- Email: [email protected]
Molecular Cloning and Expression of Human L-Pipecolate Oxidase
Biochemical and Biophysical Research Communications 270, 1101–1105 (2000) doi:10.1006/bbrc.2000.2575, available online at http://www.idealibrary.com on
Molecular Cloning and Expression of Human L-Pipecolate Oxidase Lodewijk IJlst, Isabella de Kromme, Wendy Oostheim, and Ronald J. A. Wanders 1 Department of Clinical Chemistry and Department of Pediatrics, Emma Children’s Hospital, Laboratory of Genetic Metabolic Diseases, Universtity of Amsterdam, Academic Medical Centre, P.O. Box 22700, 1100 DE Amsterdam, The Netherlands
Received March 24, 2000
In higher eukaryotes L-lysine can be degraded via two distinct routes including the saccharopine pathway and the L-pipecolate pathway. The saccharopine pathway is the primary route of degradation of lysine in most tissues except the brain in which the L-pipecolate pathway is most active. L-pipecolate is formed from L-lysine via two enzymatic reactions and then undergoes dehydrogenation to ⌬ 1-piperideine-6carboxylate. At least in humans and monkeys, this is brought about by the enzyme L-pipecolate oxidase (PIPOX) localized in peroxisomes. In literature, several patients have been described with hyperpipecolic acidaemia. The underlying mechanism responsible for the impaired degradation of pipecolate has remained unclear through the years. In order to resolve this question, we have now cloned the human L-pipecolate oxidase cDNA which codes for a protein of 390 amino acids and contains an ADP-␣-binding fold compatible with its identity as a flavoprotein. Furthermore, the deduced protein ends in ⴚKAHL at its carboxy terminus which constitutes a typical Type I peroxisomal-targeting signal (PTS I). © 2000 Academic Press Key Words: peroxisomes; amino acids; pipecolic acid; peroxisomal disorders.
L-Pipecolic acid (piperidine-2-carboxylate) has long been known to be an intermediate in the degradation of L-lysine in mammals although the primary route of L-lysine degradation is via the saccharopine pathway (Fig. 1). In this pathway L-lysine is transformed into ⌬ 1-piperideine-6-carboxylate via the sequential action of L-lysine 2-ketoglutarate reductase and saccharopine dehydrogenase. These two reactions are catalyzed by a single bifunctional enzyme (1). In brain however, the activity of this bifunctional enzyme is very low and degradation of L-lysine proceeds predominantly via To whom correspondence should be addressed. Fax: ⫹ 31 20 6962596. E-mail: [email protected]. 1
L-pipecolate as intermediate (2–5). L-Pipecolate is formed from L-lysine via two enzymatic reactions with ⌬ 1-piperideine-2-carboxylate and its open-chain form 2-keto-6-aminocaproate as intermediate. The exact mechanism of oxidation of L-pipecolate remained unclear until we (6, 7) and others (8, 9) identified an enzyme converting L-pipecolate into ⌬ 1piperideine-6-carboxylate which at physiological pH spontaneously opens to form 2-aminoadipic acid semialdehyde. This semialdehyde is then converted into 2-aminoadipic acid via an NAD-dependent dehydrogenase studied in detail by Chang and coworkers (10). The enzyme converting L-pipecolate into ⌬ 1piperideine-6-carboxylate turned out to be an oxidase with molecular oxygen as second substrate and H2O 2 as product (7). Furthermore, L-pipecolate oxidase activity was found to be deficient in patients suffering from the cerebro-hepato-renal (Zellweger) syndrome (6, 11). In these patients morphologically distinguishable peroxisomes are absent due to a defect in peroxisome biogenesis leading to a deficiency of virtually all peroxisomal enzymes (12). These findings not only provided an explanation for the elevated L-pipecolate levels in body fluids from Zellweger patients but also suggested that L-pipecolate oxidase might well be a peroxisomal enzyme which turned out to be true, at least in human (7) and monkey liver (9). Interestingly, in lower mammals such as rats and rabbits L-pipecolate appears to be oxidized predominantly but not exclusively in mitochondria (13). The first mammalian L-pipecolate oxidase was purified and characterized by Mihalik et al. (14) from monkey liver as a 46 kDa protein with a covalently bound flavin. Reuber et al. (15) purified the enzyme from rabbit kidney and established that sarcosine, L-pipecolate, and L-proline are all good substrates for the enzyme. Maximal velocity was highest with sarcosine as substrate which led the authors to name the enzyme sarcosine oxidase (SOX) although the catalytic efficiency of the enzyme reflected in the K m/V max ratio
1101
0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
Vol. 270, No. 3, 2000
FIG. 1.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
Schematic representation of the breakdown of L-lysine via saccharopine and L-pipecolate.
