Molecular cloning and characterization of three cDNAs encoding allatostatin-like neurosecretory peptides from Pandalopsis japonica

Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Molecular cloning and characterization of three cDNAs encoding allatostatin-like neurosecretory peptides from Pandalopsis japonica☆ Umme Salma a, Yeon-Hwa Jang a, Md. Hasan Uddowla a, Myunggi Yi b, Seung Pyo Gong c, Hyi-Seung Lee d, Hyun-Woo Kim a,⁎ a

Department of Marine Biology, Pukyong National University, Busan 608-737, Republic of Korea Department of Biomedical Engineering, Pukyong National University, Busan 608-737, Republic of Korea Department of Marine Bio-Materials and Aquaculture, Pukyong National University, Busan 608-737, Republic of Korea d Marine Natural Products Laboratory, Korea Ocean Research & Development Institute, Ansan PO Box 29, Seoul 425-600, Republic of Korea b c

a r t i c l e

i n f o

Article history: Received 10 May 2012 Received in revised form 3 September 2012 Accepted 4 September 2012 Available online 8 September 2012 Keywords: Methyl farnesoate Crustacean Pandalopsis japonica Myoinhibitory peptide Allatostatin

a b s t r a c t Three cDNAs encoding allatostatin-like peptides (two myoinhibitory peptides; Paj-MIPI and Paj-MIPII, and one C-type AST; Paj-ASTC) were identified from Pandalopsis japonica through a combination of bioinformatic analysis and PCR-based gene cloning strategy. Paj-MIPI and Paj-MIPII encoded proteins with 189 and 117 amino acid residues, respectively, and a total of 10 mature peptides are putatively produced from the two MIP cDNAs (seven from Paj-MIPI and three from Paj-MIPII). Among the MIPs from various arthropods, their size and organization varied and it was unable to establish the monophyletic evolutionary relationship, which is mainly due to difference in the number and location of the mature peptide W(X6)W motif of each MIP gene. Based on the sequence similarity of six residues flanked by two conserved tryptophan (W) residues, crustacean MIPs could be further classified into at least four groups. Paj-ASTC cDNA (648 bp) encoded a protein with 143 amino acid residues. The prepropeptide of Paj-ASTC showed conserved C-type AST characteristics including a signal sequence, two dibasic cleavage sites, and a mature peptide sequence with two cysteine residues at the 7th and 14th positions, creating a disulfide bridge. Based on the sequence similarity in the mature peptides, the ASTCs in arthropods could be further classified into two subgroups, AVSCF-ASTC and PISCF-ASTC. Phylogenetic and sequence similarity analysis showed that Paj-ASTC belonged to the PISCF-ASTC subgroup. Expression studies revealed that AST-like peptides from P. japonica were mainly expressed in neuronal tissues, and the expression of Paj-ASTC was also detected in the intestine. Eyestalk ablation (ESA) altered the mRNA expression levels of both Paj-MIPs and Paj-ASTC, suggesting that factors from the sinus gland/X organ complex had a transient effect on AST-like peptide transcription. Correlation analysis of three allatostatin-like peptides revealed a strong positive correlation in brain tissues, suggesting that transcriptional regulation of three allatostatin-like peptides from P. japonica is influenced by the similar physiological condition. © 2012 Elsevier Inc. All rights reserved.

1. Introduction The allatostatins (ASTs) are pleiotropic neuropeptides that are found mostly in arthropods, including insects and crustacean species. They were first identified and characterized in the insect Diploptera punctata (Pratt et al., 1989; Woodhead et al., 1989). Several hundred ASTs and AST-like peptides have been subsequently identified in insects and crustaceans (Stay and Tobe, 2007). AST peptides have been classified into three types of family members based on conserved structural characteristics. The first peptide group is the FGLamide or A-type family (FGLa/ ASTs), in which the conserved pentapeptide sequence (Y/F)XFG(L/I) ☆ This work was supported by the Ministry of Land, Transport and 426 Maritime Affairs, Republic of Korea (PM55420). ⁎ Corresponding author: Tel.: +82 51 629 5926; fax: +82 51 629 5930. E-mail address: [email protected] (H.-W. Kim). 1096-4959/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cbpb.2012.09.001

amide is found at the carboxy-terminus (Woodhead et al., 1989). Since this type of peptide was first characterized in cockroaches, they are also called cockroach-type ASTs. The second peptide group (B-type) was first isolated from crickets, which have a common carboxyterminal W(X6)W amide (Lorenz et al., 1995a). The first C-type AST peptide, pQVRFRQCYFNPISCF-COOH (PISCF-ASTC), was identified in the tobacco hornworm, Manduca sexta (Kramer et al., 1991). Later, a second C-type AST, SYWKQCAFNAVSCFamide (AVSCF-ASTC), was isolated from the honeybee, Apis mellifera (Hummon et al., 2006). Although identification of these three types of ASTs was performed using different species, recent genome-wide studies have found that all three types of ASTs exist in most insect species, with several exceptions (Stay and Tobe, 2007). In addition, genomic analysis of ASTC genes identified a paralog of ASTC genes called ASTCC, which is clustered to ASTC gene on the chromosomes of several insects (Veenstra, 2009). More recently, the consensus nomenclature for insect neuropeptides proposed that the

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

B-type ASTs are no more eligible for this classification since they were originally reported as the family of myoinhibitory peptides (MIPs) and they were shown to have very limited allatostatic activity in some species (Coast and Schooley, 2011). Since allatostatic activity of crustacean B-type AST homologs is still unknown, we classified the crustacean B-type ASTs into AST-like peptide group but MIP was used in this study in respect to the previous insect AST nomenclature. Despite the structural differences of the ASTs, they share common biological functions, altering the production of insect juvenile hormone (JH) species-specifically. Although all three types of AST-like peptides are identified in most insect species, they do not always exhibit allatostatic functions. FGLa/ASTs act as true ASTs only in cockroaches, crickets, and termites (Yagi et al., 2008; Weaver and Audsley, 2009). The allatostatic activity of MIPs was only detected in the order Ensifera including Gryllus bimaculatus (Weaver and Audsley, 2009), and ASTCs act only in Lepidoptera and Diptera species, including M. sexta and Aedes aegypti (Kramer et al., 1991; Li et al., 2006). In addition to their allatostatic functions, all AST peptides exhibit a variety of additional species-specific pleiotropic activities (Blackburn et al., 1995; Hua et al., 1999; Stay, 2000). FGLa/ASTs show multiple inhibitory functions in insects. Inhibition of muscle contraction was shown in the foregut (Duve et al., 1995) and hindgut (Lange et al., 1993) of cockroaches and in the ileum of blowflies (Duve and Thorpe, 1994). Inhibition of peristaltic movement of the oviduct was also detected in the locust Schistocerca gregaria (Veelaert et al., 1996). FGLa/ASTs affected egg development by inhibiting vitellogenin production and its release from the periovarian fat body in the cockroach, Blattella germanica (Martin et al., 1996). MIPs exerted as myoinhibitory activities in locusts, Locusta migratoria and were found to be present in moth, M. sexta. They also inhibit spontaneous contractions of the hindgut and oviduct of L. migratoria (Schoofs et al., 1991) and significantly reduce the peristalsis rate of M. sexta (Blackburn et al., 1995). Another MIP from Bombyx mori (Bom-PTSP) acts as a prothoracicostatic peptide by interfering with ecdysteroid biosynthesis in the prothoracic gland (PG) (Hua et al., 1999). The C-type AST of the fruit fly Drosophila melanogaster appeared to have an inhibitory effect on muscle contraction and decreased the heart rate (Price et al., 2002). These data indicated that all three types of ASTs act as pleiotropic peptides in insect species. In addition to insect species, it appears that all types of AST-like peptides exist in crustaceans. Genomic and proteomic studies identified all three types of ASTs in the primitive crustacean, Daphnia pulex (Dircksen et al., 2011). Until now, approximately 100 FGLa/AST peptides have been identified from four decapod crustaceans and one primitive copepod crustacean species, including three peptides from crayfish Orconectes limosus (Dircksen et al., 1999), 20 peptides from the crab Carcinus maenas (Duve et al., 1997), 40 peptides from the tiger prawn Penaeus monodon (Duve et al., 2002), 35 from fresh water prawn Macrobrachium rosenbergii (Yin et al., 2006), and 7 from the copepod Calanus finmarchicus (Christie et al., 2008b). As compared with FGLa/ ASTs, fewer MIP and ASTC peptides have been identified. A total of 10 MIP peptides were identified in the pericardial organs (PO) of Cancer borealis by mass spectrometry (Ma et al., 2009c), and 13 MIP peptides were also isolated from the central nervous system and neuroendocrine organs (brain, thoracic ganglia, and PO) of the European green crab C. maenas (Ma et al., 2009a). As shown for ASTCs in insects, two structurally different ASTCs were identified in the crustaceans. The existence of PISCF-ASTC peptides was identified by MALDI-FTMS in six decapod crustaceans, including infraorder: Stenopodidea, Astacidea, Thalassinidea, Achelata, Anomura, and Brachyura (Stemmler et al., 2010). AVSCFASTC peptides were also identified in five other decapods, including infraorder: Astacidea, Achelata, Anomura, Brachyura, and Thalassinidea (Dickinson et al., 2009). Although all three types of AST-like peptides are known to be present in decapods, little information is available regarding the characteristics of the genes encoding the three types of allatostatin homologs

