- Email: [email protected]
Molecular cloning and characterization of three novel Hemocyanins from Chinese mitten crab, Eriocheir sinensis
Aquaculture 434 (2014) 385–396
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Molecular cloning and characterization of three novel Hemocyanins from Chinese mitten crab, Eriocheir sinensis Ying Huang, Xin Huang, Libo Hou, Liang An, Kai-Min Hui, Qian Ren 1, Wen Wang 1 Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, PR China
a r t i c l e
i n f o
Article history: Received 13 May 2014 Received in revised form 29 July 2014 Accepted 31 July 2014 Available online 8 August 2014 Keywords: Eriocheir sinensis Hemocyanin Innate immunity Bacteria challenge
a b s t r a c t Hemocyanin is a copper-binding protein and plays a crucial role in the physiological processes in crustaceans. However, little is known about the hemocyanin from the Chinese mitten crab, Eriocheir sinensis. In this study, three forms of hemocyanins designated as EsHc1, EsHc2 and EsHc3 were cloned from E. sinensis by using expressed sequence tag (EST) analysis and rapid amplification of cDNA ends (RACE) approach. The open reading frames (ORFs) of EsHc1, EsHc2 and EsHc3 genes were 2182, 2580 and 2220 bp encoding proteins with 678, 662 and 691 amino acids, respectively, and all contain three tandem hemocyanin domains: 1) hemocyanin N, 2) hemocyanin M or tyrosinase, and 3) hemocyanin C domain. BLASTP and phylogenetic tree analysis showed that EsHc1 was clustered together with cryptocyanin 1 from Portunus pelagicus (PpCc1) and cryptocyanin from Metacarcinus magister (MmCc), EsHc2 and EsHc3 with hemocyanin from Pacifastacus leniusculus (PlHc) and hemocyanin subunit 1 from M. magister (MmHc1) were gathered into one clade. EsHc1 was mainly expressed in hepatopancreas and hemocytes with a lower level of expression in nerves, eyestalk, muscles, intestine, gills and heart; whereas EsHc2 and EsHc3 were mainly expressed in hepatopancreas and were also detected in hemocytes. Quantitative real-time RT-PCR analysis showed that EsHcs mRNA transcription in hepatopancreas was significantly expressed at various time points after infection with Lipopolysaccharide (LPS), peptidoglycan (PGN), Staphylococcus aureus, Vibrio parahaemolyticus and Aeromonas hydrophila. In summary, there is evidence that the three isoforms of hemocyanin genes participate in the innate immune response against bacteria infecting the Chinese mitten crab. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Chinese mitten crab Eriocheir sinensis is an economically important species and has been cultured commercially in China and other Asian countries (Li et al., 2007). With the development of intensive culture and environmental deterioration, this aquatic production frequently incurred serious infectious diseases caused by viruses, fungi, bacteria, spiroplasma and parasites, resulting in decreased growth in crab production and vast economic losses (Bonami and Zhang, 2011; Morado, 2011; Wang, 2011; Wang et al., 2002, 2004). As an invertebrate, crustaceans (including crabs) lack a true adaptive immune response system (Hoffmann and Reichhart, 2002). However, living in an aquatic environment rich in microorganisms, crabs have developed effective systems for detecting and eliminating noxious microorganisms, which depend entirely on a non-specific innate immune response (Mu et al., 2011). The defense mechanisms, largely based on the activity of blood cells, include hemolymph coagulation, a rapid and powerful system that prevents blood loss upon wounding and participates in the engulfment E-mail addresses: [email protected] (Q. Ren), [email protected], [email protected] (W. Wang). 1 Tel.: +86 25 85891955; fax: +86 25 85891526.
http://dx.doi.org/10.1016/j.aquaculture.2014.07.033 0044-8486/© 2014 Elsevier B.V. All rights reserved.
of invading microorganisms (Destoumieux et al., 1997). Therefore, studies on crustacean innate immunity are needed to provide new insights into the control of infectious diseases and the development of sustainable crab farming. Hemocyanin (Hc) is a large, oxygen-transport protein, freely dissolved in the hemolymph of various arthropods and mollusks (Van Holde and Miller, 1995), and plays an essential role in transporting exogenous copper to accumulator sites in respiratory pigment (Rtal and Truchot, 1996). Copper is a structural component of hemocyanin in the respiratory protein of crustaceans (Engel and Brouwer, 1987; Rainer and Brouwer, 1993). It has been well documented that the level of dietary copper is essential to the normal function of the immune system in animals (Bala and Failla, 1992; Lall, 2002). However, copper is not only an essential trace element but also is potentially toxic to animals. So an adequate level of copper in crustacean hemolymph is required (Lee and Shiau, 2002; Sun et al., 2011). Besides traditional function of hemocyanin as the transport and storage of molecular oxygen for many arthropods, it has been demonstrated that hemocyanin is a multi-functional protein involved in several physiological processes such as protein storage, osmotic regulation, ecdysone transportation, molting regulation and exoskeleton formation (Adachi et al., 2005; Jaenicke et al., 1999; Paul and Pirow, 1998).
386
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Table 1 Primers used in the current study. Primers name
Sequences (5′-3′)
EsHc1-F EsHc1-R EsHc2-F EsHc2-R EsHc3-F EsHc3-R UPM Long
TCCTTTGGTCCACCGAGACATCA AACCTGACGGTCGAGCATGGTGTAG GCCCCCGCTCTACGAGGTCACGC TCGGAGTGCGTGACGGCAATGTA GCCACCCTACACCGCCGACGAAC ATGCCGATGTCCTCGCCGAAGTAG
Short 5′-CDS Primer A SMARTerIIA oligo 3′-CDS primer A EsHc1-RT-F EsHc1-RT-R EsHc2-RT-F EsHc2-RT-R EsHc3-RT-F EsHc3-RT-R Es-GAPDH-RT-F Es-GAPDH-RT-R
CTAATACGACTCACTATAGGGCAAGCAGTGGT ATCAACGCAGAGT CTAATACGACTCACTATAGGGC T25VN AAGCAGTGGTATCAACGCAGAGTACXXXXX AAGCAGTGGTATCAACGCAGAGTAC(T)30VN TCACTGACGCTGCTGAGGACG CGATGAAGACGCCACGGTTGTA CAAGGGTAACGAGGAGGGTCT AAGTAGTAAAGGGGAGGGGGG TCGAGTTCTGGCTCAATGTGTA CTTAGTGCTGGTCTTTGTGTTT CTGCCCAAAACATCATCCCATC CTCTCATCCCCAGTGAAATCGC
(St. Louis, MO, USA). The Gram-positive bacterium S. aureus (obtained from the Shandong University), and Gram-negative bacterium V. parahaemolyticus (ATCC 17802, Microbial Culture Collection Center, Beijing, China) were grown in LB broth at 37 °C. Live A. hydrophila (ATCC 7966, Microbial Culture Collection Center, Beijing, China) were grown in LB broth at 28 °C.
2.2. Immune challenge in crabs Two hundred crabs were employed for the immune challenge experiment. The crabs were randomly divided into 6 groups (LPS-, PGN-, S. aureus-, A. hydrophila-, V. parahaemolyticus- and PBS-challenged groups) and each group contained 30 individuals. Each of the challenged groups received an injection of one of the following infectious pathogens: 50 μl LPS (0.5 μg/μl), 50 μl PGN (0.5 μg/μl), 50 μl of
X = undisclosed base in the proprietary SMARTer oligo sequence. N = A, C, G, or T; V = A, G, or C.
Recently, more and more reports reveal that hemocyanin can provide an immediate and rapid immune response to invading microorganisms, and it has been reported as a novel and important defense molecule of the non-specific innate immune system (Decker and Jaenicke, 2004; Decker et al., 2001; Jiang et al., 2007; Lei et al., 2008; Nagai et al., 2001; Zhang et al., 2004, 2006). For example, hemocyanin of the horseshoe crab Tachypleus tridentatus could be functionally converted into a phenoloxidase-like enzyme by the clotting enzyme and by chitin-binding antimicrobial peptides (Decker and Jaenicke, 2004; Decker et al., 2001). Hemocyanin isolated from horseshoe crab Carcinoscorpius rotundicauda is activated by microbial proteases to produce reactive oxygen species (ROS), resulting in formation of a strong antimicrobial response (Jiang et al., 2007; Nagai et al., 2001). The black tiger shrimp Penaeus monodon hemocyanin is an antiviral agent against a variety of viruses including DNA and RNA viruses (Zhang et al., 2004). Two subunits of hemocyanin from the penaeid prawn Penaeus japonicas exhibit differences in antiviral defense (Lei et al., 2008). Moreover, hemocyanin from shrimp Litopenaeus vannamei reacts with anti-human Ig as an antigen, binds to bacteria as an agglutinin, binds to vertebrate erythrocytes as a hemolysin, and acts as an immune-enhancing protein (Zhang et al., 2006). However, presently, the biological functions of E. sinensis hemocyanin have not been well studied, thus there is a need for further examination. In the present study, three novel hemocyanins were identified in the Chinese mitten crab E. sinensis (designated as EsHc1, EsHc2 and EsHc3). Their mRNA distributions in different tissues were studied, and the expression patterns were examined in hepatopancreas after crabs were challenged with lipopolysaccharide (LPS), peptidoglycan (PGN), Staphyloccocus aureus, Vibrio parahaemolyticus and Aeromonas hydrophila. This research contributes toward a better understanding of the innate immunity of E. sinensis. 2. Materials and methods 2.1. Experimental animals and microbes Healthy E. sinensis, averaging 60 g in weight, were collected from a local market in Yangzhou, Jiangsu Province, China, and cultured in 200 L aquaculture tanks containing freshwater and an aeration system at 23 ± 2 °C for two weeks before processing. Lipopolysaccharide (LPS) (Escherichia coli Serotype 055:B5) and peptidoglycan (PGN) (Micrococcus luteus) were purchased from Sigma
Fig. 1. Nucleotide (above) and the deduced amino acid sequences (below) of the EsHc1 to EsHc3 cDNAs from E. sinensis. Deduced amino acid residues are numbered on the right. Start codon and stop codon are shown in bold type. Signal peptide sequences are labeled in italics. The hemocyanin N domains of EsHc1 to EsHc3, located behind the signal peptide, are underlined; the hemocyanin M domain of EsHc1 or the tyrosinase domains of EsHc2 and EsHc3 are shaded; the boxes denote the hemocyanin C domains of EsHc1 to EsHc3.
Y. Huang et al. / Aquaculture 434 (2014) 385–396
387
Fig. 1 (continued).
live S. aureus suspension (approximately 3 × 107 cells), 50 μl of V. parahaemolyticus (3 × 107 cells) or 50 μl of A. hydrophila (3 × 105 cells). Crabs in the control group were injected with the same volume of Phosphate Buffered Saline (PBS, 0.14 M NaCl, 3 mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4). After treatment, the crabs were returned to the culture water tanks, and the hepatopancreas from every three crabs per group was randomly collected from the experimental and control groups at 0, 2, 6, 12 and 24 h post-injection, respectively. The hemolymph of healthy crabs was collected from the base of the third pereiopod using a 1-ml sterile syringe preloaded with an equal volume of improved anti-coagulant buffer (ACD-B) (Huang et al., 2013) and then centrifuged immediately at 2000 rpm for 5 min at 4 °C to isolate the hemocytes. Other tissues, such as heart, gills, muscles, intestines, nerves, and eyestalk were also collected from untreated crabs for tissue distribution studies and RNA extraction.