was highest with L-pipecolate. The corresponding cDNA was cloned from rabbit liver, encodes a protein of 390 amino acids and contains an N-terminal ADP-␣binding fold, a motif highly conserved in tightly bound flavoproteins. Identification of the human L-pipecolate oxidase cDNA is important since many patients have been described in literature with hyperpipecolic acidaemia. The underlying basis for the elevated L-pipecolate levels has remained mysterious. For this reason we have set out to clone the human L-pipecolate oxidase (PIPOX) cDNA using the mouse and rabbit liver L-pipecolate/sarcosine oxidase sequence information. The results are described below. MATERIALS AND METHODS RNA isolation and cDNA synthesis. Total RNA was isolated from control liver specimens using the acid guanidinium thiocyanatephenol-chloroform extraction procedure (16) and used to prepare cDNA (17). Sequence analysis. The complete PIPOX cDNA was amplified in three overlapping fragments using the following M13-tagged primers: fragment A: [-21M13]-TCTGTGGCTGTGGGGCTGAG, [M13rev]ATATGCATAGATAACTCCTC; fragment B: [-21M13]-TCTGAGGAACTGAAGCAACG, [M13rev]-CCTTCATCAGCCCTGGGTAC; fragment C: [-21M13]-CCTTTCCGTGCTTCCTGTGG, [M13rev]-AGGTAGACTCAATCATCTGG.
Sequence analysis of these PCR fragments using fluorescent labeled M13 primers ([-21M13] ⫽ TGTAAAACGACGGCCAGT; [M13rev] ⫽ CAGGAAACAGCTATGACC) was performed on an Applied Biosystems 377A automated DNA sequencer following the manufacturer’s (Amersham Life Science) protocols. Polymerase chain reaction. The cDNA (5–10 l) was amplified in a mixture (25 l) containing 10 mM Tris–HCl (pH 8.4 at 25EC), 1.5 mM MgCl 2, 50 mM KCl, 0.1 mg/ml BSA, oligonucleotide primers as indicated (12.5 pmol each) and 2.5 U Taq polymerase (Promega). DNA amplification was performed in a PTC–100 thermocycler from M.J. Research Inc. programmed as follows: 120 s at 96°C initial to cycling, 30 cycles of 30 s at 94°C, 30 s at 55°C and 60 s per kb at 72°C followed by 5 min at 72°C. 5⬘ RACE PCR was performed according to manufacturer’s protocol (Clontech) from a human liver cDNA library (Clontech) using the following primer: GCTTCCTCGGGAGTGTGGTAGAAAGAAC. A specific amplification product was obtained in a nested PCR using the following primer: TTTGGCCAGGTGGTATGCAGTGAAGCAG. Construction of expression plasmid. PIPOX was expressed as a MBP-fusion protein in E. coli essentially as described by Reuber et al. (15). The complete open reading frame of the gene coding for PIPOX was amplified in a PCR reaction using the following primer set: ATATGAATTCATGGCGGCTCAGAAAGATCTC and TCAAAGGTGGGCTTTGCCCAG. The PCR products amplified from control liver cDNA was first inserted into pGEM-T (Promega). The cloned PCR products were sequenced to assess the integrity of the PCR process. Plasmid pMAL c-2 (New England Biolabs) was used to create pMal–PIPOX by cloning the ORF of PIPOX into the EcoRI and SalI sites downstream of the lacI promoter. This plasmid was used to transform E. coli BL21-CodonPlus(DE3)-RIL (Strategene) cells,
1102
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Nucleotide and deduced amino acid sequences of human PIPOX. 5⬘ and 3⬘ UTRs are denoted by lowercase letters.
