- Email: [email protected]
Molecular cloning and characterization of proliferating cell nuclear antigen (PCNA) from Chinese shrimp Fenneropenaeus chinensis
Comparative Biochemistry and Physiology, Part B 151 (2008) 225–229
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part B j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p b
Molecular cloning and characterization of proliferating cell nuclear antigen (PCNA) from Chinese shrimp Fenneropenaeus chinensis Yusu Xie a,b, Bing Wang a, Fuhua Li a,⁎, Hao Jiang a,b, Jianhai Xiang a,⁎ a b
Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, PR China Graduate School, Chinese Academy of Sciences, Beijing 100039, PR China
a r t i c l e
i n f o
Article history: Received 17 March 2008 Received in revised form 9 July 2008 Accepted 11 July 2008 Available online 16 July 2008 Keywords: Fenneropenaeus chinensis Haematopoietic tissue PCNA Vibrio challenge WSSV challenge
a b s t r a c t The proliferating cell nuclear antigen gene was cloned from Fenneropenaeus chinensis (FcPCNA). The fulllength cDNA sequence of FcPCNA encodes 260 amino acids showing high identity with PCNAs reported in other species. FcPCNA expressed especially high in proliferating tissues of shrimp such as haematopoietic tissue (HPT) and ovary. In order to understand the response of HPT to bacteria and virus challenge, mRNA level of FcPCNA in HPT was analyzed after shrimp were challenged by Vibrio anguillarum and white spot syndrome virus (WSSV). FcPCNA expression in HPT of shrimp was responsive to WSSV and Vibrio challenge, but different expression profiles were obtained after challenge by these two pathogens. The data provide additional information to understand the defense mechanisms of shrimp against virus and bacteria. © 2008 Elsevier Inc. All rights reserved.
1. Introduction Proliferating cell nuclear antigen (PCNA), initially identified as an auxiliary protein for mammalian DNA polymerase δ (Pol δ) (Bravo et al., 1987; Prelich et al., 1987), plays important roles in nucleic acid metabolism. As an essential component of the DNA replication machinery in cells, it is a eukaryotic DNA sliding clamp functionally analogous to the E. coli DNA polymerase III β-subunit and the phage T4 gene45 protein (Tsurimoto, 1998; Johnson and O'Donnell, 2005). Three identical PCNA monomers form a ring-shaped trimer in a headto-tail arrangement to encircle the double helix DNA in cooperation with the clamp loader RF-C, and functions as a processivity factor for DNA Pol δ and ε by clamping the polymerases on the DNA template to process DNA synthesis. In addition to functioning in DNA replication by interaction with proteins such as RF-C, Pol δ, Fen 1 and DNA ligase 1, PCNA can also interact with several other proteins such as p21, Gadd45, CDK2, cyclin D and DNA methyltransferase which are involved in DNA repair, cell-cycle control and chromatin remodeling (Kelman, 1997; Tsurimoto, 1998; Maga and Hübscher, 2003). Genes encoding PCNA and its homologues have been isolated from wide variety of species including mammals (Almendral et al., 1987; Matsumoto et al.,1987; Yamaguchi et al.,1991), insects (Yamaguchi et al., 1990; Tammariello and Denlinger,1998; Ruike et al., 2006), higher plants (López et al., 1995, 1997; Strzalka and Ziemienowicz, 2007), marine phytoplankton (Lin and Carpenter, 1998), fungi (Bauer and Burgers, ⁎ Corresponding authors. Li is to be contacted at Tel.: +86 532 82898571; fax: +86 532 82898578. Xiang, Tel.: +86 532 82898568; fax: +86 532 82898578. E-mail addresses: [email protected] (F. Li), [email protected] (J. Xiang). 1096-4959/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpb.2008.07.006
1990; Hamada et al., 2002), viruses (GenBank accession number: NP_046209, YP_473291) and archaeans (Iwai et al., 2000). PCNA is highly conserved both in function and sequence. It is an acidic, nonhistone nuclear protein with an apparent isoelectric point of 4.8–4.9 and molecular mass of 33–36 kDa. As its synthesis and expression is cellcycle dependent with the highest expression in dividing cells and little expression in quiescent cells (Bravo et al., 1987; Hamada et al., 2002; Liu et al., 2005), PCNA can be used to mark cell proliferation activity and is helpful to study the developmental processes for detection of dynamic changes during morphogenesis (Köhler et al., 2005) and haematopoiesis (Leung et al., 2005), estimation of marine phytoplankton growth rates (Liu et al., 2005), tracing cell proliferation during muscle growth (Martin and Johnston, 2005) and neurogenesis (Raucci et al., 2006), and can also be used as a biomarker in clinical studies for response to chemotherapy, prognosis and overall survival in cancer or other disease patients (Vital-Reyes et al., 2006; Lyshchik et al., 2007). White spot syndrome virus (WSSV) and Vibrio are regarded as major pathogens of shrimp diseases in aquaculture worldwide. During pathogen infection, the expression of immune related genes in shrimp can change (He et al., 2004, 2005; Wang et al., 2006; Liu et al., 2007), and also the total number of circulating haemocytes can vary distinctly (Van de Braak et al., 2002a; Wang et al., 2002; Wongprasert et al., 2003; Wu and Muroga, 2004; Hameed et al., 2006; Liu et al., 2007). The circulating haemocytes of crustaceans play important roles in the host immune response, performing functions as recognition, phagocytosis, melanization, encapsulation, cytotoxicity and cell–cell communication (Johansson et al., 2000; Lee and Söderhäll, 2002). The haematopoietic tissue (HPT), situated mainly on the dorsal side of the stomach, has been described in several crustacean species and
226
Y. Xie et al. / Comparative Biochemistry and Physiology, Part B 151 (2008) 225–229
commonly believed to be the haemocyte-producing organ (Johansson et al., 2000; Van de Braak et al., 2002b; Söderhäll et al., 2003; Zhang et al., 2006), although the regulation of haematopoiesis in crustacean is still not clearly understood. It is commonly agreed that there are tentative haematopoietic stem cells in the HPT, which can proliferate during a stimulation to increase release of new haemocytes from the HPT to the circulation. As the expression of PCNA might be closely related to cell proliferation, PCNA is potentially useful to mark cell proliferation activity in HPT. In the present study, we report the identification and characterization of the full-length cDNA encoding PCNA from Chinese shrimp Fenneropenaeus chinensis. To better understand the effect of pathogen stimulation on the HPT of shrimp, the expression of PCNA in HPT of F. chinensis was analyzed when shrimp were challenged by Vibrio anguillarum and WSSV. 2. Materials and methods
at 58 °C for 1 min and extension at 72 °C for 1 min; followed by 1 cycle of 72 °C for 10 min. PCR products were isolated on a 1.2% agarose gel, purified by PCR purification kit (Promega, USA), and cloned into pMD18-T vector (TaKaRa, Dalian), then transformed into E. coli TOP 10, the positive transformants were screened by PCR and then sequenced. Based on the partial sequence of FcPCNA, the 5′- and 3′-ends were obtained by semi-nested PCR approaches using two gene specific primers and adapter primers. For 5′-end PCR, cDNA template used was from the ovary cDNA library of F. chinensis, the PCR reaction was performed with gene specific primer PCNA-r1 and an anchor primer T3 (5′-ATTAACCCTCACTAAAGGGA-3′), followed by semi-nested PCR with T3 and another PCNA specific primer PCNA-r2 (5′-CCTTGTCTACACTGGAGGTCTG-3′). For 3′-end PCR, PCR was performed with gene specific primer PCNA-f1 and adapter primer AP (5′-GGCCACGCGTCGACTAGTAC-3′) using ovary cDNA as template, and then semi-nested PCR was carried out with another PCNA specific primer PCNA-f2 (5′CAGCAGCAGGAGACATTGGTA-3′) and AP. The PCR products were gelpurified and sequenced as described above.
2.1. Animals 2.5. Sequence analysis The Chinese shrimp F. chinensis with a body length of 10 ± 0.5 cm were purchased from a local shrimp farm and reared in 8 m3 fiber glass tanks in which the salinity and temperature of the seawater were maintained similar to those of the shrimp culture ponds. Shrimp were fed with clam meat for a week and acclimated to laboratory conditions. Shrimp haemolymph was collected from the ventral sinus located at the first abdominal segment and mixed with an equal volume of modified Alsevier solution anticoagulant (Bachère et al., 1988), and centrifuged for 10 min at 800 ×g, 4 °C. Haemocyte pellets and shrimp tissues were preserved in liquid nitrogen immediately for RNA extraction.
