- Email: [email protected]
PORC gene, the human homologue of the Drosophila segment polarity gene Porcupine
Gene 288 (2002) 147–157 www.elsevier.com/locate/gene
Molecular cloning and initial characterization of the MG61/PORC gene, the human homologue of the Drosophila segment polarity gene Porcupine Andrea Caricasole 1, Teresa Ferraro, Joseph M. Rimland, Georg C. Terstappen* GlaxoSmithKline, Medicines Research Centre, Via Fleming 4, 37135 Verona, Italy Received 10 July 2001; received in revised form 5 October 2001; accepted 4 February 2002 Received by M. D’Urso
Abstract Insect and vertebrate Porcupine genes encode multi-pass endoplasmic reticulum proteins involved in the processing of Wnt (wingless and int homologue) proteins, a class of secreted glycoprotein factors homologous to the Drosophila melanogaster segment polarity gene Wingless (Wg). Here we report the cloning of cDNAs encoding the human homologue of the Drosophila gene Porcupine (Porc), the characterization of its genomic structure and the quantitative analysis of its expression in a comprehensive panel of human tissues. The human Porcupine locus (MG61/PORC) spans 15 exons over approximately 12 kb of genomic sequence on Xp11.23. Real-time quantitative expression analysis reveals that MG61/PORC transcripts are expressed in multiple tissues, but are particularly abundant in the brain. Like its mouse and Xenopus homologues, MG61/PORC encodes four protein isoforms (A–D) generated through alternative splicing and expressed in a tissue-specific fashion. Finally, we present evidence indicating that MG61/PORC can influence the activity of a human Wnt7A expression construct in a T-cell factor-responsive reporter assay. q 2002 Elsevier Science B.V. All rights reserved. Keywords: Wnt (wingless and int homologue processing); TaqMan; Isoforms; Expression pattern; Functional analysis
1. Introduction The Wnt (wingless and int homologue) family comprises a set of relatively large (ca 40 kDa), structurally related, secreted glycoproteins homologous to the Drosophila segment polarity gene Wingless (Wg) (Dale, 1998; Seidensticker and Behrens, 2000). Wnt genes have been described from invertebrate and vertebrate organisms, where they have been shown to play important roles in developmental processes as well as in carcinogenesis in man (Dale, 1998; Sokol, 1999; Polakis, 2000; Seidensticker and Behrens, 2000). They exert their effects through interaction with a family of seven-transmembrane (7-TM) receptors homolo-
Abbreviations: bp, base pair(s); cDNA, DNA complementary to RNA; dNTP, deoxyribonucleoside triphosphate; ds, double stranded; FAM, carboxyfluorescein; kDa, kiloDaltons or 1000 Daltons; kb, kilobase pair(s) or 1000 bp; mRNA, messenger RNA; mg, microgram; ng, nanogram; p, plasmid; PCR, polymerase chain reaction; Porc, porcupine; ss, single stranded; TCF, T-cell factor; Wg, wingless; Wnt, wingless and int homologue * Corresponding author. Tel.: 139-45-921-8957; fax: 139-45-921-8047. E-mail address: [email protected] (G.C. Terstappen). 1 Present address: Department of Human Physiology and Pharmacology, University of Rome ‘La Sapienza’, Piazzale Aldo Moro 5, 00185 Rome, Italy.
gous to the Drosophila segment polarity gene frizzled, which relay the signal inside the cell by activating at least two signal transduction pathways (Wang et al., 1996; Dale, 1998; Kuhl et al., 2000; Seidensticker and Behrens, 2000). Interaction of Wnt factors with frizzled receptors is modulated by a wide variety of soluble (Xu et al., 1998; Piccolo et al., 1999) and membrane-bound (Lin and Perrimon, 1999; Tamai et al., 2000) (Pinson et al., 2000) (Wehrli et al., 2000) molecules. Biochemical studies of Wnt signalling have often involved the transfection of cell lines with Wnt DNA complementary to RNAs (cDNAs), and have revealed that the processing and secretion of Wnt factors appears to be relatively inefficient (Burrus and McMahon, 1995; Tanaka et al., 2000). In Drosophila, the segment polarity gene porcupine (Porc) has been characterized as essential for Wg processing and secretion (Kadowaki et al., 1996). Porc encodes a multipass endoplasmic reticulum (ER) transmembrane protein, necessary for the correct distribution of Wg protein in the fly embryo (Kadowaki et al., 1996). A recent bioinformatics analysis (Hofmann, 2000) has suggested that porcupine proteins may belong to a wider family of membrane-bound O-acyltransferases, suggesting potential mechanisms by which Porc proteins may be involved in the processing of Wg-related ligands.