grown in LB-medium supplemented with 50 g/mL ampicilline at 37°C. Expression was induced by addition of 0.3 mM IPTG for 2 h. Bacteria were subsequently lysed by sonication and the PIPOX activity was measured. L-Pipecolate oxidase (PIPOX) activity measurements. The activity of L-pipecolate oxidase was measured spectrophotometrically
at 510 nm using a medium of the following composition: 50 mM Bis-Tris-propane pH 8.7, 1 g/L Triton X-100, 6 mM 2,4,6tribromohydroxybenzoate, 1 mM aminoantipyrine, 25 M FAD, 10 mM sodium azide, 20 U/mL horseradish peroxidase (Boehringer Mannheim, Germany). Reactions were started by the addition of L-pipecolate at a final concentration of 50 mM.
1103
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
RESULTS The human EST database from NCBI was probed with the mouse sarcosine oxidase aminoacid sequence using the BLAST algorithm. The assembly of the putative human L-pipecolate/sarcosine oxidase produced only a partial transcript homologous to nucleotide 364 to 1170 from the mouse SOX ORF. Using primers on this contig and one degenerated primer (nt 1–29: [-21M13]-ATGGCNGCNCARAMNGAYYTNTGGGA3⬘) the open reading was amplified by PCR in overlapping fragments and subsequently sequenced. The remaining 5⬘ end of the cDNA was not identified in the EST database, but was amplified by a RACE PCR using two nested primers with liver cDNA as template. The resulting contig contains an ORF of 1170 bp encoding a protein of 390 amino acids with a predicted molecular weight of 44 kD (Fig. 2). The identified 5⬘ UTR and 3⬘ UTR are 42 and 212 long, respectively. Alignment with other sarcosine oxidases revealed strong homology (18). The FAD binding site consensus is located at the N-terminal part of the protein (aminoacid 9 –37) also containing a conserved histidine at position 49 which is believed to be the covalent attachment site of FAD in sarcosine dehydrogenase and dimethylglycine dehydrogenase (18). Recently a cysteine residue at the C-terminus was identified as the covalent FAD attachment site in mitochondrial sarcosine dehydrogenase from Bacillus sp. (18). This cysteine residue is also present in human PIPOX (C319) and is conserved among other oxidases and is believed to be the covalent attachment site for FAD in oxidases rather than histidine 49. This histidine is spatially near the cysteine residue and may play an important role in flavinylation. Surprisingly the homology at the cDNA level between human and rabbit L-pipecolate oxidase was very strong and differed in only 3 nucleotides (57C, 68C, 80C) at the 5⬘ end of the cDNA. The complete identity of the 3⬘ untranslated end of the cDNA between rabbit and human is even more surprising. We have verified that we have truly cloned the human PIPOX cDNA by using two different human cDNA sources as template. Moreover ESTs of human origin from NBCI are identical to the human PIPOX aminoacid sequence cDNA reported here. The 5⬘ untranslated end of the cDNA was completely different from the human sequence. This 5⬘part of the rabbit cDNA was cloned from a different genomic library as the remaining part of the cDNA which turns out to be of human origin. In order to establish that we had cloned the right cDNA, we expressed the PIPOX cDNA as an MBP-fusion protein in E. coli essentially as described by Reuber et al. (15). The MBP-fusion protein was found to exhibit L-pipecolate oxidase activity whereas no oxidase activity was found if the empty vector was expressed. In accordance with the