335

and their transcriptional regulation. Currently, a few nucleotide sequences are available as a result of bioinformatic analyses of expressed sequence tags (EST). These include single transcripts of MIP from Marsupenaeus japonicus and D. pulex and ASTCs from Litopenaeus vannamei, Homarus americanus, and D. pulex (Christie et al., 2008a; Dickinson et al., 2009; Gard et al., 2009; Ma et al., 2010). Most neuropeptides, including ASTs, are expressed as prepropeptides and undergo several posttranslational modifications, including endoplasmic reticulum (ER) signaling and cleavage, maturation by tissue-specific proteolytic convertases, and residue-specific modification. Understanding the primary structure of AST genes is the first step to understanding their transcriptional and translational regulation. In the present study, we isolated and characterized three cDNA sequences encoding two MIPs (Paj-MIPI, Paj-MIPII) and one ASTC (Paj-ASTC) from a pandalid shrimp, Pandalopsis japonica. We also determined expression patterns and measured transcript levels of the three ASTs induced by eyestalk ablation (ESA) to understand the transcriptional regulation of ESA. 2. Materials and methods 2.1. Shrimp and ESA Live shrimp (P. japonica) were purchased from the local seafood market and acclimatized at 4 °C. After acclimatization for five days, they were sacrificed for sample collection. Just after dissection, samples were stored at −70 °C until used for RNA extraction. In order to measure the number of Paj-AST homolog transcripts after ESA, ablation was performed according to previous methods (Jeon et al., 2010). On the third and seventh days after ESA, six shrimp were collected; individuals without ESA were included as controls. After sacrificing the animals, twelve tissues were collected, frozen by dumping into liquid nitrogen, and stored in the deep freezer (−70 °C) until used for the expression study. 15% shrimp died as a result of the ESA and only surviving individuals were used for the experiment. 2.2. Cloning of the Paj-AST cDNAs from P. japonica A cDNA sequence database of P. japonica neuronal tissues was established by the commercial next-generation sequencing (NGS) service (Macrogen, Korea). Total RNA was isolated from neuronal tissues, including brain, XO/SG, and thoracic and abdominal ganglia, using Trizol reagent (Sigma, USA). A cocktail containing total RNA (1 mg) was sent for analysis, and sequencing was performed on a 454 Genome Sequencer FLX platform (GS-FLX™; Roche, USA). Sequencing results were processed and assembled, and output results were displayed and analyzed using the Macrogen EST viewer (Macrogen, Korea). After screening the contigs within the EST database of P. japonica, three distinct partial sequences (530 bp, 466 bp, and 493 bp) were identified as the crustacean homologs with insect ASTs. Two of these sequences (530 bp and 466 bp, respectively) showed high similarity to B-type ASTs, and the 493-bp clone appeared to be a homolog of a C-type AST. In order to obtain the full length of each AST cDNA, rapid amplification of cDNA ends (RACE) was performed. Since all three partial sequences were expressed in neuronal tissues, including the brain and thoracic ganglia (TG), total RNA was purified from the neuronal tissues using Trizol reagent according to the manufacturer's instructions (Invitrogen, USA), quantified by absorbance at 260 nm (NanoDrop Technologies, Inc., USA), and stored at −70 °C. cDNA was synthesized in a reaction mixture (10 μL) containing 2 μg total RNA, 0.5 μL DNase 1, and 1 μL 10× DNase buffer. The reaction was maintained at 37 °C for 30 min followed by 70 °C for 10 min. After adding 1 μL of 20 μM oligo-dT primer (Table 1) and 4 μL dNTPs (2.5 mM each), the reaction was terminated by heating at 70 °C for 5 min followed by chilling on ice for 2 min. Then, 4 μL first-strand buffer (5×), 2 μL DTT (0.1 M), and 1 μL RNase Out (Invitrogen) were added, and the reaction was incubated at 37 °C for 2 min. Finally, 1 μL MMLV reverse transcriptase

336

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

Table 1 Primers used for Paj-AST study. Primer name

Sequence (5′–3′)

Paj-MIPI RT F1 Paj-MIPI RT R1 Paj-MIPII RT F1 Paj-MIPII RT R1 Paj-ASTC RT F1 Paj-ASTC RT R1 Paj-MIPII F3 Paj-MIPII F4

AGCCGACGAAGACGAACAAGAACA

Paj-MIPII F1 Paj-MIPII F2 Paj-MIPII R1 Paj-MIPII R2 Paj-MIPI R2 Paj-MIPI R1 Paj-MIPI F1 Paj-MIPI F2 Paj-MIPI F3 Paj-MIPI F4 Paj-ASTC F3 Paj-ASTC R1 Paj-ASTC R2 Paj-ASTC F1 Paj-ASTC F2 Oligo-dT Race R1

Race R2

M13F M13R 18S

18S

Description

Paj-MIPI FWD primer for qPCR AACTATTCCAGTCTCCGCTGCGCTTT Paj-MIPI RVS primer for qPCR ATTGCAGTCACTCAGTTGACCACAGC Paj-MIPII FWD primer for qPCR TCAGTGTCTGTCATCTCATCGCTACG Paj-MIPII RVS primer for qPCR TGTCAGCAAAGAACCCAACGCTGA Paj-ASTC FWD primer for qPCR ATGGTAGGGATCTCTCCTGGTAGT Paj-ASTC RVS primer for qPCR CAGACACTGAATTACAGATGGCC First FWD primer for 3′‐RACE ATTACAGATGGCCGAAGACAAGCGT Second FWD primer for 3′‐RACE ATCGTGAAAATGATGCAGCATGCACT First FWD primer for MIPI ORF ATGATGCAGCATGCACTCCGAA Second FWD primer for MIPI ORF GACCATCCGCCTCGTTTCTCTATTT First RVS primer for MIPII CTCTATTTATTCCATGATTTCAGC Second RVS primer for MIPII ATAGTGTTGACTCTTTCAACTCAAGCAACTT First RVS primer for MIPI TCAAGCAACTTGGGATTCACCAGTTTCAT Second RVS primer for MIPI TAATGGACGAAGAAGAGAAGAGGGCT First FWD primer for MIPI AGGGCTAACTGGAACAAATTTCAAGGAT Second FWD primer for MIPI ORF ATGAAACTGGTGAATCCCAAGTTGCTTGA First FWD primer for 3′‐RACE AAGTTGCTTGAGTTGAAAGAGTCAACACTAT Second FWD primer for 3′‐RACE GTCAGAAGACCAACCAAATCAAG FWD primer for ASTC ORF GACGTCACTACTTGAGTTGCCAT First RVS primer for ASTC ORF GTTGCCATCTCGCTCTTGATG Second RVS primer for ASTC ORF GGCCATGATTGCTGAGGCCAG First FWD primer for 3′‐RACE ATGATTGCTGAGGCCAGGGC Second FWD primer for 3′‐RACE CTGTGAATGCTGCGACTACGATTTTTTTTTTTTTTTT Primer for RT reaction for 3′‐RACE ACGCTGTGAATGCTGCGACTAC First reverse primer for 3′‐RACE GCTGTGAATGCTGCGACTACGA Second reverse primer for 3′‐RACE CAGGAAACAGCTATGAC Vector FWD primer for sequencing GTAAAACGACGGCCAG Vector RVD primer for sequencing rRNA-F ATGAGAGTGCTCAAAGCAGGCTACTC Forward primer for 18SrDNA rRNA-R GGCGAATCGCTAGTCAGCATCGTT Reverse primer for 18SrDNA

(Invitrogen) was added, and the reaction was incubated at 37 °C for 50 min. Enzyme inactivation was performed at 70 °C for 15 min. cDNA was quantified and stored at −20 °C.

RT-PCR was performed using two pairs of sequence-specific primers (Table 1). The PCR reaction mixture (20 μL) contained 100 ng cDNA, 1 μL of 20 μM primers, 0.2 μL Takara EX Taq polymerase, 2 μL 10× buffer (Takara Bio Inc., Japan), and dNTPs (2.5 μL of each). PCR was performed for 30 cycles of 94 °C for 3 min, 60 °C for 30 s, and 72 °C for 30 s, with post-extension at 72 °C for 5 min. Next, 3′-RACE was performed following a previously established procedure (Kim et al., 2009; Jeon et al., 2010). Each PCR was performed using two sequence-specific forward primers and the linker primers shown in Table 1; the PCR conditions were the same as above. Complete sequences were confirmed with PCR using specific forward and reverse primers (Table 1) directed to the 5′ and 3′ ends of each sequence. PCR products were separated by 1.5% agarose gel electrophoresis and stained with ethidium bromide. Stained bands with the expected size were cut and purified using a Gel Extraction Kit (Bioneer, Korea), ligated into a vector with the pGEM-T Easy Cloning Kit (Promega, USA), and transformed into the One Shot Top 10 Escherichia coli strain (Invitrogen, USA). cDNA sequences were determined with an automated DNA sequencer (ABI Biosystem, USA). Sequence similarities were analyzed with the web-based program, Basic Local Alignment Search Tool (http://www.ncbi.nlm.nih.gov/BLAST/). 2.3. Expression analysis of the three Paj-AST genes Expression analysis of the three AST-like peptides was performed by both qualitative and quantitative PCR strategies. First, tissue-specific expression profiles were determined by end-point RT-PCR. A total of twelve tissues were used for this analysis, including the gill (GI), epidermis (EP), gonad (GO), hepatopancreas (HP), deep abdominal flexor muscle (FL), deep abdominal extensor muscle (EX), heart (HT), thoracic ganglia (TG), abdominal ganglia (AG), brain (BR), sinus gland/X-organ complex (SG), and intestine (IN). Procedures for total RNA isolation and cDNA synthesis were performed using a modified version of the strategy described above, in which random hexamers were used for reverse transcription, instead of the oligo-dT primers for cloning the Paj-ASTs. Additionally, all synthesized cDNAs were treated with DNase I (Promega, USA) to eliminate genomic DNA contamination. The reaction mixture (20 μL) contained 1 μL cDNA (100 ng), 1 μL of 4 μM sequence-specific primers (Table 1), 0.2 μL Ex Taq polymerase (Takara Bio Inc., Japan), 4 μL dNTP (2.5 mM each), and 2 μL buffer (10×). PCR conditions were 3 min at 94 °C, followed by 30 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. The 18S rRNA was used as the positive control. Quantitative PCR was performed using the DNA Engine Chromo4 Real-Time Detector (Bio-Rad, USA) to measure Paj-AST expression levels between the control and ESA groups. Six samples from each group were analyzed individually. SYBR Green premix Ex Taq™ (Takara Bio Inc., Japan) was used with 50 ng cDNA as template. Real-time PCR was performed under the same conditions as used for end-point RT-PCR described above, except that the annealing temperature was 62 °C and 40 cycles was performed. Standard curves were constructed to quantify copy numbers, as described previously (Kim et al., 2008), and confirm the efficiency of each primer set. Calculated copy numbers of each PCR reaction were normalized to those of 18S rRNA (the actual copy numbers of Paj-AST divided by the actual copy numbers of 18S rRNA). 2.4. Data analysis and statistics Multiple amino acid sequence alignment was performed using the ClustalW program (http://www.ebi.ac.uk/clustalw/). Analysis results were then visualized with the GeneDoc program (http://www.nrbsc. org/gfx/genedoc/index.html). Signal peptide and possible cleavage sites were predicted by the SignalP 3.0 Server (http://www.cbs.dtu. dk/services/SignalP/). A phylogenetic tree analysis of various ASTs was generated by the neighbor joining method with Molecular Evolutionary