Fig. 1 (continued).
2.3. RNA extraction and cDNA synthesis 2.4. cDNA cloning of the full length of EsHc Total RNAs from hepatopancreas and different tissues were isolated using RNA pure high-purity total RNA rapid extraction kit (Spin-column, BioTeke, Beijing, China) according to the manufacturer's protocol. The integrity of total RNA was routinely checked with 1% agarose gel electrophoresis. The synthesis of the first strand cDNA for quantitative real-time RT-PCR analysis was performed by using the PrimeScript® 1st Strand cDNA Synthesis Kit (Takara, Dalian, China) with Oligod(T) as the primer. The mixture was incubated at 42 °C for 1 h, terminated by heating at 95 °C for 5 min, and subsequently stored at − 80 °C. To obtain the full length of hemocyanin genes, the 5′ and 3′ cDNA sequences for the rapid amplification of cDNA ends (RACE) were also synthesized using the hepatopancreas total RNA as template. The first strand cDNA (5′ cDNA and 3′ cDNA) was synthesized using a Clontech SMARTer™ RACE cDNA Amplification kit from Takara (Dalian, China) following manufacturer's instructions using 5′-CDS Primer A and SMARTer IIA oligo (5′-RACE Ready cDNA) and 3′-CDS Primer A (3′RACE-Ready cDNA). All primers are listed in Table 1.
Three expressed sequence tag (EST) sequences similar to hemocyanin gene were obtained from transcriptome sequencing of a cDNA library constructed from the hepatopancreas of E. sinensis. In detail, these ESTs were obtained from the hepatopancreas from E. sinensis using Illumina's Solexa Sequencing Technology performed by Chinese National Human Genome Center at Shanghai (data unpublished). Six gene-specific primers (EsHc1-F, EsHc1-R EsHc2-F, EsHc2-R and EsHc3F, EsHc3-R) were designed to obtain the full length of EsHc1, EsHc2 and EsHc3. A Clontech Advantage 2 PCR Kit from Takara (Dalian, China) was used for gene cloning and the PCR program was set as follows: 5 cycles at 94 °C for 30 s and 72 °C for 2 min; 5 cycles at 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 2 min; and 20 cycles at 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 2 min. The full length of EsHc1, EsHc2 and EsHc3 were obtained by overlapping the EST sequences and the 5′ and 3′ fragments. The primer sequences are shown in Table 1.
388
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Fig. 1 (continued).
2.5. Sequence and phylogenetic analysis Three EsHcs cDNA sequences were analyzed and compared using the BLASTX and BLASTP search programs through the GenBank database search (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Translation of cDNAs and predictions of the deduced proteins were performed using ExPASy (http://www.au.expasy.org/). Signal sequence and domain organization were predicted by SMART (http://smart.embl-heidelberg.de/). Calculated molecular weight and predicted isoelectric point of EsHcs were obtained through ExPASy (http://web.expasy.org/compute_pi/). Phylogenetic trees were constructed through the Neighbor-joining (NJ) method using the MEGA 5.05 software (Kumar et al., 2008). GENDOC software was used for the multiple alignments of the DNA and protein sequences of three hemocyanins.
2.6. Tissue distribution and expression pattern analysis of EsHc1 to EsHc3 by qRT-PCR Quantitative real-time PCR was used to analyze the tissue distributions of EsHc1, EsHc2, EsHc3 in heart, hemocytes, hepatopancreas, gills, muscles, intestines, nerves, and eyestalk using three pairs of specific primers (EsHc1-RT-F, EsHc1-RT-R; EsHc2-RT-F, EsHc2-RT-R; EsHc3RT-F, EsHc3-RT-R). Time-course analysis of these three genes in the hepatopancreas post LPS, PGN, S. aureus, A. hydrophila, V. parahaemolyticus and PBS challenge at 2, 6, 12, and 24 h were investigated using qRT-PCR methods with primers identical to those used in the tissue distribution analysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified for internal standardization with the primers Es-GAPDH-RTF and Es-GAPDH-RT-F (Table 1). A 2 × SYBR Premix Ex Taq kit (Takara,
Fig. 1 (continued).
Japan) was used in the qRT-PCR experiment according to the instructions of the manufacturer. The qRT-PCR was carried out in a total volume of 10 ul, containing 5 ul of 2 × SYBR Premix Ex TaqTM, 1 ul cDNA, and 2 ul of each forward and reverse primers (1 mmol/L). The qRT-PCR was programmed at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, and 60 °C for 30 s. Detailed methods were based on our previous published paper (Huang et al., 2014). 3. Result 3.1. Sequence characteristics of EsHc1 to EsHc3 Partial lengths of these three different cDNAs of hemocyanin genes (EsHc1 to EsHc3) from E. sinensis were obtained from the hepatopancreas. Based on these partial cDNA sequences, 5′ and 3′ RACE methods were performed to obtain the full cDNA sequences of EsHc1, EsHc2, and EsHc3. The complete nucleotide sequence of EsHc1 cDNA has 2182 bp in length consisting of a 2034 bp open reading frame (ORF) encoding a protein with 678 amino acids, a 15 bp 5′ terminal
Y. Huang et al. / Aquaculture 434 (2014) 385–396
389
hemocyanin N (128 amino acids), tyrosinase (144 amino acids) and hemocyanin C (250 amino acids) were also predicted in the deduced protein sequence of EsHc3. The theoretical pI and Mw of EsHc3 are 5.37 and 78.6 kDa, respectively. 3.2. Identity analysis, multiple alignments, and phylogenic analysis of EsHcs
Fig. 1 (continued).
untranslated region (UTR), and a 133 bp 3′ UTR with a poly (A) tail (Fig. 1A). The results from the SMART analysis showed that EsHc1 protein contains a signal peptide with 16 amino acids, and three tandem hemocyanin domains (hemocyanin N, hemocyanin M and hemocyanin C) (Fig. 2) comprising 127, 259 and 246 amino acids, respectively. The estimated molecular mass (Mw) and predicted isoelectric point (pI) of EsHc1 is 5.62 and 78.9 kDa. The full length of EsHc2 is 2580 bp, including a 26 bp 5′ UTR, a 568 bp 3′ UTR, and a 1986 bp ORF encoding a 662 amino acid peptide (Fig. 1B). A signal peptide region is present in the amino acid sequence between 1 and 18. Furthermore, two domains (hemocyanin N of 128 amino acids and hemocyanin C of 250 amino acids) were also predicted in EsHc2. Different from EsHc1, a tyrosinase domain of 128 amino acids replaced the hemocyanin M domain located between hemocyanin N and C domain in EsHc2. EsHc2 has a pI of 5.29 and an Mw of 75.3 kDa. EsHc3 gene has 2220 bp with a 26 bp 5′ UTR, a 121 bp 3′ UTR with a polyadenylation sequence AATAAA (position 2172 to 2177), a poly (A) tail, and a 2073 bp ORF encoding a peptide with 691 amino acids (Fig. 1C). Three conserved domains of
BLAST search showed that all the three forms exhibit similarity with Hcs from other crustaceans, such as shrimp, freshwater prawn, crayfish, and crab. BLASTP searches of the non-redundant protein database in GenBank showed that EsHc1 has the highest sequence similarity with PpCc1 from Portunus pelagicus (81% identity) and MmCc from Metacarcinus magister (80% identity). EsHc2 has 78% identity with hemocyanin subunit 1 from M. magister and 71% identity with hemocyanin from Pacifastacus leniusculus. Similarly, EsHc3 has 80% and 72% identity with hemocyanin from M. magister and P. leniusculus, respectively. The multiple alignments showed that hemocyanin genes from E. sinensis (EsHc1, EsHc2, EsHc3 and EsHc6) were highly conserved, especially EsHc2 and EsHc3, most of their amino acids are the same (Fig. 3). Conserved sequence and characteristic motifs of copperbinding proteins, metal-binding six histidine residues (H) were identified in the deduced amino acid sequences of EsHc2, EsHc3 and EsHc6, while EsHc1 has only three histidine residues (the first, second, third histidine residues). The fourth, fifth and sixth H were replaced by threonine (T), tyrosine (Y) and glutamine (Q), respectively. These conserved histidine residues are likely to be involved in binding copper. A phylogenetic tree was constructed based on the neighbor-joining method with the full-length hemocyanin family amino acid sequences. The result of the phylogenetic analysis revealed that majority of all Hc genes are clustered into three main clades (1, 2 and 3; Fig. 4). The strength of the supports on the tree varied, whereas some of the internal branches within the three clades are well resolved. EsHc1 together with cryptocyanin 1 from P. pelagicus (PpCc1) and cryptocyanin from M. magister (MmCc) are clustered into clade 3. Only four genes from three species (P. leniusculus, M. magister and E. sinensis) were gathered into clade 2, including the two genes (EsHc2 and EsHc3) identified in our study, which have close relationships with the PlHc gene and MmHc1 gene. Other Hcs in crustaceans and only one hemocyanin gene from E. sinensis (EsHc6), which were reported previously, are in clade 1. 3.3. Tissue distributions of EsHc1 to EsHc3 The qRT-PCR was used to investigate the tissue distributions of EsHc1 to EsHc3 transcripts. Results showed that EsHc1 was mainly expressed in the hepatopancreas and hemocytes with a lower level of expressions in the nerves, eyestalk, muscles, intestine, gills and heart.
Fig. 2. Distribution of three tandem hemocyanin domain of hemocyanin in E. sinensis.
390
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Fig. 3. Multiple alignments of EsHc1 to EsHc3 protein sequences. EsHc6: hemocyanin subunit 6 from Eriocheir sinensis (AEG64817.1). The six histidine residues within the copper-binding sites are boxed.