0378-1119/02/$ - see front matter q 2002 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(02)00467-5
148
A. Caricasole et al. / Gene 288 (2002) 147–157
In porc mutant flies, Wg accumulates in the endoplasmic reticulum, in a manner very similar to that observed for recombinant Wnt expression in transfected mammalian cell lines (Burrus and McMahon, 1995). Porcupine proteins are structurally and functionally conserved throughout evolution (van den Heuvel et al., 1993; Tanaka et al., 2000). Therefore, porcupine genes are predicted to be necessary for correct processing and secretion of Wnt molecules in as diverse organisms as flies, worms and vertebrates. In contrast to Drosophila porcupine, Xenopus and mouse homologues of the fly gene give rise to four proteins through alternative transcript splicing (Tanaka et al., 2000). Murine porcupine transcripts are particularly abundant in brain and lung, organs where many Wnt genes are expressed (Gavin et al., 1990), but the exact function of individual porcupine isoforms remains unclear. Although a partial cDNA encoding a human homologue of Drosophila porcupine has been identified (MG61, GenBank Accession No. L08239), this sequence significantly deviated from the other vertebrate porcupine genes at its 5 0 end (Tanaka et al., 2000). Here we report the cloning and characterization of the human homologue (MG61/PORC) of Drosophila porcupine and show that the predicted MG61/PORC protein is homologous to Xenopus and mouse porcupine genes in its entirety. As for other vertebrate porcupine genes, there are four transcripts generated by alternative splicing. The organization of the MG61/PORC genomic locus, the pattern of expression of transcripts encoding individual MG61/PORC isoforms, the quantitative analysis of MG61/PORC expression in a comprehensive panel of human tissues and an initial functional analysis of MG61/PORC in Wnt signalling are also reported.
2. Materials and methods
2.2. Polymerase chain reaction (PCR) amplification employing a proofreading thermostable DNA polymerase, and automated DNA sequencing PCR amplification was carried out employing the GeneAmp XL PCR kit (PE Biosystems, Branchburg, NJ, USA), using cDNA from adult human hippocampus (see below) or cDNA from the human neuroblastoma cell line NB-OK-1 (Sasaki et al., 1997) as a template. Reaction conditions (for primers, dNTP and enzyme) were according to manufacturer’s protocol, with a final Mg(OAc)2 concentration of 0.8 mM. Primer sequences were as follows: 5 0 primer 5 0 TGGGGGTCTGCAATGGCCACCTTTAGC3 0 ; 3 0 primer: 5 0 CAGAACCCATTGGTCATGGGCTCTGCC3 0 . Reaction details were as follows: 948C/3 0 ; 45 £ (948C/30 0 ; 558C/ 30 0 ; 728C/5 0 ); 728C/20 0 . PCR products were analyzed by electrophoresis on a 1% agarose gel poured and run in 1 £ TAE buffer (Sambrook et al., 1989). Products were cloned using the TOPO TA Cloning system (Invitrogen BV, Groningen, NL). Plasmid DNA was recovered and subjected to automated DNA sequencing by standard protocols using an ABI377 machine (PE Biosystems, Branchburg, NJ, USA). Nucleotide sequences and predicted amino acid sequences have been deposited in GenBank (Accession Nos. AF317058, AF317059, AF317060, AF317061). A human Wnt7A cDNA encompassing the entire coding sequence was amplified from cDNA derived from adult human brain as described above (Section 2.2) using the following PCR primers: forward primer 5 0 -TTGATATCACCATGAACCGGAAAGCGCTG-3 0 and reverse primer 5 0 -TTTCTAGAGGTCCAGTCCTCCCAGCAATC-3 0 . PCR reaction conditions were as follows: 948C/3 0 ; 45 cycles of (948C/30 0 ; 558C/ 30 0 ; 728C/1 0 ); 728C/10 0 . The resulting PCR product was cloned and sequenced to verify identity with the deposited human Wnt7A cDNA sequence (GenBank Accession No. D83175).