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

Genetics Analysis (MEGA4), and bootstrapping tests were performed with 1000 replications (Tamura et al., 2007). All primers used in this experiment were designed using the IDT SciTools program (http:// www.idtdna.com/SciTools/SciTools.aspx) and synthesized by Bioneer Company (Korea). Significant differences in AST-like peptide expression levels between each tissue type were evaluated by comparing the means and using Student's t-tests with the Sigma plot program. The results were considered statistically significant if the p value was b 0.05. 3. Results 3.1. Isolation and characterization of Paj-MIPs Based on the results of combined sequence analysis obtained from several RACE runs and sequences from the EST database, two distinct MIP cDNAs were isolated. A single transcript-forming open reading frame (ORF) was confirmed by RT-PCR using primers targeting the terminal sequence of each strand (Table 1). The first MIP from P. japonica, Paj-MIPI (776 bp), encoded a protein with 189 amino acids (Fig. 1A), and the second Paj-MIPII cDNA sequence contained an ORF encoding 117 amino acids (Fig. 1B). The first 25 residues were predicted as the signal peptide sequence, and putative cleavage was predicted to occur between Ala 25 and Gln26. By contrast, neither a putative signal peptide nor a start codon (AUG) was identified at the 5′ end of the Paj-MIPI sequence, indicating that the isolated Paj-MIPI was a partial transcript. We tried several times to obtain the Paj-MIPI sequence located further upstream, but failed. Although we failed to obtain the full-length Paj-MIPI, two distinct transcripts of type-B AST were first identified in P. japonica. The primary structures of MIP prepropeptides from representative decapod and insect species were compared (Fig. 2). The size of prepropeptides was significantly different in each MIP gene. This variability is mainly due to the different numbers and location of the mature peptide W(X6)W motifs in each MIP. Among the compared MIP members, Paj-MIPII (117residues) turned out to be the smallest protein, whereas Bom-PTSP (274 residues), MIP from B. mori encoded the largest protein (Fig. 2). Produced mature peptides of each MIP gene were predicted by the dibasic endoproteolytic cleavage sites (KR/KK) and by the limited single basic residues (Veenstra, 2000). The average length of produced mature peptides ranged from 9 to 12 residues. One exceptional mature MIP peptide was predicted in Paj-MIPI, since this doesn't belong to the limited monobasic cleavage described in Veenstra (2000) (Fig. 1). A prepropeptide of Paj-MIPI is putatively processed into seven mature peptides, whereas three mature peptides were predicted to be produced from Paj-MIPII (Fig. 2). As shown for the Paj-MIPs, the organization of the prepropeptides differed not only by the number of mature peptides, but also by the intervening sequences between two mature peptides. Only a single mature peptide existed by an intervening sequence in Paj-MIPII and Mj-ASTB (M. japonicus), whereas two or three mature peptides were clustered without any intervening sequence in Paj-MIPI and Tc-ASTB (Fig. 2). Tc-ASTB, from the insect Tribolium castaneum, contained six mature peptides, all showing different mature peptide organizations: single, dual, and triple. Dappu-ASTB from D. pulex, contained eight mature peptides with 5 single and 1 triple clusters. Another MIP from an insect species, B. mori, encoded the longest prepropeptide (274 residues), producing 14 mature peptides of eight different kinds; among them, five and six mature peptides clustered without any intervening sequences (Fig. 2). In order to understand the structural characteristics of 10 MIPs from two Paj-MIP genes, a comparative analysis was performed with currently identified crustacean B-type peptides (Table 2). More than 50 different B-type AST peptides were analyzed from eight crustacean species through a combination of bioinformatic analysis of the nucleotide database and mass spectrometric analysis (Fu et al., 2005; Christie et al., 2008a; Ma et al., 2008, 2009a,2009c, 2010; Gard et al.,

337

2009). All identified peptides had the conserved MIP peptide motif, W(X6)W, where X indicates any amino acid residue. In addition, a glycine residue for α-amidation was well-conserved at the C-terminus of each mature peptide, which is essential for their activity (Merkler, 1994). Multiple alignment results proposed that crustacean MIPs could be further classified into at least four subgroups based on the sequence similarity of six residues flanked by two conserved tryptophan (W) residues (Fig. 3). Peptides in subgroup 1 exhibited well-conserved W(N/G/S) KFQGSW sequences, and they are found in all crustacean species, except for D. pulex. Members belonging to subgroup 2 contained a W(S/N)(S/ N)(L/M)RG(T/A)W motif, which was less conserved as compared with subgroup 1 members. Subgroup 2 peptides were widely identified both in cladoceran and decapod MIPs (Fig. 3 and Table 2). In addition to the two major subgroups, peptides of subgroup 3, WAHFRGSW, were found in brachyurans and penaeids, which suggested that these peptides may also be conserved throughout decapod crustaceans. The subgroup 4 MIPs, WSSLRSAW, were only conserved among brachyurans. Unfortunately, a corresponding peptide of subgroup 3 or 4 was not identified in the present study of P. japonica. Peptides that did not belong to those three categories were classified as “others.” These unclassified peptides were identified in most examined species (Table 2). 3.2. Isolation and characterization of Paj-ASTC In addition to two MIP cDNAs, a full-length C-type AST cDNA (Paj-ASTC) was isolated from P. japonica. A single transcript-forming ORF was confirmed by RT-PCR using primers targeting the terminal sequence of each strand (Table 1). The full-length Paj-ASTC cDNA (616 bp) encoded a protein of 143 amino acid residues (Fig. 4). The deduced amino acid sequence of Paj-ASTC contained a well-conserved signal peptide sequence and its putative cleavage site between Ala 21 and Gln22 residues. These results indicated that Paj-ASTC encodes the full-length typical secretory neuropeptide. Deduced amino acid sequence analysis of Paj-ASTC identified two dibasic cleavage sites for furin-like convertases, which flank wellconserved decapenta-mature peptides (Fig. 4). The mature peptide of Paj-ASTC exhibited the conserved PISCF carboxy-terminal sequence and two cysteine residues at the 7th and 14th positions, creating a disulfide bridge. One major difference of the mature Paj-ASTC peptide from other ASTCs was the change of a glutamine residue to a leucine at the N-terminus. In contrast to the Paj-ASTC peptide, a conserved glutamine residue was found in the mature peptide of Lv-ASTC from the shrimp species, L. vannamei (Fig. 5). Amino-terminus blocked by pyroglutamine is a common characteristic of PISCF-ASTCs, and the effects of the glutamine residue replacement in Paj-ASTC are still unclear (Stay and Tobe, 2007). Besides the two conserved dibasic cleavage sites producing a mature peptide, three additional dibasic sequences were identified at the variable N-terminal regions of both Paj-ASTC and Lv-ASTC (Fig. 5). These three putative dibasic cleavage sites were only found in shrimp ASTCs and they were not identified in the Ha-ASTC from H. americanus. The carboxy-terminal sequence of Paj-ASTC lacks glycine residue for amidation and ends with RRK residues, which would be proteolytically processed. Multiple amino acid alignment revealed that Paj-ASTC showed the highest amino acid sequence similarity to Lv-ASTC (64%), followed by ASTCs from insect species, including Bm-ASTC of B. mori (29%) and Dm-ASTC of D. melanogaster (28%). The relatively low sequence similarities among arthropod ASTs were mostly due to the variable N-terminal region of each prepropeptide (Fig. 5). Lower sequence similarity (17–60%) was found at the N-terminal variable region than in the mature peptide region (57–88%). Unexpectedly, the Ha-ASTC from decapods crustacean, H. americanus had only 31% and 26% similarity with Paj-ASTC and Lv-ASTC, respectively. In fact, ASTCs in arthropods were divided into two subgroups based on the primary structure (Fig. 5). ASTCs from two penaeid shrimp species, lepidopteran (B. mori), dipteran (D. melanogaster and Anopheles

338

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

Fig. 1. Nucleotide and deduced amino acid sequences of the Paj-MIPs from P. japonica (A) Paj-MIPI; (B) Paj-MIPII. Nucleotides (left) and amino acids (right) were numbered. Primers used for cloning are indicated by arrow and the asterisk indicates the stop codon. Signal peptide is highlighted in black and polyadenylation signal is underlined (only found in Paj-MIPI). Putative cleavage sites are boxed. Mature peptide regions are highlighted in gray.

gambiae) and coleopteran (T. castaneum) showed conserved PISCF sequence without glycine residue for amidation at the carboxy terminus (PISCF-ASTCs). ASTCs from hymenopteran and orthopteran

(A. mellifera, L. migratoria, Nasonia vitripennis), cladoceran (D. pulex) and decapod crustacean (H. americanus) exhibited common characteristics including AVSCF-containing mature peptide sequence and

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

339

Fig. 2. Comparison of peptide organizations of type-B preproallatostatins (MIPs) from insect and crustacean. Individual peptide sequences were boxed. Putative dibasic cleavage sites (KR/KK) were indicated on the upper side of each box. Peptide length is shown by Arabic letters. Species and GenBank accession numbers: P. japonica, Paj-MIPI (JQ956412); Paj-MIPII (JQ956413); M. japonicus, Mj-ASTB (CI998633); T. castaneum, Tc-ASTB (NP_001137202); B. mori, Bom-PTSP (NP_001036890); D. pulex, Dp-ASTB (FE274885).