The cloned sequence was analyzed for the identity and similarity with other known sequences by NCBI BLAST search program. The multiple sequence alignments were performed on amino acid sequences of known PCNA molecules using CLUSTAL W. 2.6. Tissue distribution of FcPCNA
In the challenging experiment, each WSSV-challenged and bacteria-challenged (V. anguillarum) group was injected with 20 μL tissue homogenate in PBS from WSSV infected shrimp and 20 μL PBS containing inactive bacteria (107 CFU mL− 1), respectively; and control group was injected with 20 μL sterile PBS. The HPTs of eight shrimp from each group were collected for quantitative real-time PCR at each sampling point, 0, 3, 6, 12, 24, 48, 72 and 96 h after challenge and preserved in liquid nitrogen immediately for RNA extraction.
Semi-quantitative RT-PCR was employed to study the expression of FcPCNA in various shrimp tissues (testis, ovary, haemocytes, gill, intestine, hepatopancreas, muscle, stomach, HPT, heart, lymphoid organ and nerve). The target gene specific primers PCNA-f1, 5′ATCAAGGACCTGCTGAACGA-3′, and PCNA-r2, 5′-CCTTGTCTACACTGGAGGTCTG-3′, were used to generate a fragment of 517 bp. The PCR conditions were 94 °C for 4 min; 94 °C for 50 s, 58 °C for 50 s, 72 °C for 50 s, 29 cycles; 10 min extension at 72 °C. The F. chinensis β-actin, amplified using primers actin-f, 5′-AGTAGCCGCCCTGGTTGTAGA-3′, and actin-r, 5′-TTCTCCATGTCGTCCCAG-3′, was used as internal standard gene. The PCR conditions were 94 °C for 4 min; 94 °C for 50 s, 58 °C for 50 s, 72 °C for 50 s, 26 cycles; 10 min extension at 72 °C. PCR products were analyzed on 2% agarose gel, stained with ethidium bromide and visualized under ultraviolet light.
2.3. RNA extraction and cDNA synthesis
2.7. Quantification of FcPCNA mRNA expression in HPT by real-time PCR
Total RNA was extracted from hepatopancreas, haemocytes, lymphoid organ, heart, stomach, intestine, nerve, ovary, testis, muscle, HPT and gill using Unizol Reagent (BioStar, Shanghai) following the manufacturer's protocol. RNA quality was assessed by electrophoresis on 1.2% agarose gel. Total RNA was treated with RQ1 RNase-Free DNase (Promega, USA) to remove contaminating DNA from the total RNA and cDNA was synthesized from 2 μg total RNA by M-MLV reverse transcriptase (Promega, USA) following the manufacturer's protocol with oligo(dT) primer AOLP (5′GGCCACGCGTCGACTAGTAC (T)16(A/C/G)-3′).
The expression of FcPCNA in F. chinensis HPT in response to bacteria and virus challenge was measured by quantitative real-time PCR. The primers of target gene were pReal-F (5′-CACAGGTTTCGCTTTCCA-3′) and pReal-R (5′-CGAGTCTTCGTCCTCAATC-3′), generating a segment of 113 bp. As the expression of β-actin varied when shrimp were challenged by WSSV, F. chinensis triosephosphate isomerase (TPI) was used as internal control (Wang et al., 2006) to verify the quantitative real-time PCR reaction. The primers of internal control gene were TPI-F (5′-GAGGCTAACCGCACCCA-3′) and TPI-R (5′-ACAAAGTCTGGCTTGAGTGATG-3′), producing a fragment of 320 bp. The SYBR Green real-time PCR assay was carried out on a Mastercycler ep realplex 4S (Eppendorf, Germany) using Blend TaqPlus-PCR reaction system (TOYOBO). Each sample was run in triplicates as well as for the internal control gene. Briefly, the cycling conditions were as follows: for PCNA, 94 °C for 2 min followed by 40 cycles of 94 °C for 20 s, 61.5 °C for 20 s and 72 °C for 20 s; for TPI, 94 °C for 2 min followed by 40 cycles of 94 °C for 20 s, 58 °C for 30 s and 72 °C for 30 s. Gene expression was presented using a modification of the 2− ΔΔCt method as described by Livak and Schmittgen (2001). Data were statistically analyzed by one-way analysis of variance (one-way
2.2. WSSV and Vibrio challenge experiment
2.4. Cloning and sequencing of F. chinensis PCNA (FcPCNA) An EST homologous to PCNA was found from the cephalothorax cDNA library of F. chinensis (Xiang, 2002). To verify the result of PCNAlike EST, we designed a pair of primers, PCNA-f1 (5′-ATCAAGGACCTGCTGAACGA-3′) and PCNA-r1 (5′-CAAGAAGTAACGGATGTGGC-3′) based on the above EST sequence. PCR amplification was performed using the cDNA template from the cephalothorax cDNA library, the PCR conditions were as follows: 1 cycle of 94°C for 5 min; 35 cycles including denaturation at 94 °C for 1 min, annealing
Y. Xie et al. / Comparative Biochemistry and Physiology, Part B 151 (2008) 225–229
227
Fig. 1. Multiple alignments of the deduced amino acid sequence of FcPCNA with other known PCNAs. F. chinensis (EF051247), D. melanogaster (NP_476905), B. mori (NP_001036825), H. sapiens (NP_002583), M. musculus (NP_035175), R. norvegicus (NP_071776). Residues in black background indicate higher levels of amino acid similarity. The center loop, the interdomain connecting loop and the C-terminal tail, known to be important for interaction of PCNA-binding proteins, are indicated.
ANOVA) using SPSS software 11.0; values were considered to be significant at P b 0.05.
isoelectric point of 4.59. Multiple alignments of FcPCNA with that of other species showed high conservation (Fig. 1). The BLAST results (Table 1) of the deduced amino acid sequence of FcPCNA showed that the
3. Results 3.1. Cloning of FcPCNA cDNA from F. chinensis The full-length FcPCNA cDNA obtained from F. chinensis was 1106 bp (GenBank accession no. EF051247) in length, containing a 783 bp ORF, a 101 bp 5′ untranslated region and a 225 bp 3′ untranslated region including a stop codon (TAA). It encoded a predicted product of 260 amino acids with a molecular mass of 28.8 kDa and a theoretical
Table 1 The BLAST results of the deduced amino acid sequence of FcPCNA showing relationship with other known PCNAs Organism
Accession number
E value
Identities (BLASTP)
Drosophila melanogaster Sarcophaga crassipalpis Bombyx mori Mus musculus Homo sapiens Rattus norvegicus Xenopus laevis Danio rerio Styela clava
NP_476905 O16852 NP_001036825 NP_035175 NP_002583 NP_071776 P18248 NP_571479 P53358
1.00E−125 8.00E−125 7.00E−123 4.00E−116 8.00E−116 1.00E−115 2.00E−115 4.00E−107 6.00E−102
80% 79% 80% 73% 73% 73% 73% 68% 66%
Fig. 2. Expression of FcPCNA in different tissues of shrimp. (a): Electrophoresis results of FcPCNA and β-actin expression in different tissues. (b): The abundance of FcPCNA mRNA was normalized with β-actin mRNA, and shown as relative gene expression + standard deviations (SD), each in triplicate.
228
Y. Xie et al. / Comparative Biochemistry and Physiology, Part B 151 (2008) 225–229
sequence obtained is closest to arthropods compared to other organisms. Furthermore, several important conserved structural domains of eukaryotic PCNA were identified in the deduced amino acid sequence, such as the interdomain connecting loop which interacts with DNA polymerase δ, Fen-1, p21, a C-terminal tail which interacts with replication factor C (RF-C), DNA polymerase ε, CDK2 and GADD45, and the center loop which interacts with RF-C and DNA polymerase δ. 3.2. Tissue distribution of FcPCNA The mRNA transcripts indicated that FcPCNA was widely expressed in all examined tissues with different expression levels (Fig. 2). FcPCNA expressions were poor in nerve, haemocytes and heart, relatively higher in intestine, gill, stomach, muscle, lymphoid organ and hepatopancreas, and strong in ovary, HPT and testis. The expression levels of FcPCNA in the ovary and HPT are nearly 7-fold higher than that in the nerve. 3.3. Expression profiles of FcPCNA in HPT after challenge Expression profiles of FcPCNA in HPT of shrimp injected with inactivated V. anguillarum (Vibrio-challenged group) or PBS (control group) are shown in Fig. 3a. The mRNA level of FcPCNA in Vibriochallenged group was noticeably different from the control group in which FcPCNA expression level in HPT remained much more stable. At 6, 24, 72 and 96 h post-Vibrio injection, the expression levels of FcPCNA are apparently up-regulated compared with those in the control group (P b 0.05). At the other sampling points (3, 12, 48 h postinjection), there is no difference at the expression levels of FcPCNA in HPT between Vibrio-challenged group and control group. However, the expression profile of FcPCNA in HPT of shrimp after WSSV challenge (Fig. 3b) was distinct from that in shrimp injected with V. anguillarum. Compared to the control group, the expression of FcPCNA in HPT showed a down-regulation at 3 h post-WSSV injection. At 6 and 12 h post-injection, its expression showed a significant upregulation in WSSV-challenged shrimp. At 24 h, the expression level of FcPCNA showed no difference compared with that in the control group, while it showed up-regulation in WSSV-challenged shrimp at 48 h, and then restored to the same level with that in the control group at 72 h post-injection. At 96 h, no shrimp survived in WSSVchallenged group.