The transcript of EsHc2 was detected mainly in the hepatopancreas and a weak band was detected in hemocytes. EsHc3 was primarily expressed in the hepatopancreas and could also be detected in hemocytes (Fig. 5). 3.4. Expression pattern of EsHc1 to EsHc3 in the hepatopancreas upon bacterial challenge The expression levels of EsHc1 to EsHc3 upon challenge with LPS, PGN, S. aureus, V. parahaemolyticus and A. hydrophila were observed using qRT-PCR methods to investigate the roles of Hc genes from E. sinensis in anti-bacterial innate immunity. The transcript of EsHc1 in hepatopancreas was upregulated after the 2 h LPS challenge, reached the highest level at 6 h, and then declined from 12 h to 24 h. After PGN and S. aureus challenge, EsHc1 was also upregulated at 2, 6, and 12 h. At 2 h V. parahaemolyticus challenge, EsHc1 was upregulated and the subsequent expression was downregulated from 12 h to 24 h. EsHc1 further increased at 2, 12, and 24 h after A. hydrophila challenge (Fig. 6). EsHc2 was rapidly upregulated and peaked within 2 h of LPS and A. hydrophila challenge, and then decreased from 6 h to 24 h after challenge. EsHc2 was downregulated at 2 h after PGN challenge, in contrast to its upregulated expression at 6 h and 12 h. After S. aureus challenge, EsHc2 was initially upregulated at 2 h, decreased after 6 h, and finally increased again from 12 h to 24 h. The transcript of EsHc2 was lower at 2 h and 24 h after V. parahaemolyticus challenge (Fig. 7). EsHc3 quickly reached the highest level at 2 h post challenge, and then was continuously downregulated from 6 h to 12 h after V. parahaemolyticus challenge. After LPS and S. aureus challenge, EsHc3
exhibited an expression pattern similar to that of EsHc3 upon LPS challenge, the different is that EsHc3 expression was subsequently upregulated from 6 h to 24 h. By contrast, EsHc3 initially decreased at 2 h PGN challenge, and then increased at 6 h. EsHc3 was also upregulated at 2 h and 6 h after A. hydrophila challenge, and then quickly declined down to the lowest level from 12 h to 24 h (Fig. 8). In addition, the transcripts of EsHc1 to EsHc3 series in the hepatopancreas did not change obviously after PBS challenge from 2 h to 24 h. 4. Discussion In aquatic organisms, molecular characterization of immune genes is necessary for describing the immune mechanisms and for control of disease. Recently, hemocyanins, the main protein component of hemolymph from mollusks and arthropods, were reported as novel and important defense molecules of the non-specific innate immune system in invertebrates, especially in crustaceans (Decker and Jaenicke, 2004; Decker et al., 2001). So far, about 50 different hemocyanins from crustaceans, insects, chelicerates, myriapods and onychophorans have been characterized (Giomi and Beltramini, 2007). However, there is in fact little information on the structure, evolution, and physiological functions of hemocyanins from the Chinese mitten crab (E. sinensis). In the present study, three forms of hemocyanin genes (named EsHc1, EsHc2 and EsHc3) were identified from E. sinensis. The ORFs of EsHc1, EsHc2 and EsHc3 were 2182, 2580 and 2220 bp encoding a polypeptide of 678, 662 and 691 amino acids, respectively (Fig. 1A, B and C). All EsHcs contain a signal sequence between 1 and 16 amino acids
Y. Huang et al. / Aquaculture 434 (2014) 385–396
391
Fig. 4. Phylogenetic analysis of EsHc1 to EsHc3 with Hcs from other species. FcHc: hemocyanin from F. chinensis (ACM61982.1); PmHc: hemocyanin from P. monodon (AEB77775.1); FmHc: hemocyanin from Fenneropenaeus merguiensis (AGT20779.1); MnHc and MnHc1: hemocyanin and hemocyanin subunit 1 from Macrobrachium nipponense (AEC46861.1; AGA17871.1); MjHcL and MjHcY: hemocyanin subunit L and Y from Marsupenaeus japonicas (ABR14693.1; ABR14694.1); AmHc1: hemocyanin gamma subunit 1 from Atyopsis moluccensis (CCF55383.1); CqHc: hemocyanin from Cherax quadricarinatus (AFP23115.1); LvHc: hemocyanin from L. vannamei (CAA57880.1); CmHc1: hemocyanin gamma subunit 1 from Caridina multidentata (CCF55387.1); EsHc6: hemocyanin subunit 6 from E. sinensis (AEG64817.1); MmHc1 and MmHc6: hemocyanin subunit 1 and 6 from M. magister (AAW57889.1; AAA96966.2); MmCc: cryptocyanin from M. magister (AAD09762.1); PcHc: hemocyanin from Palaemon carinicauda (AEJ08191.1); PsHc: hemocyanin from Porcellio scaber (ACS44711.1); PvHc1: hemocyanin subunit 1 from Palinurus vulgaris (CAC69243.1); CsHc: hemocyanin from Cyamus scammoni (ABB59715.1); PlHc: hemocyanin from P. leniusculus (AAM81357.1); EpHc1: hemocyanin subunit 1 from Eurydice pulchra (ACS44712.1); PpCc1 and PpHc: cryptocyanin 1 and hemocyanin from P. pelagicus (ABM54471.1; ABM74407.1).
(EsHc1) or between 1 and 18 amino acids (EsHc2 and EsHc3), which is necessary for secretion from the endoplasmic reticulum, similar to EsHc6 from E. sinensis (Sun et al., 2012), FcHc from Fenneropenaeus chinensis (Sun et al., 2010) and MrHc from M. rosenbergii (Arockiaraj et al., 2013). The hemocyanin was typical of crustaceans, being folded into each of three domains, the first and third domains are the N- and C-terminals of hemocyanin, and the second domain contains the hemocyanin active site, which contains a combination of two copper ions CuA
and CuB (Sun et al., 2010). Like other hemocyanins, EsHc1 contains three tandem hemocyanin domains, including hemocyanin N, hemocyanin M and hemocyanin C; while EsHc2 and EsHc3 contain hemocyanin N, tyrosinase and hemocyanin C domains. Tyrosinase, a critical component of the arthropodan innate immune system (Cerenius and Söderhäll, 2004; Söderhäll and Cerenius, 1998), is involved in the formation of pigments such as melanin and other polyphenolic compounds (David et al., 2005). The CuA and CuB are present in the
392
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Fig. 5. Tissue distribution of EsHc1 to EsHc3 cDNAs from E. sinensis in heart, hemocytes, hepatopancreas, gills, muscle, intestine, nerve and eyestalk using qRT-PCR methods. Expression of the gene encoding GAPDH was used as the control.
α-helix region of the EsHcs protein. This may be a binding site with six conserved histidine residues (Arockiaraj et al., 2013). In the structure of EsHc2 and EsHc3, CuA is coordinated with His209, His213 and His237; whereas, CuB is coordinated with His356, His360 and His396. EsHc1 has
only one copper ion (CuA). CuA is coordinated with His219, His223 and His250. Copper is a structural component of hemocyanin, the respiratory protein of all crustaceans. Hemocyanins from other species, such as FcHc (Sun et al., 2010) and MrHc (Arockiaraj et al., 2013), have a similar structure. In the phylogenetic tree, EsHc1 was clustered together with PpCc1 and MmCc. Moreover, EsHc2 and EsHc3 clustered with PlHc and MmHc1 in one clade. However, EsHc6 also from E. sinensis was detached. The structural features and relationships displayed in the BLASTP result, and in the phylogenic tree, suggested that EsHcs reported in our study are classified as three new members of the Hcs superfamily of crabs. Tissue distribution analysis using qRT-PCR methods showed that EsHc1 mRNA was widely expressed in all detected tissues, including the heart, hemocytes, hepatopancreas, gills, muscles, intestine, nerves and eyestalk with the highest expression in hepatopancreas. This is in accordance with earlier research reports that the wide distributions of EsHc1 in various tissues may result from the infiltration of haemocytes into different tissues, because crabs possess an open circulation system (Sun et al., 2012). The mRNA transcripts of EsHc6 from E. sinensis (Sun et al., 2012), PjHcL and PjHcY from P. japonicas (Lei et al., 2008), and FcHc from F. chinensis (Sun et al., 2010) could also be detected widely in all the examined tissues with remarkably different expression levels. However, there is a significant differentiated tissue distribution of EsHc2 and EsHc3. The highest expression levels of EsHc2 and EsHc3 were detected in the hepatopancreas. It also was detected in hemocytes with relatively low expression level. Previous studies have shown that the hepatopancreas is a major site of Hcs production; whereas, hemocytes are the secondary expression site for Hcs. In our current research, the results showed that the hepatopancreas is the principal site of EsHcs synthesis, and hemocyte is also an important production site for EsHcs. It is thought that the innate immune system relies on its ability to rapidly detect pathogen-associated molecular patterns (PAMPs) displayed by invading pathogenic microbes, such as LPS, PGN and β1,3-glycan (Janeway, 1989; Medzhitov and Janeway, 1997; Vasta et al., 2004). So, research exploring the mRNA expressions of EsHcs after infection with different PAMPs and bacterium has proved to be helpful in deciphering the implications of those functions in the defense system. In this study, EsHcs mRNA transcriptions in hepatopancreas tissue were significantly expressed at various time points after infection with LPS, PGN, S. aureus, V. parahaemolyticus and A. hydrophila. In details, all of these three EsHc genes were upregulated by Vibrio challenge. EsHc1 was increased 14 times at 2 h after V. parahaemolyticus challenge, and EsHc3 was increased 1.5-fold. While EsHc2 transcript revealed two significant peaks following V. parahaemolyticus challenge (increasing about 2- and 1.7-fold at 2 h and 12 h after challenge, respectively). Vibriosis is the major bacterial disease caused by bacteria in the genus Vibrio (Jiravanichpaisal et al., 1994). The outbreaks of these diseases have led to high mortality rates of E. sinensis and the near or total collapse of the crab farming industry throughout the world (Xu et al., 2002). EsHc genes may participate in the anti-Vibrio immune response in E. sinensis. Similar to prior published reports (Sun et al., 2010), FcHc from F. chinensis shows antimicrobial activity against V. anguillarum, and furthermore FcHc was upregulated 3 h after Vibrio challenge, reached the highest level after 6 h, and then decreased after 12 h. This suggests that Hc genes act as effector molecules that may participate in the anti-Vibrio immune response in F. chinensis. MrHc (MrProPO) mRNA transcription in the hepatopancreas after V. harveyi injection was also significantly increased 19-fold at 24 h with subsequent decrease at 48 h (Arockiaraj et al., 2013). In hemocyanin protein levels, PmHc from the black tiger shrimp P. monodon has a remarkable 8-fold increase at 48 h post V. harveyi infection compared to that at 0 h (Somboonwiwat et al., 2010). Furthermore, EsHcs expressions were also upregulated under A. hydrophila challenge. EsHc1 was increased 3.5-fold at 24 h of A. hydrophila challenge, while EsHc2 and EsHc3 both were increased about 6.5-fold at 2 h after challenge. In a previous study, the expression of EsHc6 mRNA was up-regulated and peaked at
Y. Huang et al. / Aquaculture 434 (2014) 385–396
393
Fig. 6. qRT-PCR analysis of EsHc1 in the hepatopancreas of E. sinensis at 0, 2, 6, 12 and 24 h after LPS, PGN, S. aureus, A. hydrophila and V. parahaemolyticus challenge. The mRNA levels of EsHc1 were analyzed and standardized according to the GAPDH mRNA levels. Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with values of the control. Error bars represent ± S.D. of the three independent PCR amplifications and quantifications.