the conserved glycine residue for amidation. These subgroup members were named as AVSCF-ASTC (Fig. 5). The other ASTCs showed a conserved PISCF‐containing mature peptide without glycine residue resulting in the unmodified carboxy-terminus. Several ASTC-like peptides so called ASTCC exhibited unique characteristics from typical ASTCs (Fig. 5). The mature peptides contained AV(S/T)CF sequence, which is similar to AVSCF-ASTC, whereas they lack glycine residue for amidation. In addition, dibasic proteolytic cleavage occurs at different sites producing longer and variable amino-terminal sequence of each mature peptide (Fig. 5). Interestingly, all three ASTC/ASTCC were identified in D. pulex; DappuASTC1 (AVSCF-ASTC), DappuASTC2 (ASTCC), and DappuASTC3 (PISCF-ASTC) (Fig. 6). In order to understand the evolutionary relationship of C-type ASTs in arthropods, a phylogenetic tree was constructed (Fig. 6). As shown in the multiple alignment analysis, C-type ASTs in arthropods were clustered into two major groups, PISCF-ASTC and AVSCF-ASTC. ASTC-like peptides, ASTCCs were more closely related to AVSCF-ASTC. This result suggested that two ASTCs have been evolved from the ancestral ASTC genes and gene duplication events occurred from AVSCF-ASTC producing a paralog, ASTCC. Two C-type AST prepropeptides from shrimp species, Lv-ASTC and Paj-ASTC, were clustered with PISCF-ASTC group members, including D. melanogaster, B. mori, and T. castaneum. Three ASTC-like peptides from D. pulex helped us understand the evolution of ASTC/ASTCC family member (Fig. 6). The third ASTC from D. pulex, DappuASTC3, was clustered with the A. gambiae ASTC. Similarly, ASTC from D. pulex, DappuASTC2/CC, also showed close a relationship with the A. gambiae AVSCF-ASTC. The AVSCF-ASTC from D. pulex, DappuASTC1, was grouped with H. americanus ASTC along with other insect AVSCF-ASTCs (Fig. 6). These phylogenetic data support the closer evolutionary relationship between branchipod (D. pulex) and hexapod (insects) rather than decapod crustaceans as shown in several studies (Regier and Shultz, 1997; Glenner et al., 2006). 3.3. Expression analysis of the three Paj-ASTs End-point RT-PCR results showed that the major production sites of the AST-like peptides are neuronal tissues (Fig. 7). The tissue expression profiles of two Paj-MIPs were identical; both were expressed highly in the brain and moderately in other neuronal

tissues, including the abdominal ganglia, thoracic ganglia, and sinus gland/X-organ complex (SG/XO). As for the two Paj-MIPs, Paj-ASTC was strongly expressed in neuronal tissues, including the brain, abdominal ganglia, thoracic ganglia, and SG/XO. Expression of Paj-ASTC was also detected in the intestine, which is also shown in insect species (Sheng et al., 2007). In order to understand the effects of ESA on the transcriptional levels of the three AST-like peptides, quantitative RT-PCR was performed after the ESA (Fig. 8). In the control group, both the Paj-MIPI and Paj-MIPII transcripts in the brain were 5.3- and 3.3-fold, and 4- and 1.9-fold, higher than in the abdominal and thoracic ganglia, respectively. Likewise, Paj-ASTC transcripts were 2.18and 3.44-fold higher than in the abdominal ganglia and thoracic ganglia, respectively (Table 3). These results support the end-point RT-PCR data indicating that the brain is the major production site of all three Paj-ASTs. In all three neuronal tissues, including the brain and abdominal and thoracic ganglia, the expression levels of Paj-MIPII and Paj-ASTC were similar, whereas Paj-MIPI transcripts were significantly lower (by 2.78- to 3-fold). The effects of ESA on the expression levels of both Paj-MIPs were not significant in the abdominal ganglia or thoracic ganglia. However, significant changes in Paj-MIPI transcript numbers were identified in the brain, in which Paj-MIPI mRNA expression decreased by 3.2-fold on day 7 post-ESA as compared with day 3 post-ESA (Fig. 8A). Similar expression patterns were also found for Paj-MIPII, but these results were not statistically significant (Fig. 8B). On day 3 post-ESA, copy numbers of the Paj-ASTC transcript reached up to 3.5-fold higher than the control group, whereas on day 7, copy numbers decreased to basal levels (Fig. 8C). Unlike Paj-MIPs, significant transcriptional changes in Paj-ASTC were also identified in the thoracic ganglia. Collectively, ESA resulted in significant temporal induction of Paj-AST expression in the brain, and its level decreased to baseline by day 7 post-ESA, suggesting that removal of factors from the SG/XO complex may have caused temporal induction of Paj-ASTs, either directly or indirectly, and a putative negative feedback reaction may exit to maintain homeostasis. In order to determine if the copy numbers of the three AST-like peptides are related to each other, correlation analysis was performed (Fig. 9). Interestingly, all three AST-like peptides from P. japonica showed a strong positive correlation in brain tissue, with high r2 values.

340

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

Table 2 List of putative MIPs from known crustacean species. Name

Sequences

Species

Source

Paj-MIPI

A N W N K F Q G S Wamide N N W S N L Q G S Wamide G G W S S L Q G S Wamide A W K N L H G A Wamide P A Y P T R V S P R S A N W S S L R G T Wamide S G D W N S L R G A Wamide N D G D W S Q F R G S Wamide A D W S S M R G T Wamide G G W N K F Q G S Wamide A N W N K F Q G S Wamide A D W S S M R G A Wamide A D W D K F Q G S Wamide A E W N K F Q G S Wamide A G W N K F Q G S Wamide A D W N K F Q G S Wamide N W N K F Q G S Wamide K W A A G R S A Wamide R W S K F Q G S Wamide A D W N K F Q G S Wamide L T W N K F Q G S Wamide S A D W N S L R G T Wamide S T N W S N L R G T Wamide V P N D W A H F R G S Wamide N N N W S K F Q G S Wamide N N W S K F Q G S Wamide T S W G K F Q G S Wamide Q W S S M R G A Wamide S G K W S N L R G A Wamide S G K W S N L R G A Wamide L G N W S N L R G A Wamide S T N W S S L R S A Wamide V P N D W A H F R G S Wamide A W S N L G Q A Wamide A G W N K F Q G S Wamide V T W G K F Q G S Wamide G S N W S N L R G A Wamide G V N W S N L R G A Wamide T S W G K F Q G S Wamide G N W N K F Q G S Wamide N N W S K F Q G S Wamide Q W S S M R G A Wamide S G K W S N L R G A Wamide S T N W S S L R S A Wamide N N N W S K F Q G S Wamide V P N D W A H F R G S Wamide G N W N K F Q G S Wamide N W N K F Q G S Wamide N N W S K F Q G S Wamide N N N W S K F Q G S Wamide S T N W S S L R S A Wamide N N W N R M Q G M Wamide A W S D L S Q Q G Wamide S W T Q L H G V Wamide R W D Q L H G A Wamide S G W N K M Q G V Wamide G W N Q L Q G V Wamide N W N N L R G A Wamide E S G W N N L K G L Wamide T N W N K F Q G S Wamide

Pandalopsis japonica

Present study (in silico + cloning)

Marsupenaeus japonica

MALDI-FTMS + in silico (Christie et al., 2008a)

Litopenaeus vannamei

MALDI-FTMS + In silico (Ma et al., 2010)

Cancer borealis

MALDI-FTMS (Ma et al., 2009c)

Cancer maenas

MALDI-FTSM (Ma et al., 2009a)

Cancer productus

MALDI-FTMS (Fu et al., 2005)

Daphnia pulex

Genome mining (Gard et al., 2009)

Homarus americanus

MALDI TOF/TOF (Ma et al., 2008)

Paj-MIPII

Mj-ASTB

Lv-ASTB

Cb-ASTB

Cm-ASTB

Cp-ASTB

Dp-ASTB

Ha-ASTB

4. Discussion 4.1. Two copies of Paj-MIP transcripts and various MIP mature peptides In the present study, we isolated two different cDNAs encoding MIP from the decapod crustacean, P. japonica. Although we failed to isolate the full-length Paj-MIPI, we identified two copies of MIP genes in arthropods for the first time. Primary structure of each Paj-MIP transcript was significantly different from each other (Fig. 2). Until now, only a single copy of a MIP gene had been identified in each arthropod. Total genome sequence analysis of D. melanogaster, T. castaneum, and A. gambiae also supported the idea that a single MIP gene exists in insect species

(Williamson et al., 2001; Riehle et al., 2002; Richards et al., 2008). In addition to insect species, recent transcriptomic analysis of D. pulex showed the presence of single MIP transcripts in cladoceran crustaceans (Dircksen et al., 2011). Based on the current limited information, it is not clear if dual copies of MIP genes are common characteristics of decapod crustaceans. Multiple copies of MIP genes may have little to do with the number of mature peptides produced. Based on the current information, the number of mature peptides did not show any conceivable evolutionary relationship and varied across species. Mass spectrometric and in silico analysis showed that the number of MIP peptides produced by decapod species ranged from 5 to 13; 5 in M. japonicus,

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a

341

W(N/G/S)KFQGSW (Subgroup1)

WAHFRGSW (Subgroup3)

W(S/N)(S/N)(L/M)RG(T/A)W (Subgroup2)

WSSLRSAW (Subgroup4)

Others

Fig. 3. Classification of crustacean type-B AST (MIPs) peptides based on amino acid sequence similarity. Out of seven mature peptides of Paj-MIPI, one peptide (Paj-MIPI-1) belongs to group 1 and four classified as “others” (Paj-MIPI-2, 3, 5 and 7) fall into group 2 category. Two peptides of Paj-MIPII (Paj-MIPII-2 and P-MIPII-3) belong to group 1 and Paj-MIPII-1 is grouped under group 2 category. Two Paj-MIPI peptides (PajMIPI-4 and PajMIPI-6) fall into “others” category.

342

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

Fig. 4. Nucleotide and deduced amino acid sequences of the Paj-ASTC from P. japonica. Nucleotides (left) and amino acids (right) were numbered. Primers used for cloning are indicated by arrow and the asterisk indicates the stop codon. Signal peptide is highlighted in black. Putative cleavage site is boxed. Cysteins involved in intramolecular disulfide bonds are circled. Putative mature peptide region at C-terminal is underlined.