Fig. 3. Relative FcPCNA expression levels (2− ΔΔCt) in HPT at different time intervals postVibrio anguillarum (a) and post-WSSV injection (b). Bars represented the mean+SD (n =3). Significant differences (Pb 0.05) of FcPCNA expression between the infected and the same control at each sampling point were indicated with asterisks, respectively.
4. Discussion In this study, a full-length cDNA of PCNA was successfully cloned from Chinese shrimp F. chinensis. To our knowledge, this is the first full-length cDNA of PCNA cloned from a crustacean. Several typical conserved structural domains of eukaryotic PCNA, such as the interdomain connecting loop, a C-terminal tail and the center loop, were identified in FcPCNA. These domains are essential for the functions of PCNA in DNA replication and other nucleic acid metabolism (Tsurimoto, 1998; Maga and Hübscher, 2003). Analysis of deduced amino acid sequence of FcPCNA showed high conservation to that of Drosophila melanogaster, Bombyx mori and other species. The molecular characteristics of FcPCNA suggested that it might play very important roles in DNA replication and cell-cycle control as reported in other organisms. When studying the tissue distribution of FcPCNA, its expression is high in proliferating tissues including HPT, which was regarded as a vigorously proliferating tissue in freshwater crayfish (Söderhäll et al., 2003), ovary and testis, while almost no expression is noted in nerve which is known to have little proliferation activity. Based on its important roles in cell proliferation, PCNA has been used for prognosis of tumor and cancer development in human (Lee et al., 1995). In zebrafish Danio renio, PCNA can be used to mark cell proliferation in HPT and to identify a population of progenitor cells (Leung et al., 2005). In marine dinoflagellate Prorocentrum donghaiense and green algae Dunaliella salina, it was reported that PCNA could be taken as a marker of cell proliferation (Liu et al., 2005). Present data showed that the expression level of FcPCNA in shrimp is closely related to proliferation activity of tissues, FcPCNA is possible to be taken as a marker of cell proliferation. It is generally agreed that the HPT is responsible for production and supply of haemocytes. When shrimp were injected by inactivated V. anguillarum, the expression of FcPCNA is up-regulated at 6, 24, 72, and 96 h compared with that of control group at the same sampling points. So we inferred that the inactivated Vibrio might stimulate the proliferation activity of HPT cells. It was already reported that the mitotic index of HPT in zymogen injection group was significantly higher than that of control group in F. chinensis (Zhang et al., 2005). In tiger shrimp Penaeus monodon, the mitotic index of HPT in LPS injection group was significantly higher at 24 h and 48 h compared to the PBS injection group (Van de Braak et al., 2002a). In freshwater crayfish Pacifastacus leniusculus, injection of the β-1,3-glucan laminarin can stimulate the maturation of haematopoietic stem cells within the HPT and new haemocytes were released into the circulation (Söderhäll et al., 2003). Different expression profiles of FcPCNA were obtained when shrimp were challenged by WSSV. At 3 h post-WSSV challenge, the expression of FcPCNA in HPT of shrimp is down-regulated compared with that of control group at the same time. However, it showed upregulation at 6 and 12 h post-WSSV injection compared with that of control. The data indicated that WSSV might inhibit the proliferation activity of HPT at the early stage of infection. Then the shrimp might produce a series of immune reaction to fight the virus. The upregulation of FcPCNA expression at 6, 12, and 48 h might indicate the protection mechanism of shrimp to fight against WSSV through active proliferation of HPT cells. The different expression profiles of FcPCNA in HPT caused by Vibrio or WSSV might indicate different immune defense mechanism of shrimp response to different types of pathogen. Since the number of free haemocytes can vary during infection, new haemocytes need to be compensatorily and proportionally produced at varying rates from HPT. Although there were no shrimp left at 96 h post-WSSV challenge, the expression level of FcPCNA was still as high as that of the control group at 72 h. In general, shrimp needs more haemocytes to fight against WSSV replication. It has been considered that apoptosis is the main anti-viral mechanism in invertebrates (Rhee and Park, 2001; Hameed et al., 2006), which was suggested as the primary cause of death in virus-infected shrimp (Sahtout et al., 2001;
Y. Xie et al. / Comparative Biochemistry and Physiology, Part B 151 (2008) 225–229
Khanobdee et al., 2002). The high expression of FcPCNA in HPT after Vibrio or WSSV challenge suggests that more haemocytes will be produced from HPT. The relationship between the active proliferation of HPT cells and compensation of haemocytes in the haemolymph of shrimp needs further study to clarify the mechanism of haemocytes production during pathogen challenge. Acknowledgements This work was financially supported by Major State Basic Research Development Program of China (973 program) 2006CB101804, HighTech Research and Development Program of China (863 program) 2006AA09Z424 and General Program of National Natural Science Foundation of China 30471347. References Almendral, J.M., Huebsch, D., Blundell, P.A., Macdonald-Bravo, H., Bravo, R., 1987. Cloning and sequence of the human nuclear protein cyclin: homology with DNA-binding proteins. Proc. Natl. Acad. Sci. USA 84, 1575–1579. Bachère, E., Chagot, D., Grizel, H., 1988. Separation of Crassostrea gigas hemocytes by density gradient centrifugation and counterflow centrifugal elutriation. Dev. Comp. Immunol. 12, 549–559. Bauer, G.A., Burgers, P.M.J., 1990. Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene. Nucleic Acids Res. 18, 261–265. Bravo, R., Frank, R., Blundell, P.A., Macdonald-Bravo, H., 1987. Cyclin/PCNA is the auxiliary protein of DNA polymerase-δ. Nature 326, 515–517. Hamada, F., Namekawa, S., Kasai, N., Nara, T., Kimura, S., Sugawara, F., Sakaguchi, K., 2002. Proliferating cell nuclear antigen from a basidiomycete, Coprinus cinereus. Eur. J. Biochem. 269, 164–174. Hameed, A.S.S., Sarathi, M., Sudhakaran, R., Balasubramanian, G., Musthaq, S.S., 2006. Quantitative assessment of apoptotic hemocytes in white spot syndrome virus (WSSV)-infected penaeid shrimp, Penaeus monodon and Penaeus indicus, by flow cytometric analysis. Aquaculture 256, 111–120. He, N., Liu, H., Xu, X., 2004. Identification of genes involved in the response of haemocytes of Penaeus japonicus by suppression subtractive hybridization (SSH) following microbial challenge. Fish Shellfish Immunol. 17, 121–128. He, N., Qin, Q., Xu, X., 2005. Differential profile of genes expressed in hemocytes of White Spot Syndrome Virus-resistant shrimp (Penaeus japonicus) by combining suppression subtractive hybridization and differential hybridization. Antivir. Res. 66, 39–45. Iwai, T., Kurosawa, N., Itoh, Y.H., Horiuchi, T., 2000. Phylogenetic analysis of archaeal PCNA homologues. Extremophiles 4, 357–364. Johansson, M.W., Keyser, P., Sritunyalucksana, K., Söderhäll, K., 2000. Crustacean haemocytes and haematopoiesis. Aquaculture 191, 45–52. Johnson, A., O'Donnell, M., 2005. Cellular DNA replicases: components and dynamics at the replication fork. Annu. Rev. Biochem. 74, 283–315. Kelman, Z., 1997. PCNA: structure, functions and interactions. Oncogene 14, 629–640. Khanobdee, K., Soowannayan, C., Flegel, T.W., Ubol, S., Withyachumnarnkul, B., 2002. Evidence for apoptosis correlated with mortality in the giant black tiger shrimp Penaeus monodon infected with yellow head virus. Dis. Aquat. Org. 48, 79–90. Köhler, T., Pröls, F., Brand-Saberi, B., 2005. PCNA in situ hybridization: a novel and reliable tool for detection of dynamic changes in proliferative activity. Histochem. Cell Biol. 123, 315–327. Lee, S.Y., Söderhäll, K., 2002. Early events in crustacean innate immunity. Fish Shellfish Immunol. 12, 421–437. Lee, C.S., Redshaw, A., Boag, G., 1995. Assessment of cell proliferation in human laryngeal cancers using PCNA and Ki-67 antigen immunostaining. Cell Vis. 2, 296–300. Leung, A.Y.H., Leung, J.C.K., Chan, L.Y.Y., Ma, E.S.K., Kwan, T.T.F., Lai, K.N., Meng, A., Liang, R., 2005. Proliferating cell nuclear antigen (PCNA) as a proliferative marker during embryonic and adult zebrafish hematopoiesis. Histochem. Cell Biol. 124, 105–111. Lin, S., Carpenter, E.J., 1998. Identification and preliminary characterization of PCNA gene in the marine phytoplankton Dunaliella tertiolecta and Isochrysis galbana. Mol. Mar. Biol. Biotechnol. 7, 62–71. Liu, J., Jiao, N., Hong, H., Luo, T., Cai, H., 2005. Proliferating cell nuclear antigen (PCNA) as a marker of cell proliferation in the marine dinoflagellate Prorocentrum donghaiense Lu and the green alga Dunaliella salina Teodoresco. J. Appl. Phycol. 17, 323–330. Liu, Y.C., Li, F.H., Dong, B., Wang, B., Luan, W., Zhang, X.J., Zhang, L.S., Xiang, J.H., 2007. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol. Immunol. 44, 598–607. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCt method. Methods 25, 402–408. López, I., Khan, S., Vázquez-Ramos, J., Hussey, P.J., 1995. Molecular cloning of a maize cDNA clone encoding a putative proliferating cell nuclear antigen. Biochim. Biophys. Acta 1260, 119–121.
