- Email: [email protected]
Molecular Cloning and Chromosomal Mapping of Olfactory Receptor Genes Expressed in the Male Germ Line: Evidence for Their Wide Distribution in the Human Genome
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
237, 283–287 (1997)
RC977043
Molecular Cloning and Chromosomal Mapping of Olfactory Receptor Genes Expressed in the Male Germ Line: Evidence for Their Wide Distribution in the Human Genome Pierre Vanderhaeghen,1 Ste´phane Schurmans, Gilbert Vassart,* and Marc Parmentier I.R.I.B.H.N. and *Department of Medical Genetics, Universite´ Libre de Bruxelles, Campus Erasme, 808 Route de Lennik, B-1070 Brussels, Belgium
Received June 19, 1997
Olfactory receptor genes constitute the largest family of G protein-coupled receptors. We have previously shown that members of this family are expressed during spermatogenesis, and that the corresponding proteins are displayed on mature sperm cells. In each mammalian species, a restricted subset of olfactory receptors is expressed in male germ cells and displays a pattern of expression suggestive of their potential implication in the control of sperm physiology. In addition to the cDNA fragments available previously, we now report the molecular cloning of two olfactory receptor cDNAs from a human testis library. Five olfactory receptor genes expressed in germ cells were localized in the human genome by radiation hybrid mapping. Three of the genes map to the short arm of chromosome 19 (19p13.1-19p31.3), one to chromosome 11 (11q22.1-22.3), and one to chromosome 17 (17q21-22). The former two localizations fall within clusters previously identified for members of the putative olfactory receptor gene family expressed in olfactory mucosa. Similarly, sequence analysis has revealed that these testicular genes share no distinctive structural features from the other, non-testicular, members of the family. The expression of a subset of olfactory receptor genes in the male germ line is therefore not correlated to their belonging to a specific structural subgroup, or to a specific gene cluster or chromosomal segment. q 1997 Academic Press
Olfactory receptors (OR) constitute a large subfamily of G protein-coupled receptors, with up to a thou1 Present address: Dept. Cell Biology, Harvard Medical School, 240 Longwood Ave., Boston, MA 02115. E-mail: [email protected]. harvard.edu.
sand members expected in mammalian species (13). All olfactory receptors cloned so far in mammals display common sequence characteristics that make them clearly belong to a distinct subfamily among G protein-coupled receptors. The OR gene family is also characterized by a unique pattern of expression, each member being expressed in a restricted subset of olfactory neurons. Experimental evidence has provided arguments for a stochastic model of OR gene expression in individual olfactory neurons, possibly involving cis-mechanisms (4). The chromosomal distribution of the OR gene family has been partially elucidated, revealing the existence of several gene clusters spread onto various chromosomes (5-10). These findings have raised the question of the relationships between the transcriptional control of OR genes and the genomic organization of the family. In this frame, it was recently shown that the expression of a given OR gene in a specific area of the olfactory mucosa was not linked to its chromosomal location, suggesting a locus-independent control of expression of OR genes in this tissue (10). We reported previously that, in contrast with most members of the family, some OR genes are expressed in the male germ line of different mammalian species, including human (2), and that the corresponding proteins are displayed in post-meiotic sperm cell progenitors, and on mature sperm cells (11). In every mammalian species tested, the male germ line expresses a limited and specific repertoire of OR genes, and their pattern of expression suggests potential roles in the control of sperm physiology (11-13). The possible involvement of OR in sperm-egg interactions (14) could have important implications in the fields of fertility and sterility. However, little is known about the specific mechanisms that account for the selective expression of
283
0006-291X/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
AID
BBRC 7043
/
6935$$$301
08-01-97 07:34:28
bbrcgs
AP: BBRC
Vol. 237, No. 2, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Amino acid sequences deduced from the HTPCR92 and HT2 olfactory receptor clones, compared with a previously described human OR clone, HGMP07E (9). Bars and roman numbers represent the putative transmembrane segments. Identical residues are shown in bold.