3 h by 7.7-fold after the A. hydrophila challenge, indicating it is possible to investigate that EsHc6 may be potentially involved in the immune responses of E. sinensis (Sun et al., 2012). In A. hydrophila-injected M. rosenbergii, MrHc mRNA expression significantly increased at 12, 24 and 48 h when compared to the control group (Arockiaraj et al., 2013). Therefore, the variation of EsHc gene expressions in the hepatopancreas after PAMPs and bacterial challenges indicate that hemocyanin protein is actively involved in the innate immune system of crab, thus enhancing its resistance against the entry of pathogens. In conclusion, the cDNAs of EsHc1 to EsHc3 were cloned from E. sinensis. Tissue distribution and expression patterns of EsHcs after LPS, PGN, S. aureus, V. parahaemolyticus and A. hydrophila challenge were investigated through qRT-PCR. From the molecular characterization and expression pattern, there is evidence that EsHcs are believed
to play an important role in crab innate immunity. However, further research is needed to clarify the more precise role and immune functions of EsHcs in crab immune defense. Acknowledgments We appreciate Professor O. Roger Anderson (Columbia University) for editing the manuscript. This work was supported by grants from the National Natural Sciences Foundation of China (NSFC Nos.31170120, 31101926, 31272686, and 31200139), The Natural Science Foundation of Jiangsu Province (BK20131401), Natural Science Fund of Colleges and universities in Jiangsu Province (13KJB240002), Jiangsu Agriculture Science and Technology Innovation Fund (JASTIF) CX (12)3066, Project for Aquaculture in Jiangsu Province (Nos. Y2013-45, D2013-5-3, and
394
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Fig. 7. qRT-PCR analysis of EsHc2 in the hepatopancreas of E. sinensis at 0, 2, 6, 12 and 24 h after LPS, PGN, S. aureus, A. hydrophila and V. parahaemolyticus challenge. The mRNA levels of EsHc2 were analyzed and standardized according to the GAPDH mRNA levels. Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with values of the control. Error bars represent ± S.D. of the three independent PCR amplifications and quantifications.
D2013-5-4) and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
References Adachi, K., Wakamatsu, K., Ito, S., Miyamoto, N., Kokubo, T., Nishioka, T., et al., 2005. An oxygen transporter hemocyanin can act on the late pathway of melanin synthesis. Pigment Cell Res. 18, 214–219. Arockiaraj, J., Gnanam, A.J., Pothikasalam, G.,Milton, J.,Pasupuleti, M.,Bhatt, P.,Palanisamy, R., Kumaresan, V., Thirumalai, M.K., Arasu, A., Sathyamoorthi, A., Prabha, N., 2013. A novel prophenoloxidase, hemocyanin encoded copper containing active enzyme from prawn: Gene characterization. Gene 524, 139–151. Bala, S.,Failla, M.C., 1992. Copper deficiency reversibly impairs DNA synthesis in activated T lymphocytes by limiting interleukin 2 activity. Proc. Natl. Acad. Sci. 89, 6794–6797. Bonami, J.R., Zhang, S., 2011. Viral diseases in commercially exploited crabs: a review. J. Invertebr. Pathol. 106, 6–17. Cerenius, L.,Söderhäll, K., 2004. The prophenoloxidase-activating system in invertebrates. Immunol. Rev. 198, 116–126. David, M.L., Lisha, N.B., Shufei, Z., Sheri, A.A., James, B.N., Michael, R.K., 2005. A hemocytespecific integrin required for hemocytic encapsulation in tobacco horn worm, Manduca sexta. Insect Biochem. Mol. Biol. 35, 369–380.
Decker, H.,Jaenicke, E., 2004. Recent findings on phenoloxidase activity and antimicrobial activity of hemocyanins. Dev. Comp. Immunol. 28, 673–687. Decker, H.,Ryan, M.,Jaenicke, E.,Terwilliger, N., 2001. SDS-induced phenoloxidase activity of hemocyanins from Limulus polyphemus, Eurypelma californicum, and Cancer magister. J. Biol. Chem. 276, 17796–17799. Destoumieux, D., Bulet, P., Loew, D., Dorsselaer, A.V., Rodriguez, J., Bachere, E., 1997. Penaeidins, a new family of antimicrobial peptides isolated from the shrimp Penaeus vannamei (Decapoda). J. Biol. Chem. 272, 28398–28406. Engel, D.W.,Brouwer, M., 1987. Metal regulation and molting in the blue crab, Callinectes sapidus: metallothione in function in metal metabolism. Biol. Bull. 173, 239–251. Giomi, F.,Beltramini, M., 2007. The molecular heterogeneity of hemocyanin: its role in the adaptive plasticity of crustacea. Gene 398, 192–201. Hoffmann, J.A., Reichhart, J.M., 2002. Drosophila innate immunity: an evolutionary perspective. Nat. Immunol. 3, 121–126. Huang, Y.,Li, Y.R.,An, L.,Hui, K.M.,Ren, Q.,Wang, W., 2013. Cloning and characterization of a clip domain serine protease and its homolog (Masquerade) from Eriocheir sinensis. Fish Shellfish Immunol. 35, 1155–1162. Huang, Y.,An, L.,Hui, K.M.,Ren, Q.,Wang, W., 2014. An LDLa domain-containing C-type lectin is involved in the innate immunity of Eriocheir sinensis. Dev. Comp. Immunol. 42, 333–344. Jaenicke, E., Föll, R., Decker, H., 1999. Spider hemocyanin binds ecdysone and 20-OHecdysone. J. Biol. Chem. 274, 34267–34271. Janeway Jr., C.A., 1989. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb. Symp. Quant. Biol. 54 (Pt1), 1–13.
Y. Huang et al. / Aquaculture 434 (2014) 385–396
395
Fig. 8. qRT-PCR analysis of EsHc3 in the hepatopancreas of E. sinensis at 0, 2, 6, 12 and 24 h after LPS, PGN, S. aureus, A. hydrophila and V. parahaemolyticus challenges. The mRNA levels of EsHc3 were analyzed and standardized according to the GAPDH mRNA levels. Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with values of the control. Error bars represent ± S.D. of the three independent PCR amplifications and quantifications.
Jiang, N., Tan, N.S., Ho, B., Ding, J.L., 2007. Respiratory protein-generated reactive oxygen species as an antimicrobial strategy. Nat. Immunol. 8 (10), 1114–1122. Jiravanichpaisal, P., Miyazaki, T., Limsuwan, C., 1994. Histopathology, biochemistry, and pathogenicity of Vibrio harveyi infecting black tiger prawn Penaeus monodon. J. Aquat. Anim. Health 6, 27–35. Kumar, S.,Nei, M.,Dudley, J.,Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306. Lall, S.P., 2002. The minerals. In: Halver, J.E., Hardy, R.W. (Eds.), Fish nutrition. Academic Press, New York, pp. 259–308. Lee, M.H., Shiau, S.Y., 2002. Dietary copper requirement of juvenile grass shrimp, Penaeus mondon, and effects on non-specific immune responses. Fish Shellfish Immunol. 13 (4), 259–270. Lei, K.Y., Li, F., Zhang, M.C., Yang, H.J., Luo, T.,Xu, X., 2008. Difference between hemocyanin subunits from shrimp Penaeus japonicus in anti-WSSV defense. Dev. Comp. Immunol. 32 (7), 808–813. Li, X.D.,Lei, Y.Z.,Gao, X.D.,Ma, C.Y.,Dong, S.L., 2007. Calcium carbonate supersaturation and precipitation in Chinese mitten crab (Eriocheir japonica sinensis) larval ponds in China: mass mortality, crystal form analysis, and safety saturation index. Aquaculture 272, 361–369. Medzhitov, R., Janeway Jr., C.A., 1997. Innate immunity: impact on the adaptive immune response. Curr. Opin. Immunol. 9, 4–9. Morado, J.F., 2011. Protistan diseases of commercially important crabs: a review. J. Invertebr. Pathol. 106, 27–53.
Mu, C., Zheng, P., Zhao, J., Wang, L., Qiu, L., Zhang, H., et al., 2011. A novel type III crustin (CrusEs2) identified from Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 31 (1), 142–147. Nagai, T., Osaki, T., Kawabata, S.-I., 2001. Functional conversion of hemocyanin to phenoloxidase by horseshoe crab antimicrobial peptides. J. Biol. Chem. 276, 27166–27170. Paul, R.J.,Pirow, R., 1998. The physiological significance of respiratory proteins in invertebrates. Zoology 100, 298–306. Rainer, J., Brouwer, M., 1993. Hemocyanin synthesis in the blue crab Callinectes sapidus. Comp. Biochem. Physiol. B 104, 69–73. Rtal, A.,Truchot, J.P., 1996. Haemolymph transport and tissue accumulation of exogenous copper in the shore crab, Carcinus maenas. Mar. Pollut. Bull. 32, 802–811. Söderhäll, K., Cerenius, L., 1998. Role of the prophenoloxidase-activating system in invertebrate immunity. Curr. Opin. Immunol. 10, 23–28. Somboonwiwat, K., Chaikeeratisak, V., Wang, H.C., Lo, C.F., Tassanakajon, A., 2010. Proteomic analysis of differentially expressed proteins in Penaeus monodon hemocytes after Vibrio harveyi infection. Proteome Sci. 8, 39. Sun, J., Wang, B.J., Sun, Z.J., Li, X.H., Jiang, S., 2010. cDNA cloning and sequence analysis of hemocyanin in Fenneropenaeus chinensis. Prog. Fish. Sci. 1, 1–14 [in Chinese with English abstract]. Sun, S.M.,Chen, M.,Chen, L.Q.,Jiang, H.B.,Li, E.C., 2011. Optimal dietary copper and zinc requirements for juvenile Chinese mitten crab, Eriocheir sinensis. Isr. J. Aquacult. Bamidgeh 63 (3), 580–687.
396
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Sun, S.M., Chen, L.Q., Qin, J.G., Ye, J.Y., Qin, C.J., Jiang, H.B., Li, E.C., 2012. Molecular cloning, characterization and mRNA expression of copper-binding protein hemocyanin subunit in Chinese mitten crab, Eriocheir sinensis. Fish Shellfish Immunol. 33, 1222–1228. Van Holde, K.E., Miller, K.I., 1995. Hemocyanins. Adv. Protein Chem. 47, 1–81. Vasta, G.R.,Ahmed, H.,Odom, E.W., 2004. Structural and functional diversity of lectin repertoires in invertebrates, protochordates and ectothermic vertebrates. Curr. Opin. Struct. Biol. 14, 617–630. Wang, W., 2011. Bacterial diseases of crabs: a review. J. Invertebr. Pathol. 106, 18–26. Wang, W.,Zhu, N.N.,Gu, Z.F.,Du, K.,Xu, Z.K., 2002. Study on the transmission of tremor disease (TD) in the Chinese mitten crab, Eriocheir sinensis (Crustacea: Decapoda). J. Invertebr. Pathol. 81, 202–204.
Wang, W., Chen, J.X., Du, K.H., Xu, Z.K., 2004. Morphology of spiroplasmas in the Chinese mitten crab Eriocheir sinensis associated with tremor disease. Res. Microbiol. 155, 630–635. Xu, H.S., Shu, M.A., Zhan, X.A., Wang, S.X., 2002. Identification of Vibrio parahaemolyticus isolated from cultured Eriocheir sinensis and pathogenicity of its extracellular products. J. Fish. China 26, 357–362. Zhang, X.B.,Huang, C.H.,Qin, Q.W., 2004. Antiviral properties of hemocyanin isolated from Penaeus monodon. Antiviral Res. 61, 93–99. Zhang, Y.L., Wang, S.Y., Xu, A.L., Chen, Y., Lin, B.K., Peng, X.X., 2006. Affinity proteomic approach for identification of an IgA-like protein in Litopenaeus vannamei and study on its agglutination characterization. J. Proteome Res. 5, 815–821.