8 in L. vannamei, 8 in D. pulex, 10 in C. borealis, and 13 in C. maenas (Christie et al., 2008a; Ma et al., 2009a,2009c, 2010; Dircksen et al., 2011). Two Paj-MIP genes produced a total of 10 mature peptides of nine different sequences, which are similar to other decapods (Fig. 2). Compared with crustaceans, relatively fewer MIP peptides have been identified in insects. Genome sequencing and mass spectrometric data revealed a total of six MIP peptides from T. castaneum and Tenebrio molitor (Abdel-latief et al., 2003; Richards et al., 2008). Based on a GenBank database analysis (http://www.ncbi.nlm.nih. gov/genbank), we also identified five MIP peptides from both D. melanogaster and A. aegypti and four from both C. quinquefasciatus and A. gambiae. However, the largest insect MIP transcript in B. mori (Bom-PTSP) produces a total of 14 mature peptides of eight different sequences (Yamanaka et al., 2010), which is the same for MIP peptides produced by L. vannamei (Table 2). These results show that the number of mature peptides varies across species and suggests that the number of MIP genes may not be related to the number of mature peptides produced. In addition, two copies of MIP gene appear to be unrelated to different transcriptional regulation processes. Quantitative analysis of two Paj-MIP transcripts showed a strong positive correlation in both control and ESA individuals, which suggests that transcriptional regulation may be under similar physiological condition (Fig. 9). We also failed to identify any significant difference in mature peptides between Paj-MIPI and Paj-MIPII (Fig. 3). In fact, the organization, length, and number of mature peptides from MIP genes vary in each species, and we were unable to find a typical evolutionary relationship (Fig. 2). However, it appears that dual copies of MIP genes may not be the result of the simple gene duplication event at least, since the organization of each MIP varies among the different species.

Although we classified MIP mature peptides into four subgroups based on amino acid sequence similarity, there remained numerous unclassified sequences from various species, which were highly variable within the six residues flanked by two conserved Trp residues (Fig. 3). As described above, 4–8 kinds of MIP peptides exist in each insect species, whereas 3–13 peptides have been identified in each crustacean species. Although the biological implications of a high number and variety of MIP remain elusive, a number of different MIP peptides were able to recognize the same target receptor, producing similar biological signaling processes, in insect species. Until now, only two putative MIP receptors have been isolated in insect species (Johnson et al., 2003). Using a heterologous expression system (HEK293 cells), the sex peptide receptor (SPR) from B. mori responded to all four peptides tested (AWQDLNSAW-NH2, APEKWAAFHGSW-NH2, AWQDMSSAW-NH2, and AWSSLHSGWA) at a concentration of 10−7 M, suggesting that many MIP peptides are specific for a common receptor (Yamanaka et al., 2010). Unfortunately, no orthologous receptor has been identified in decapod crustaceans, and we do not know if MIPs in decapod species are similar to those from insects. 4.2. Comparative analysis of three C-type ASTs in arthropods In addition to two MIPs, we also identified and characterized an ASTC cDNA from a decapod crustacean. Based on amino acid sequence similarity and phylogenetic analysis, arthropod ASTCs can be divided into two subgroups, AVSCF-ASTCs and PISCF-ASTCs (Fig. 6). Each subgroup member shares a common characteristic in the primary structure and mature peptide sequence, which is distinct from the other subgroup members (Fig. 5). PISCF-ASTCs, including Paj-ASTC, had relatively longer precursor peptides (114–143 residues) and representative mature

Fig. 5. Multiple amino acid alignment of C-type allatostatins from arthropods. Signal peptides are shaded in ash. Putative cleavage sites are shaded in black. Mature peptide regions are underlined. Two asterisks indicate the disulfide bridge. Species and GenBank accession numbers: P. japonica, Paj-ASTC (JQ956414); L. vannamei, Lv-ASTC (FE175093); B. mori, Bm-ASTC (NP_001124356); D. melanogaster, Dm-ASTC (NP_523542); A. gambiae, Ag-ASTC (XP_001689183); T. castaneum, Tc-ASTC (EFA09152); A. mellifera, Am-ASTC (XP_001121443); L. migratoria, Lm-ASTC (CO820847); H. americanus, Ha-ASTC (EY291152); Ixodes scapularis, Is-ASTC (XP_002433459); A. gambiae, Ag-ASTCC (BX467238); A. mellifera, Am-ASTCC (BI503345, DB747626, DB749381); B. mori, Bm-ASTCC (fmgV41d19f and fmgV41d19r); D. melanogaster, Dm-ASTCC (BT024357), N. vitripennis, Nv-ASTC and Nv-ASTCC sequences: contig5540 of the genome sequence; D. pulex, DappuASTC1, DappuASTC2/CC and DappuASTC3 (sequences are collected from the website “Daphnia pulex v1.0”).

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

343

344

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

Fig. 7. Tissue expression profile of Paj-MIPI, Paj-MIPII and Paj-ASTC. Endpoint RT-PCR products were separated on 1.5% agarose gel and stained with ethidium bromide (inverted image). 18S rRNA was used as a positive control. BR, brain; SG, sinus gland–X organ complex; AG, abdominal ganglia; TG, thoracic ganglia; GO, gonad; HP, hepatopancreas; IN, intestine; FL, flexor muscle; EX, extensor muscle; HT, heart; GI, gill; EP, epidermis.

Fig. 6. Phylogenetic tree of various C-type allatostatins from arthropods. The diagram was generated by the minimum evolution method and bootstrapping test was performed with 1000 replication using Molecular Evolutionary Genetics Analysis (MEGA4) software. The scale bar represents 0.1 amino acid substitution per site. Species and GenBank accession numbers are the same as Fig. 5.

peptides (15 residues) were (Q/L)(V/I)R(Y/F)(R/H)QCYFNPISCF-COOH (Fig. 5). The amino-termini of the mature peptides are conserved with the glutamine residue, which is further modified into pyroglutamine. One exception was identified in Paj-ASTC in which the corresponding residue was replaced by leucine (Fig. 5). Di or tri basic residues for proteolytic process at the carboxy-terminus were also well conserved in all PISCF-ASTCs (Fig. 5). The second subgroup of ASTC, AVSCF-ASTCs, had relatively smaller precursor proteins (89–105 residues). The length differences of the two precursor proteins were mainly due to the length between the signal sequence and the mature peptide (Fig. 5). In addition to proteolytic mono- or dibasic residues at the carboxy-terminus, glycine residue of each AVSCF-ASTC is also well conserved, which is further processed into the carboxy-amidated mature peptide (14 residues); (S/N)YW(K/R)QCAFNAVSCF-amide (Fig. 5). Until now, the biological functions of amidation at the carboxyl terminus were not clearly established for AVSCF-ASTCs. However, biological activities of two synthetic forms of two C-type ASTs of M. sexta (Mas-AS acid and MAS-AS amide) had similar ranges of ED50 values (2–5 nM) and bioactivity (Kramer et al., 1991). These results showed that two ASTCs are different gene products with distinct structural characteristics from each other. In addition to two ASTCs, ASTCCs were also identified in most arthropod (Veenstra, 2009). Although they show the conserved AV(S/T)CFcontaining carboxy-terminus and the cysteine spacing for disulfide bridge, several other structural characteristics are different from the typical ASTCs. Mature peptide of ASTCC is larger (from 19 to 25 residues) than ASTCs (14 or 15 residues) because of different dibasic cleavage sites (Fig. 5). Additional putative cleavage site is also identified at the variable amino-terminal sequences in each ASTCC. In addition, ASTCC from D. melanogaster possesses an unusual signal-anchor sequence instead of a signal peptide sequence. As a result of gene duplication event, ASTC/ASTCC genes were generated in insect species (Veenstra, 2009). Although three ASTC/ASTCC genes (DappuASTC1, 2, 3) exist in D. pulex genome, two genes are found in insect. ASTCC and ASTC exist as a gene cluster in both insect and cladoceran genome (Veenstra, 2009; Dircksen et al., 2011).

Besides the DappuASTC2/C1 gene cluster, additional PISCF-ASTC gene, DappuASTC3 exist in D. pulex genome, whereas only a gene cluster was identified in each insect genome. The ASTCC/ASTC gene cluster structure is different among different insects. A gene cluster is composed of ASTCC and PISCF-ASTC in the most holometabolous insects including Coleoptera (T. castaneum), Lepidoptera (B. mori), and Diptera (D. melanogaster), whereas ASTCC and AVSCF-ASTC form a cluster in the other insect species including Orthoptera (L. migratoria) and Hymenoptera (A. mellifera and N. vitripennis). Those differences in the ASTC gene cluster are exactly consistent with phylogenomic analysis (Savard et al., 2006). Those results suggest that two ASTCs were evolved by a systematic process not by a simple point mutation or addition of function, which has been proposed previously (Veenstra, 2009). Although three different ASTC/ASTCC members were identified in the cladoceran genome (Dircksen et al., 2011), cDNA encoding ASTCC has not been identified in decapod crustacean. To our knowledge, only three ASTC cDNA sequences have been currently identified in decapods. According to the results of a transcriptomic analysis of H. americanus brain, SYWKQCAFNAVSCFamide (AVSCF-ASTC) sequence was identified, and its existence was confirmed by mass spectrometry (Dickinson et al., 2009). In C. borealis, PISCF-ASTC (CbAST-C1) was first identified in POs by modified mass spectrometry, and the ortholog of AVSCFASTC from H. americanus, CbAST-C2, was also identified using the EST database search strategy (Ma et al., 2009b). This result suggests that it is possible that both AVSCF- and PISCF‐ASTCs exist in decapod genome. In addition to two published C-type ASTs, a full-length ASTC cDNA sequence (Lv-ASTC) from Dendrobranchiata, L. vannamei (GenBank accession number: FE175093) was identified from GenBank database. Collectively, three C-type AST genes have been identified, and two (Paj-ASTC and Lv-ASTC) belong to the PISCF-AST subgroup, whereas one (Ha-ASTC) is an AVSCF-ASTC member. Although Veenstra classified Lv-ASTC into ASTCC members (Veenstra, 2009), it appears to be PISCF-ASTC members, which is distinct from AVSCF-ASTC and its paralog, ASTCC. These results showed that both types of ASTC genes exist in decapods, as in insect species. However, we still have no idea if there are 3 genes as in D. pulex or 2 genes as in insect species within decapod genome. Although ASTCs were clearly classified into two subgroups based on their primary structures, no functional differences were identified between the two ASTCs. Electrophysiological experiments demonstrated that both CbAST-C1 (PISCF-ASTC) and CbAST-C2 (AVSCF-ASTC) exhibited similar inhibitory effects on the frequency of the pyloric rhythm of the STG in a state-dependent manner (Ma et al., 2009b). Alanine substitution of the Lepidopteran C-type AST, Manse-AS,