results of Reuber et al. (15) activity was not very high even if expression was done in E. coli BL21CodonPlus(DE3)-RIL. DISCUSSION In this paper we report the cloning of the human L-pipecolate oxidase cDNA. Several arguments suggest that the cDNA which we identified truly codes for human L-pipecolate oxidase. First, sequence comparison shows that the deduced protein is highly homologous with mouse sarcosine oxidase and several of the monomeric bacterial sarcosine oxidases. Second, the deduced protein has an ADP-␣-binding fold compatible with its identity as a flavoprotein. Third, expression studies revealed L-pipecolate oxidase activity when expressed as MBP-fusion protein. Fourth, the human cDNA identified by us codes for a protein with ⫺KAHL at its carboxyterminus. Recent studies have shown that this tetrapeptide constitutes a true peroxisome targeting signal (PTS) of the Type 1 form which is recognized by the PTS1-receptor as encoded by the PEX 5 gene and subsequently transported into the peroxisome (19). The availability of the human L-pipecolate oxidase cDNA will now allow studies in the many patients described with L-pipecolic acidaemia. It is known that some of the original patients with hyperpipecolic acidaemia were in fact affected by a disorder of peroxisome biogenesis since later studies revealed additional peroxisomal abnormalities including elevated very-long-chain fatty acids and other abnormalities consistent with a defect in peroxisome biogenesis (20). On the other hand, we know of several patients with apparently isolated hyperpipecolic acidaemia (21) and a single patient with combined hyperpipecolic/hyperphytanic acidaemia (22). We have recently found that although L-pipecolate oxidase activity is virtually undetectable in fibroblasts, there is expression of L-pipecolate oxidase mRNA which now allows molecular studies in fibroblasts from candidate patients. REFERENCES
1104
1. Markovitz, P. J., Chuang, D. T., and Cox, R. P. (1984) J. Biol. Chem. 259, 11643–11646. 2. Chang, Y. F. (1976) Biochem. Biophys. Res. Commun. 69, 174 – 180. 3. Chang, Y. F. (1978) J. Neurochem. 30, 355–360. 4. Hutzler, J., and Dancis, J. (1968) Biochim. Biophys. Acta 158, 62– 69. 5. Chang, Y. F. (1982) Neurochem. Res. 7, 577–588. 6. Wanders, R. J. A., Romeyn, G. J., van Roermund, C. W. T., Schutgens, R. B. H., van den Bosch, H., and Tager, J. M. (1988) Biochem. Biophys. Res. Commun. 154, 33–38. 7. Wanders, R. J. A., Romeyn, G. J., Schutgens, R. B. H., and Tager, J. M. (1989) Biochem. Biophys. Res. Commun. 164, 550 –555.
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
8. Kramar, R., Kremser, K., and Schon, H. (1989) J. Clin. Chem. Clin. Biochem. 27, 319 –321. 9. Mihalik, S. J., and Rhead, W. J. (1989) J. Biol. Chem. 264, 2509 –2517. 10. Chang, Y. F., Ghosh, P., and Rao, V. V. (1990) Biochim. Biophys. Acta. 1038, 300 –305. 11. Mihalik, S. J., Moser, H. W., Watkins, P. A., Danks, D. M., Poulos, A., and Rhead, W. J. (1989) Pediatr. Res. 25, 548 –552. 12. Wanders, R. J. A. (1999) Neurochem. Res. 24, 565–580. 13. Mihalik, S. J., and Rhead, W. J. (1991) J. Comp. Physiol. B 160, 671– 676. 14. Mihalik, S. J., McGuinness, M., and Watkins, P. A. (1991) J. Biol. Chem. 266, 4822– 4830. 15. Reuber, B. E., Karl, C., Reimann, S. A., Mihalik, S. J., and Dodt, G. (1997) J. Biol. Chem. 272, 6766 – 6776. 16. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156 –159.
17. IJlst, L., Wanders, R. J. A., Ushikubo, S., Kamijo, T., and Hashimoto, T. (1994) Biochim. Biophys. Acta 1215, 347–350. 18. Wagner, M. A., Khanna, P., and Jorns, M. S. (1999) Biochemistry 38, 5588 –5595. 19. Hettema, E. H., Distel, B., and Tabak, H. F. (1999) Biochim. Biophys. Acta 1451, 17–34. 20. Lazarow, P. B., and Moser, H. W. (1995) in The Metabolic and Molecular Bases of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., Eds.), pp. 2287–2324, McGrawHill, New York. 21. Kerckaert, I., Poll-The, B.-T., Duran, M., Roeleveld, A. B. C., Espeel, M., Wanders, R. J. A., and Roels, F. (2000) Virchow’s Arch., in press. 22. Baumgartner, M. R., Jansen, G. A., Verhoeven, N. M., Mooyer, P. A., Jakobs, C., Roels, F., Espeel, M., Fourmaintraux, A., Bellet, H., Wanders, R. J. A., and Saudubray, J. M. (2000) Ann. Neurol. 47, 109 –113.