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Molecular cloning and characterization of three novel Hemocyanins from Chinese mitten crab, Eriocheir sinensis Ying Huang, Xin Huang, Libo Hou, Liang An, Kai-Min Hui, Qian Ren 1, Wen Wang 1 Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, PR China
a r t i c l e
i n f o
Article history: Received 13 May 2014 Received in revised form 29 July 2014 Accepted 31 July 2014 Available online 8 August 2014 Keywords: Eriocheir sinensis Hemocyanin Innate immunity Bacteria challenge
a b s t r a c t Hemocyanin is a copper-binding protein and plays a crucial role in the physiological processes in crustaceans. However, little is known about the hemocyanin from the Chinese mitten crab, Eriocheir sinensis. In this study, three forms of hemocyanins designated as EsHc1, EsHc2 and EsHc3 were cloned from E. sinensis by using expressed sequence tag (EST) analysis and rapid amplification of cDNA ends (RACE) approach. The open reading frames (ORFs) of EsHc1, EsHc2 and EsHc3 genes were 2182, 2580 and 2220 bp encoding proteins with 678, 662 and 691 amino acids, respectively, and all contain three tandem hemocyanin domains: 1) hemocyanin N, 2) hemocyanin M or tyrosinase, and 3) hemocyanin C domain. BLASTP and phylogenetic tree analysis showed that EsHc1 was clustered together with cryptocyanin 1 from Portunus pelagicus (PpCc1) and cryptocyanin from Metacarcinus magister (MmCc), EsHc2 and EsHc3 with hemocyanin from Pacifastacus leniusculus (PlHc) and hemocyanin subunit 1 from M. magister (MmHc1) were gathered into one clade. EsHc1 was mainly expressed in hepatopancreas and hemocytes with a lower level of expression in nerves, eyestalk, muscles, intestine, gills and heart; whereas EsHc2 and EsHc3 were mainly expressed in hepatopancreas and were also detected in hemocytes. Quantitative real-time RT-PCR analysis showed that EsHcs mRNA transcription in hepatopancreas was significantly expressed at various time points after infection with Lipopolysaccharide (LPS), peptidoglycan (PGN), Staphylococcus aureus, Vibrio parahaemolyticus and Aeromonas hydrophila. In summary, there is evidence that the three isoforms of hemocyanin genes participate in the innate immune response against bacteria infecting the Chinese mitten crab. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Chinese mitten crab Eriocheir sinensis is an economically important species and has been cultured commercially in China and other Asian countries (Li et al., 2007). With the development of intensive culture and environmental deterioration, this aquatic production frequently incurred serious infectious diseases caused by viruses, fungi, bacteria, spiroplasma and parasites, resulting in decreased growth in crab production and vast economic losses (Bonami and Zhang, 2011; Morado, 2011; Wang, 2011; Wang et al., 2002, 2004). As an invertebrate, crustaceans (including crabs) lack a true adaptive immune response system (Hoffmann and Reichhart, 2002). However, living in an aquatic environment rich in microorganisms, crabs have developed effective systems for detecting and eliminating noxious microorganisms, which depend entirely on a non-specific innate immune response (Mu et al., 2011). The defense mechanisms, largely based on the activity of blood cells, include hemolymph coagulation, a rapid and powerful system that prevents blood loss upon wounding and participates in the engulfment E-mail addresses: [email protected] (Q. Ren), [email protected], [email protected] (W. Wang). 1 Tel.: +86 25 85891955; fax: +86 25 85891526.
http://dx.doi.org/10.1016/j.aquaculture.2014.07.033 0044-8486/© 2014 Elsevier B.V. All rights reserved.
of invading microorganisms (Destoumieux et al., 1997). Therefore, studies on crustacean innate immunity are needed to provide new insights into the control of infectious diseases and the development of sustainable crab farming. Hemocyanin (Hc) is a large, oxygen-transport protein, freely dissolved in the hemolymph of various arthropods and mollusks (Van Holde and Miller, 1995), and plays an essential role in transporting exogenous copper to accumulator sites in respiratory pigment (Rtal and Truchot, 1996). Copper is a structural component of hemocyanin in the respiratory protein of crustaceans (Engel and Brouwer, 1987; Rainer and Brouwer, 1993). It has been well documented that the level of dietary copper is essential to the normal function of the immune system in animals (Bala and Failla, 1992; Lall, 2002). However, copper is not only an essential trace element but also is potentially toxic to animals. So an adequate level of copper in crustacean hemolymph is required (Lee and Shiau, 2002; Sun et al., 2011). Besides traditional function of hemocyanin as the transport and storage of molecular oxygen for many arthropods, it has been demonstrated that hemocyanin is a multi-functional protein involved in several physiological processes such as protein storage, osmotic regulation, ecdysone transportation, molting regulation and exoskeleton formation (Adachi et al., 2005; Jaenicke et al., 1999; Paul and Pirow, 1998).
386
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Table 1 Primers used in the current study. Primers name
Sequences (5′-3′)
EsHc1-F EsHc1-R EsHc2-F EsHc2-R EsHc3-F EsHc3-R UPM Long
TCCTTTGGTCCACCGAGACATCA AACCTGACGGTCGAGCATGGTGTAG GCCCCCGCTCTACGAGGTCACGC TCGGAGTGCGTGACGGCAATGTA GCCACCCTACACCGCCGACGAAC ATGCCGATGTCCTCGCCGAAGTAG
Short 5′-CDS Primer A SMARTerIIA oligo 3′-CDS primer A EsHc1-RT-F EsHc1-RT-R EsHc2-RT-F EsHc2-RT-R EsHc3-RT-F EsHc3-RT-R Es-GAPDH-RT-F Es-GAPDH-RT-R
CTAATACGACTCACTATAGGGCAAGCAGTGGT ATCAACGCAGAGT CTAATACGACTCACTATAGGGC T25VN AAGCAGTGGTATCAACGCAGAGTACXXXXX AAGCAGTGGTATCAACGCAGAGTAC(T)30VN TCACTGACGCTGCTGAGGACG CGATGAAGACGCCACGGTTGTA CAAGGGTAACGAGGAGGGTCT AAGTAGTAAAGGGGAGGGGGG TCGAGTTCTGGCTCAATGTGTA CTTAGTGCTGGTCTTTGTGTTT CTGCCCAAAACATCATCCCATC CTCTCATCCCCAGTGAAATCGC
(St. Louis, MO, USA). The Gram-positive bacterium S. aureus (obtained from the Shandong University), and Gram-negative bacterium V. parahaemolyticus (ATCC 17802, Microbial Culture Collection Center, Beijing, China) were grown in LB broth at 37 °C. Live A. hydrophila (ATCC 7966, Microbial Culture Collection Center, Beijing, China) were grown in LB broth at 28 °C.
2.2. Immune challenge in crabs Two hundred crabs were employed for the immune challenge experiment. The crabs were randomly divided into 6 groups (LPS-, PGN-, S. aureus-, A. hydrophila-, V. parahaemolyticus- and PBS-challenged groups) and each group contained 30 individuals. Each of the challenged groups received an injection of one of the following infectious pathogens: 50 μl LPS (0.5 μg/μl), 50 μl PGN (0.5 μg/μl), 50 μl of
X = undisclosed base in the proprietary SMARTer oligo sequence. N = A, C, G, or T; V = A, G, or C.
Recently, more and more reports reveal that hemocyanin can provide an immediate and rapid immune response to invading microorganisms, and it has been reported as a novel and important defense molecule of the non-specific innate immune system (Decker and Jaenicke, 2004; Decker et al., 2001; Jiang et al., 2007; Lei et al., 2008; Nagai et al., 2001; Zhang et al., 2004, 2006). For example, hemocyanin of the horseshoe crab Tachypleus tridentatus could be functionally converted into a phenoloxidase-like enzyme by the clotting enzyme and by chitin-binding antimicrobial peptides (Decker and Jaenicke, 2004; Decker et al., 2001). Hemocyanin isolated from horseshoe crab Carcinoscorpius rotundicauda is activated by microbial proteases to produce reactive oxygen species (ROS), resulting in formation of a strong antimicrobial response (Jiang et al., 2007; Nagai et al., 2001). The black tiger shrimp Penaeus monodon hemocyanin is an antiviral agent against a variety of viruses including DNA and RNA viruses (Zhang et al., 2004). Two subunits of hemocyanin from the penaeid prawn Penaeus japonicas exhibit differences in antiviral defense (Lei et al., 2008). Moreover, hemocyanin from shrimp Litopenaeus vannamei reacts with anti-human Ig as an antigen, binds to bacteria as an agglutinin, binds to vertebrate erythrocytes as a hemolysin, and acts as an immune-enhancing protein (Zhang et al., 2006). However, presently, the biological functions of E. sinensis hemocyanin have not been well studied, thus there is a need for further examination. In the present study, three novel hemocyanins were identified in the Chinese mitten crab E. sinensis (designated as EsHc1, EsHc2 and EsHc3). Their mRNA distributions in different tissues were studied, and the expression patterns were examined in hepatopancreas after crabs were challenged with lipopolysaccharide (LPS), peptidoglycan (PGN), Staphyloccocus aureus, Vibrio parahaemolyticus and Aeromonas hydrophila. This research contributes toward a better understanding of the innate immunity of E. sinensis. 2. Materials and methods 2.1. Experimental animals and microbes Healthy E. sinensis, averaging 60 g in weight, were collected from a local market in Yangzhou, Jiangsu Province, China, and cultured in 200 L aquaculture tanks containing freshwater and an aeration system at 23 ± 2 °C for two weeks before processing. Lipopolysaccharide (LPS) (Escherichia coli Serotype 055:B5) and peptidoglycan (PGN) (Micrococcus luteus) were purchased from Sigma
Fig. 1. Nucleotide (above) and the deduced amino acid sequences (below) of the EsHc1 to EsHc3 cDNAs from E. sinensis. Deduced amino acid residues are numbered on the right. Start codon and stop codon are shown in bold type. Signal peptide sequences are labeled in italics. The hemocyanin N domains of EsHc1 to EsHc3, located behind the signal peptide, are underlined; the hemocyanin M domain of EsHc1 or the tyrosinase domains of EsHc2 and EsHc3 are shaded; the boxes denote the hemocyanin C domains of EsHc1 to EsHc3.
Y. Huang et al. / Aquaculture 434 (2014) 385–396
387
Fig. 1 (continued).
live S. aureus suspension (approximately 3 × 107 cells), 50 μl of V. parahaemolyticus (3 × 107 cells) or 50 μl of A. hydrophila (3 × 105 cells). Crabs in the control group were injected with the same volume of Phosphate Buffered Saline (PBS, 0.14 M NaCl, 3 mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4). After treatment, the crabs were returned to the culture water tanks, and the hepatopancreas from every three crabs per group was randomly collected from the experimental and control groups at 0, 2, 6, 12 and 24 h post-injection, respectively. The hemolymph of healthy crabs was collected from the base of the third pereiopod using a 1-ml sterile syringe preloaded with an equal volume of improved anti-coagulant buffer (ACD-B) (Huang et al., 2013) and then centrifuged immediately at 2000 rpm for 5 min at 4 °C to isolate the hemocytes. Other tissues, such as heart, gills, muscles, intestines, nerves, and eyestalk were also collected from untreated crabs for tissue distribution studies and RNA extraction.