229
López, I., Khan, S., Vázquez, J., Hussey, P.J., 1997. The proliferating cell nuclear antigen (PCNA) gene family in Zea mays is composed of two members that have similar expression programmes. Biochim. Biophys. Acta 1353, 1–6. Lyshchik, A., Higashi, T., Hara, T., Nakamoto, Y., Fujimoto, K., Doi, R., Imamura, M., Saga, T., Togashi, K., 2007. Expression of glucose transporter-1, hexokinase-II, proliferating cell nuclear antigen and survival of patients with pancreatic cancer. Cancer Investig. 25, 154–162. Maga, G., Hübscher, U., 2003. Proliferating cell nuclear antigen (PCNA): a dancer with many partners. J. Cell. Sci. 116, 3051–3060. Martin, C.I., Johnston, I.A., 2005. The molecular regulation of exercised-induced muscle fibre hypertrophy in the common carp: expression of MyoD, PCNA and components of the calcineurin-signalling pathway. Comp. Biochem. Physiol. B 142, 324–334. Matsumoto, K., Moriuchi, T., Koji, T., Nakane, P.K., 1987. Molecular cloning of cDNA coding for rat proliferating cell nuclear antigen (PCNA)/cyclin. EMBO J. 6, 637–642. Prelich, G., Tan, C.K., Kostura, M., Mathews, M.B., So, A.G., Downey, K.M., Stillman, B., 1987. Functional identity of proliferating cell nuclear antigen and a DNA polymerase-δ auxiliary protein. Nature 326, 517–520. Raucci, F., Fiore, M.M.D., Pinelli, C., D'Aniello, B., Luongo, L., Polese, G., Rastogi, R.K., 2006. Proliferative activity in the frog brain: a PCNA-immunohistochemistry analysis. J. Chem. Neuroanat. 32, 127–142. Rhee, W.J., Park, T.H., 2001. Flow cytometric analysis of the effect of silkworm hemolymph on the baculovirus-induced insect cell apoptosis. J. Microbiol. Biotechnol. 11, 853–857. Ruike, T., Takeuchi, R., Takata, K., Oshige, M., Kasai, N., Shimanouchi, K., Kanai, Y., Nakamura, R., Sugawara, F., Sakaguchi, K., 2006. Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster. FEBS J. 273, 5062–5073. Sahtout, A.H., Hassan, M.D., Shariff, M., 2001. DNA fragmentation, an indicator of apoptosis, in cultured black tiger shrimp Penaeus monodon infected with white spot syndrome virus (WSSV). Dis. Aquat. Org. 44, 155–159. Söderhäll, I., Bangyeekhun, E., Mayo, S., Söderhäll, K., 2003. Hemocyte production and maturation in an invertebrate animal; proliferation and gene expression in haematopoietic stem cells of Pacifastacus leniusculus. Dev. Comp. Immunol. 27, 661–672. Strzalka, W., Ziemienowicz, A., 2007. Molecular cloning of Phaseolus vulgaris cDNA encoding proliferating cell nuclear antigen. J. Plant Physiol. 164, 209–213. Tammariello, S.P., Denlinger, D.L., 1998. Cloning and sequencing of proliferating cell nuclear antigen (PCNA) from the flesh fly, Sarcophaga crassipalpis, and its expression in response to cold shock and heat shock. Gene 215, 425–429. Tsurimoto, T., 1998. PCNA, a multifunctional ring on DNA. Biochim. Biophys. Acta 1443, 23–39. Van de Braak, C.B., Botterblom, M.H., Huisman, E.A., Rombout, J.H., van der Knaap, W.P., 2002a. Preliminary study on haemocyte response to white spot syndrome virus infection in black tiger shrimp Penaeus monodon. Dis. Aquat. Org. 51, 149–155. Van de Braak, C.B.T., Botterblom, M.H.A., Liu, W., Taverne, N., van der Knaap, W.P.W., Rombout, J.H.W.M., 2002b. The role of the haematopoietic tissue in haemocyte production and maturation in the black tiger shrimp (Penaeus monodon). Fish Shellfish Immunol. 12, 253–272. Vital-Reyes, V., Rodríguez-Burford, C., Chhieng, D.C., Alvarado-Cabrero, I., ReyesFuentes, A., Grizzle, W.E., 2006. Ovarian expression of markers associated with proliferation or apoptosis in women with diminished ovarian reserve. Fertil. Steril. 86, 176–185. Wang, Y.T., Liu, W., Seah, J.N., Lam, C.S., Xiang, J.H., Korzh, V., Kwang, J., 2002. White spot syndrome virus (WSSV) infects specific hemocytes of the shrimp Penaeus merguiensis. Dis. Aquat. Org. 52, 249–259. Wang, B., Li, F., Dong, B., Zhang, X., Zhang, C., Xiang, J., 2006. Discovery of the genes in response to White Spot Syndrome Virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray. Mar. Biotechnol. 8, 491–500. Wongprasert, K., Khanobdee, K., Glunukarn, S.S., Meeratana, P., Withyachumnarnkul, B., 2003. Time-course and levels of apoptosis in various tissues of black tiger shrimp Penaeus monodon infected with white-spot syndrome virus. Dis. Aquat. Org. 55, 3–10. Wu, J.L., Muroga, K., 2004. Apoptosis does not play an important role in the resistance of ‘immune’ Penaeus japonicus against white spot syndrome virus. J. Fish Dis. 27, 15–21. Xiang, J.H., 2002. Over 10,000 expressed sequence tags from Fenneropenaeus chinensis. International Aquaculture Conference and Exposition, Beijing, pp. 101–102. Yamaguchi, M., Nishida, Y., Moriuchi, T., Hirose, F., Hui, C.C., Suzuki, Y., Matsukage, A., 1990. Drosophila proliferating cell nuclear antigen (cyclin) gene: structure, expression during development, and specific binding of homeodomain proteins to its 5′-flanking region. Mol. Cell. Biol. 10, 872–879. Yamaguchi, M., Hayashi, Y., Hirose, F., Matsuoka, S., Moriuchi, T., Shiroishi, T., Moriwaki, K., Matsukage, A., 1991. Molecular cloning and structural analysis of mouse gene and pseudogenes for proliferating cell nuclear antigen. Nucleic Acids Res. 19, 2403–2410. Zhang, Z.F., Shao, M.Y., Kang, K.H., 2005. Changes of enzyme activity and hematopoiesis in Chinese prawn Fenneropenaeus chinensis (Osbeck) induced by white spot syndrome virus and zymosan A. Aquacult. Res. 36, 674–681. Zhang, Z.F., Shao, M., Kang, K.H., 2006. Classification of haematopoietic cells and haemocytes in Chinese prawn Fenneropenaeus chinensis. Fish Shellfish Immunol. 21, 159–169.