OR genes in male germ cells, and no data are available concerning the genomic organization of the testicular subset of the OR gene family. Here we report the molecular cloning of two OR genes from a human testis cDNA library, and the chromosomal distribution of five human testicular OR genes, as assessed by radiation hybrid mapping. MATERIALS AND METHODS
obtained from human genomic DNA, while no amplification was obtained from hamster DNA used as a negative control. The PCR results were analyzed using the Rhmapper computer program through the publicly available World Wide Web server of the Whitehead Institute/ MIT Center (http://www-genome.wi.mit.edu/ cgi-bin/contig/rhmapper.pl). In each case, the processing of the results by the Rhmapper program allowed unambiguous assignment of each OR gene to a specific chromosome segment, with a significant lod score (ú15).
RESULTS AND DISCUSSION
Cloning and sequencing. In order to isolate new members of the OR gene family that are expressed in the human male germ line, a human testis lGT11-cDNA library was screened with the human HGMP07 OR probe (2). Two clones were obtained. The full coding sequence of HTPCR92 was further isolated from a human genomic DNA library. The clones were isolated according to standard procedures (15), and sequenced on an Applied Biosystems sequencer. Chromosomal mapping. Five human OR genes were selected: HTPCR92 and HT2, isolated from a human testis cDNA library (this study), and HTPCR16, HTPCR25, and HTPCR86 previously obtained by reverse transcription- PCR from human testis cDNA (12). A panel of 93 radiation hybrid clones (Genebridge 4 panel, Research Genetics, Huntsville, AL) was used to map the five genes by PCR screening (16). As the members of the OR gene family are highly homologous to each other, a great care was taken to design gene-specific primers that did not show cross-hybridization with other OR genes (HT2: TGGGTGCCATATTTGGCTGT and AGGAGGCAGAATTTGCAGGC; HTPCR16: CACTCCATTGTCCAACTGGC and TGTCCATGAGGAATGGGGTG; HTPCR25: GGCCTGGTTTGTGCATCAG and AAAGATTACAACCGCCAACA; HTPCR86: TGGGTTCCCTGCTCGAGACC and TGAGGCCACCAGACTTGTCC; HTPCR92: CCCATGATTGCAGGGCTCTA and GGGCATTGCACTCGGAACAT). Reaction mixtures consisted of 50 ml of 25 mM Tris/HCl buffer, pH 8.0, containing 50 mM KCl, 1-1.5 mM MgCl, 0.2 mM dNTPs, 0.01% gelatin, 5% DMSO, 50 ng target DNA, 50 ng of each of the primers, and 1 U Taq DNA polymerase. The reaction cycling conditions were as follows: 937C for 2 min 30 sec, 937C for 1 min, 587C for 2 min (557C for HTPCR25), 727C for 3 min, for 35 cycles, 727C for 6 min (followed by an additional set of 20 cycles for HTPCR16). PCR products were electrophoresed on 2% agarose gels. An amplification product of the expected size (in the range of 300-600 bp) was consistently
The expression of OR genes in the sperm cells of several mammalian species could have important implications in human sterility and contraception (2,1114). This prompted us to isolate new members of the OR family specifically expressed in the human testis. Two such genes were isolated from a human testis cDNA library. One of the cDNAs corresponded to a cDNA fragment (HTPCR92) previously obtained from human testis by low stringency PCR (2). They share all the structural features of the other members of the OR family, displaying a high degree of sequence conservation in the putative transmembrane domains II, III, VI and VII (figure 1). Overall, they do not display any distinctive structural landmarks as compared with the other, non-testicular, members of the family (figure 2). In olfactory neurons, the specificity of expression of OR genes is thought to result from both locus-independent and cis-mechanisms (4,10). Given the specific and restricted pattern of expression of the subset of OR genes preferentially expressed in the testis (2,11,12), we have investigated whether this subset of olfactory receptor genes was clustered in the human genome or scattered to the various clusters already identified for OR genes. Five genes were selected: for each of these genes, a robust and specific
284
AID
BBRC 7043
/
6935$$$302
08-01-97 07:34:28
bbrcgs
AP: BBRC
Vol. 237, No. 2, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Dendrogram representing the sequence similarities between putative olfactory receptors. A dot tags the names of the clones isolated from human testis cDNA. The chromosomal location is indicated on the right. HTPCR92 and HT2 sequences were obtained through the screening of a testis cDNA library (this study). All the other genes correspond to previously described sequences (2,5,6,9,10,12). The dendrogram was generated by using the Pileup routine of the GCG software package, and the analysis was restricted to the region spanning transmembrane segments III to VI.