Fig. 1 (continued).
2.3. RNA extraction and cDNA synthesis 2.4. cDNA cloning of the full length of EsHc Total RNAs from hepatopancreas and different tissues were isolated using RNA pure high-purity total RNA rapid extraction kit (Spin-column, BioTeke, Beijing, China) according to the manufacturer's protocol. The integrity of total RNA was routinely checked with 1% agarose gel electrophoresis. The synthesis of the first strand cDNA for quantitative real-time RT-PCR analysis was performed by using the PrimeScript® 1st Strand cDNA Synthesis Kit (Takara, Dalian, China) with Oligod(T) as the primer. The mixture was incubated at 42 °C for 1 h, terminated by heating at 95 °C for 5 min, and subsequently stored at − 80 °C. To obtain the full length of hemocyanin genes, the 5′ and 3′ cDNA sequences for the rapid amplification of cDNA ends (RACE) were also synthesized using the hepatopancreas total RNA as template. The first strand cDNA (5′ cDNA and 3′ cDNA) was synthesized using a Clontech SMARTer™ RACE cDNA Amplification kit from Takara (Dalian, China) following manufacturer's instructions using 5′-CDS Primer A and SMARTer IIA oligo (5′-RACE Ready cDNA) and 3′-CDS Primer A (3′RACE-Ready cDNA). All primers are listed in Table 1.
Three expressed sequence tag (EST) sequences similar to hemocyanin gene were obtained from transcriptome sequencing of a cDNA library constructed from the hepatopancreas of E. sinensis. In detail, these ESTs were obtained from the hepatopancreas from E. sinensis using Illumina's Solexa Sequencing Technology performed by Chinese National Human Genome Center at Shanghai (data unpublished). Six gene-specific primers (EsHc1-F, EsHc1-R EsHc2-F, EsHc2-R and EsHc3F, EsHc3-R) were designed to obtain the full length of EsHc1, EsHc2 and EsHc3. A Clontech Advantage 2 PCR Kit from Takara (Dalian, China) was used for gene cloning and the PCR program was set as follows: 5 cycles at 94 °C for 30 s and 72 °C for 2 min; 5 cycles at 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 2 min; and 20 cycles at 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 2 min. The full length of EsHc1, EsHc2 and EsHc3 were obtained by overlapping the EST sequences and the 5′ and 3′ fragments. The primer sequences are shown in Table 1.
388
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Fig. 1 (continued).
2.5. Sequence and phylogenetic analysis Three EsHcs cDNA sequences were analyzed and compared using the BLASTX and BLASTP search programs through the GenBank database search (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Translation of cDNAs and predictions of the deduced proteins were performed using ExPASy (http://www.au.expasy.org/). Signal sequence and domain organization were predicted by SMART (http://smart.embl-heidelberg.de/). Calculated molecular weight and predicted isoelectric point of EsHcs were obtained through ExPASy (http://web.expasy.org/compute_pi/). Phylogenetic trees were constructed through the Neighbor-joining (NJ) method using the MEGA 5.05 software (Kumar et al., 2008). GENDOC software was used for the multiple alignments of the DNA and protein sequences of three hemocyanins.
2.6. Tissue distribution and expression pattern analysis of EsHc1 to EsHc3 by qRT-PCR Quantitative real-time PCR was used to analyze the tissue distributions of EsHc1, EsHc2, EsHc3 in heart, hemocytes, hepatopancreas, gills, muscles, intestines, nerves, and eyestalk using three pairs of specific primers (EsHc1-RT-F, EsHc1-RT-R; EsHc2-RT-F, EsHc2-RT-R; EsHc3RT-F, EsHc3-RT-R). Time-course analysis of these three genes in the hepatopancreas post LPS, PGN, S. aureus, A. hydrophila, V. parahaemolyticus and PBS challenge at 2, 6, 12, and 24 h were investigated using qRT-PCR methods with primers identical to those used in the tissue distribution analysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified for internal standardization with the primers Es-GAPDH-RTF and Es-GAPDH-RT-F (Table 1). A 2 × SYBR Premix Ex Taq kit (Takara,
Fig. 1 (continued).
Japan) was used in the qRT-PCR experiment according to the instructions of the manufacturer. The qRT-PCR was carried out in a total volume of 10 ul, containing 5 ul of 2 × SYBR Premix Ex TaqTM, 1 ul cDNA, and 2 ul of each forward and reverse primers (1 mmol/L). The qRT-PCR was programmed at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, and 60 °C for 30 s. Detailed methods were based on our previous published paper (Huang et al., 2014). 3. Result 3.1. Sequence characteristics of EsHc1 to EsHc3 Partial lengths of these three different cDNAs of hemocyanin genes (EsHc1 to EsHc3) from E. sinensis were obtained from the hepatopancreas. Based on these partial cDNA sequences, 5′ and 3′ RACE methods were performed to obtain the full cDNA sequences of EsHc1, EsHc2, and EsHc3. The complete nucleotide sequence of EsHc1 cDNA has 2182 bp in length consisting of a 2034 bp open reading frame (ORF) encoding a protein with 678 amino acids, a 15 bp 5′ terminal
Y. Huang et al. / Aquaculture 434 (2014) 385–396
389
hemocyanin N (128 amino acids), tyrosinase (144 amino acids) and hemocyanin C (250 amino acids) were also predicted in the deduced protein sequence of EsHc3. The theoretical pI and Mw of EsHc3 are 5.37 and 78.6 kDa, respectively. 3.2. Identity analysis, multiple alignments, and phylogenic analysis of EsHcs
Fig. 1 (continued).
untranslated region (UTR), and a 133 bp 3′ UTR with a poly (A) tail (Fig. 1A). The results from the SMART analysis showed that EsHc1 protein contains a signal peptide with 16 amino acids, and three tandem hemocyanin domains (hemocyanin N, hemocyanin M and hemocyanin C) (Fig. 2) comprising 127, 259 and 246 amino acids, respectively. The estimated molecular mass (Mw) and predicted isoelectric point (pI) of EsHc1 is 5.62 and 78.9 kDa. The full length of EsHc2 is 2580 bp, including a 26 bp 5′ UTR, a 568 bp 3′ UTR, and a 1986 bp ORF encoding a 662 amino acid peptide (Fig. 1B). A signal peptide region is present in the amino acid sequence between 1 and 18. Furthermore, two domains (hemocyanin N of 128 amino acids and hemocyanin C of 250 amino acids) were also predicted in EsHc2. Different from EsHc1, a tyrosinase domain of 128 amino acids replaced the hemocyanin M domain located between hemocyanin N and C domain in EsHc2. EsHc2 has a pI of 5.29 and an Mw of 75.3 kDa. EsHc3 gene has 2220 bp with a 26 bp 5′ UTR, a 121 bp 3′ UTR with a polyadenylation sequence AATAAA (position 2172 to 2177), a poly (A) tail, and a 2073 bp ORF encoding a peptide with 691 amino acids (Fig. 1C). Three conserved domains of
BLAST search showed that all the three forms exhibit similarity with Hcs from other crustaceans, such as shrimp, freshwater prawn, crayfish, and crab. BLASTP searches of the non-redundant protein database in GenBank showed that EsHc1 has the highest sequence similarity with PpCc1 from Portunus pelagicus (81% identity) and MmCc from Metacarcinus magister (80% identity). EsHc2 has 78% identity with hemocyanin subunit 1 from M. magister and 71% identity with hemocyanin from Pacifastacus leniusculus. Similarly, EsHc3 has 80% and 72% identity with hemocyanin from M. magister and P. leniusculus, respectively. The multiple alignments showed that hemocyanin genes from E. sinensis (EsHc1, EsHc2, EsHc3 and EsHc6) were highly conserved, especially EsHc2 and EsHc3, most of their amino acids are the same (Fig. 3). Conserved sequence and characteristic motifs of copperbinding proteins, metal-binding six histidine residues (H) were identified in the deduced amino acid sequences of EsHc2, EsHc3 and EsHc6, while EsHc1 has only three histidine residues (the first, second, third histidine residues). The fourth, fifth and sixth H were replaced by threonine (T), tyrosine (Y) and glutamine (Q), respectively. These conserved histidine residues are likely to be involved in binding copper. A phylogenetic tree was constructed based on the neighbor-joining method with the full-length hemocyanin family amino acid sequences. The result of the phylogenetic analysis revealed that majority of all Hc genes are clustered into three main clades (1, 2 and 3; Fig. 4). The strength of the supports on the tree varied, whereas some of the internal branches within the three clades are well resolved. EsHc1 together with cryptocyanin 1 from P. pelagicus (PpCc1) and cryptocyanin from M. magister (MmCc) are clustered into clade 3. Only four genes from three species (P. leniusculus, M. magister and E. sinensis) were gathered into clade 2, including the two genes (EsHc2 and EsHc3) identified in our study, which have close relationships with the PlHc gene and MmHc1 gene. Other Hcs in crustaceans and only one hemocyanin gene from E. sinensis (EsHc6), which were reported previously, are in clade 1. 3.3. Tissue distributions of EsHc1 to EsHc3 The qRT-PCR was used to investigate the tissue distributions of EsHc1 to EsHc3 transcripts. Results showed that EsHc1 was mainly expressed in the hepatopancreas and hemocytes with a lower level of expressions in the nerves, eyestalk, muscles, intestine, gills and heart.
Fig. 2. Distribution of three tandem hemocyanin domain of hemocyanin in E. sinensis.
390
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Fig. 3. Multiple alignments of EsHc1 to EsHc3 protein sequences. EsHc6: hemocyanin subunit 6 from Eriocheir sinensis (AEG64817.1). The six histidine residues within the copper-binding sites are boxed.