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part B j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p b
Molecular cloning and characterization of proliferating cell nuclear antigen (PCNA) from Chinese shrimp Fenneropenaeus chinensis Yusu Xie a,b, Bing Wang a, Fuhua Li a,⁎, Hao Jiang a,b, Jianhai Xiang a,⁎ a b
Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, PR China Graduate School, Chinese Academy of Sciences, Beijing 100039, PR China
a r t i c l e
i n f o
Article history: Received 17 March 2008 Received in revised form 9 July 2008 Accepted 11 July 2008 Available online 16 July 2008 Keywords: Fenneropenaeus chinensis Haematopoietic tissue PCNA Vibrio challenge WSSV challenge
a b s t r a c t The proliferating cell nuclear antigen gene was cloned from Fenneropenaeus chinensis (FcPCNA). The fulllength cDNA sequence of FcPCNA encodes 260 amino acids showing high identity with PCNAs reported in other species. FcPCNA expressed especially high in proliferating tissues of shrimp such as haematopoietic tissue (HPT) and ovary. In order to understand the response of HPT to bacteria and virus challenge, mRNA level of FcPCNA in HPT was analyzed after shrimp were challenged by Vibrio anguillarum and white spot syndrome virus (WSSV). FcPCNA expression in HPT of shrimp was responsive to WSSV and Vibrio challenge, but different expression profiles were obtained after challenge by these two pathogens. The data provide additional information to understand the defense mechanisms of shrimp against virus and bacteria. © 2008 Elsevier Inc. All rights reserved.
1. Introduction Proliferating cell nuclear antigen (PCNA), initially identified as an auxiliary protein for mammalian DNA polymerase δ (Pol δ) (Bravo et al., 1987; Prelich et al., 1987), plays important roles in nucleic acid metabolism. As an essential component of the DNA replication machinery in cells, it is a eukaryotic DNA sliding clamp functionally analogous to the E. coli DNA polymerase III β-subunit and the phage T4 gene45 protein (Tsurimoto, 1998; Johnson and O'Donnell, 2005). Three identical PCNA monomers form a ring-shaped trimer in a headto-tail arrangement to encircle the double helix DNA in cooperation with the clamp loader RF-C, and functions as a processivity factor for DNA Pol δ and ε by clamping the polymerases on the DNA template to process DNA synthesis. In addition to functioning in DNA replication by interaction with proteins such as RF-C, Pol δ, Fen 1 and DNA ligase 1, PCNA can also interact with several other proteins such as p21, Gadd45, CDK2, cyclin D and DNA methyltransferase which are involved in DNA repair, cell-cycle control and chromatin remodeling (Kelman, 1997; Tsurimoto, 1998; Maga and Hübscher, 2003). Genes encoding PCNA and its homologues have been isolated from wide variety of species including mammals (Almendral et al., 1987; Matsumoto et al.,1987; Yamaguchi et al.,1991), insects (Yamaguchi et al., 1990; Tammariello and Denlinger,1998; Ruike et al., 2006), higher plants (López et al., 1995, 1997; Strzalka and Ziemienowicz, 2007), marine phytoplankton (Lin and Carpenter, 1998), fungi (Bauer and Burgers, ⁎ Corresponding authors. Li is to be contacted at Tel.: +86 532 82898571; fax: +86 532 82898578. Xiang, Tel.: +86 532 82898568; fax: +86 532 82898578. E-mail addresses: [email protected] (F. Li), [email protected] (J. Xiang). 1096-4959/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpb.2008.07.006
1990; Hamada et al., 2002), viruses (GenBank accession number: NP_046209, YP_473291) and archaeans (Iwai et al., 2000). PCNA is highly conserved both in function and sequence. It is an acidic, nonhistone nuclear protein with an apparent isoelectric point of 4.8–4.9 and molecular mass of 33–36 kDa. As its synthesis and expression is cellcycle dependent with the highest expression in dividing cells and little expression in quiescent cells (Bravo et al., 1987; Hamada et al., 2002; Liu et al., 2005), PCNA can be used to mark cell proliferation activity and is helpful to study the developmental processes for detection of dynamic changes during morphogenesis (Köhler et al., 2005) and haematopoiesis (Leung et al., 2005), estimation of marine phytoplankton growth rates (Liu et al., 2005), tracing cell proliferation during muscle growth (Martin and Johnston, 2005) and neurogenesis (Raucci et al., 2006), and can also be used as a biomarker in clinical studies for response to chemotherapy, prognosis and overall survival in cancer or other disease patients (Vital-Reyes et al., 2006; Lyshchik et al., 2007). White spot syndrome virus (WSSV) and Vibrio are regarded as major pathogens of shrimp diseases in aquaculture worldwide. During pathogen infection, the expression of immune related genes in shrimp can change (He et al., 2004, 2005; Wang et al., 2006; Liu et al., 2007), and also the total number of circulating haemocytes can vary distinctly (Van de Braak et al., 2002a; Wang et al., 2002; Wongprasert et al., 2003; Wu and Muroga, 2004; Hameed et al., 2006; Liu et al., 2007). The circulating haemocytes of crustaceans play important roles in the host immune response, performing functions as recognition, phagocytosis, melanization, encapsulation, cytotoxicity and cell–cell communication (Johansson et al., 2000; Lee and Söderhäll, 2002). The haematopoietic tissue (HPT), situated mainly on the dorsal side of the stomach, has been described in several crustacean species and
226
Y. Xie et al. / Comparative Biochemistry and Physiology, Part B 151 (2008) 225–229
commonly believed to be the haemocyte-producing organ (Johansson et al., 2000; Van de Braak et al., 2002b; Söderhäll et al., 2003; Zhang et al., 2006), although the regulation of haematopoiesis in crustacean is still not clearly understood. It is commonly agreed that there are tentative haematopoietic stem cells in the HPT, which can proliferate during a stimulation to increase release of new haemocytes from the HPT to the circulation. As the expression of PCNA might be closely related to cell proliferation, PCNA is potentially useful to mark cell proliferation activity in HPT. In the present study, we report the identification and characterization of the full-length cDNA encoding PCNA from Chinese shrimp Fenneropenaeus chinensis. To better understand the effect of pathogen stimulation on the HPT of shrimp, the expression of PCNA in HPT of F. chinensis was analyzed when shrimp were challenged by Vibrio anguillarum and WSSV. 2. Materials and methods
at 58 °C for 1 min and extension at 72 °C for 1 min; followed by 1 cycle of 72 °C for 10 min. PCR products were isolated on a 1.2% agarose gel, purified by PCR purification kit (Promega, USA), and cloned into pMD18-T vector (TaKaRa, Dalian), then transformed into E. coli TOP 10, the positive transformants were screened by PCR and then sequenced. Based on the partial sequence of FcPCNA, the 5′- and 3′-ends were obtained by semi-nested PCR approaches using two gene specific primers and adapter primers. For 5′-end PCR, cDNA template used was from the ovary cDNA library of F. chinensis, the PCR reaction was performed with gene specific primer PCNA-r1 and an anchor primer T3 (5′-ATTAACCCTCACTAAAGGGA-3′), followed by semi-nested PCR with T3 and another PCNA specific primer PCNA-r2 (5′-CCTTGTCTACACTGGAGGTCTG-3′). For 3′-end PCR, PCR was performed with gene specific primer PCNA-f1 and adapter primer AP (5′-GGCCACGCGTCGACTAGTAC-3′) using ovary cDNA as template, and then semi-nested PCR was carried out with another PCNA specific primer PCNA-f2 (5′CAGCAGCAGGAGACATTGGTA-3′) and AP. The PCR products were gelpurified and sequenced as described above.
2.1. Animals 2.5. Sequence analysis The Chinese shrimp F. chinensis with a body length of 10 ± 0.5 cm were purchased from a local shrimp farm and reared in 8 m3 fiber glass tanks in which the salinity and temperature of the seawater were maintained similar to those of the shrimp culture ponds. Shrimp were fed with clam meat for a week and acclimated to laboratory conditions. Shrimp haemolymph was collected from the ventral sinus located at the first abdominal segment and mixed with an equal volume of modified Alsevier solution anticoagulant (Bachère et al., 1988), and centrifuged for 10 min at 800 ×g, 4 °C. Haemocyte pellets and shrimp tissues were preserved in liquid nitrogen immediately for RNA extraction.