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

345

Table 3 Comparison of mRNA transcript number of three preproallatostatins among the control group. Name

Paj-MIPI Paj-MIPII Paj-ASTC

Mean relative copy number ± S.D. BR

AG

TG

0.049 ± 0.040 0.136 ± 0.117 0.148 ± 0.139

0.009 ± 0.014 0.034 ± 0.062 0.068 ± 0.100

0.015 ± 0.004 0.063 ± 0.026 0.043 ± 0.021

our knowledge regarding the similarities and differences of the two C-type ASTCs. 4.3. Three crustacean ASTs and their putative functions

Fig. 8. Effects of eye stalk ablation (ESA) on expression of Paj-MIPs and Paj-ASTC in brain, abdominal and thoracic ganglia. (A) Paj-MIPI (B) Paj-MIPII and (C) Paj-ASTC. mRNA transcripts of Paj-MIPI, II and Paj-ASTC were quantified by qPCR and data were normalized by the copy number of 18S rRNA. The data represents mean values ± SE (n = 6). Different lowercase letters above the columns indicate the significant differences at the p b 0.05 level.

demonstrated that two cysteine residues forming a disulfide bond and a Phe9 residue were important for inhibiting JH synthesis at a dose of 10 nM indicating disulfide bonds and its neighboring residue forming backbone structure are critical for activity (Audsley et al., 2008). However, we cannot exclude the possibility of a functional difference between the two C-type ASTs based on the significant and conserved evolutionary and structural differences described above. Isolation of receptors corresponding to each ASTC would be a prerequisite to extend

In the present study, we identified and characterized Paj-MIPs and Paj-ASTC cDNAs. In addition to our study, previous studies identified and characterized type-A ASTs in decapod crustaceans (Secher et al., 2001; Yin et al., 2006; Christie et al., 2008b), indicating that all three types of ASTs exist in decapod crustaceans, as seen in insect species. We also found that the structural characteristics and evolutionary relationships of both ASTs are extremely complicated in arthropods, whereas their expression profiles were similar. We showed that both Paj-MIPs and Paj-ASTC had similar tissue distribution profiles and a strong positive correlation, suggesting that their expression may be affected directly or indirectly by the similar physiological conditions (Figs. 7 and 9). In insects, a B-type AST precursor in a cricket, G. bimaculatus, was found to be expressed in the brain, sub-esophageal ganglion, thoracic ganglia, abdominal ganglia, caecum plus midgut, and hindgut (Wang et al., 2004), whereas a C-type AST precursor in the Eri silk worm, Samia cynthia ricini, was expressed in the brain, midgut, and nerve cord (Sheng et al., 2007), suggesting that the tissue distribution profiles of crustacean ASTs are also similar to those of insect species. We also identified the transient upregulation of Paj-MIPI and Paj-ASTC in the brain by day 3 after ESA and a decrease thereafter to basal levels (Fig. 8). ESA stimulates molting by increasing hemolymph ecdysteroids produced by the Y-organ (Webster, 1986; Nakatsuji et al., 2006; Covi et al., 2009; McDonald et al., 2011; Mykles, 2011). ESA also stimulates MF production by eliminating inhibitory hormones in the eyestalk, resulting in increased secretion of MF by the mandibular organ (Tsukimura and Borst, 1992; Laufer et al., 1997). We found that the major production site of both Paj-MIPs and Paj-ASTC is the brain and their transcription in the brain was influenced by ESA. The relationship between change in AST-like peptide levels and induced MF by ESA should be further elucidated. In insect species, all three types of ASTs were also reported to have species-specific allatostatic functions (Lorenz et al., 1995a,b; Li et al., 2006). The primary function of ASTs is inhibition of juvenile hormone (JH) synthesis by the corpora allata (CA) in insect species (Kramer et al., 1991; Stay et al., 1994; Lorenz et al., 1995b, 1999). JH, the epoxidated forms of methyl farnesoate (MF), is involved in various physiological processes, including molting, metamorphosis, reproductive maturation, and pheromone biosynthesis, in insects (Belles et al., 1994). In fact, JH is not found in crustaceans because they lack epoxidase and Sadenosyl-methionine (SAM)-dependent methyltransferase, which converts farnesoic acid (FA) to JH III (Hui et al., 2010). Although JH does not exist in decapod crustaceans, accumulating data suggest that MF and FA may function as hormones similar to JH in insect species (Borst et al., 1987; Laufer et al., 1987; Abdu et al., 1998; Laufer and Biggers, 2001; Chan et al., 2005). The major site for crustacean MF production is the mandibular organ (MO), which is located in the mandibulomaxillary region (Borst et al., 1987; Nagaraju et al., 2004; Nagaraju, 2007). Interestingly, there is another peptide hormone that inhibits MF production, which is unique to crustaceans and is not present in insect species. MF production in crustaceans is inhibited by mandibular

346

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

A Relative copy number of Paj-MIPII

functions of MIPs and ASTCs until now. Since both MIP and ASTC cDNA sequences were obtained in the present study, further studies should seek to understand the relationship between the three types of crustacean AST-like peptides and CHH family members, including MOIH, and MF metabolism regulation. Unfortunately, it has been challenging to isolate receptors that interact with either ASTs or CHH members, and no further functional studies have been performed to investigate the cellular processes of those two important peptide hormones in growth, maturation, and reproduction. This is the first step toward extending our knowledge regarding the roles of peptide hormones on MF metabolism in decapod crustaceans.

References

Relative copy number of Paj-MIPI

Relative copy number of Paj-ASTC

B

Relative copy number of Paj-MIPI

Relative copy number of Paj-ASTC

C

Relative copy number of Paj-MIPII Fig. 9. Relationship among mRNA expression levels of three allatostatins (Paj-MIPI, II and Paj-ASTC) in brain tissue. (A) Correlation between Paj-MIPI and Paj-MIPII; (B) correlation between Paj-MIPI and Paj-ASTC and (C) correlation between Paj-MIPII and Paj-ASTC. Correlation coefficient value is indicated by r2.

organ-inhibiting hormone (MOIH), which is a type II crustacean hyperglycemic hormone (CHH) family member (Wainwright et al., 1999; Lu et al., 2000). In contrast to MOIH, there is no evidence for inhibition of MF production by crustacean ASTs. Cockroach ASTs have a stimulatory effect on MF production in the MO of the crayfish Procambarus clarkii, suggesting that A-type ASTs may have cross-reactive allatostatic functions (Kwok et al., 2005); however, there was no direct evidence of the

Abdel-latief, M., Meyering-Vos, M., Hoffmann, K.H., 2003. Molecular characterisation of cDNAs from the fall armyworm Spodoptera frugiperda encoding Manduca sexta allatotropin and allatostatin preprohormone peptides. Insect Biochem. Mol. Biol. 33, 467–476. Abdu, U., Takac, P., Laufer, H., Sagi, A., 1998. Effect of methyl farnesoate on late larval development and metamorphosis in the prawn Macrobrachium rosenbergii (Decapoda, Palaemonidae): a juvenoid-like effect? Biol. Bull. 195, 112–119. Audsley, N., Matthews, H.J., Price, N.R., Weaver, R.J., 2008. Allatoregulatory peptides in Lepidoptera, structures, distribution and functions. J. Insect Physiol. 54, 969–980. Belles, X., Maestro, J.L., Piulachs, M.D., Johnsen, A.H., Duve, H., Thorpe, A., 1994. Allatostatic neuropeptides from the cockroach Blattella germanica (L.) (Dictyoptera, Blattellidae). Identification, immunolocalization and activity. Regul. Pept. 53, 237–247. Blackburn, M.B., Wagner, R.M., Kochansky, J.P., Harrison, D.J., Thomas-Laemont, P., Raina, A.K., 1995. The identification of two myoinhibitory peptides, with sequence similarities to the galanins, isolated from the ventral nerve cord of Manduca sexta. Regul. Pept. 57, 213–219. Borst, D.W., Laufer, H., Landau, M., Chang, E.S., Hertz, W.A., Baker, F.C., Schooley, D.A., 1987. Methyl farnesoate and its role in crustacean reproduction and development. Insect Biochem. 17, 1123–1127. Chan, S.M., Mak, A.S., Choi, C.L., Ma, T.H., Hui, J.H., Tiu, S.H., 2005. Vitellogenesis in the red crab, Charybdis feriatus: contributions from small vitellogenin transcripts (CfVg) and farnesoic acid stimulation of CfVg expression. Ann. N. Y. Acad. Sci. 1040, 74–79. Christie, A.E., Cashman, C.R., Brennan, H.R., Ma, M., Sousa, G.L., Li, L., Stemmler, E.A., Dickinson, P.S., 2008a. Identification of putative crustacean neuropeptides using in silico analyses of publicly accessible expressed sequence tags. Gen. Comp. Endocrinol. 156, 246–264. Christie, A.E., Sousa, G.L., Rus, S., Smith, C.M., Towle, D.W., Hartline, D.K., Dickinson, P.S., 2008b. Identification of A-type allatostatins possessing −Y X FGI/Vamide carboxytermini from the nervous system of the copepod crustacean Calanus finmarchicus. Gen. Comp. Endocrinol. 155, 526–533. Coast, G.M., Schooley, D.A., 2011. Toward a consensus nomenclature for insect neuropeptides and peptide hormones. Peptides 32, 620–631. Covi, J.A., Chang, E.S., Mykles, D.L., 2009. Conserved role of cyclic nucleotides in the regulation of ecdysteroidogenesis by the crustacean molting gland. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 152, 470–477. Dickinson, P.S., Wiwatpanit, T., Gabranski, E.R., Ackerman, R.J., Stevens, J.S., Cashman, C.R., Stemmler, E.A., Christie, A.E., 2009. Identification of SYWKQCAFNAVSCFamide: a broadly conserved crustacean C-type allatostatin-like peptide with both neuromodulatory and cardioactive properties. J. Exp. Biol. 212, 1140–1152. Dircksen, H., Skiebe, P., Abel, B., Agricola, H., Buchner, K., Muren, J.E., Nassel, D.R., 1999. Structure, distribution, and biological activity of novel members of the allatostatin family in the crayfish Orconectes limosus. Peptides 20, 695–712. Dircksen, H., Neupert, S., Predel, R., Verleyen, P., Huybrechts, J., Strauss, J., Hauser, F., Stafflinger, E., Schneider, M., Pauwels, K., Schoofs, L., Grimmelikhuijzen, C.J., 2011. Genomics, transcriptomics, and peptidomics of Daphnia pulex neuropeptides and protein hormones. J. Proteome Res. 10, 4478–4504. Duve, H., Thorpe, A., 1994. Distribution and functional significance of Leu-callatostatins in the blowfly Calliphora vomitoria. Cell Tissue Res. 276, 367–379. Duve, H., Wren, P., Thorpe, A., 1995. Innervation of the foregut of the cockroach Leucophaea maderae and inhibition of spontaneous contractile activity by callatostatin neuropeptides. Physiol. Entomol. 20, 33–44. Duve, H., Johnsen, A.H., Maestro, J.L., Scott, A.G., Jaros, P.P., Thorpe, A., 1997. Isolation and identification of multiple neuropeptides of the allatostatin superfamily in the shore crab Carcinus maenas. Eur. J. Biochem. 250, 727–734. Duve, H., Johnsen, A.H., Scott, A.G., Thorpe, A., 2002. Allatostatins of the tiger prawn, Penaeus monodon (Crustacea: Penaeidea). Peptides 23, 1039–1051. Fu, Q., Kutz, K.K., Schmidt, J.J., Hsu, Y.W.A., Messinger, D.I., Cain, S.D., de la Iglesia, H.O., Christie, A.E., Li, L., 2005. Hormone complement of the Cancer productus sinus gland and pericardial organ: an anatomical and mass spectrometric investigation. J. Comp. Neurol. 493, 607–626. Gard, A.L., Lenz, P.H., Shaw, J.R., Christie, A.E., 2009. Identification of putative peptide paracrines/hormones in the water flea Daphnia pulex (Crustacea; Branchiopoda; Cladocera) using transcriptomics and immunohistochemistry. Gen. Comp. Endocrinol. 160, 271–287. Glenner, H., Thomsen, P.F., Hebsgaard, M.B., Sørensen, M.V., Willerslev, E., 2006. Evolution: the origin of insects. Science 314, 1883–1884.