expression in the testis was previously reported (12), while from a structural point of view, the encoded proteins are representative of the various subgroups constituting the OR family (figure 2). The results obtained are presented in figure 3. Three of the genes were mapped to the chomosome 19 short arm. HT2 and HTPCR86 are located between the markers WI-7557 (2.33 cR from HTPCR86) and WI-8049 (at close proximity to HT2), in a region spanning 7cR (equivalent to about 2 Mb for chromosome 19 (17)), in the 19p13.2-13.3 region, while HTPCR92 is located at 7.47 cR from WI-6344, in the 19p13.1 region. HTPCR16 was mapped to chromosome 17 (at 4.5 cR from WI6277), in the 17q21-22 region, and HTPCR25 was mapped to the 11q22.1-22.3 region of chromosome 11 (at close proximity to the D11S936 marker). Although limited to five genes (out of an estimated repertoire of 50 OR genes expressed in human testis (12)), our data show that these genes are spread into various clusters located onto different chromosomes, as previously described for the putative OR genes expressed in olfactory mucosa. One of the locations
found, 17q21-22, has not yet been reported to contain any OR gene cluster. In contrast, the other loci include the short arm of chromosome 19 which was previously described to contain a cluster of OR genes (8). Similarly, two other chromosomal locations, 19p13.3 and 11q22.1, are paralogous to regions of the mouse genome that were shown to contain OR gene clusters (on mouse chromosomes 10 and 9, respectively (10)). This suggests that OR genes expressed in testis are clustered with other, non-testicular, members of the family. The three testicular OR genes that are physically linked on chromosome 19 belong to the same structural subfamily (figure 2). This finding is again reminiscent of the situation described for other OR genes, where most of the genes belonging to a same structural subfamily are clustered in the genome (5,10). Similarly, mouse and human OR genes mapped to paralogous regions belong to the same structural subfamily (figure 2: M15, K4 and HTPCR25; M64 and HT2). It appears therefore that the group of olfactory receptors expressed in testis has not evolved independently from the rest of the family. The OR gene family has evolved by duplications of an ancestral clustered repertoire, and more recent duplications within each cluster (5,10). Some of the genes have been selected in each species for germ line expression. Several non-OR genes are found at close proximity of testicular OR genes, including in the 2 Mb region containing HTPCR86 and HT2. Clustered OR genes are therefore interspersed with other, non OR genes. Many genes sharing a common pattern of expression in the testis are clustered in specific domains of the genome. These include the t complex in the mouse (18), or the ‘‘transition’’ locus in the human species (19). The locations of the testicular OR genes do not match any of these loci. In addition, no other testis-specific gene could be found in their chromosomal vicinity. This rules out the possibility that the expression of OR genes in the testis is the mere result of their proximity to chromatin regions displaying high transcriptional activity in this organ. The expression of OR genes in the mammalian germ-line therefore seems to involve locus-independent mechanisms, as was described for the expression of OR genes in the olfactory mucosa (10). The testicular expression could be controlled via transmechanisms, involving tissue-specific promoters and transcription factors, as recently proposed for a murine testis OR gene (20). As a conclusion, a specific repertoire of olfactory receptor genes is expressed in the human male germ line, and these testis-specific OR genes are distributed in the human genome, within clusters shared with nontesticular OR genes. Further characterization of the genomic organization and structure of these genes will be required to fully understand their potential implica-
285
AID
BBRC 7043
/
6935$$$302
08-01-97 07:34:28
bbrcgs
AP: BBRC
Vol. 237, No. 2, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Schematic representation of the chromosomal locations of the human testis OR genes. Radiation hybrid framework maps of chromosome 19, chromosome 17 long arm, and chromosome 11 long arm, with positions of the five studied genes (indicated in bold).
tions in the field of sperm cell physiology, and the specific mechanisms of transcriptional control driving the gene expression in olfactory neurons and spermatogenic cells.