The cloned sequence was analyzed for the identity and similarity with other known sequences by NCBI BLAST search program. The multiple sequence alignments were performed on amino acid sequences of known PCNA molecules using CLUSTAL W. 2.6. Tissue distribution of FcPCNA
In the challenging experiment, each WSSV-challenged and bacteria-challenged (V. anguillarum) group was injected with 20 μL tissue homogenate in PBS from WSSV infected shrimp and 20 μL PBS containing inactive bacteria (107 CFU mL− 1), respectively; and control group was injected with 20 μL sterile PBS. The HPTs of eight shrimp from each group were collected for quantitative real-time PCR at each sampling point, 0, 3, 6, 12, 24, 48, 72 and 96 h after challenge and preserved in liquid nitrogen immediately for RNA extraction.
Semi-quantitative RT-PCR was employed to study the expression of FcPCNA in various shrimp tissues (testis, ovary, haemocytes, gill, intestine, hepatopancreas, muscle, stomach, HPT, heart, lymphoid organ and nerve). The target gene specific primers PCNA-f1, 5′ATCAAGGACCTGCTGAACGA-3′, and PCNA-r2, 5′-CCTTGTCTACACTGGAGGTCTG-3′, were used to generate a fragment of 517 bp. The PCR conditions were 94 °C for 4 min; 94 °C for 50 s, 58 °C for 50 s, 72 °C for 50 s, 29 cycles; 10 min extension at 72 °C. The F. chinensis β-actin, amplified using primers actin-f, 5′-AGTAGCCGCCCTGGTTGTAGA-3′, and actin-r, 5′-TTCTCCATGTCGTCCCAG-3′, was used as internal standard gene. The PCR conditions were 94 °C for 4 min; 94 °C for 50 s, 58 °C for 50 s, 72 °C for 50 s, 26 cycles; 10 min extension at 72 °C. PCR products were analyzed on 2% agarose gel, stained with ethidium bromide and visualized under ultraviolet light.
2.3. RNA extraction and cDNA synthesis
2.7. Quantification of FcPCNA mRNA expression in HPT by real-time PCR
Total RNA was extracted from hepatopancreas, haemocytes, lymphoid organ, heart, stomach, intestine, nerve, ovary, testis, muscle, HPT and gill using Unizol Reagent (BioStar, Shanghai) following the manufacturer's protocol. RNA quality was assessed by electrophoresis on 1.2% agarose gel. Total RNA was treated with RQ1 RNase-Free DNase (Promega, USA) to remove contaminating DNA from the total RNA and cDNA was synthesized from 2 μg total RNA by M-MLV reverse transcriptase (Promega, USA) following the manufacturer's protocol with oligo(dT) primer AOLP (5′GGCCACGCGTCGACTAGTAC (T)16(A/C/G)-3′).
The expression of FcPCNA in F. chinensis HPT in response to bacteria and virus challenge was measured by quantitative real-time PCR. The primers of target gene were pReal-F (5′-CACAGGTTTCGCTTTCCA-3′) and pReal-R (5′-CGAGTCTTCGTCCTCAATC-3′), generating a segment of 113 bp. As the expression of β-actin varied when shrimp were challenged by WSSV, F. chinensis triosephosphate isomerase (TPI) was used as internal control (Wang et al., 2006) to verify the quantitative real-time PCR reaction. The primers of internal control gene were TPI-F (5′-GAGGCTAACCGCACCCA-3′) and TPI-R (5′-ACAAAGTCTGGCTTGAGTGATG-3′), producing a fragment of 320 bp. The SYBR Green real-time PCR assay was carried out on a Mastercycler ep realplex 4S (Eppendorf, Germany) using Blend TaqPlus-PCR reaction system (TOYOBO). Each sample was run in triplicates as well as for the internal control gene. Briefly, the cycling conditions were as follows: for PCNA, 94 °C for 2 min followed by 40 cycles of 94 °C for 20 s, 61.5 °C for 20 s and 72 °C for 20 s; for TPI, 94 °C for 2 min followed by 40 cycles of 94 °C for 20 s, 58 °C for 30 s and 72 °C for 30 s. Gene expression was presented using a modification of the 2− ΔΔCt method as described by Livak and Schmittgen (2001). Data were statistically analyzed by one-way analysis of variance (one-way
2.2. WSSV and Vibrio challenge experiment
2.4. Cloning and sequencing of F. chinensis PCNA (FcPCNA) An EST homologous to PCNA was found from the cephalothorax cDNA library of F. chinensis (Xiang, 2002). To verify the result of PCNAlike EST, we designed a pair of primers, PCNA-f1 (5′-ATCAAGGACCTGCTGAACGA-3′) and PCNA-r1 (5′-CAAGAAGTAACGGATGTGGC-3′) based on the above EST sequence. PCR amplification was performed using the cDNA template from the cephalothorax cDNA library, the PCR conditions were as follows: 1 cycle of 94°C for 5 min; 35 cycles including denaturation at 94 °C for 1 min, annealing
Y. Xie et al. / Comparative Biochemistry and Physiology, Part B 151 (2008) 225–229
227
Fig. 1. Multiple alignments of the deduced amino acid sequence of FcPCNA with other known PCNAs. F. chinensis (EF051247), D. melanogaster (NP_476905), B. mori (NP_001036825), H. sapiens (NP_002583), M. musculus (NP_035175), R. norvegicus (NP_071776). Residues in black background indicate higher levels of amino acid similarity. The center loop, the interdomain connecting loop and the C-terminal tail, known to be important for interaction of PCNA-binding proteins, are indicated.
ANOVA) using SPSS software 11.0; values were considered to be significant at P b 0.05.
isoelectric point of 4.59. Multiple alignments of FcPCNA with that of other species showed high conservation (Fig. 1). The BLAST results (Table 1) of the deduced amino acid sequence of FcPCNA showed that the
3. Results 3.1. Cloning of FcPCNA cDNA from F. chinensis The full-length FcPCNA cDNA obtained from F. chinensis was 1106 bp (GenBank accession no. EF051247) in length, containing a 783 bp ORF, a 101 bp 5′ untranslated region and a 225 bp 3′ untranslated region including a stop codon (TAA). It encoded a predicted product of 260 amino acids with a molecular mass of 28.8 kDa and a theoretical
Table 1 The BLAST results of the deduced amino acid sequence of FcPCNA showing relationship with other known PCNAs Organism
Accession number
E value
Identities (BLASTP)
Drosophila melanogaster Sarcophaga crassipalpis Bombyx mori Mus musculus Homo sapiens Rattus norvegicus Xenopus laevis Danio rerio Styela clava
NP_476905 O16852 NP_001036825 NP_035175 NP_002583 NP_071776 P18248 NP_571479 P53358
1.00E−125 8.00E−125 7.00E−123 4.00E−116 8.00E−116 1.00E−115 2.00E−115 4.00E−107 6.00E−102
80% 79% 80% 73% 73% 73% 73% 68% 66%
Fig. 2. Expression of FcPCNA in different tissues of shrimp. (a): Electrophoresis results of FcPCNA and β-actin expression in different tissues. (b): The abundance of FcPCNA mRNA was normalized with β-actin mRNA, and shown as relative gene expression + standard deviations (SD), each in triplicate.
228
Y. Xie et al. / Comparative Biochemistry and Physiology, Part B 151 (2008) 225–229
sequence obtained is closest to arthropods compared to other organisms. Furthermore, several important conserved structural domains of eukaryotic PCNA were identified in the deduced amino acid sequence, such as the interdomain connecting loop which interacts with DNA polymerase δ, Fen-1, p21, a C-terminal tail which interacts with replication factor C (RF-C), DNA polymerase ε, CDK2 and GADD45, and the center loop which interacts with RF-C and DNA polymerase δ. 3.2. Tissue distribution of FcPCNA The mRNA transcripts indicated that FcPCNA was widely expressed in all examined tissues with different expression levels (Fig. 2). FcPCNA expressions were poor in nerve, haemocytes and heart, relatively higher in intestine, gill, stomach, muscle, lymphoid organ and hepatopancreas, and strong in ovary, HPT and testis. The expression levels of FcPCNA in the ovary and HPT are nearly 7-fold higher than that in the nerve. 3.3. Expression profiles of FcPCNA in HPT after challenge Expression profiles of FcPCNA in HPT of shrimp injected with inactivated V. anguillarum (Vibrio-challenged group) or PBS (control group) are shown in Fig. 3a. The mRNA level of FcPCNA in Vibriochallenged group was noticeably different from the control group in which FcPCNA expression level in HPT remained much more stable. At 6, 24, 72 and 96 h post-Vibrio injection, the expression levels of FcPCNA are apparently up-regulated compared with those in the control group (P b 0.05). At the other sampling points (3, 12, 48 h postinjection), there is no difference at the expression levels of FcPCNA in HPT between Vibrio-challenged group and control group. However, the expression profile of FcPCNA in HPT of shrimp after WSSV challenge (Fig. 3b) was distinct from that in shrimp injected with V. anguillarum. Compared to the control group, the expression of FcPCNA in HPT showed a down-regulation at 3 h post-WSSV injection. At 6 and 12 h post-injection, its expression showed a significant upregulation in WSSV-challenged shrimp. At 24 h, the expression level of FcPCNA showed no difference compared with that in the control group, while it showed up-regulation in WSSV-challenged shrimp at 48 h, and then restored to the same level with that in the control group at 72 h post-injection. At 96 h, no shrimp survived in WSSVchallenged group.