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348 Hua, Y.J., Tanaka, Y., Nakamura, K., Sakakibara, M., Nagata, S., Kataoka, H., 1999. Identification of a prothoracicostatic peptide in the larval brain of the silkworm, Bombyx mori. J. Biol. Chem. 274, 31169–31173. Hui, J.H., Hayward, A., Bendena, W.G., Takahashi, T., Tobe, S.S., 2010. Evolution and functional divergence of enzymes involved in sesquiterpenoid hormone biosynthesis in crustaceans and insects. Peptides 31, 451–455. Hummon, A.B., Richmond, T.A., Verleyen, P., Baggerman, G., Huybrechts, J., Ewing, M.A., Vierstraete, E., Rodriguez-Zas, S.L., Schoofs, L., Robinson, G.E., Sweedler, J.V., 2006. From the genome to the proteome: uncovering peptides in the Apis brain. Science 314, 647–649. Jeon, J.M., Lee, S.O., Kim, K.S., Baek, H.J., Kim, S., Kim, I.K., Mykles, D.L., Kim, H.W., 2010. Characterization of two vitellogenin cDNAs from a Pandalus shrimp (Pandalopsis japonica): expression in hepatopancreas is down-regulated by endosulfan exposure. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 157, 102–112. Johnson, E.C., Bohn, L.M., Barak, L.S., Birse, R.T., Nassel, D.R., Caron, M.G., Taghert, P.H., 2003. Identification of Drosophila neuropeptide receptors by G protein-coupled receptors–beta-arrestin2 interactions. J. Biol. Chem. 278, 52172–52178. Kim, K.S., Kim, B.K., Kim, H.J., Yoo, M.S., Mykles, D.L., Kim, H.W., 2008. Pancreatic lipase-related protein (PY-PLRP) highly expressed in the vitellogenic ovary of the scallop, Patinopecten yessoensis. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151, 52–58. Kim, Y.-J., Kang, H.-E., Cho, G.-T., Suh, Y.-S., Yoo, M.S., Kim, H.-W., 2009. Identification and characterization of three differentially expressed ovarian genes associated with ovarian maturation in Yesso scallop, Patinopecten yessoensis. J. Fish. Aquat. Sci. 12, 276–285. Kramer, S.J., Toschi, A., Miller, C.A., Kataoka, H., Quistad, G.B., Li, J.P., Carney, R.L., Schooley, D.A., 1991. Identification of an allatostatin from the tobacco hornworm, Manduca sexta. Proc. Natl. Acad. Sci. U. S. A. 88, 9458. Kwok, R., Rui Zhang, J., Tobe, S.S., 2005. Regulation of methyl farnesoate production by mandibular organs in the crayfish, Procambarus clarkii: a possible role for allatostatins. J. Insect Physiol. 51, 367–378. Lange, A.B., Chan, K.K., Stay, B., 1993. Effect of allatostatin and proctolin on antennal pulsatile organ and hindgut muscle in the cockroach, Diploptera punctata. Arch. Insect Biochem. Physiol. 24, 79–92. Laufer, H., Biggers, W.J., 2001. Unifying concepts learned from methyl farnesoate for invertebrate reproduction and post-embryonic development. Am Zool. 41, 442–457. Laufer, H., Borst, D., Baker, F.C., Reuter, C.C., Tsai, L.W., Schooley, D.A., Carrasco, C., Sinkus, M., 1987. Identification of a juvenile hormone-like compound in a crustacean. Science 235, 202–205. Laufer, H., Takac, P., Ahl, J., Laufer, M., 1997. Methyl farnesoate and the effect of eyestalk ablation on the morphogenesis of the juvenile female spider crab Libinia emarginata. Invertebr. Reprod. Dev. 31, 63–68. Li, Y., Hernandez-Martinez, S., Fernandez, F., Mayoral, J.G., Topalis, P., Priestap, H., Perez, M., Navare, A., Noriega, F.G., 2006. Biochemical, molecular, and functional characterization of PISCF-allatostatin, a regulator of juvenile hormone biosynthesis in the mosquito Aedes aegypti. J. Biol. Chem. 281, 34048. Lorenz, M.W., Kellner, R., Hoffmann, K.H., 1995a. A family of neuropeptides that inhibit juvenile hormone biosynthesis in the cricket, Gryllus bimaculatus. J. Biol. Chem. 270, 21103–21108. Lorenz, M.W., Kellner, R., Hoffmann, K.H., 1995b. Identification of two allatostatins from the cricket, Gryllus bimaculatus de Geer (Ensifera, Gryllidae): additional members of a family of neuropeptides inhibiting juvenile hormone biosynthesis. Regul. Pept. 57, 227–236. Lorenz, M.W., Hoffmann, K.H., Gade, G., 1999. Juvenile hormone biosynthesis in larval and adult stick insects, Carausius morosus. J. Insect Physiol. 45, 443–452. Lu, W., Wainwright, G., Webster, S.G., Rees, H.H., Turner, P.C., 2000. Clustering of mandibular organ-inhibiting hormone and moult-inhibiting hormone genes in the crab, Cancer pagurus, and implications for regulation of expression. Gene 253, 197–207. Ma, M., Chen, R., Sousa, G.L., Bors, E.K., Kwiatkowski, M.A., Goiney, C.C., Goy, M.F., Christie, A.E., Li, L., 2008. Mass spectral characterization of peptide transmitters/ hormones in the nervous system and neuroendocrine organs of the American lobster Homarus americanus. Gen. Comp. Endocrinol. 156, 395–409. Ma, M., Bors, E.K., Dickinson, E.S., Kwiatkowski, M.A., Sousa, G.L., Henry, R.P., Smith, C.M., Towle, D.W., Christie, A.E., Li, L., 2009a. Characterization of the Carcinus maenas neuropeptidome by mass spectrometry and functional genomics. Gen. Comp. Endocrinol. 161, 320–334. Ma, M., Szabo, T.M., Jia, C., Marder, E., Li, L., 2009b. Mass spectrometric characterization and physiological actions of novel crustacean C-type allatostatins. Peptides 30, 1660–1668. Ma, M., Wang, J., Chen, R., Li, L., 2009c. Expanding the crustacean neuropeptidome using a multifaceted mass spectrometric approach. J. Proteome Res. 8, 2426–2437. Ma, M., Gard, A.L., Xiang, F., Wang, J., Davoodian, N., Lenz, P.H., Malecha, S.R., Christie, A.E., Li, L., 2010. Combining in silico transcriptome mining and biological mass spectrometry for neuropeptide discovery in the Pacific white shrimp Litopenaeus vannamei. Peptides 31, 27–43. Martin, D., Piulachs, M.D., Belles, X., 1996. Inhibition of vitellogenin production by allatostatin in the German cockroach. Mol. Cell. Endocrinol. 121, 191–196. McDonald, A.A., Chang, E.S., Mykles, D.L., 2011. Cloning of a nitric oxide synthase from green shore crab, Carcinus maenas: a comparative study of the effects of eyestalk ablation on expression in the molting glands (Y-organs) of C. maenas, and blackback land crab, Gecarcinus lateralis. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 158, 150–162. Merkler, D.J., 1994. C-terminal amidated peptides: production by the bi> in vitrob/i> enzymatic amidation of glycine-extended peptides and the importance of the amide to bioactivity. Enzyme Microb. Technol. 16, 450–456.