2.1. Bioinformatics analysis
2.3. cDNA synthesis and RT-PCR studies
Human genomic sequences containing the complete PORC gene were retrieved by BLAST (Altschul et al., 1990) as follows. The mouse Porcupine amino acid sequence (isoform D, GenBank L08239) was compared to genomic sequences using NCBI’s Human Genome TBLASTN facility. The pairwise alignments between the mouse protein and the human genomic sequences dynamically translated in all six frames were used to deduce the intron/exon positions on the genomic sequences. The splice site consensus sequence prediction was carried out using the WWW interface of Neural Network Splice Site Prediction Tool (NNSPLICE0.9, http://www.fruitfly.org/seq_tools/splice.html). The multiple alignment program CLUSTALW (Thompson et al., 1994) was used for nucleotide or protein sequence comparisons. The PROSCAN program (Prestridge, 1995) was employed to define putative promoter regions within the analyzed human genomic sequences.
Human polyadenylated RNA from various human tissues was purchased from Clontech (Palo Alto, CA, USA). A total of 1 mg polyadenylated RNA from each tissue was converted to cDNA employing Superscript II reverse transcriptase (Life Tech. Inc., MD, USA) and oligodT and random hexamer oligonucleotide (250 ng each) in a final volume of 20 ml, according to manufacturer’s instructions. Following first strand cDNA synthesis, the reaction volume was increased to 100 and 1 ml of this was used for each PCR reaction. Assuming a 50% efficiency in the reverse transcription (RT) reaction, approximately 5 ng of cDNA were employed in each RT-PCR and TaqMan (see below) reaction. For the analysis of the distribution of transcripts encoding the four PORC isoforms conditions were as follows: forward primer: 5 0 CCTTGTGCTGTCCACTTGCGT3 0 and reverse primer: 5 0 CTGAAGTGGAAGGAGACAGCA3 0 . PCR conditions were: 948C/3 0 ; 45 cycles of (948C/30 0 ; 558C/30 0 ; 728C/30 0 );
A. Caricasole et al. / Gene 288 (2002) 147–157
728C/10 0 . For b-actin amplification, PCR conditions were the same except that primers were 5 0 TGAACCCTA-AGGCCAACCGTG3 0 and 5 0 GCTCATAGCTCTTCTCCAGGG3 0 . 2.4. Cell culture, RNA isolation and Northern blotting Cell lines (Neuro2A mouse neuroblastoma, rat PC12 pheochromocytoma, human neuroblastoma NB-OK-1 and human HepG2 hepatoma) were cultured essentially as described (Sasaki et al., 1997; Sala et al., 2000). Polyadenylated RNA was extracted from subconfluent cell monolayers using a modified oligo-dT cellulose binding protocol (Sambrook et al., 1989). In order to isolate messenger RNA (mRNA) from rat organs, total RNA was first isolated according to (Auffray and Rougeon, 1980), followed by extraction of polyadenylated RNA by the oligo-dT cellulose binding protocol (Sambrook et al., 1989). Northern blotting, hybridization with radioactively labelled probes and autoradiography were carried out according to standard protocols (Sambrook et al., 1989). 2.5. Real-time quantitative analysis of gene expression (TaqMan) Real time quantitative PCR analysis of PORC and b-actin expression was carried out with the aid of an ABI7700 machine (PE Biosystems, Branchburg, NJ, USA). A 2 £ stock cocktail of reagents comprising all necessary TaqMan PCR components except primers and probe was purchased from PE Biosystems and employed according to manufacturer’s instructions. TaqMan MG61/PORC-specific primers were as follows: 5 0 primer: 5 0 CCCTGGCTTTTATCACTTACGTG3 0 ; 3 0 primer: 5 0 AGGCACTGAGGATCCG-AGC3 0 . The TaqMan MG61/PORC- specific probe was 5 0 AGCATGTCCTCCGGAAGCGCC3 0 , and was FAM labelled at its 5 0 end. Final primers and probe concentrations were 300 nM each primer and 200 nM, respectively. Reaction parameters were 508C/2 0 ; 958C/10 0 ; 35 £ (958C/15 0 ; 538C/ 1 0 ). Three measurements per sample were carried out in each of two independent experiments. Results were analyzed with the ABI Sequence Detector software version 1.6.3 (PE Biosystems, Branchburg, NJ, USA). Quantitation was carried out relative to a standard curve of MG61/PORC cDNA (isoform D). For b-actin quantitation, a b-actin detection kit was purchased (PE Biosystems, Branchburg, NJ, USA) and employed according to manufacturer’s instructions. 