic use in the treatment of antitumor and chemoprophylaxis (Zhao et al., 2010). S. baicalesis has also been shown to contain high concentrations of melatonin, a potent antioxidant (Murch et al., 2004). The main compounds of S. baicalensis are important sources for the development of anti-cancer, anti-inflammatory, and neuroprotective drugs. In higher plants, the phenylpropanoid pathway, a secondary metabolism pathway, is responsible for producing flavonoids (as well as a variety of other physiologically important metabolites, including lignins, coumarins, phytoalexins, and stilbenes, which play important roles in plant development, mechanical support, and disease resistance) (Harakava, 2005; Lau et al., 2007). Phenylalanine ammonia-lyase (PAL, EC 4.3.1.5) is the first key enzyme of the phenylpropanoid pathway; it catalyzes L-phenylalanine to trans-cinnamic acid. PAL has been extensively studied in
9716
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
plants because of its decisive function in the biosynthesis of various secondary metabolites (Liu et al., 2006). PAL is thought to be responsible for many essential functions, including establishing mechanical support, pigments like anthocyanins, and signaling with flavonoid nodulation factors (Weisshaar and Jenkins, 1998). PAL also induces phenylpropanoid biosynthesis in response to biotic and abiotic stressors, such as pathogen attacks, UV irradiation, mechanical wounding, and light (Dixon and Paiva, 1995). Cinnamate 4-hydroxylase (C4H, EC 1.14.13.11) is the second key enzyme of the phenylpropanoid pathway; it catalyzes the hydroxylation of trans-cinnamic acid to p-coumaric acid (Weisshaar and Jenkins, 1998). C4H constitutes the CYP73 family of cytochrome P450, which catalyzes monooxygenase reactions which, in plants, are often involved in the biosynthesis of diverse metabolites (Chapple, 1998). C4H controls the carbon flux for many phytoalexins that are synthesized when plants are challenged by pathogens (Teutsch et al., 1993). In addition to PAL and C4H, 4-coumarate:CoA ligase (4CL; EC 6.2.1.12) and chalcone synthase (CHS; EC 2.3.1.74) are also important compounds involved in regulating biosynthesis and flux control in the S. baicalensis flavone pathway (Supplementary Fig. S1b). 4CL converts p-coumarate to its coenzyme-A ester, which is a precursor for a variety of phenylpropanoid biosynthetic derivatives, including lignins, flavonoids, and phytoalexins. CHS operates the first dedicated reaction of the flavonoid pathway in higher plants; it catalyzes the condensation of one molecule of 4coumaroyl-CoA and three molecules of malonyl-CoA, yielding naringenin chalcone. CHS cDNA has been isolated from S. baicalensis hairy roots, and external stresses have been reported to repress CHS gene expression (Zhou et al., 2003). The phenylpropanoid pathway produces various secondary metabolites, most of which have beneficial effects on human health. PAL, C4H, 4CL, and CHS are important enzymes in this pathway, facilitating biosynthesis of flavonoids and other important secondary metabolites from phenylalanine. An improved understanding of these enzymes is vital for identifying targets for biotechnological manipulation of product accumulation (Singh et al., 2009). This paper describes, for the first time, full-length cloning of S. baicalenesis PALs (SbPAL1, SbPAL2, and SbPAL3) and C4H (SbC4H) (GenBank Accession numbers: HM062775, HM062776, HM062777, and HM062778, respectively) using rapid amplification of cDNA ends (RACE)–PCR. Using these genes (PALs and C4H) and previously-isolated clones (4CL and CHS), we characterized each gene and correlated gene expression with flavone biosynthesis in response to biotic and abiotic stress in S. baicalensis.