REFERENCES
ACKNOWLEDGMENTS The continuous support and interest of Dr. J. E. Dumont is deeply acknowledged. We thank Christiane Christophe-Hobertus for the synthesis of the oligonucleotides, and M. Samson for helpful advice. We thank Dr. D. Jenne for sharing unpublished results. This work was supported by the Belgian Programme on Interuniversity Poles of attraction initiated by the Belgian State, Prime Minister’s Office, Science Policy Programming. It was also supported by the Fondation Me´dicale Reine Elisabeth, the Fonds de la Recherche Scientifique Me´dicale of Belgium, the Association Recherche Biome´dicale et Diagnostic. The scientific responsibility is assumed by the authors. P.V. and S.S. are respectively Aspirant and Chercheur Qualifie´ of the Fonds National de la Recherche Scientifique.
1. Buck, L. B., and Axel, R. (1991) Cell 65, 175–187. 2. Parmentier, M., Libert, F., Schurmans, S., Schiffmann, S., Lefort, A., Eggerickx, D., Ledent, C., Mollereau, C., Ge´rard, C., Perret, J., Grootegoed, A., and Vassart, G. (1992) Nature (Lond.) 355, 453–455. 3. Parmentier, M., Schurmans, S., Libert, F., Vanderhaeghen, P., and Vassart, G. (1992) in Handbook of Receptors and Channels (S. J. Peroutka, Ed.), pp. 237–250, CRC Press, London. 4. Chess, A., Simon, I., Cedar, H., and Axel, R. (1995) Cell 78, 823– 834. 5. Ben-Arie, N., Lancet, D., Taylor, C., Khen, M., Walker, N., Ledbetter, D. H., Carrozzo, R., Patel, K., Sheer, D., Lehrach, H., and North, M. A. (1994) Hum. Mol. Gen. 3, 229–235. 6. Fan, W., Liu, Y., Parimoo, S., and Weissman, S. M. (1995) Genomics 27, 119–123. 7. Glusman, G., Clifton, S., Roe, B., and Lancet, D. (1996) Genomics 37, 147–160.
286
AID
BBRC 7043
/
6935$$$303
08-01-97 07:34:28
bbrcgs
AP: BBRC
Vol. 237, No. 2, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
8. Reed, R. R. (1992) Cold Spring Harbor Symposia on quantitative biology LVII, 501–504. 9. Schurmans, S., Muscatelli, F., Miot, F., Mattei, M., Vassart, G., and Parmentier, M. (1993) Cytogenet Cell Genet. 63, 200–204. 10. Sullivan, S., Adamson, M. C., Ressler, K., Kozak, C., and Buck, L. B. (1996) Proc. Natl. Acad. Sci. USA 93, 884–888. 11. Vanderhaeghen, P., Schurmans, S., Vassart, G., and Parmentier, M. (1993) J. Cell Biol. 123, 1441–1452. 12. Vanderhaeghen, P., Schurmans, S., Vassart, G., and Parmentier, M. (1997) Genomics 39, 239–246. 13. Walensky, L. D., Roskams, A. J., Lefkowitz, R. J., Snyder, S. H., and Ronnett, G. V. (1995) Mol. Med. 1, 130–141. 14. Ward, C. R., and Kopf, G. S. (1993) Dev. Biol. 158, 9–34. 15. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1988) Molecular
16. 17. 18. 19.
20.
Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Walter, M. A., Spillett, D. J., Thomas, P., Weissenbach, J., and Goodfellow, P. N. (1994) Nature Genetics 7, 22–28. Hudson, T., Stein, L., collaborators, Page, D. C., and Lander, E. S. (1995) Science 270, 1945–1954. Yeom, Y., Abe, K., Bennett, D., and Artzt, K. (1992) Proc. Natl. Acad. Sci. USA 89, 773–777. Chaudary, S., Wykes, S., Kramer, J., Mohamed, A., Koppitch, F., Nelson, J., and Krawetz, S. (1995) J. Biol. Chem. 270, 8755– 8762. Asai, H., Kasai, H., Matsuda, Y., Yamazaki, N., Nagawa, F., Sakano, H., and Tsuboi, A. (1996) Biochem. Biophys. Research Com. 221, 240–247.