2.6. Transient transfection assays The Wnt7A cDNA obtained as described in Section 2.2 was subcloned into the pCIN4 mammalian expression vector (Rees et al., 1996). A human MG61/PORC cDNA comprising the entire coding sequence for the D isoform was similarly subcloned into pCIN4. The pTCF construct comprised four copies of a TCF response element upstream
149
of a TATA element-luciferase coding sequence transcriptional unit (Bettini et al., 2002). Transient transfections were carried out in triplicate employing LipofectAMINE 2000 (Life Tech. Inc.) according to manufacturer’s instructions. Approximately 50,000 cells/well were seeded into 96-well plates. A total of 0.64 mg/well DNA was transfected into each well, including luciferase reporter plasmid, expression constructs and carrier plasmid DNA as appropriate. Luciferase assays were carried out employing the Packard Luclite Luciferase reporter gene assay kit (Packard Bioscience) according to manufacturer’s instructions, and chemiluminescence was measured in a Packard Topcount counter.
3. Results 3.1. In silico identification and characterization of MG61/ PORC Human sequences homologous to the longest of the mouse porcupine cDNAs and protein (PORC D, Accession No. AB036749) were retrieved from GenBank (GenBank ESThum, GenBank-Pri and GenBank-humHTG subdivisions) using the BLASTN and TBLASTN programs. A partial cDNA sequence previously identified as encoding part of the human homologue of mouse PORC D (MG61, Accession No. L08239; Tanaka et al., 2000) and a number of ESTs (e.g. BE530168, AI922683, AA907337, AA928142, AA010594) were identified within the expressed human genome complement. The predicted amino acid sequence of MG61 is highly homologous to mouse PORC D (93% in the region comprised between nucleotides 105–1312), except for the amino terminalmost sequence which appears to be entirely unrelated (Tanaka et al., 2000). An alignment of the mouse porc D cDNA with the genomic sequence of MG61 revealed the entire coding exon complement of the human PORC protein (Fig. 1A). The locus spans approximately 12 kb of genomic sequence, and is organized into 15 exons, of which exons 2– 15 are coding. Exons 1 and 2 comprise 5 0 UTR sequences, while exon 15 includes the 3 0 UTR region. All predicted exons display splice donor and acceptor sites which conform to the AG/GT rule (Fig. 1B). This analysis also partly explained the discrepancy between the 5 0 portion of the MG61 protein (L08239) and mouse porc (e.g. see Tanaka et al., 2000). The discrepancy appears to reside in the fact that the first annotated exon for the MG61 gene (corresponding to the second coding exon of the PORC/ MG61 locus described in the present work) has been assigned a different splice acceptor site (nucleotide position 104,711). If the splice acceptor site located at position 104,659 is considered instead, then the homology between the predicted GenBank MG61 protein and mouse PORC stretches for a further 17 amino acids upstream reaching the 5 0 end of the second coding exon, coinciding with a splice acceptor site predicted by the Neural Network Splice
150
A. Caricasole et al. / Gene 288 (2002) 147–157
Fig. 1. Predicted structure of the human MG61/PORC locus. (A) Exon-intron structure of the MG61/PORC gene. The 15 exons are represented by boxes (shaded when coding) separated by lines (introns). Exon sizes are indicated above the boxes, while intron sizes are displayed below the lines. (B) The intron/ exon splice junctions are indicated, together with their scores as evaluated by the Neural Network Splice Site Prediction Tool (see text). N.R.: score below 0.05.