on a gyratory shaker (120 rpm) in a growth chamber with a 16-h photoperiod. Suspension cells of S. baicalensis were grown in MS liquid medium containing 2 mg L1 2,4-D and 0.1 mg L1 NAA, and were sub-cultured every 2 weeks. All experiments were conducted in triplicate and repeated at least three times. 2.2. Methyl jasmonate (MeJa) treatment and wounding of cell suspension cultures MeJa, a compound that elicits the activation of secondary metabolism genes in response to stress, was dissolved in 100% ethanol. MeJa elicitor solutions were added to the culture medium immediately afterward, for 24 h (or 72 h, for HPLC analysis), at concentrations of 0, 10, 50, 100, 200, or 300 lM, for real-time quantitative RT-PCR analysis. To examine how gene expression in response to MeJa changed over time, suspension cells were examined in a single elicitor treatment (100 lM MeJa), at multiple time points (0, 1, 3, 6, 12, 24, 48, 72, and 96 h). Wounding of cell suspension cultures was performed by collecting cells in sterile Petri dishes (50 10 mm), withdrawing most of the medium, and repeatedly cutting into the cellular mass with a sharp scalpel. Treated cells were collected and frozen in sealed clear polyethylene plastic bags at 80 °C until they were used. Each treatment consisted of three flasks and the experiment was repeated in triplicate. 2.3. RNA extraction and quantitative real-time PCR Total RNA was isolated from S. baicalensis suspension cells using an RNeasy Plant Mini Kit (QIAGEN, Valencia, CA, USA). For quantitative real-time PCR, 3 lg of total RNA was reverse-transcribed using a Superscript II First Strand Synthesis Kit and an oligo(dT)20 primer, according to the manufacturer’s protocols (Invitrogen, Carlsbad, CA, USA). The resulting cDNA mixtures were used as templates for RT-PCR. For transcription-level analysis by RT-PCR, RNAs from different organs of S. baicalensis were harvested and single-stranded cDNAs were synthesized from the isolated total RNA using the aforementioned protocols and gene-specific primer sets designed for realtime PCR (Table 1). Specific primers for Sb4CL and SbCHS genes were obtained from previously-isolated clones (Sb4CL1, Sb4CL2, and SbCHS; Accession numbers: AB166767, AB166768 and Table 1 Primers used in this study. Reaction
Oligo name
Sequences (50 to 30 )
RACE PCR
PAL1-5 nested PAL1-3 nested PAL2-5 nested PAL2-3 nested PAL3-5 nested PAL3-3 nested C4H-5 nested C4H-3 nested PAL-con-F PAL-con-R1 C4H-con-F C4H-con-R
AAAGCCGGAGTCGATGCCGGCCA GAATTTCCAGGGCACCCCTATTGA GCCAAGAG GCAAGAACATTGGCC GGCCATACATGGTGGCA TTTCC GGCCATACATGGTGGCAATTTCC GGACCGGTATGCGCTTCGTACGTCTCCACA CCATTCGGAGACGAAGGGTTTCCTTG AGGTCGAGGCCAATGGCAATGACT TMCARGGMTACTCHGGCATMMG GCGCTYTNSACRTGGTTNGTVA TCGATCGAGTGGGGCATTGC AAGTCATTGCCATTGGCCTC
Real-time PCR
SbPAL1-F SbPAL1-R SbPAL2-F SbPAL21-R SbPAL3-F SbPAL3-R SbC4H-F SbC4H-R Sb4CL-F Sb4CL-R SbCHS-F SbCHS-R
GCGAATAGTGTTCATGATGAGGAT CAATGGCTGCCTTTCCAGTT GATTCTGCGTCCAACTCAGTGA GCGTCGGCATTATCCCTG GGCCACCAAGATGATCGA CAATGGCCAATCTTGCATTG GCCGATTCTCTGTATCACTATC ATGATTAAAATGATCTTGGCTTT ATAATCAAATACAAAGGGTTCCA ACCTGTTTGGATATAAATTGCTT GCAGTCCACTTATGCTGATTAC GTGAAGTTGTCGTTCTCCTTC
2. Methods 2.1. Callus induction and cell suspension culture Seeds of S. baicalensis were surface-sterilized with 70% ethanol for 30 s and 2% sodium hypochlorite solution for 10 min, then rinsed three times in sterile water. Ten seeds were placed on agar-solidified culture medium, which consisted of salts and vitamins of MS medium (Murashige and Skoog, 1962) solidified with 0.7% agar. The seeds were germinated at 25 °C in a growth chamber with a 16-h photoperiod. For callus induction, leaf explants were cut aseptically at the ends, into approximately 7 7 mm2 sections, and placed on the medium. The basal medium was supplemented with 2.0 mg L1 2,4-dichlorophenoxy acetic acid (2,4-D), 0.1 mg L1 a-naphthalene acetic acid (NAA) and 30 g L1 of sucrose. After 3–4 weeks, calli were sub-cultured onto medium consisting of MS salts and vitamins and containing 2.0 mg L1 2,4-D. Calli were then transferred to 30 mL of MS liquid medium containing 3% sucrose. Suspension cultures were maintained at 25 °C
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
AB008748, respectively). PCR reactions were carried out in triplicate for 40 cycles on a MiniOpticon (Bio-Rad Laboratories, Hercules, CA, USA) using a QIAGEN Quantitect SYBR Green PCR Kit. PCR protocols were as follows: one cycle of 5 min at 95 °C; 30 cycles with a denaturing time of 30 s at 95 °C, an annealing time of 30 s at 56 °C, and an elongation time of 30 s at 72 °C; and a final elongation step of 10 min at 72 °C. Identical PCR conditions were used for all targets.