287
AID
BBRC 7043
/
6935$$$303
08-01-97 07:34:28
bbrcgs
AP: BBRC
237, 283–287 (1997)
RC977043
Molecular Cloning and Chromosomal Mapping of Olfactory Receptor Genes Expressed in the Male Germ Line: Evidence for Their Wide Distribution in the Human Genome Pierre Vanderhaeghen,1 Ste´phane Schurmans, Gilbert Vassart,* and Marc Parmentier I.R.I.B.H.N. and *Department of Medical Genetics, Universite´ Libre de Bruxelles, Campus Erasme, 808 Route de Lennik, B-1070 Brussels, Belgium
Received June 19, 1997
Olfactory receptor genes constitute the largest family of G protein-coupled receptors. We have previously shown that members of this family are expressed during spermatogenesis, and that the corresponding proteins are displayed on mature sperm cells. In each mammalian species, a restricted subset of olfactory receptors is expressed in male germ cells and displays a pattern of expression suggestive of their potential implication in the control of sperm physiology. In addition to the cDNA fragments available previously, we now report the molecular cloning of two olfactory receptor cDNAs from a human testis library. Five olfactory receptor genes expressed in germ cells were localized in the human genome by radiation hybrid mapping. Three of the genes map to the short arm of chromosome 19 (19p13.1-19p31.3), one to chromosome 11 (11q22.1-22.3), and one to chromosome 17 (17q21-22). The former two localizations fall within clusters previously identified for members of the putative olfactory receptor gene family expressed in olfactory mucosa. Similarly, sequence analysis has revealed that these testicular genes share no distinctive structural features from the other, non-testicular, members of the family. The expression of a subset of olfactory receptor genes in the male germ line is therefore not correlated to their belonging to a specific structural subgroup, or to a specific gene cluster or chromosomal segment. q 1997 Academic Press
Olfactory receptors (OR) constitute a large subfamily of G protein-coupled receptors, with up to a thou1 Present address: Dept. Cell Biology, Harvard Medical School, 240 Longwood Ave., Boston, MA 02115. E-mail: [email protected]. harvard.edu.
sand members expected in mammalian species (13). All olfactory receptors cloned so far in mammals display common sequence characteristics that make them clearly belong to a distinct subfamily among G protein-coupled receptors. The OR gene family is also characterized by a unique pattern of expression, each member being expressed in a restricted subset of olfactory neurons. Experimental evidence has provided arguments for a stochastic model of OR gene expression in individual olfactory neurons, possibly involving cis-mechanisms (4). The chromosomal distribution of the OR gene family has been partially elucidated, revealing the existence of several gene clusters spread onto various chromosomes (5-10). These findings have raised the question of the relationships between the transcriptional control of OR genes and the genomic organization of the family. In this frame, it was recently shown that the expression of a given OR gene in a specific area of the olfactory mucosa was not linked to its chromosomal location, suggesting a locus-independent control of expression of OR genes in this tissue (10). We reported previously that, in contrast with most members of the family, some OR genes are expressed in the male germ line of different mammalian species, including human (2), and that the corresponding proteins are displayed in post-meiotic sperm cell progenitors, and on mature sperm cells (11). In every mammalian species tested, the male germ line expresses a limited and specific repertoire of OR genes, and their pattern of expression suggests potential roles in the control of sperm physiology (11-13). The possible involvement of OR in sperm-egg interactions (14) could have important implications in the fields of fertility and sterility. However, little is known about the specific mechanisms that account for the selective expression of
283
0006-291X/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
AID
BBRC 7043
/
6935$$$301
08-01-97 07:34:28
bbrcgs
AP: BBRC
Vol. 237, No. 2, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Amino acid sequences deduced from the HTPCR92 and HT2 olfactory receptor clones, compared with a previously described human OR clone, HGMP07E (9). Bars and roman numbers represent the putative transmembrane segments. Identical residues are shown in bold.