Site Prediction Tool at position 104,662 (Fig. 2). The joining of this exon with the first predicted human MG61/PORC coding exon (exon 2) yields the full coding complement for human MG61/PORC (not shown) as supported by the homology with the mouse PORC cDNA sequence and by the existence of a matching human EST (Accession No. BE531068). Further upstream in the MG61/PORC locus, an alignment of the mouse PORC D cDNA with the genomic sequence AF196972 revealed the possible presence of a 5 0 non-coding exon at position 102,348–102,470. The existence of this exon is again supported by the presence of a human EST (Accession No. BE531068) which comprises almost 800 bp of MG61/PORC sequence, including a 5 0 UTR (Fig. 3). In order to identify candidate promoter regions upstream of this exon, 1000 bp of genomic region 5 0 of exon 1 was subjected to analysis using the PROSCAN program (Prestridge, 1995). This analysis identified a putative promoter region (score 89.97) comprising a TATA box and several potential SP1 binding elements (Fig. 3). The predicted transcript initiation site on the human genomic MG61/PORC sequence lies very close to the predicted start of exon 1, in proximity to the 5 0 end of a human EST sequence and the 5 0 UTR of the mouse PORC cDNA. This
indicates this region as a strong candidate promoter for the human MG61/PORC locus. In order to predict in silico the 3 0 UTR of the MG61/PORC gene, a representative number of human MG61/PORC ESTs (AI922683, AA907337, AA928142, AA010594) were aligned with the genomic sequence of the region comprising the last coding exon, exon 14 (AF196972; position 113,758– 114,238). This alignment (not shown) indicated that these ESTs terminated at similar positions, 14–19 nucleotides downstream a consensus polyadenylation signal (AATAAA) located at position 114,154, which can therefore be considered as a probable signal for transcription termination. Thus, the 3 0 UTR of MG61/PORC may extend to this candidate polyadenylation signal 315 bp downstream of the stop codon. Interestingly, the characterized polyadenylation signal for the mouse PORC gene is located 306 bp downstream of the stop codon (see GenBank AB036749). With respect to the coding exon complement of the MG61/PORC locus, the two alternatively spliced exons which in the mouse and in Xenopus laevis give rise to the four PORC isoforms (Tanaka et al., 2000) are of particular interest. These are also conserved in man (exons 7 and 8; Fig. 4) indicating the possibility that MG61/PORC might be
A. Caricasole et al. / Gene 288 (2002) 147–157
151
Fig. 2. Sequence of a portion of human genomic DNA from AF196972 comprising exon 2 of MG61/PORC (boxed). The splice acceptor and donor sequences resulting in the correct processing of exon 2 are italicized. The splice acceptor signal yielding the MG61 transcript is underlined. Numbers refer to the position of the indicated sequence within AF196972.
expressed as four isoforms (A–D) arising from alternative splicing of these exons. The predicted MG61/PORC D protein shares a high degree of homology with the mouse and Xenopus proteins (97 and 89%, respectively).
3.2. Cloning of full length human MG61/PORC cDNAs Following the in silico characterization of the MG61/ PORC locus, a set of PCR primers were designed to include
Fig. 3. Predicted structure of the putative promoter, 5 0 and 3 0 UTRs of the MG61/PORC locus. Alignment of genomic sequences from AF196972 with BE531068 (human EST) and mouse PORC D (AB036749). The human genomic sequences from AF196972 comprise the predicted promoter sequence and the first predicted exon (position 102,095–102,470) joined to the second exon (position 103,151–103,322). The promoter region predicted by the PROSCAN program (see text) includes a TATA element (boxed) and several SP1 binding elements. The putative transcript initiation site is indicated by an arrow. The MG61/PORC translation initiation codon is also boxed.