9717
(Table 1). All PCRs were initiated with the hot start method using the RACE cDNA template. All products were cloned and subcloned into TOPO TA vectors and sequenced using the aforementioned protocols. Full-length PAL and C4H sequences were aligned using MultAlin (http://bioinfo.genotoul.fr/multalin/ multalin.html). 2.5. High performance liquid chromatography (HPLC) analysis
2.4. Isolation of cDNA encoding PAL and C4H GeneRacerTM Kits (Invitrogen) were used to synthesize single strand cDNA, according to the manufacturer’s protocols. SbPAL and SbC4H conserved fragments were PCR-amplified with PALcon-F, PAL-con-R, C4H-con-F, and C4H-con-R. PCR products were subcloned into a TOPO TA vector (Invitrogen) and sequenced. Sequence data were used to design new primer pairs for RACE–PCR
Suspension cells (0.05 g) were frozen in liquid nitrogen, ground to a fine powder using a mortar and pestle, and extracted with 10 mL of 70% ethanol for 1 h at 60 °C. After centrifugation, the supernatant was filtered through a 0.45-lm poly filter and analyzed by HPLC. The analysis was monitored at 275 nm and performed using a C18 column (250 mm 4.6 mm, 5 lm; RStech, Daejon, Korea). The mobile phase was a gradient prepared from
Fig. 1. Protein sequence alignment. (a) Alignment of amino acid sequences for SbPAL1, SbPAL2, and SbPAL3 from Scutellaria baicalensis with PALs from Arabidopsis thaliana (AtPAL1, AtPAL2, and AtPAL3), Camellia sinensis (CsPAL), Brassica rapa (BrPAL), Agastache rugosa (ArPAL), Nicotiana tabacum (NtPALA and NtPALB), and Salvia miltiorrhiza (SmPAL). (b) Alignment of amino acid sequences for SbC4H from S. baicalensis with C4Hs from A. rugosa (ArC4H), A. thaliana (AtC4H), Citrus sinensis (CsC4H2), Ginko biloba (GbC4H), Allium cepa (AcC4H), Populus trichocarpa (PtC4G1), and Populus tremuloides (PtC4H2-2).
9718
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
Fig. 1 (continued)
mixtures of acetonitrile, methanol, and 0.2% acetic acid; the column was maintained at 30 °C. The flow rate was set at 1.0 mL min1, and the injection volume was 20 lL. Results were calculated using a standard curve. 3. Results and discussion 3.1. Isolation and sequence analysis of PAL and C4H from S. baicalensis SbPAL1 was 2124 bp long with an open reading frame, and encoded 708 amino acids. SbPAL2 was 2136 bp long with an open reading frame, and encoded 712 amino acids. SbPAL3 was 2127 bp long with an open reading frame, and encoded 709 amino acids. Alignments showed that there is high amino acid sequence identity and similarity (89% and 94%, respectively) between SbPAL2 and SbPAL3, and these have fairly high identity and similarity with SbPAL1 (81% and 88%, respectively) (Fig. 2a). Alignment with PAL family sequences from Arabidopsis thaliana (NM129260, NM115186, NM120505), Camellia sinensis (AY694188), Brassica
rapa (EU402423), Agastache rugosa (AF326116), Nicotiana tabacum (AB008199, AB008200), and Salvia miltiorrhiza (EF462460) also showed high identity and similarity (81–82% and 87–89%, respectively) with SbPAL1. Results were similar for SbPAL2 (81–90% identity and 89–94% similarity) and SbPAL3 (81–82% identity and 87–89% similarity). All three PALs had only moderate identity and similarity with AtPAL3 from A. thaliana (73% and 81% for SbPAL1; 74% and 83% for SbPAL2; 73% and 81% for SbPAL3, respectively). A phylogenetic tree constructed from the deduced amino acid sequences of plant PALs showed that SbPAL1 formed a distinct group, whereas SbPAL2 and SbPAL3 clustered together (data not shown) (Fig. 1a). The SbC4H cDNA was a 1524-bp long with an open reading frame encoding 508 amino acids. SbC4H shares only 80% identity (90% similarity) with CsC4H from Citrus sinensis (AF255014), but 85–89% identity (93–95% similarity) with other C4Hs from A. rugosa (AY616436), A. thaliana (U71081), Ginko biloba (AY748324), Allium cepa (AY541032), Populus trichocarpa (EU603304), and Populus tremuloides (DQ522295) (Fig. 1b).