OR genes in male germ cells, and no data are available concerning the genomic organization of the testicular subset of the OR gene family. Here we report the molecular cloning of two OR genes from a human testis cDNA library, and the chromosomal distribution of five human testicular OR genes, as assessed by radiation hybrid mapping. MATERIALS AND METHODS
obtained from human genomic DNA, while no amplification was obtained from hamster DNA used as a negative control. The PCR results were analyzed using the Rhmapper computer program through the publicly available World Wide Web server of the Whitehead Institute/ MIT Center (http://www-genome.wi.mit.edu/ cgi-bin/contig/rhmapper.pl). In each case, the processing of the results by the Rhmapper program allowed unambiguous assignment of each OR gene to a specific chromosome segment, with a significant lod score (ú15).
RESULTS AND DISCUSSION
Cloning and sequencing. In order to isolate new members of the OR gene family that are expressed in the human male germ line, a human testis lGT11-cDNA library was screened with the human HGMP07 OR probe (2). Two clones were obtained. The full coding sequence of HTPCR92 was further isolated from a human genomic DNA library. The clones were isolated according to standard procedures (15), and sequenced on an Applied Biosystems sequencer. Chromosomal mapping. Five human OR genes were selected: HTPCR92 and HT2, isolated from a human testis cDNA library (this study), and HTPCR16, HTPCR25, and HTPCR86 previously obtained by reverse transcription- PCR from human testis cDNA (12). A panel of 93 radiation hybrid clones (Genebridge 4 panel, Research Genetics, Huntsville, AL) was used to map the five genes by PCR screening (16). As the members of the OR gene family are highly homologous to each other, a great care was taken to design gene-specific primers that did not show cross-hybridization with other OR genes (HT2: TGGGTGCCATATTTGGCTGT and AGGAGGCAGAATTTGCAGGC; HTPCR16: CACTCCATTGTCCAACTGGC and TGTCCATGAGGAATGGGGTG; HTPCR25: GGCCTGGTTTGTGCATCAG and AAAGATTACAACCGCCAACA; HTPCR86: TGGGTTCCCTGCTCGAGACC and TGAGGCCACCAGACTTGTCC; HTPCR92: CCCATGATTGCAGGGCTCTA and GGGCATTGCACTCGGAACAT). Reaction mixtures consisted of 50 ml of 25 mM Tris/HCl buffer, pH 8.0, containing 50 mM KCl, 1-1.5 mM MgCl, 0.2 mM dNTPs, 0.01% gelatin, 5% DMSO, 50 ng target DNA, 50 ng of each of the primers, and 1 U Taq DNA polymerase. The reaction cycling conditions were as follows: 937C for 2 min 30 sec, 937C for 1 min, 587C for 2 min (557C for HTPCR25), 727C for 3 min, for 35 cycles, 727C for 6 min (followed by an additional set of 20 cycles for HTPCR16). PCR products were electrophoresed on 2% agarose gels. An amplification product of the expected size (in the range of 300-600 bp) was consistently
The expression of OR genes in the sperm cells of several mammalian species could have important implications in human sterility and contraception (2,1114). This prompted us to isolate new members of the OR family specifically expressed in the human testis. Two such genes were isolated from a human testis cDNA library. One of the cDNAs corresponded to a cDNA fragment (HTPCR92) previously obtained from human testis by low stringency PCR (2). They share all the structural features of the other members of the OR family, displaying a high degree of sequence conservation in the putative transmembrane domains II, III, VI and VII (figure 1). Overall, they do not display any distinctive structural landmarks as compared with the other, non-testicular, members of the family (figure 2). In olfactory neurons, the specificity of expression of OR genes is thought to result from both locus-independent and cis-mechanisms (4,10). Given the specific and restricted pattern of expression of the subset of OR genes preferentially expressed in the testis (2,11,12), we have investigated whether this subset of olfactory receptor genes was clustered in the human genome or scattered to the various clusters already identified for OR genes. Five genes were selected: for each of these genes, a robust and specific
284
AID
BBRC 7043
/
6935$$$302
08-01-97 07:34:28
bbrcgs
AP: BBRC
Vol. 237, No. 2, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Dendrogram representing the sequence similarities between putative olfactory receptors. A dot tags the names of the clones isolated from human testis cDNA. The chromosomal location is indicated on the right. HTPCR92 and HT2 sequences were obtained through the screening of a testis cDNA library (this study). All the other genes correspond to previously described sequences (2,5,6,9,10,12). The dendrogram was generated by using the Pileup routine of the GCG software package, and the analysis was restricted to the region spanning transmembrane segments III to VI.