1105
Molecular Cloning and Expression of Human L-Pipecolate Oxidase Lodewijk IJlst, Isabella de Kromme, Wendy Oostheim, and Ronald J. A. Wanders 1 Department of Clinical Chemistry and Department of Pediatrics, Emma Children’s Hospital, Laboratory of Genetic Metabolic Diseases, Universtity of Amsterdam, Academic Medical Centre, P.O. Box 22700, 1100 DE Amsterdam, The Netherlands
Received March 24, 2000
In higher eukaryotes L-lysine can be degraded via two distinct routes including the saccharopine pathway and the L-pipecolate pathway. The saccharopine pathway is the primary route of degradation of lysine in most tissues except the brain in which the L-pipecolate pathway is most active. L-pipecolate is formed from L-lysine via two enzymatic reactions and then undergoes dehydrogenation to ⌬ 1-piperideine-6carboxylate. At least in humans and monkeys, this is brought about by the enzyme L-pipecolate oxidase (PIPOX) localized in peroxisomes. In literature, several patients have been described with hyperpipecolic acidaemia. The underlying mechanism responsible for the impaired degradation of pipecolate has remained unclear through the years. In order to resolve this question, we have now cloned the human L-pipecolate oxidase cDNA which codes for a protein of 390 amino acids and contains an ADP-␣-binding fold compatible with its identity as a flavoprotein. Furthermore, the deduced protein ends in ⴚKAHL at its carboxy terminus which constitutes a typical Type I peroxisomal-targeting signal (PTS I). © 2000 Academic Press Key Words: peroxisomes; amino acids; pipecolic acid; peroxisomal disorders.
L-Pipecolic acid (piperidine-2-carboxylate) has long been known to be an intermediate in the degradation of L-lysine in mammals although the primary route of L-lysine degradation is via the saccharopine pathway (Fig. 1). In this pathway L-lysine is transformed into ⌬ 1-piperideine-6-carboxylate via the sequential action of L-lysine 2-ketoglutarate reductase and saccharopine dehydrogenase. These two reactions are catalyzed by a single bifunctional enzyme (1). In brain however, the activity of this bifunctional enzyme is very low and degradation of L-lysine proceeds predominantly via To whom correspondence should be addressed. Fax: ⫹ 31 20 6962596. E-mail: [email protected]. 1
L-pipecolate as intermediate (2–5). L-Pipecolate is formed from L-lysine via two enzymatic reactions with ⌬ 1-piperideine-2-carboxylate and its open-chain form 2-keto-6-aminocaproate as intermediate. The exact mechanism of oxidation of L-pipecolate remained unclear until we (6, 7) and others (8, 9) identified an enzyme converting L-pipecolate into ⌬ 1piperideine-6-carboxylate which at physiological pH spontaneously opens to form 2-aminoadipic acid semialdehyde. This semialdehyde is then converted into 2-aminoadipic acid via an NAD-dependent dehydrogenase studied in detail by Chang and coworkers (10). The enzyme converting L-pipecolate into ⌬ 1piperideine-6-carboxylate turned out to be an oxidase with molecular oxygen as second substrate and H2O 2 as product (7). Furthermore, L-pipecolate oxidase activity was found to be deficient in patients suffering from the cerebro-hepato-renal (Zellweger) syndrome (6, 11). In these patients morphologically distinguishable peroxisomes are absent due to a defect in peroxisome biogenesis leading to a deficiency of virtually all peroxisomal enzymes (12). These findings not only provided an explanation for the elevated L-pipecolate levels in body fluids from Zellweger patients but also suggested that L-pipecolate oxidase might well be a peroxisomal enzyme which turned out to be true, at least in human (7) and monkey liver (9). Interestingly, in lower mammals such as rats and rabbits L-pipecolate appears to be oxidized predominantly but not exclusively in mitochondria (13). The first mammalian L-pipecolate oxidase was purified and characterized by Mihalik et al. (14) from monkey liver as a 46 kDa protein with a covalently bound flavin. Reuber et al. (15) purified the enzyme from rabbit kidney and established that sarcosine, L-pipecolate, and L-proline are all good substrates for the enzyme. Maximal velocity was highest with sarcosine as substrate which led the authors to name the enzyme sarcosine oxidase (SOX) although the catalytic efficiency of the enzyme reflected in the K m/V max ratio
1101
0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
Vol. 270, No. 3, 2000
FIG. 1.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
Schematic representation of the breakdown of L-lysine via saccharopine and L-pipecolate.