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
3.2. Expression of flavone biosynthetic genes in different organs of S. baicalensis Different flavone biosynthetic genes were expressed in different S. baicalensis tissues (Supplementary Fig. S2). In flowers the expression levels of SbC4H and SbCHS genes were high, and in stems those of SbPAL1, SbC4H, and Sb4CL were higher than other
9719
genes. Three PALs genes showed different expression pattern in different organs. In flowers their expression was similar each other, however the transcript level of SbPAL1 was highest in stems, one of SbPAL3 was in roots, and one of SbPAL2 was in leaves. In leaves, the expression of SbCHS was highest. In roots, nearly all flavone biosynthetic genes except SbPAL1 showed increased levels of expression.
Fig. 2. Accumulation of genes for flavonoid biosynthesis in S. baicalenesis cell suspensions treated with methyl jasmonate. (a) Induction of flavonoid biosynthetic genes in S. baicalensis cell suspensions in response to treatment with different concentrations of methyl jasmonate. (b) Time course of induction of flavonoid biosynthetic genes in methyl jasmonate (100 lM)-treated cell suspension cultures of S. baicalensis. Each value is the mean of three replicates ± SD.
9720
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
Fig. 3. Time course of the effect of wounding on the expression of flavonoid biosynthetic genes in S. baicalensis suspension cells. Each value is the mean of three replicates ± SD.
3.3. Inducible expression of flavone biosynthetic genes in S. baicalensis All flavone biosynthetic genes measured in this study were upregulated in response to elicitor (MeJa) treatment. Transcript accumulation was apparent for all genes (Fig. 2a), particularly SbPAL3 increased up to 24-fold comparison to without MeJa treatment. Although SbPAL1, SbC4H, and Sb4CL transcripts were clearly induced treatment with 100 lM MeJa, expression levels of other genes involved in flavone biosynthesis was induced in treatment with 200 lM MeJa. SbPAL1 and Sb4CL transcripts were induced within 48 h, whereas levels of SbC4H and SbCHS transcripts increased within 24 h of treatment with 100 lM MeJa (Fig. 2b). This result is similar to previous works, for instance, MeJa initiates PAL gene transcription in Glycine max (Gundlach et al., 1992), improves ginsenoside content in cell (Lu et al., 2001) and hairy root (Palazon et al., 2003) cultures of Panax ginseng, enhances the production of sesquiterpenes and lipoxygenase metabolites in hairy root cultures of Solanum tuberosum (Komaraiah et al., 2003), and stimulates soyasaponin biosynthesis and accumulation of related secondary metabolite genes in Glycyrrhiza glabra (common licorice) cultures (Hayashi et al., 2003). S. baicalensis suspension cells responded to wounding with obvious transcriptional accumulation of flavonoid biosynthetic genes (Fig. 3). SbPAL1, SbC4H, and Sb4CL transcript levels transiently increased within 1–3 h after wounding, then returned to near-control levels. Transcripts of SbPAL2, SbPAL3, and SbCHS accumulated to maximum levels within 24 h of wounding, before returning to previous levels. This result was not surprising, as increased gene expression after wounding has been described in soybean and alfalfa (Creelman et al., 1992; Junghans et al., 1993); similarly, in white spruce, wounding has resulted in the accumulation of CHS mRNA (Richard et al., 2000).