152
A. Caricasole et al. / Gene 288 (2002) 147–157
the initiation (ATG) and stop codons of MG61/PORC. These were employed in an RT-PCR reaction using a proofreading polymerase to characterize the expressed coding complement of the MG61/PORC locus, using cDNA from human adult hippocampus or from the human neuroblastoma cell line NB-OK-1 (see (Sasaki et al., 1997) and references therein). The resulting PCR products were cloned and subjected to double pass DNA sequencing. Of seven sequenced clones encompassing the MG61/PORC full length coding sequence from adult human hippocampus, four were 1386 bp in length and comprised both exons 6 and 7 (thus encoding MG61/PORC D), two were 1353 bp in length and lacked both exons (thus encoding MG61/PORC A) and one (1371 bp) comprised exon 6 only (thus encoding MG61/PORC B). Three clones amplified from cDNA obtained from the NB-OK-1 neuroblastoma cell line were sequenced and all three (1353 bp) lacked both exons (thus encoding MG61/PORC A). This indicates that alternative splicing of MG61/PORC exons 7 and 8 gives rise to at least three of the four isoforms characterized in mouse and Xenopus (Tanaka et al., 2000). The sequencing data entirely
confirmed the coding exon structure predicted in silico, with MG61/PORC proteins predicted from cDNA sequence and from in silico analysis being 100% identical (not shown). We found no evidence of a cDNA similar in structure to L08239 (MG61).
3.3. Expression of MG61/PORC in rodent and human tissues and cell lines In order to determine the approximate transcript size of MG61/PORC transcripts in rodents and man, a Northern blot of polyadenylated RNA from rat organs and mouse, rat and human cell lines was probed with a MG61/PORC cDNA (Fig. 5). The results suggested that PORC genes are expressed as a main transcript of ca 1.8 kb in rat (PC12) and human cell lines. This transcript size is consistent with a predicted full length cDNA of at least 1877 bp (exons 1–15). By Northern blotting analysis, expression of the rat PORC gene appeared to be restricted to the brain with two transcripts sized ca 1.8 and 3.5 kb being apparent.
Fig. 4. Predicted structure of the four MG61/PORC isoforms, generated by alternative splicing of exons 7 and 8. The splicing event giving rise to transcripts encoding each isoform is indicated, together with the amino acids involved. Exons (numbered) are represented by boxes and are separated by introns (lines). Exon sizes are indicated below each box, and intron sizes are indicated above each line.
A. Caricasole et al. / Gene 288 (2002) 147–157
153
richest source of MG61/PORC transcripts, consistent with findings in the mouse (Tanaka et al., 2000). 3.6. MG61/PORC expression can influence Wnt7Amediated activation of the Wnt pathway in PC12 cells
Fig. 5. Expression of MG61/PORC transcripts in rodent tissues and cell lines and in human cell lines. Northern blot of polyadenylated RNA from rat tissues (adrenal, heart, brain, kidney, liver and testis) and from mouse (Neuro2A), rat (PC12) and human (NB-OK-1, HepG2) cell lines. The blot was probed with a full length MG61/PORC cDNA, stripped and re-probed with a b -actin probe to control for mRNA loading.
3.4. Four MG61/PORC isoforms (A–D) are differentially expressed in human tissues A set of RT-PCR primers were designed to confirm the existence of the four MG61/PORC isoforms (A–D). The primers were designed to amplify the region across the alternatively spliced exons, as in Tanaka et al. (2000), in order to distinguish between the four MG61/PORC transcripts after separation of the PCR products (A: 107 bp; B:124 bp; C: 121 bp; D: 140 bp; see Fig. 4) upon separation by agarose gel electrophoresis (Fig. 6A). The existence of isoform C was confirmed by diagnostic restriction enzyme digestion of PCR products amplified from heart cDNA (data not shown). MG61/PORC is expressed in several human tissues, including the brain, heart, kidney, lung, skeletal muscle, spleen, uterus and testis. Within the adult human brain, expression was observed in all structures analyzed. Analysis of the results indicated that transcripts encoding the four MG61/PORC isoforms were differentially expressed in the available human tissues (Fig. 6B).