expression in the testis was previously reported (12), while from a structural point of view, the encoded proteins are representative of the various subgroups constituting the OR family (figure 2). The results obtained are presented in figure 3. Three of the genes were mapped to the chomosome 19 short arm. HT2 and HTPCR86 are located between the markers WI-7557 (2.33 cR from HTPCR86) and WI-8049 (at close proximity to HT2), in a region spanning 7cR (equivalent to about 2 Mb for chromosome 19 (17)), in the 19p13.2-13.3 region, while HTPCR92 is located at 7.47 cR from WI-6344, in the 19p13.1 region. HTPCR16 was mapped to chromosome 17 (at 4.5 cR from WI6277), in the 17q21-22 region, and HTPCR25 was mapped to the 11q22.1-22.3 region of chromosome 11 (at close proximity to the D11S936 marker). Although limited to five genes (out of an estimated repertoire of 50 OR genes expressed in human testis (12)), our data show that these genes are spread into various clusters located onto different chromosomes, as previously described for the putative OR genes expressed in olfactory mucosa. One of the locations
found, 17q21-22, has not yet been reported to contain any OR gene cluster. In contrast, the other loci include the short arm of chromosome 19 which was previously described to contain a cluster of OR genes (8). Similarly, two other chromosomal locations, 19p13.3 and 11q22.1, are paralogous to regions of the mouse genome that were shown to contain OR gene clusters (on mouse chromosomes 10 and 9, respectively (10)). This suggests that OR genes expressed in testis are clustered with other, non-testicular, members of the family. The three testicular OR genes that are physically linked on chromosome 19 belong to the same structural subfamily (figure 2). This finding is again reminiscent of the situation described for other OR genes, where most of the genes belonging to a same structural subfamily are clustered in the genome (5,10). Similarly, mouse and human OR genes mapped to paralogous regions belong to the same structural subfamily (figure 2: M15, K4 and HTPCR25; M64 and HT2). It appears therefore that the group of olfactory receptors expressed in testis has not evolved independently from the rest of the family. The OR gene family has evolved by duplications of an ancestral clustered repertoire, and more recent duplications within each cluster (5,10). Some of the genes have been selected in each species for germ line expression. Several non-OR genes are found at close proximity of testicular OR genes, including in the 2 Mb region containing HTPCR86 and HT2. Clustered OR genes are therefore interspersed with other, non OR genes. Many genes sharing a common pattern of expression in the testis are clustered in specific domains of the genome. These include the t complex in the mouse (18), or the ‘‘transition’’ locus in the human species (19). The locations of the testicular OR genes do not match any of these loci. In addition, no other testis-specific gene could be found in their chromosomal vicinity. This rules out the possibility that the expression of OR genes in the testis is the mere result of their proximity to chromatin regions displaying high transcriptional activity in this organ. The expression of OR genes in the mammalian germ-line therefore seems to involve locus-independent mechanisms, as was described for the expression of OR genes in the olfactory mucosa (10). The testicular expression could be controlled via transmechanisms, involving tissue-specific promoters and transcription factors, as recently proposed for a murine testis OR gene (20). As a conclusion, a specific repertoire of olfactory receptor genes is expressed in the human male germ line, and these testis-specific OR genes are distributed in the human genome, within clusters shared with nontesticular OR genes. Further characterization of the genomic organization and structure of these genes will be required to fully understand their potential implica-
285
AID
BBRC 7043
/
6935$$$302
08-01-97 07:34:28
bbrcgs
AP: BBRC
Vol. 237, No. 2, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Schematic representation of the chromosomal locations of the human testis OR genes. Radiation hybrid framework maps of chromosome 19, chromosome 17 long arm, and chromosome 11 long arm, with positions of the five studied genes (indicated in bold).
tions in the field of sperm cell physiology, and the specific mechanisms of transcriptional control driving the gene expression in olfactory neurons and spermatogenic cells.