3.4. HPLC analysis of flavonoid contents in S. baicalensis Using HPLC analysis, we demonstrated that flavones—specifically, baicalin, baicalein and wogonin—accumulated in different
tissues of S. baicalensis. Furthermore, of the analyzed compounds, baiclain had the highest concentration. The baicalin and baicalein contents in roots were 22 and 107 times higher than those in flowers, respectively (Table 2). Treatment with MeJa for 72 h increased flavone contents in cell suspensions. After treatment with 200 lM of MeJa, baicalin increased 4.5-time, baicalein increased 1.4-time, and wogonin increased 3.1-time (Table 3). Recent work has shown that the activity of elicitors such as MeJa, enhances major flavones in hairy roots of S. baicalensis (Hwang, 2006; Kuzovkina et al., 2005). Hwang, (2006) observed the baicalin content of the roots increased up to 3-fold after treatment with 10 mM MeJa. (Kuzovkina et al., 2005) showed the treatment of 3-week-old cultured roots with MeJa doubled the total concentration of major flavones in roots.
Table 2 Production levels of baicalin, baicalein, and wogonin in different organs of S. baicalenesis. Organs
Flower Stem Leaf Root
Flavones (lg/g DW) Baicalin
Baicalein
Wogonin
3859.33 839.63 1490.40 84212.30
78.49 – 71.78 8386.90
– – – 1496.03
Table 3 Induction of baicalin, baicalein, and wogonin in S. baicalensis cell suspensions in response to different concentrations of MeJa. MeJA conc. (lM)
0 10 50 100 200 300
Flavones (lg/g) Baicalin
Baicalein
Wogonin
2696.98 5575.97 4601.38 4462.56 12028.00 1990.73
63.49 63.86 65.14 64.14 88.93 62.28
– – – – 3.16 1.02
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
Wounded suspension cells upregulated expression of SbPAL1, SbC4H, and Sb4CL within 1–3 h after wounding, however, the transcript levels of SbPAL2, SbPAL3 and SbCHS increased 24 h later (Fig. 3). However, the contents of flavones in wounded suspension cells were decreased. This might be explained that the suspension cells after wounding treatment were not healthful or dead although expression levels flavones synthetic genes were upregulated (data not shown). These results indicated that the expression of flavones biosynthetic genes measured in this study was mostly induced by treatment with 100–200 lM of MeJa and also the contents of major flavones in S. baicalenesis increased with same treatment. Consistent with flavones accumulation, we might analogize the expression of flavone biosynthetic genes associated with the production of major flavones in S. baicalenesis. The overexpression of biosynthetic genes like SbPALs, SbC4H, Sb4CL, and SbCHS genes might have the effect of increasing the secondary metabolite contents of this plant. This study suggests the potential of producing more secondary metabolites using hairy root cultures of S. baicalenesis. Transformed hairy root cultures have attracted considerable attention owing to their genetic and biochemical stability, rapid growth rate, and ability to synthesize secondary products at levels comparable to wild-type roots (Georgiev et al., 2007; Rahman et al., 2009; Srivastava and Srivastava, 2007). The isolation of genes encoding biosynthetic enzymes coupled with hairy root culture will provide a powerful model system for investigating molecular regulation and for evaluating the potential of metabolic engineering. 4. Conclusions The phytochemicals examined here—baicalin, baicalein, and wogonin—are only some of the many compounds produced by S. baicalensis; its rich supply of secondary metabolites and its importance as a medicinal plant make it an excellent model system for continued research of useful medicinal compounds. Having determined that SbPALs and SbC4H are key enzymes in the S. baicalensis flavone biosynthetic pathway, we are currently focusing our efforts on producing transgenic hairy roots via the introduction of flavone biosynthetic genes. Cumulatively, we hope that this and related work will develop and improve technologies for producing useful medicinal compounds. Acknowledgements This study was financially supported by research fund of Chungnam National University in 2009. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.biortech.2010.07.083. References Chapple, C., 1998. Molecular-genetic analysis of plant cytochrome P450dependent monooxygenases. Annual Review of Plant Physiology and Plant Molecular Biology 49, 311–343. Chi, Y.S., Lim, H., Park, H., Kim, H.P., 2003. Effects of wogonin, a plant flavone from Scutellaria radix, on skin inflammation: in vivo regulation of inflammationassociated gene expression. Biochemical Pharmacology 66, 1271–1278. Creelman, R.A., Tierney, M.L., Mullet, J.E., 1992. Jasmonic acid/methyl jasmonate accumulate in wounded soybean hypocotyls and modulate wound gene expression. Proceedings of the National Academy of Sciences of the United States of America 89, 4938–4941. Dixon, R.A., Paiva, N.L., 1995. Stress-induced phenylpropanoid metabolism. Plant Cell 7, 1085–1097. Gao, S.L., Chen, B.J., Zhu, D.N., 2002. In vitro production and identification of autotetraploids of Scutellaria baicalensis. Plant Cell, Tissue and Organ Culture 70, 289–293.