The transcript of EsHc2 was detected mainly in the hepatopancreas and a weak band was detected in hemocytes. EsHc3 was primarily expressed in the hepatopancreas and could also be detected in hemocytes (Fig. 5). 3.4. Expression pattern of EsHc1 to EsHc3 in the hepatopancreas upon bacterial challenge The expression levels of EsHc1 to EsHc3 upon challenge with LPS, PGN, S. aureus, V. parahaemolyticus and A. hydrophila were observed using qRT-PCR methods to investigate the roles of Hc genes from E. sinensis in anti-bacterial innate immunity. The transcript of EsHc1 in hepatopancreas was upregulated after the 2 h LPS challenge, reached the highest level at 6 h, and then declined from 12 h to 24 h. After PGN and S. aureus challenge, EsHc1 was also upregulated at 2, 6, and 12 h. At 2 h V. parahaemolyticus challenge, EsHc1 was upregulated and the subsequent expression was downregulated from 12 h to 24 h. EsHc1 further increased at 2, 12, and 24 h after A. hydrophila challenge (Fig. 6). EsHc2 was rapidly upregulated and peaked within 2 h of LPS and A. hydrophila challenge, and then decreased from 6 h to 24 h after challenge. EsHc2 was downregulated at 2 h after PGN challenge, in contrast to its upregulated expression at 6 h and 12 h. After S. aureus challenge, EsHc2 was initially upregulated at 2 h, decreased after 6 h, and finally increased again from 12 h to 24 h. The transcript of EsHc2 was lower at 2 h and 24 h after V. parahaemolyticus challenge (Fig. 7). EsHc3 quickly reached the highest level at 2 h post challenge, and then was continuously downregulated from 6 h to 12 h after V. parahaemolyticus challenge. After LPS and S. aureus challenge, EsHc3
exhibited an expression pattern similar to that of EsHc3 upon LPS challenge, the different is that EsHc3 expression was subsequently upregulated from 6 h to 24 h. By contrast, EsHc3 initially decreased at 2 h PGN challenge, and then increased at 6 h. EsHc3 was also upregulated at 2 h and 6 h after A. hydrophila challenge, and then quickly declined down to the lowest level from 12 h to 24 h (Fig. 8). In addition, the transcripts of EsHc1 to EsHc3 series in the hepatopancreas did not change obviously after PBS challenge from 2 h to 24 h. 4. Discussion In aquatic organisms, molecular characterization of immune genes is necessary for describing the immune mechanisms and for control of disease. Recently, hemocyanins, the main protein component of hemolymph from mollusks and arthropods, were reported as novel and important defense molecules of the non-specific innate immune system in invertebrates, especially in crustaceans (Decker and Jaenicke, 2004; Decker et al., 2001). So far, about 50 different hemocyanins from crustaceans, insects, chelicerates, myriapods and onychophorans have been characterized (Giomi and Beltramini, 2007). However, there is in fact little information on the structure, evolution, and physiological functions of hemocyanins from the Chinese mitten crab (E. sinensis). In the present study, three forms of hemocyanin genes (named EsHc1, EsHc2 and EsHc3) were identified from E. sinensis. The ORFs of EsHc1, EsHc2 and EsHc3 were 2182, 2580 and 2220 bp encoding a polypeptide of 678, 662 and 691 amino acids, respectively (Fig. 1A, B and C). All EsHcs contain a signal sequence between 1 and 16 amino acids
Y. Huang et al. / Aquaculture 434 (2014) 385–396
391
Fig. 4. Phylogenetic analysis of EsHc1 to EsHc3 with Hcs from other species. FcHc: hemocyanin from F. chinensis (ACM61982.1); PmHc: hemocyanin from P. monodon (AEB77775.1); FmHc: hemocyanin from Fenneropenaeus merguiensis (AGT20779.1); MnHc and MnHc1: hemocyanin and hemocyanin subunit 1 from Macrobrachium nipponense (AEC46861.1; AGA17871.1); MjHcL and MjHcY: hemocyanin subunit L and Y from Marsupenaeus japonicas (ABR14693.1; ABR14694.1); AmHc1: hemocyanin gamma subunit 1 from Atyopsis moluccensis (CCF55383.1); CqHc: hemocyanin from Cherax quadricarinatus (AFP23115.1); LvHc: hemocyanin from L. vannamei (CAA57880.1); CmHc1: hemocyanin gamma subunit 1 from Caridina multidentata (CCF55387.1); EsHc6: hemocyanin subunit 6 from E. sinensis (AEG64817.1); MmHc1 and MmHc6: hemocyanin subunit 1 and 6 from M. magister (AAW57889.1; AAA96966.2); MmCc: cryptocyanin from M. magister (AAD09762.1); PcHc: hemocyanin from Palaemon carinicauda (AEJ08191.1); PsHc: hemocyanin from Porcellio scaber (ACS44711.1); PvHc1: hemocyanin subunit 1 from Palinurus vulgaris (CAC69243.1); CsHc: hemocyanin from Cyamus scammoni (ABB59715.1); PlHc: hemocyanin from P. leniusculus (AAM81357.1); EpHc1: hemocyanin subunit 1 from Eurydice pulchra (ACS44712.1); PpCc1 and PpHc: cryptocyanin 1 and hemocyanin from P. pelagicus (ABM54471.1; ABM74407.1).
(EsHc1) or between 1 and 18 amino acids (EsHc2 and EsHc3), which is necessary for secretion from the endoplasmic reticulum, similar to EsHc6 from E. sinensis (Sun et al., 2012), FcHc from Fenneropenaeus chinensis (Sun et al., 2010) and MrHc from M. rosenbergii (Arockiaraj et al., 2013). The hemocyanin was typical of crustaceans, being folded into each of three domains, the first and third domains are the N- and C-terminals of hemocyanin, and the second domain contains the hemocyanin active site, which contains a combination of two copper ions CuA
and CuB (Sun et al., 2010). Like other hemocyanins, EsHc1 contains three tandem hemocyanin domains, including hemocyanin N, hemocyanin M and hemocyanin C; while EsHc2 and EsHc3 contain hemocyanin N, tyrosinase and hemocyanin C domains. Tyrosinase, a critical component of the arthropodan innate immune system (Cerenius and Söderhäll, 2004; Söderhäll and Cerenius, 1998), is involved in the formation of pigments such as melanin and other polyphenolic compounds (David et al., 2005). The CuA and CuB are present in the
392
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Fig. 5. Tissue distribution of EsHc1 to EsHc3 cDNAs from E. sinensis in heart, hemocytes, hepatopancreas, gills, muscle, intestine, nerve and eyestalk using qRT-PCR methods. Expression of the gene encoding GAPDH was used as the control.
α-helix region of the EsHcs protein. This may be a binding site with six conserved histidine residues (Arockiaraj et al., 2013). In the structure of EsHc2 and EsHc3, CuA is coordinated with His209, His213 and His237; whereas, CuB is coordinated with His356, His360 and His396. EsHc1 has
only one copper ion (CuA). CuA is coordinated with His219, His223 and His250. Copper is a structural component of hemocyanin, the respiratory protein of all crustaceans. Hemocyanins from other species, such as FcHc (Sun et al., 2010) and MrHc (Arockiaraj et al., 2013), have a similar structure. In the phylogenetic tree, EsHc1 was clustered together with PpCc1 and MmCc. Moreover, EsHc2 and EsHc3 clustered with PlHc and MmHc1 in one clade. However, EsHc6 also from E. sinensis was detached. The structural features and relationships displayed in the BLASTP result, and in the phylogenic tree, suggested that EsHcs reported in our study are classified as three new members of the Hcs superfamily of crabs. Tissue distribution analysis using qRT-PCR methods showed that EsHc1 mRNA was widely expressed in all detected tissues, including the heart, hemocytes, hepatopancreas, gills, muscles, intestine, nerves and eyestalk with the highest expression in hepatopancreas. This is in accordance with earlier research reports that the wide distributions of EsHc1 in various tissues may result from the infiltration of haemocytes into different tissues, because crabs possess an open circulation system (Sun et al., 2012). The mRNA transcripts of EsHc6 from E. sinensis (Sun et al., 2012), PjHcL and PjHcY from P. japonicas (Lei et al., 2008), and FcHc from F. chinensis (Sun et al., 2010) could also be detected widely in all the examined tissues with remarkably different expression levels. However, there is a significant differentiated tissue distribution of EsHc2 and EsHc3. The highest expression levels of EsHc2 and EsHc3 were detected in the hepatopancreas. It also was detected in hemocytes with relatively low expression level. Previous studies have shown that the hepatopancreas is a major site of Hcs production; whereas, hemocytes are the secondary expression site for Hcs. In our current research, the results showed that the hepatopancreas is the principal site of EsHcs synthesis, and hemocyte is also an important production site for EsHcs. It is thought that the innate immune system relies on its ability to rapidly detect pathogen-associated molecular patterns (PAMPs) displayed by invading pathogenic microbes, such as LPS, PGN and β1,3-glycan (Janeway, 1989; Medzhitov and Janeway, 1997; Vasta et al., 2004). So, research exploring the mRNA expressions of EsHcs after infection with different PAMPs and bacterium has proved to be helpful in deciphering the implications of those functions in the defense system. In this study, EsHcs mRNA transcriptions in hepatopancreas tissue were significantly expressed at various time points after infection with LPS, PGN, S. aureus, V. parahaemolyticus and A. hydrophila. In details, all of these three EsHc genes were upregulated by Vibrio challenge. EsHc1 was increased 14 times at 2 h after V. parahaemolyticus challenge, and EsHc3 was increased 1.5-fold. While EsHc2 transcript revealed two significant peaks following V. parahaemolyticus challenge (increasing about 2- and 1.7-fold at 2 h and 12 h after challenge, respectively). Vibriosis is the major bacterial disease caused by bacteria in the genus Vibrio (Jiravanichpaisal et al., 1994). The outbreaks of these diseases have led to high mortality rates of E. sinensis and the near or total collapse of the crab farming industry throughout the world (Xu et al., 2002). EsHc genes may participate in the anti-Vibrio immune response in E. sinensis. Similar to prior published reports (Sun et al., 2010), FcHc from F. chinensis shows antimicrobial activity against V. anguillarum, and furthermore FcHc was upregulated 3 h after Vibrio challenge, reached the highest level after 6 h, and then decreased after 12 h. This suggests that Hc genes act as effector molecules that may participate in the anti-Vibrio immune response in F. chinensis. MrHc (MrProPO) mRNA transcription in the hepatopancreas after V. harveyi injection was also significantly increased 19-fold at 24 h with subsequent decrease at 48 h (Arockiaraj et al., 2013). In hemocyanin protein levels, PmHc from the black tiger shrimp P. monodon has a remarkable 8-fold increase at 48 h post V. harveyi infection compared to that at 0 h (Somboonwiwat et al., 2010). Furthermore, EsHcs expressions were also upregulated under A. hydrophila challenge. EsHc1 was increased 3.5-fold at 24 h of A. hydrophila challenge, while EsHc2 and EsHc3 both were increased about 6.5-fold at 2 h after challenge. In a previous study, the expression of EsHc6 mRNA was up-regulated and peaked at
Y. Huang et al. / Aquaculture 434 (2014) 385–396
393
Fig. 6. qRT-PCR analysis of EsHc1 in the hepatopancreas of E. sinensis at 0, 2, 6, 12 and 24 h after LPS, PGN, S. aureus, A. hydrophila and V. parahaemolyticus challenge. The mRNA levels of EsHc1 were analyzed and standardized according to the GAPDH mRNA levels. Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with values of the control. Error bars represent ± S.D. of the three independent PCR amplifications and quantifications.