was highest with L-pipecolate. The corresponding cDNA was cloned from rabbit liver, encodes a protein of 390 amino acids and contains an N-terminal ADP-␣binding fold, a motif highly conserved in tightly bound flavoproteins. Identification of the human L-pipecolate oxidase cDNA is important since many patients have been described in literature with hyperpipecolic acidaemia. The underlying basis for the elevated L-pipecolate levels has remained mysterious. For this reason we have set out to clone the human L-pipecolate oxidase (PIPOX) cDNA using the mouse and rabbit liver L-pipecolate/sarcosine oxidase sequence information. The results are described below. MATERIALS AND METHODS RNA isolation and cDNA synthesis. Total RNA was isolated from control liver specimens using the acid guanidinium thiocyanatephenol-chloroform extraction procedure (16) and used to prepare cDNA (17). Sequence analysis. The complete PIPOX cDNA was amplified in three overlapping fragments using the following M13-tagged primers: fragment A: [-21M13]-TCTGTGGCTGTGGGGCTGAG, [M13rev]ATATGCATAGATAACTCCTC; fragment B: [-21M13]-TCTGAGGAACTGAAGCAACG, [M13rev]-CCTTCATCAGCCCTGGGTAC; fragment C: [-21M13]-CCTTTCCGTGCTTCCTGTGG, [M13rev]-AGGTAGACTCAATCATCTGG.
Sequence analysis of these PCR fragments using fluorescent labeled M13 primers ([-21M13] ⫽ TGTAAAACGACGGCCAGT; [M13rev] ⫽ CAGGAAACAGCTATGACC) was performed on an Applied Biosystems 377A automated DNA sequencer following the manufacturer’s (Amersham Life Science) protocols. Polymerase chain reaction. The cDNA (5–10 l) was amplified in a mixture (25 l) containing 10 mM Tris–HCl (pH 8.4 at 25EC), 1.5 mM MgCl 2, 50 mM KCl, 0.1 mg/ml BSA, oligonucleotide primers as indicated (12.5 pmol each) and 2.5 U Taq polymerase (Promega). DNA amplification was performed in a PTC–100 thermocycler from M.J. Research Inc. programmed as follows: 120 s at 96°C initial to cycling, 30 cycles of 30 s at 94°C, 30 s at 55°C and 60 s per kb at 72°C followed by 5 min at 72°C. 5⬘ RACE PCR was performed according to manufacturer’s protocol (Clontech) from a human liver cDNA library (Clontech) using the following primer: GCTTCCTCGGGAGTGTGGTAGAAAGAAC. A specific amplification product was obtained in a nested PCR using the following primer: TTTGGCCAGGTGGTATGCAGTGAAGCAG. Construction of expression plasmid. PIPOX was expressed as a MBP-fusion protein in E. coli essentially as described by Reuber et al. (15). The complete open reading frame of the gene coding for PIPOX was amplified in a PCR reaction using the following primer set: ATATGAATTCATGGCGGCTCAGAAAGATCTC and TCAAAGGTGGGCTTTGCCCAG. The PCR products amplified from control liver cDNA was first inserted into pGEM-T (Promega). The cloned PCR products were sequenced to assess the integrity of the PCR process. Plasmid pMAL c-2 (New England Biolabs) was used to create pMal–PIPOX by cloning the ORF of PIPOX into the EcoRI and SalI sites downstream of the lacI promoter. This plasmid was used to transform E. coli BL21-CodonPlus(DE3)-RIL (Strategene) cells,
1102
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Nucleotide and deduced amino acid sequences of human PIPOX. 5⬘ and 3⬘ UTRs are denoted by lowercase letters.