REFERENCES
ACKNOWLEDGMENTS The continuous support and interest of Dr. J. E. Dumont is deeply acknowledged. We thank Christiane Christophe-Hobertus for the synthesis of the oligonucleotides, and M. Samson for helpful advice. We thank Dr. D. Jenne for sharing unpublished results. This work was supported by the Belgian Programme on Interuniversity Poles of attraction initiated by the Belgian State, Prime Minister’s Office, Science Policy Programming. It was also supported by the Fondation Me´dicale Reine Elisabeth, the Fonds de la Recherche Scientifique Me´dicale of Belgium, the Association Recherche Biome´dicale et Diagnostic. The scientific responsibility is assumed by the authors. P.V. and S.S. are respectively Aspirant and Chercheur Qualifie´ of the Fonds National de la Recherche Scientifique.
1. Buck, L. B., and Axel, R. (1991) Cell 65, 175–187. 2. Parmentier, M., Libert, F., Schurmans, S., Schiffmann, S., Lefort, A., Eggerickx, D., Ledent, C., Mollereau, C., Ge´rard, C., Perret, J., Grootegoed, A., and Vassart, G. (1992) Nature (Lond.) 355, 453–455. 3. Parmentier, M., Schurmans, S., Libert, F., Vanderhaeghen, P., and Vassart, G. (1992) in Handbook of Receptors and Channels (S. J. Peroutka, Ed.), pp. 237–250, CRC Press, London. 4. Chess, A., Simon, I., Cedar, H., and Axel, R. (1995) Cell 78, 823– 834. 5. Ben-Arie, N., Lancet, D., Taylor, C., Khen, M., Walker, N., Ledbetter, D. H., Carrozzo, R., Patel, K., Sheer, D., Lehrach, H., and North, M. A. (1994) Hum. Mol. Gen. 3, 229–235. 6. Fan, W., Liu, Y., Parimoo, S., and Weissman, S. M. (1995) Genomics 27, 119–123. 7. Glusman, G., Clifton, S., Roe, B., and Lancet, D. (1996) Genomics 37, 147–160.
286
AID
BBRC 7043
/
6935$$$303
08-01-97 07:34:28
bbrcgs
AP: BBRC
Vol. 237, No. 2, 1997
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
8. Reed, R. R. (1992) Cold Spring Harbor Symposia on quantitative biology LVII, 501–504. 9. Schurmans, S., Muscatelli, F., Miot, F., Mattei, M., Vassart, G., and Parmentier, M. (1993) Cytogenet Cell Genet. 63, 200–204. 10. Sullivan, S., Adamson, M. C., Ressler, K., Kozak, C., and Buck, L. B. (1996) Proc. Natl. Acad. Sci. USA 93, 884–888. 11. Vanderhaeghen, P., Schurmans, S., Vassart, G., and Parmentier, M. (1993) J. Cell Biol. 123, 1441–1452. 12. Vanderhaeghen, P., Schurmans, S., Vassart, G., and Parmentier, M. (1997) Genomics 39, 239–246. 13. Walensky, L. D., Roskams, A. J., Lefkowitz, R. J., Snyder, S. H., and Ronnett, G. V. (1995) Mol. Med. 1, 130–141. 14. Ward, C. R., and Kopf, G. S. (1993) Dev. Biol. 158, 9–34. 15. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1988) Molecular
16. 17. 18. 19.
20.
Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Walter, M. A., Spillett, D. J., Thomas, P., Weissenbach, J., and Goodfellow, P. N. (1994) Nature Genetics 7, 22–28. Hudson, T., Stein, L., collaborators, Page, D. C., and Lander, E. S. (1995) Science 270, 1945–1954. Yeom, Y., Abe, K., Bennett, D., and Artzt, K. (1992) Proc. Natl. Acad. Sci. USA 89, 773–777. Chaudary, S., Wykes, S., Kramer, J., Mohamed, A., Koppitch, F., Nelson, J., and Krawetz, S. (1995) J. Biol. Chem. 270, 8755– 8762. Asai, H., Kasai, H., Matsuda, Y., Yamazaki, N., Nagawa, F., Sakano, H., and Tsuboi, A. (1996) Biochem. Biophys. Research Com. 221, 240–247.
287
AID
BBRC 7043
/
6935$$$303
08-01-97 07:34:28
bbrcgs
AP: BBRC