3 h by 7.7-fold after the A. hydrophila challenge, indicating it is possible to investigate that EsHc6 may be potentially involved in the immune responses of E. sinensis (Sun et al., 2012). In A. hydrophila-injected M. rosenbergii, MrHc mRNA expression significantly increased at 12, 24 and 48 h when compared to the control group (Arockiaraj et al., 2013). Therefore, the variation of EsHc gene expressions in the hepatopancreas after PAMPs and bacterial challenges indicate that hemocyanin protein is actively involved in the innate immune system of crab, thus enhancing its resistance against the entry of pathogens. In conclusion, the cDNAs of EsHc1 to EsHc3 were cloned from E. sinensis. Tissue distribution and expression patterns of EsHcs after LPS, PGN, S. aureus, V. parahaemolyticus and A. hydrophila challenge were investigated through qRT-PCR. From the molecular characterization and expression pattern, there is evidence that EsHcs are believed
to play an important role in crab innate immunity. However, further research is needed to clarify the more precise role and immune functions of EsHcs in crab immune defense. Acknowledgments We appreciate Professor O. Roger Anderson (Columbia University) for editing the manuscript. This work was supported by grants from the National Natural Sciences Foundation of China (NSFC Nos.31170120, 31101926, 31272686, and 31200139), The Natural Science Foundation of Jiangsu Province (BK20131401), Natural Science Fund of Colleges and universities in Jiangsu Province (13KJB240002), Jiangsu Agriculture Science and Technology Innovation Fund (JASTIF) CX (12)3066, Project for Aquaculture in Jiangsu Province (Nos. Y2013-45, D2013-5-3, and
394
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Fig. 7. qRT-PCR analysis of EsHc2 in the hepatopancreas of E. sinensis at 0, 2, 6, 12 and 24 h after LPS, PGN, S. aureus, A. hydrophila and V. parahaemolyticus challenge. The mRNA levels of EsHc2 were analyzed and standardized according to the GAPDH mRNA levels. Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with values of the control. Error bars represent ± S.D. of the three independent PCR amplifications and quantifications.
D2013-5-4) and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
References Adachi, K., Wakamatsu, K., Ito, S., Miyamoto, N., Kokubo, T., Nishioka, T., et al., 2005. An oxygen transporter hemocyanin can act on the late pathway of melanin synthesis. Pigment Cell Res. 18, 214–219. Arockiaraj, J., Gnanam, A.J., Pothikasalam, G.,Milton, J.,Pasupuleti, M.,Bhatt, P.,Palanisamy, R., Kumaresan, V., Thirumalai, M.K., Arasu, A., Sathyamoorthi, A., Prabha, N., 2013. A novel prophenoloxidase, hemocyanin encoded copper containing active enzyme from prawn: Gene characterization. Gene 524, 139–151. Bala, S.,Failla, M.C., 1992. Copper deficiency reversibly impairs DNA synthesis in activated T lymphocytes by limiting interleukin 2 activity. Proc. Natl. Acad. Sci. 89, 6794–6797. Bonami, J.R., Zhang, S., 2011. Viral diseases in commercially exploited crabs: a review. J. Invertebr. Pathol. 106, 6–17. Cerenius, L.,Söderhäll, K., 2004. The prophenoloxidase-activating system in invertebrates. Immunol. Rev. 198, 116–126. David, M.L., Lisha, N.B., Shufei, Z., Sheri, A.A., James, B.N., Michael, R.K., 2005. A hemocytespecific integrin required for hemocytic encapsulation in tobacco horn worm, Manduca sexta. Insect Biochem. Mol. Biol. 35, 369–380.
Decker, H.,Jaenicke, E., 2004. Recent findings on phenoloxidase activity and antimicrobial activity of hemocyanins. Dev. Comp. Immunol. 28, 673–687. Decker, H.,Ryan, M.,Jaenicke, E.,Terwilliger, N., 2001. SDS-induced phenoloxidase activity of hemocyanins from Limulus polyphemus, Eurypelma californicum, and Cancer magister. J. Biol. Chem. 276, 17796–17799. Destoumieux, D., Bulet, P., Loew, D., Dorsselaer, A.V., Rodriguez, J., Bachere, E., 1997. Penaeidins, a new family of antimicrobial peptides isolated from the shrimp Penaeus vannamei (Decapoda). J. Biol. Chem. 272, 28398–28406. Engel, D.W.,Brouwer, M., 1987. Metal regulation and molting in the blue crab, Callinectes sapidus: metallothione in function in metal metabolism. Biol. Bull. 173, 239–251. Giomi, F.,Beltramini, M., 2007. The molecular heterogeneity of hemocyanin: its role in the adaptive plasticity of crustacea. Gene 398, 192–201. Hoffmann, J.A., Reichhart, J.M., 2002. Drosophila innate immunity: an evolutionary perspective. Nat. Immunol. 3, 121–126. Huang, Y.,Li, Y.R.,An, L.,Hui, K.M.,Ren, Q.,Wang, W., 2013. Cloning and characterization of a clip domain serine protease and its homolog (Masquerade) from Eriocheir sinensis. Fish Shellfish Immunol. 35, 1155–1162. Huang, Y.,An, L.,Hui, K.M.,Ren, Q.,Wang, W., 2014. An LDLa domain-containing C-type lectin is involved in the innate immunity of Eriocheir sinensis. Dev. Comp. Immunol. 42, 333–344. Jaenicke, E., Föll, R., Decker, H., 1999. Spider hemocyanin binds ecdysone and 20-OHecdysone. J. Biol. Chem. 274, 34267–34271. Janeway Jr., C.A., 1989. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb. Symp. Quant. Biol. 54 (Pt1), 1–13.
Y. Huang et al. / Aquaculture 434 (2014) 385–396
395
Fig. 8. qRT-PCR analysis of EsHc3 in the hepatopancreas of E. sinensis at 0, 2, 6, 12 and 24 h after LPS, PGN, S. aureus, A. hydrophila and V. parahaemolyticus challenges. The mRNA levels of EsHc3 were analyzed and standardized according to the GAPDH mRNA levels. Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with values of the control. Error bars represent ± S.D. of the three independent PCR amplifications and quantifications.
Jiang, N., Tan, N.S., Ho, B., Ding, J.L., 2007. Respiratory protein-generated reactive oxygen species as an antimicrobial strategy. Nat. Immunol. 8 (10), 1114–1122. Jiravanichpaisal, P., Miyazaki, T., Limsuwan, C., 1994. Histopathology, biochemistry, and pathogenicity of Vibrio harveyi infecting black tiger prawn Penaeus monodon. J. Aquat. Anim. Health 6, 27–35. Kumar, S.,Nei, M.,Dudley, J.,Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306. Lall, S.P., 2002. The minerals. In: Halver, J.E., Hardy, R.W. (Eds.), Fish nutrition. Academic Press, New York, pp. 259–308. Lee, M.H., Shiau, S.Y., 2002. Dietary copper requirement of juvenile grass shrimp, Penaeus mondon, and effects on non-specific immune responses. Fish Shellfish Immunol. 13 (4), 259–270. Lei, K.Y., Li, F., Zhang, M.C., Yang, H.J., Luo, T.,Xu, X., 2008. Difference between hemocyanin subunits from shrimp Penaeus japonicus in anti-WSSV defense. Dev. Comp. Immunol. 32 (7), 808–813. Li, X.D.,Lei, Y.Z.,Gao, X.D.,Ma, C.Y.,Dong, S.L., 2007. Calcium carbonate supersaturation and precipitation in Chinese mitten crab (Eriocheir japonica sinensis) larval ponds in China: mass mortality, crystal form analysis, and safety saturation index. Aquaculture 272, 361–369. Medzhitov, R., Janeway Jr., C.A., 1997. Innate immunity: impact on the adaptive immune response. Curr. Opin. Immunol. 9, 4–9. Morado, J.F., 2011. Protistan diseases of commercially important crabs: a review. J. Invertebr. Pathol. 106, 27–53.
Mu, C., Zheng, P., Zhao, J., Wang, L., Qiu, L., Zhang, H., et al., 2011. A novel type III crustin (CrusEs2) identified from Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 31 (1), 142–147. Nagai, T., Osaki, T., Kawabata, S.-I., 2001. Functional conversion of hemocyanin to phenoloxidase by horseshoe crab antimicrobial peptides. J. Biol. Chem. 276, 27166–27170. Paul, R.J.,Pirow, R., 1998. The physiological significance of respiratory proteins in invertebrates. Zoology 100, 298–306. Rainer, J., Brouwer, M., 1993. Hemocyanin synthesis in the blue crab Callinectes sapidus. Comp. Biochem. Physiol. B 104, 69–73. Rtal, A.,Truchot, J.P., 1996. Haemolymph transport and tissue accumulation of exogenous copper in the shore crab, Carcinus maenas. Mar. Pollut. Bull. 32, 802–811. Söderhäll, K., Cerenius, L., 1998. Role of the prophenoloxidase-activating system in invertebrate immunity. Curr. Opin. Immunol. 10, 23–28. Somboonwiwat, K., Chaikeeratisak, V., Wang, H.C., Lo, C.F., Tassanakajon, A., 2010. Proteomic analysis of differentially expressed proteins in Penaeus monodon hemocytes after Vibrio harveyi infection. Proteome Sci. 8, 39. Sun, J., Wang, B.J., Sun, Z.J., Li, X.H., Jiang, S., 2010. cDNA cloning and sequence analysis of hemocyanin in Fenneropenaeus chinensis. Prog. Fish. Sci. 1, 1–14 [in Chinese with English abstract]. Sun, S.M.,Chen, M.,Chen, L.Q.,Jiang, H.B.,Li, E.C., 2011. Optimal dietary copper and zinc requirements for juvenile Chinese mitten crab, Eriocheir sinensis. Isr. J. Aquacult. Bamidgeh 63 (3), 580–687.
396
Y. Huang et al. / Aquaculture 434 (2014) 385–396
Sun, S.M., Chen, L.Q., Qin, J.G., Ye, J.Y., Qin, C.J., Jiang, H.B., Li, E.C., 2012. Molecular cloning, characterization and mRNA expression of copper-binding protein hemocyanin subunit in Chinese mitten crab, Eriocheir sinensis. Fish Shellfish Immunol. 33, 1222–1228. Van Holde, K.E., Miller, K.I., 1995. Hemocyanins. Adv. Protein Chem. 47, 1–81. Vasta, G.R.,Ahmed, H.,Odom, E.W., 2004. Structural and functional diversity of lectin repertoires in invertebrates, protochordates and ectothermic vertebrates. Curr. Opin. Struct. Biol. 14, 617–630. Wang, W., 2011. Bacterial diseases of crabs: a review. J. Invertebr. Pathol. 106, 18–26. Wang, W.,Zhu, N.N.,Gu, Z.F.,Du, K.,Xu, Z.K., 2002. Study on the transmission of tremor disease (TD) in the Chinese mitten crab, Eriocheir sinensis (Crustacea: Decapoda). J. Invertebr. Pathol. 81, 202–204.
Wang, W., Chen, J.X., Du, K.H., Xu, Z.K., 2004. Morphology of spiroplasmas in the Chinese mitten crab Eriocheir sinensis associated with tremor disease. Res. Microbiol. 155, 630–635. Xu, H.S., Shu, M.A., Zhan, X.A., Wang, S.X., 2002. Identification of Vibrio parahaemolyticus isolated from cultured Eriocheir sinensis and pathogenicity of its extracellular products. J. Fish. China 26, 357–362. Zhang, X.B.,Huang, C.H.,Qin, Q.W., 2004. Antiviral properties of hemocyanin isolated from Penaeus monodon. Antiviral Res. 61, 93–99. Zhang, Y.L., Wang, S.Y., Xu, A.L., Chen, Y., Lin, B.K., Peng, X.X., 2006. Affinity proteomic approach for identification of an IgA-like protein in Litopenaeus vannamei and study on its agglutination characterization. J. Proteome Res. 5, 815–821.