grown in LB-medium supplemented with 50 g/mL ampicilline at 37°C. Expression was induced by addition of 0.3 mM IPTG for 2 h. Bacteria were subsequently lysed by sonication and the PIPOX activity was measured. L-Pipecolate oxidase (PIPOX) activity measurements. The activity of L-pipecolate oxidase was measured spectrophotometrically
at 510 nm using a medium of the following composition: 50 mM Bis-Tris-propane pH 8.7, 1 g/L Triton X-100, 6 mM 2,4,6tribromohydroxybenzoate, 1 mM aminoantipyrine, 25 M FAD, 10 mM sodium azide, 20 U/mL horseradish peroxidase (Boehringer Mannheim, Germany). Reactions were started by the addition of L-pipecolate at a final concentration of 50 mM.
1103
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
RESULTS The human EST database from NCBI was probed with the mouse sarcosine oxidase aminoacid sequence using the BLAST algorithm. The assembly of the putative human L-pipecolate/sarcosine oxidase produced only a partial transcript homologous to nucleotide 364 to 1170 from the mouse SOX ORF. Using primers on this contig and one degenerated primer (nt 1–29: [-21M13]-ATGGCNGCNCARAMNGAYYTNTGGGA3⬘) the open reading was amplified by PCR in overlapping fragments and subsequently sequenced. The remaining 5⬘ end of the cDNA was not identified in the EST database, but was amplified by a RACE PCR using two nested primers with liver cDNA as template. The resulting contig contains an ORF of 1170 bp encoding a protein of 390 amino acids with a predicted molecular weight of 44 kD (Fig. 2). The identified 5⬘ UTR and 3⬘ UTR are 42 and 212 long, respectively. Alignment with other sarcosine oxidases revealed strong homology (18). The FAD binding site consensus is located at the N-terminal part of the protein (aminoacid 9 –37) also containing a conserved histidine at position 49 which is believed to be the covalent attachment site of FAD in sarcosine dehydrogenase and dimethylglycine dehydrogenase (18). Recently a cysteine residue at the C-terminus was identified as the covalent FAD attachment site in mitochondrial sarcosine dehydrogenase from Bacillus sp. (18). This cysteine residue is also present in human PIPOX (C319) and is conserved among other oxidases and is believed to be the covalent attachment site for FAD in oxidases rather than histidine 49. This histidine is spatially near the cysteine residue and may play an important role in flavinylation. Surprisingly the homology at the cDNA level between human and rabbit L-pipecolate oxidase was very strong and differed in only 3 nucleotides (57C, 68C, 80C) at the 5⬘ end of the cDNA. The complete identity of the 3⬘ untranslated end of the cDNA between rabbit and human is even more surprising. We have verified that we have truly cloned the human PIPOX cDNA by using two different human cDNA sources as template. Moreover ESTs of human origin from NBCI are identical to the human PIPOX aminoacid sequence cDNA reported here. The 5⬘ untranslated end of the cDNA was completely different from the human sequence. This 5⬘part of the rabbit cDNA was cloned from a different genomic library as the remaining part of the cDNA which turns out to be of human origin. In order to establish that we had cloned the right cDNA, we expressed the PIPOX cDNA as an MBP-fusion protein in E. coli essentially as described by Reuber et al. (15). The MBP-fusion protein was found to exhibit L-pipecolate oxidase activity whereas no oxidase activity was found if the empty vector was expressed. In accordance with the