9721
Gao, Z., Yang, X., Huang, K., Xu, H., 2000. Free-radical scavenging and mechanism study of flavonoids extracted from the radix of Scutellaria baicalensis Georgi. Applied Magnetic Resonance 19, 35–44. Georgiev, M.I., Pavlov, A.I., Bley, T., 2007. Hairy root type plant in vitro systems as sources of bioactive substances. Applied Microbiology and Biotechnology 74, 1175–1185. Gundlach, H., Muller, M.J., Kutchan, T.M., Zenk, M.H., 1992. Jasmonic acid is a signal transducer in elicitor-induced plant cell cultures. Proceedings of the National Academy of Sciences USA 89, 2389–2393. Guo, Q., Zhao, L., You, Q., Yang, Y., Gu, H., Song, G., Lu, N., Xin, J., 2007. Anti-hepatitis B virus activity of wogonin in vitro and in vivo. Antiviral Research 74, 16–24. Harakava, R., 2005. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus. Genetics and Molecular Biology 28, 601–607. Hayashi, H., Huang, P., Inoue, K., 2003. Up-regulation of soyasaponin biosynthesis by methyl jasmonate in cultured cells of Glycyrrhiza glabra. Plant Cell Physiology 44, 404–411. Horvath, C.R., Martos, P.A., Saxena, P.K., 2005. Identification and quantification of eight flavones in root and shoot tissues of the medicinal plant Huang-qin (Scutellaria baicalensis Georgi) using high-performance liquid chromatography with diode array and mass spectrometric detection. Journal of Chromatography A 1062, 199–207. Hwang, S., 2006. Baicalin production in transformed hairy root clones of Scutellaria baicalensis. Biotechnology and Bioprocess Engineering 11, 105–109. Junghans, H., Dalkin, K., Dixon, R.A., 1993. Stress responses In alfalfa (MedicagoSativa L). 15. Characterization and expression patterns of members of a subset of the chalcone synthase Multigene Family. Plant Molecular Biology 22, 239– 253. Komaraiah, P., Reddy, G.V., Reddy, P.S., Raghavendra, A.S., Ramakrishna, S.V., Reddanna, P., 2003. Enhanced production of antimicrobial sesquiterpenes and lipoxygenase metabolites in elicitor-treated hairy root cultures of Solanum tuberosum. Biotechnology Letters 25, 593–597. Kovács, G., Kuzovkina, I.N., Szoke, É., Kursinszki, L., 2004. HPLC determination of flavonoids in hairy-root cultures of Scutellaria baicalensis Georgi. Chromatographia 60, S81–85. Kuzovkina, I.N., Guseva, A.V., Kovács, D., Szöke, É., Vdovitchenko, M.Y., 2005. Flavones in genetically transformed Scutellaria baicalensis roots and induction of their synthesis by elicitation with methyl jasmonate. Russian Journal of Plant Physiology 52, 77–82. Lau, C.S., Carrier, D.J., Beitle, R.R., Bransby, D.I., Howard, L.R., Lay, J.J.O., Liyanage, R., Clausen, E.C., 2007. Identification and quantification of glycoside flavonoids in the energy crop Albizia julibrissin. Bioresource Technology 98, 429–435. Li-Weber, M., 2009. New therapeutic aspects of flavones: the anticancer properties of Scutellaria and its main active constituents Wogonin, Baicalein and Baicalin. Cancer Treatment Reviews 35, 57–68. Li, H., Murch, S., Saxena, P., 2000. Thidiazuron-induced de novo shoot organogenesis on seedlings, etiolated hypocotyls and stem segments of Huang-qin. Plant Cell, Tissue and Organ Culture 62, 169–173. Liu, R., Xu, S., Li, J., Hu, Y., Lin, Z., 2006. Expression profile of a PAL gene from Astragalus membranaceus var Mongholicus and its crucial role in flux into flavonoid biosynthesis. Plant Cell Reports 25, 705–710. Lu, M.B., Wong, H.L., Teng, W.L., 2001. Effects of elicitation on the production of saponin in cell culture of Panax ginseng. Plant Cell Reports 20, 674–677. Martens, S., Mithöfer, A., 2005. Flavones and flavone synthases. Phytochemistry 66, 2399–2407. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum 15, 473–497. Murch, S.J., Rupasinghe, H.P.V., Goodenowe, D., Saxena, P.K., 2004. A metabolomic analysis of medicinal diversity in Huang-qin (Scutellaria baicalensis Georgi) genotypes: discovery of novel compounds. Plant Cell Reports 23, 419–425. Palazon, J., Cusido Rosa, M., Bonfill, M., Mallol, A., Moyano, E., Morales, C., Pinol, M.T., 2003. Elicitation of different Panax ginseng transformed root phenotypes for an improved ginsenoside production. Plant Physiology and Biochemistry 41, 1019– 1025. Rahman, L.u., Kouno, H., Hashiguchi, Y., Yamamoto, H., Narbad, A., Parr, A., Walton, N., Ikenaga, T., Kitamura, Y., 2009. HCHL expression in hairy roots of Beta vulgaris yields a high accumulation of p-hydroxybenzoic acid (pHBA) glucose ester, and linkage of pHBA into cell walls. Bioresource Technology 100, 4836– 4842. Richard, S., Lapointe, G., Rutledge, R.G., Seguin, A., 2000. Induction of chalcone synthase expression in white spruce by wounding and jasmonate. Plant Cell Physiology 41, 982–987. Singh, K., Kumar, S., Rani, A., Gulati, A., Ahuja, P., 2009. Phenylalanine ammonialyase (PAL) and cinnamate 4-hydroxylase (C4H) and catechins (flavan-3-ols) accumulation in tea. Functional & Integrative Genomics 9, 125–134. Son, D., Lee, P., Lee, J., Kim, H., Kim, S.Y., 2004. Neuroprotective effect of wogonin in hippocampal slice culture exposed to oxygen and glucose deprivation. European Journal of Pharmacology 493, 99–102. Srivastava, S., Srivastava, A.K., 2007. Hairy root culture for mass-production of highvalue secondary metabolites. Critical Reviews in Biotechnology 27, 29–43. Teutsch, H.G., Hasenfratz, M.P., Lesot, A., Stoltz, C., Garnier, J.M., Jeltsch, J.M., Durst, F., Werch-Reichhart, D., 1993. Isolation and sequence of a cDNA encoding the Jerusalem artichoke cinnamate-4-hydroxylase, a major plant cytochrome P450 involved in the general phenylpropanoid pathway. Proceedings of the National Academy of Sciences USA 90, 4102–4106. Weisshaar, B., Jenkins, G.I., 1998. Phenylpropanoid biosynthesis and its regulation. Current Opinion in Plant Biology 1, 251–257.
9722
H. Xu et al. / Bioresource Technology 101 (2010) 9715–9722
Zhao, Q., Wang, J., Zou, M.-J., Hu, R., Zhao, L., Qiang, L., Rong, J.-J., You, Q.-D., Guo, Q.L., 2010. Wogonin potentiates the antitumor effects of low dose 5-fluorouracil against gastric cancer through induction of apoptosis by down-regulation of NF-kappaB and regulation of its metabolism. Toxicology Letters 197, 201–210.
Zhou, Y., Nagashima, S., Hirotani, M., Suzuki, H., Yoshikawa, T., 2003. Expression of the chalcone synthase gene in Scutellaria baicalensis hairy root cultures was unusually reduced by environmental stresses. Plant Biotechnology 20, 207–214.