347

Mykles, D.L., 2011. Ecdysteroid metabolism in crustaceans. J. Steroid Biochem. Mol. Biol. 127, 196–203. Nagaraju, G.P.C., 2007. Is methyl farnesoate a crustacean hormone? Aquaculture 272, 39–54. Nagaraju, G.P.C., Reddy, P.R., Reddy, P.S., 2004. Mandibular organ: its relation to body weight, sex, molt and reproduction in the crab, Oziotelphusa senex senex Fabricius (1791). Aquaculture 232, 603–612. Nakatsuji, T., Sonobe, H., Watson, R.D., 2006. Molt-inhibiting hormone-mediated regulation of ecdysteroid synthesis in Y-organs of the crayfish (Procambarus clarkii): involvement of cyclic GMP and cyclic nucleotide phosphodiesterase. Mol. Cell. Endocrinol. 253, 76–82. Pratt, G.E., Farnsworth, D.E., Siegel, N.R., Fok, K.F., Feyereisen, R., 1989. Identification of an allatostatin from adult Diploptera punctata. Biochem. Biophys. Res. Commun. 163, 1243–1247. Price, M.D., Merte, J., Nichols, R., Koladich, P.M., Tobe, S.S., Bendena, W.G., 2002. Drosophila melanogaster flatline encodes a myotropin orthologue to Manduca sexta allatostatin. Peptides 23, 787–794. Regier, J.C., Shultz, J.W., 1997. Molecular phylogeny of the major arthropod groups indicates polyphyly of crustaceans and a new hypothesis for the origin of hexapods. Mol. Biol. Evol. 14, 902–913. Richards, S., Gibbs, R.A., Weinstock, G.M., Brown, S.J., Denell, R., Beeman, R.W., Gibbs, R., Bucher, G., Friedrich, M., Grimmelikhuijzen, C.J., Klingler, M., Lorenzen, M., Roth, S., Schroder, R., Tautz, D., Zdobnov, E.M., Muzny, D., Attaway, T., Bell, S., Buhay, C.J., Chandrabose, M.N., Chavez, D., Clerk-Blankenburg, K.P., Cree, A., Dao, M., Davis, C., Chacko, J., Dinh, H., Dugan-Rocha, S., Fowler, G., Garner, T.T., Garnes, J., Gnirke, A., Hawes, A., Hernandez, J., Hines, S., Holder, M., Hume, J., Jhangiani, S.N., Joshi, V., Khan, Z.M., Jackson, L., Kovar, C., Kowis, A., Lee, S., Lewis, L.R., Margolis, J., Morgan, M., Nazareth, L.V., Nguyen, N., Okwuonu, G., Parker, D., Ruiz, S.J., Santibanez, J., Savard, J., Scherer, S.E., Schneider, B., Sodergren, E., Vattahil, S., Villasana, D., White, C.S., Wright, R., Park, Y., Lord, J., Oppert, B., Brown, S., Wang, L., Weinstock, G., Liu, Y., Worley, K., Elsik, C.G., Reese, J.T., Elhaik, E., Landan, G., Graur, D., Arensburger, P., Atkinson, P., Beidler, J., Demuth, J.P., Drury, D.W., Du, Y.Z., Fujiwara, H., Maselli, V., Osanai, M., Robertson, H.M., Tu, Z., Wang, J.J., Wang, S., Song, H., Zhang, L., Werner, D., Stanke, M., Morgenstern, B., Solovyev, V., Kosarev, P., Brown, G., Chen, H.C., Ermolaeva, O., Hlavina, W., Kapustin, Y., Kiryutin, B., Kitts, P., Maglott, D., Pruitt, K., Sapojnikov, V., Souvorov, A., Mackey, A.J., Waterhouse, R.M., Wyder, S., Kriventseva, E.V., Kadowaki, T., Bork, P., Aranda, M., Bao, R., Beermann, A., Berns, N., Bolognesi, R., Bonneton, F., Bopp, D., Butts, T., Chaumot, A., Denell, R.E., Ferrier, D.E., Gordon, C.M., Jindra, M., Lan, Q., Lattorff, H.M., Laudet, V., von Levetsow, C., Liu, Z., Lutz, R., Lynch, J.A., da Fonseca, R.N., Posnien, N., Reuter, R., Schinko, J.B., Schmitt, C., Schoppmeier, M., Shippy, T.D., Simonnet, F., Marques-Souza, H., Tomoyasu, Y., Trauner, J., Van der Zee, M., Vervoort, M., Wittkopp, N., Wimmer, E.A., Yang, X., Jones, A.K., Sattelle, D.B., Ebert, P.R., Nelson, D., Scott, J.G., Muthukrishnan, S., Kramer, K.J., Arakane, Y., Zhu, Q., Hogenkamp, D., Dixit, R., Jiang, H., Zou, Z., Marshall, J., Elpidina, E., Vinokurov, K., Oppert, C., Evans, J., Lu, Z., Zhao, P., Sumathipala, N., Altincicek, B., Vilcinskas, A., Williams, M., Hultmark, D., Hetru, C., Hauser, F., Cazzamali, G., Williamson, M., Li, B., Tanaka, Y., Predel, R., Neupert, S., Schachtner, J., Verleyen, P., Raible, F., Walden, K.K., Angeli, S., Foret, S., Schuetz, S., Maleszka, R., Miller, S.C., Grossmann, D., 2008. The genome of the model beetle and pest Tribolium castaneum. Nature 452, 949–955. Riehle, M.A., Garczynski, S.F., Crim, J.W., Hill, C.A., Brown, M.R., 2002. Neuropeptides and peptide hormones in Anopheles gambiae. Science 298, 172–175. Savard, J., Tautz, D., Richards, S., Weinstock, G.M., Gibbs, R.A., Werren, J.H., Tettelin, H., Lercher, M.J., 2006. Phylogenomic analysis reveals bees and wasps (Hymenoptera) at the base of the radiation of holometabolous insects. Genome Res. 16, 1334–1338. Schoofs, L., Holman, G.M., Hayes, T.K., Nachman, R.J., De Loof, A., 1991. Isolation, identification and synthesis of locustamyoinhibiting peptide (LOM-MIP), a novel biologically active neuropeptide from Locusta migratoria. Regul. Pept. 36, 111–119. Secher, T., Lenz, C., Cazzamali, G., Sorensen, G., Williamson, M., Hansen, G.N., Svane, P., Grimmelikhuijzen, C.J., 2001. Molecular cloning of a functional allatostatin gut/brain receptor and an allatostatin preprohormone from the silkworm Bombyx mori. J. Biol. Chem. 276, 47052–47060. Sheng, Z., Ma, L., Cao, M.X., Li, S., Jiang, R.J., 2007. Biochemical and molecular characterization of allatotropin and allatostatin from the Eri silkworm, Samia cynthia ricini. Insect Biochem. Mol. Biol. 37, 90–96. Stay, B., 2000. A review of the role of neurosecretion in the control of juvenile hormone synthesis: a tribute to Berta Scharrer. Insect Biochem. Mol. Biol. 30, 653–662. Stay, B., Tobe, S.S., 2007. The role of allatostatins in juvenile hormone synthesis in insects and crustaceans. Annu. Rev. Entomol. 52, 277–299. Stay, B., Sereg Bachmann, J., Stoltzman, C., Fairbairn, S., Yu, C., Tobe, S., 1994. Factors affecting allatostatin release in a cockroach (Diploptera punctata): nerve section, juvenile hormone analog and ovary. J. Insect Physiol. 40, 365–372. Stemmler, E.A., Bruns, E.A., Cashman, C.R., Dickinson, P.S., Christie, A.E., 2010. Molecular and mass spectral identification of the broadly conserved decapod crustacean neuropeptide pQIRYHQCYFNPISCF: the first PISCF-allatostatin (Manduca sexta- or C-type allatostatin) from a non-insect. Gen. Comp. Endocrinol. 165, 1–10. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tsukimura, B., Borst, D.W., 1992. Regulation of methyl farnesoate in the hemolymph and mandibular organ of the lobster, Homarus americanus. Gen. Comp. Endocrinol. 86, 297–303. Veelaert, D., Devreese, B., Schoofs, L., Van Beeumen, J., Vanden Broeck, J., Tobe, S.S., De Loof, A., 1996. Isolation and characterization of eight myoinhibiting peptides from the desert locust, Schistocerca gregaria: new members of the cockroach allatostatin family. Mol. Cell. Endocrinol. 122, 183–190.

348

U. Salma et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 334–348

Veenstra, J.A., 2000. Mono- and dibasic proteolytic cleavage sites in insect neuroendocrine peptide precursors. Arch. Insect Biochem. Physiol. 43, 49–63. Veenstra, J.A., 2009. Allatostatin C and its paralog allatostatin double C: the arthropod somatostatins. Insect Biochem. Mol. Biol. 39, 161–170. Wainwright, G., Webster, S.G., Rees, H.H., 1999. Involvement of adenosine cyclic-3′,5′monophosphate in the signal transduction pathway of mandibular organ-inhibiting hormone of the edible crab, Cancer pagurus. Mol. Cell. Endocrinol. 154, 55–62. Wang, J., Meyering-Vos, M., Hoffmann, K.H., 2004. Cloning and tissue-specific localization of cricket-type allatostatins from Gryllus bimaculatus. Mol. Cell. Endocrinol. 227, 41–51. Weaver, R.J., Audsley, N., 2009. Neuropeptide regulators of juvenile hormone synthesis: structures, functions, distribution, and unanswered questions. Ann. N. Y. Acad. Sci. 1163, 316–329. Webster, S.G., 1986. Neurohormonal control of ecdysteroid biosynthesis by Carcinus maenas Y-organs in vitro, and preliminary characterization of the putative moltinhibiting hormone (MIH). Gen. Comp. Endocrinol. 61, 237–247. Williamson, M., Lenz, C., Winther, A.M., Nassel, D.R., Grimmelikhuijzen, C.J., 2001. Molecular cloning, genomic organization, and expression of a B-type (cricket-type)

allatostatin preprohormone from Drosophila melanogaster. Biochem. Biophys. Res. Commun. 281, 544–550. Woodhead, A.P., Stay, B., Seidel, S.L., Khan, M.A., Tobe, S.S., 1989. Primary structure of four allatostatins: neuropeptide inhibitors of juvenile hormone synthesis. Proc. Natl. Acad. Sci. U. S. A. 86, 5997–6001. Yagi, K.J., Elliott, K.L., Teesch, L., Tobe, S.S., Stay, B., 2008. Isolation of cockroach Phe-GlyLeu-amide allatostatins from the termite, Reticulitermes flavipes and their effect on juvenile hormone synthesis. J. Insect Physiol. 54, 939–948. Yamanaka, N., Hua, Y.J., Roller, L., Spalovska-Valachova, I., Mizoguchi, A., Kataoka, H., Tanaka, Y., 2010. Bombyx prothoracicostatic peptides activate the sex peptide receptor to regulate ecdysteroid biosynthesis. Proc. Natl. Acad. Sci. U. S. A. 107, 2060–2065. Yin, G.L., Yang, J.S., Cao, J.X., Yang, W.J., 2006. Molecular cloning and characterization of FGLamide allatostatin gene from the prawn, Macrobrachium rosenbergii. Peptides 27, 1241–1250.