results of Reuber et al. (15) activity was not very high even if expression was done in E. coli BL21CodonPlus(DE3)-RIL. DISCUSSION In this paper we report the cloning of the human L-pipecolate oxidase cDNA. Several arguments suggest that the cDNA which we identified truly codes for human L-pipecolate oxidase. First, sequence comparison shows that the deduced protein is highly homologous with mouse sarcosine oxidase and several of the monomeric bacterial sarcosine oxidases. Second, the deduced protein has an ADP-␣-binding fold compatible with its identity as a flavoprotein. Third, expression studies revealed L-pipecolate oxidase activity when expressed as MBP-fusion protein. Fourth, the human cDNA identified by us codes for a protein with ⫺KAHL at its carboxyterminus. Recent studies have shown that this tetrapeptide constitutes a true peroxisome targeting signal (PTS) of the Type 1 form which is recognized by the PTS1-receptor as encoded by the PEX 5 gene and subsequently transported into the peroxisome (19). The availability of the human L-pipecolate oxidase cDNA will now allow studies in the many patients described with L-pipecolic acidaemia. It is known that some of the original patients with hyperpipecolic acidaemia were in fact affected by a disorder of peroxisome biogenesis since later studies revealed additional peroxisomal abnormalities including elevated very-long-chain fatty acids and other abnormalities consistent with a defect in peroxisome biogenesis (20). On the other hand, we know of several patients with apparently isolated hyperpipecolic acidaemia (21) and a single patient with combined hyperpipecolic/hyperphytanic acidaemia (22). We have recently found that although L-pipecolate oxidase activity is virtually undetectable in fibroblasts, there is expression of L-pipecolate oxidase mRNA which now allows molecular studies in fibroblasts from candidate patients. REFERENCES
1104
1. Markovitz, P. J., Chuang, D. T., and Cox, R. P. (1984) J. Biol. Chem. 259, 11643–11646. 2. Chang, Y. F. (1976) Biochem. Biophys. Res. Commun. 69, 174 – 180. 3. Chang, Y. F. (1978) J. Neurochem. 30, 355–360. 4. Hutzler, J., and Dancis, J. (1968) Biochim. Biophys. Acta 158, 62– 69. 5. Chang, Y. F. (1982) Neurochem. Res. 7, 577–588. 6. Wanders, R. J. A., Romeyn, G. J., van Roermund, C. W. T., Schutgens, R. B. H., van den Bosch, H., and Tager, J. M. (1988) Biochem. Biophys. Res. Commun. 154, 33–38. 7. Wanders, R. J. A., Romeyn, G. J., Schutgens, R. B. H., and Tager, J. M. (1989) Biochem. Biophys. Res. Commun. 164, 550 –555.
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
8. Kramar, R., Kremser, K., and Schon, H. (1989) J. Clin. Chem. Clin. Biochem. 27, 319 –321. 9. Mihalik, S. J., and Rhead, W. J. (1989) J. Biol. Chem. 264, 2509 –2517. 10. Chang, Y. F., Ghosh, P., and Rao, V. V. (1990) Biochim. Biophys. Acta. 1038, 300 –305. 11. Mihalik, S. J., Moser, H. W., Watkins, P. A., Danks, D. M., Poulos, A., and Rhead, W. J. (1989) Pediatr. Res. 25, 548 –552. 12. Wanders, R. J. A. (1999) Neurochem. Res. 24, 565–580. 13. Mihalik, S. J., and Rhead, W. J. (1991) J. Comp. Physiol. B 160, 671– 676. 14. Mihalik, S. J., McGuinness, M., and Watkins, P. A. (1991) J. Biol. Chem. 266, 4822– 4830. 15. Reuber, B. E., Karl, C., Reimann, S. A., Mihalik, S. J., and Dodt, G. (1997) J. Biol. Chem. 272, 6766 – 6776. 16. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156 –159.
17. IJlst, L., Wanders, R. J. A., Ushikubo, S., Kamijo, T., and Hashimoto, T. (1994) Biochim. Biophys. Acta 1215, 347–350. 18. Wagner, M. A., Khanna, P., and Jorns, M. S. (1999) Biochemistry 38, 5588 –5595. 19. Hettema, E. H., Distel, B., and Tabak, H. F. (1999) Biochim. Biophys. Acta 1451, 17–34. 20. Lazarow, P. B., and Moser, H. W. (1995) in The Metabolic and Molecular Bases of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., Eds.), pp. 2287–2324, McGrawHill, New York. 21. Kerckaert, I., Poll-The, B.-T., Duran, M., Roeleveld, A. B. C., Espeel, M., Wanders, R. J. A., and Roels, F. (2000) Virchow’s Arch., in press. 22. Baumgartner, M. R., Jansen, G. A., Verhoeven, N. M., Mooyer, P. A., Jakobs, C., Roels, F., Espeel, M., Fourmaintraux, A., Bellet, H., Wanders, R. J. A., and Saudubray, J. M. (2000) Ann. Neurol. 47, 109 –113.
1105