Fig. 3. Relative FcPCNA expression levels (2− ΔΔCt) in HPT at different time intervals postVibrio anguillarum (a) and post-WSSV injection (b). Bars represented the mean+SD (n =3). Significant differences (Pb 0.05) of FcPCNA expression between the infected and the same control at each sampling point were indicated with asterisks, respectively.
4. Discussion In this study, a full-length cDNA of PCNA was successfully cloned from Chinese shrimp F. chinensis. To our knowledge, this is the first full-length cDNA of PCNA cloned from a crustacean. Several typical conserved structural domains of eukaryotic PCNA, such as the interdomain connecting loop, a C-terminal tail and the center loop, were identified in FcPCNA. These domains are essential for the functions of PCNA in DNA replication and other nucleic acid metabolism (Tsurimoto, 1998; Maga and Hübscher, 2003). Analysis of deduced amino acid sequence of FcPCNA showed high conservation to that of Drosophila melanogaster, Bombyx mori and other species. The molecular characteristics of FcPCNA suggested that it might play very important roles in DNA replication and cell-cycle control as reported in other organisms. When studying the tissue distribution of FcPCNA, its expression is high in proliferating tissues including HPT, which was regarded as a vigorously proliferating tissue in freshwater crayfish (Söderhäll et al., 2003), ovary and testis, while almost no expression is noted in nerve which is known to have little proliferation activity. Based on its important roles in cell proliferation, PCNA has been used for prognosis of tumor and cancer development in human (Lee et al., 1995). In zebrafish Danio renio, PCNA can be used to mark cell proliferation in HPT and to identify a population of progenitor cells (Leung et al., 2005). In marine dinoflagellate Prorocentrum donghaiense and green algae Dunaliella salina, it was reported that PCNA could be taken as a marker of cell proliferation (Liu et al., 2005). Present data showed that the expression level of FcPCNA in shrimp is closely related to proliferation activity of tissues, FcPCNA is possible to be taken as a marker of cell proliferation. It is generally agreed that the HPT is responsible for production and supply of haemocytes. When shrimp were injected by inactivated V. anguillarum, the expression of FcPCNA is up-regulated at 6, 24, 72, and 96 h compared with that of control group at the same sampling points. So we inferred that the inactivated Vibrio might stimulate the proliferation activity of HPT cells. It was already reported that the mitotic index of HPT in zymogen injection group was significantly higher than that of control group in F. chinensis (Zhang et al., 2005). In tiger shrimp Penaeus monodon, the mitotic index of HPT in LPS injection group was significantly higher at 24 h and 48 h compared to the PBS injection group (Van de Braak et al., 2002a). In freshwater crayfish Pacifastacus leniusculus, injection of the β-1,3-glucan laminarin can stimulate the maturation of haematopoietic stem cells within the HPT and new haemocytes were released into the circulation (Söderhäll et al., 2003). Different expression profiles of FcPCNA were obtained when shrimp were challenged by WSSV. At 3 h post-WSSV challenge, the expression of FcPCNA in HPT of shrimp is down-regulated compared with that of control group at the same time. However, it showed upregulation at 6 and 12 h post-WSSV injection compared with that of control. The data indicated that WSSV might inhibit the proliferation activity of HPT at the early stage of infection. Then the shrimp might produce a series of immune reaction to fight the virus. The upregulation of FcPCNA expression at 6, 12, and 48 h might indicate the protection mechanism of shrimp to fight against WSSV through active proliferation of HPT cells. The different expression profiles of FcPCNA in HPT caused by Vibrio or WSSV might indicate different immune defense mechanism of shrimp response to different types of pathogen. Since the number of free haemocytes can vary during infection, new haemocytes need to be compensatorily and proportionally produced at varying rates from HPT. Although there were no shrimp left at 96 h post-WSSV challenge, the expression level of FcPCNA was still as high as that of the control group at 72 h. In general, shrimp needs more haemocytes to fight against WSSV replication. It has been considered that apoptosis is the main anti-viral mechanism in invertebrates (Rhee and Park, 2001; Hameed et al., 2006), which was suggested as the primary cause of death in virus-infected shrimp (Sahtout et al., 2001;
Y. Xie et al. / Comparative Biochemistry and Physiology, Part B 151 (2008) 225–229
Khanobdee et al., 2002). The high expression of FcPCNA in HPT after Vibrio or WSSV challenge suggests that more haemocytes will be produced from HPT. The relationship between the active proliferation of HPT cells and compensation of haemocytes in the haemolymph of shrimp needs further study to clarify the mechanism of haemocytes production during pathogen challenge. Acknowledgements This work was financially supported by Major State Basic Research Development Program of China (973 program) 2006CB101804, HighTech Research and Development Program of China (863 program) 2006AA09Z424 and General Program of National Natural Science Foundation of China 30471347. References Almendral, J.M., Huebsch, D., Blundell, P.A., Macdonald-Bravo, H., Bravo, R., 1987. Cloning and sequence of the human nuclear protein cyclin: homology with DNA-binding proteins. Proc. Natl. Acad. Sci. USA 84, 1575–1579. Bachère, E., Chagot, D., Grizel, H., 1988. Separation of Crassostrea gigas hemocytes by density gradient centrifugation and counterflow centrifugal elutriation. Dev. Comp. Immunol. 12, 549–559. Bauer, G.A., Burgers, P.M.J., 1990. Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene. Nucleic Acids Res. 18, 261–265. Bravo, R., Frank, R., Blundell, P.A., Macdonald-Bravo, H., 1987. Cyclin/PCNA is the auxiliary protein of DNA polymerase-δ. Nature 326, 515–517. Hamada, F., Namekawa, S., Kasai, N., Nara, T., Kimura, S., Sugawara, F., Sakaguchi, K., 2002. Proliferating cell nuclear antigen from a basidiomycete, Coprinus cinereus. Eur. J. Biochem. 269, 164–174. Hameed, A.S.S., Sarathi, M., Sudhakaran, R., Balasubramanian, G., Musthaq, S.S., 2006. Quantitative assessment of apoptotic hemocytes in white spot syndrome virus (WSSV)-infected penaeid shrimp, Penaeus monodon and Penaeus indicus, by flow cytometric analysis. Aquaculture 256, 111–120. He, N., Liu, H., Xu, X., 2004. Identification of genes involved in the response of haemocytes of Penaeus japonicus by suppression subtractive hybridization (SSH) following microbial challenge. Fish Shellfish Immunol. 17, 121–128. He, N., Qin, Q., Xu, X., 2005. Differential profile of genes expressed in hemocytes of White Spot Syndrome Virus-resistant shrimp (Penaeus japonicus) by combining suppression subtractive hybridization and differential hybridization. Antivir. Res. 66, 39–45. Iwai, T., Kurosawa, N., Itoh, Y.H., Horiuchi, T., 2000. Phylogenetic analysis of archaeal PCNA homologues. Extremophiles 4, 357–364. Johansson, M.W., Keyser, P., Sritunyalucksana, K., Söderhäll, K., 2000. Crustacean haemocytes and haematopoiesis. Aquaculture 191, 45–52. Johnson, A., O'Donnell, M., 2005. Cellular DNA replicases: components and dynamics at the replication fork. Annu. Rev. Biochem. 74, 283–315. Kelman, Z., 1997. PCNA: structure, functions and interactions. Oncogene 14, 629–640. Khanobdee, K., Soowannayan, C., Flegel, T.W., Ubol, S., Withyachumnarnkul, B., 2002. Evidence for apoptosis correlated with mortality in the giant black tiger shrimp Penaeus monodon infected with yellow head virus. Dis. Aquat. Org. 48, 79–90. Köhler, T., Pröls, F., Brand-Saberi, B., 2005. PCNA in situ hybridization: a novel and reliable tool for detection of dynamic changes in proliferative activity. Histochem. Cell Biol. 123, 315–327. Lee, S.Y., Söderhäll, K., 2002. Early events in crustacean innate immunity. Fish Shellfish Immunol. 12, 421–437. Lee, C.S., Redshaw, A., Boag, G., 1995. Assessment of cell proliferation in human laryngeal cancers using PCNA and Ki-67 antigen immunostaining. Cell Vis. 2, 296–300. Leung, A.Y.H., Leung, J.C.K., Chan, L.Y.Y., Ma, E.S.K., Kwan, T.T.F., Lai, K.N., Meng, A., Liang, R., 2005. Proliferating cell nuclear antigen (PCNA) as a proliferative marker during embryonic and adult zebrafish hematopoiesis. Histochem. Cell Biol. 124, 105–111. Lin, S., Carpenter, E.J., 1998. Identification and preliminary characterization of PCNA gene in the marine phytoplankton Dunaliella tertiolecta and Isochrysis galbana. Mol. Mar. Biol. Biotechnol. 7, 62–71. Liu, J., Jiao, N., Hong, H., Luo, T., Cai, H., 2005. Proliferating cell nuclear antigen (PCNA) as a marker of cell proliferation in the marine dinoflagellate Prorocentrum donghaiense Lu and the green alga Dunaliella salina Teodoresco. J. Appl. Phycol. 17, 323–330. Liu, Y.C., Li, F.H., Dong, B., Wang, B., Luan, W., Zhang, X.J., Zhang, L.S., Xiang, J.H., 2007. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol. Immunol. 44, 598–607. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCt method. Methods 25, 402–408. López, I., Khan, S., Vázquez-Ramos, J., Hussey, P.J., 1995. Molecular cloning of a maize cDNA clone encoding a putative proliferating cell nuclear antigen. Biochim. Biophys. Acta 1260, 119–121.
229
López, I., Khan, S., Vázquez, J., Hussey, P.J., 1997. The proliferating cell nuclear antigen (PCNA) gene family in Zea mays is composed of two members that have similar expression programmes. Biochim. Biophys. Acta 1353, 1–6. Lyshchik, A., Higashi, T., Hara, T., Nakamoto, Y., Fujimoto, K., Doi, R., Imamura, M., Saga, T., Togashi, K., 2007. Expression of glucose transporter-1, hexokinase-II, proliferating cell nuclear antigen and survival of patients with pancreatic cancer. Cancer Investig. 25, 154–162. Maga, G., Hübscher, U., 2003. Proliferating cell nuclear antigen (PCNA): a dancer with many partners. J. Cell. Sci. 116, 3051–3060. Martin, C.I., Johnston, I.A., 2005. The molecular regulation of exercised-induced muscle fibre hypertrophy in the common carp: expression of MyoD, PCNA and components of the calcineurin-signalling pathway. Comp. Biochem. Physiol. B 142, 324–334. Matsumoto, K., Moriuchi, T., Koji, T., Nakane, P.K., 1987. Molecular cloning of cDNA coding for rat proliferating cell nuclear antigen (PCNA)/cyclin. EMBO J. 6, 637–642. Prelich, G., Tan, C.K., Kostura, M., Mathews, M.B., So, A.G., Downey, K.M., Stillman, B., 1987. Functional identity of proliferating cell nuclear antigen and a DNA polymerase-δ auxiliary protein. Nature 326, 517–520. Raucci, F., Fiore, M.M.D., Pinelli, C., D'Aniello, B., Luongo, L., Polese, G., Rastogi, R.K., 2006. Proliferative activity in the frog brain: a PCNA-immunohistochemistry analysis. J. Chem. Neuroanat. 32, 127–142. Rhee, W.J., Park, T.H., 2001. Flow cytometric analysis of the effect of silkworm hemolymph on the baculovirus-induced insect cell apoptosis. J. Microbiol. Biotechnol. 11, 853–857. Ruike, T., Takeuchi, R., Takata, K., Oshige, M., Kasai, N., Shimanouchi, K., Kanai, Y., Nakamura, R., Sugawara, F., Sakaguchi, K., 2006. Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster. FEBS J. 273, 5062–5073. Sahtout, A.H., Hassan, M.D., Shariff, M., 2001. DNA fragmentation, an indicator of apoptosis, in cultured black tiger shrimp Penaeus monodon infected with white spot syndrome virus (WSSV). Dis. Aquat. Org. 44, 155–159. Söderhäll, I., Bangyeekhun, E., Mayo, S., Söderhäll, K., 2003. Hemocyte production and maturation in an invertebrate animal; proliferation and gene expression in haematopoietic stem cells of Pacifastacus leniusculus. Dev. Comp. Immunol. 27, 661–672. Strzalka, W., Ziemienowicz, A., 2007. Molecular cloning of Phaseolus vulgaris cDNA encoding proliferating cell nuclear antigen. J. Plant Physiol. 164, 209–213. Tammariello, S.P., Denlinger, D.L., 1998. Cloning and sequencing of proliferating cell nuclear antigen (PCNA) from the flesh fly, Sarcophaga crassipalpis, and its expression in response to cold shock and heat shock. Gene 215, 425–429. Tsurimoto, T., 1998. PCNA, a multifunctional ring on DNA. Biochim. Biophys. Acta 1443, 23–39. Van de Braak, C.B., Botterblom, M.H., Huisman, E.A., Rombout, J.H., van der Knaap, W.P., 2002a. Preliminary study on haemocyte response to white spot syndrome virus infection in black tiger shrimp Penaeus monodon. Dis. Aquat. Org. 51, 149–155. Van de Braak, C.B.T., Botterblom, M.H.A., Liu, W., Taverne, N., van der Knaap, W.P.W., Rombout, J.H.W.M., 2002b. The role of the haematopoietic tissue in haemocyte production and maturation in the black tiger shrimp (Penaeus monodon). Fish Shellfish Immunol. 12, 253–272. Vital-Reyes, V., Rodríguez-Burford, C., Chhieng, D.C., Alvarado-Cabrero, I., ReyesFuentes, A., Grizzle, W.E., 2006. Ovarian expression of markers associated with proliferation or apoptosis in women with diminished ovarian reserve. Fertil. Steril. 86, 176–185. Wang, Y.T., Liu, W., Seah, J.N., Lam, C.S., Xiang, J.H., Korzh, V., Kwang, J., 2002. White spot syndrome virus (WSSV) infects specific hemocytes of the shrimp Penaeus merguiensis. Dis. Aquat. Org. 52, 249–259. Wang, B., Li, F., Dong, B., Zhang, X., Zhang, C., Xiang, J., 2006. Discovery of the genes in response to White Spot Syndrome Virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray. Mar. Biotechnol. 8, 491–500. Wongprasert, K., Khanobdee, K., Glunukarn, S.S., Meeratana, P., Withyachumnarnkul, B., 2003. Time-course and levels of apoptosis in various tissues of black tiger shrimp Penaeus monodon infected with white-spot syndrome virus. Dis. Aquat. Org. 55, 3–10. Wu, J.L., Muroga, K., 2004. Apoptosis does not play an important role in the resistance of ‘immune’ Penaeus japonicus against white spot syndrome virus. J. Fish Dis. 27, 15–21. Xiang, J.H., 2002. Over 10,000 expressed sequence tags from Fenneropenaeus chinensis. International Aquaculture Conference and Exposition, Beijing, pp. 101–102. Yamaguchi, M., Nishida, Y., Moriuchi, T., Hirose, F., Hui, C.C., Suzuki, Y., Matsukage, A., 1990. Drosophila proliferating cell nuclear antigen (cyclin) gene: structure, expression during development, and specific binding of homeodomain proteins to its 5′-flanking region. Mol. Cell. Biol. 10, 872–879. Yamaguchi, M., Hayashi, Y., Hirose, F., Matsuoka, S., Moriuchi, T., Shiroishi, T., Moriwaki, K., Matsukage, A., 1991. Molecular cloning and structural analysis of mouse gene and pseudogenes for proliferating cell nuclear antigen. Nucleic Acids Res. 19, 2403–2410. Zhang, Z.F., Shao, M.Y., Kang, K.H., 2005. Changes of enzyme activity and hematopoiesis in Chinese prawn Fenneropenaeus chinensis (Osbeck) induced by white spot syndrome virus and zymosan A. Aquacult. Res. 36, 674–681. Zhang, Z.F., Shao, M., Kang, K.H., 2006. Classification of haematopoietic cells and haemocytes in Chinese prawn Fenneropenaeus chinensis. Fish Shellfish Immunol. 21, 159–169.