3.5. Quantitative expression analysis of MG61/PORC in human tissues Real time quantitative PCR technology (Sala et al., 2000) was employed in order to quantitatively analyze the pattern of expression of MG61/PORC in different human tissues. A set of primers and probe was designed to detect MG61/ PORC transcripts in the available panel of human tissues. The results (Figs. 7A,B) are consistent with the widespread pattern of PORC expression suggested by the RT-PCR studies and with the studies carried out in the mouse (Tanaka et al., 2000). MG61/PORC transcripts are expressed at about 0.001% of polyadenylated-derived cDNA, suggesting that the gene is expressed at a very low level (e.g. see Sala et al., 2000). The brain appeared to be the
Rat PC12 cells have often been employed as a model neuronal cell system capable of responding to stimulation by Wnt factors (Shackleford et al., 1993). The overexpression of Wnt factors in mammalian cells is known to be relatively inefficient, with much Wnt protein accumulating within the transfected cells (Burrus and McMahon, 1995), a situation which resembles that observed in Drosophila cells lacking porc activity. Vertebrate PORC proteins have already been demonstrated to affect the processing of Wnt ligands (Tanaka et al., 2000), though no effects on Wnt bioactivity were reported. In order to determine whether expression of MG61/PORC can influence the Wnt bioactivity of a Wnt7A expression construct in PC12 cells, a series of transient expression assays was conducted employing a TCFresponsive reporter construct to measure Wnt pathway activation. This construct was previously shown to be responsive to treatment with lithium or Wnt7A in PC12 cells (Bettini et al., 2002). The results (Fig. 8) indicate that overexpression of at least one isoform of MG61/PORC (isoform D) can enhance the activity of a Wnt7A expression construct as measured by the TCF-responsive reporter assay. On the basis of the known function of Drosophila porc, this effect is likely to be due to enhanced processing and secretion of Wnt7A in transfected cells. Conversely, overexpression of an MG61/PORC D cDNA in the antisense orientation can result in an almost complete inhibition of Wnt7A-mediated activation of the reporter construct. This may be explained through antisense inhibition of endogenous expression of PORC in PC12 cells (which express porcupine transcripts, see Section 3.3), presumably leading to decreased processing and secretion of Wnt7A in transfected cells. In cells transfected with the highest amount of PORC D expression construct a somewhat reduced efficacy of the Wnt7A expression construct is observed, which may be due to a number of reasons (for instance, competition between the two expression constructs for endogenous (limiting) transcription factors, or to nonspecific effects of excessive PORC D production on protein processing and secretion). The activation of reporter activity by Wnt7A in the presence of maximal amounts of the expression construct encoding sense PORC D is however still greater than that observed in the comparable sample transfected with maximal amounts of antisense PORC D expression construct. 4. Discussion Expression of biologically active Wnt factors is dependent upon a number of events, including the correct processing, post-translational modification and secretion of the prepropeptide. Studies in Drosophila melanogaster have
154
A. Caricasole et al. / Gene 288 (2002) 147–157
Fig. 6. Expression of transcripts encoding MG61/PORC isoforms in different human tissues. (A) RT-PCR carried out using primers specific for MG61/PORC exons 6 and 9, enabling the distinction of MG61/PORC transcripts encoding different isoforms according to the size of resulting PCR products. Expected product sizes are: MG61/PORC A: 107 bp; MG61/PORC B: 124 bp; MG61/PORC C: 121 bp and MG61/PORC D: 140 bp. The marker is a 100 bp ladder, of which only the 200 bp fragment is visible. An RT-PCR was carried out on the same cDNA templates with primers specific for b -actin to control for cDNA integrity (400 bp product). (B) Table summarizing the results illustrated in A.
identified mutant flies whose phenotype closely resembled that of Wg mutants (van den Heuvel et al., 1993). In these flies, however, Wg protein is produced but is not secreted from the cells. The identification of the genes involved in this phenotype led to the discovery of porcupine (porc) an
endoplasmic reticulum transmembrane protein whose function appears to be that of promoting wingless secretion. The existence of a Caenorhabditis elegans homologue and of vertebrate ESTs homologous to porc (see _ HYPERLINK http://www.stanford.edu/~rnusse/wntwindow.html __http://
A. Caricasole et al. / Gene 288 (2002) 147–157
155
Fig. 7. Real-time quantitative PCR (TaqMan) analysis of MG61/PORC expression in different human tissues. (A) Absolute quantitation of MG61/PORC expression in the various samples (FB ¼ foetal brain; AB ¼ adult brain; CN ¼ caudate nucleus; CBL ¼ cerebellum; CC ¼ corpus callosum; HIP ¼ hippocampus; SN ¼ substantia nigra; PIT ¼ pituitary; THA ¼ thalamus; SPC ¼ spinal cord; BM ¼ bone marrow; HEA ¼ heart; KID ¼ kidney; LIV ¼ liver; LUN ¼ lung; PAN ¼ pancreas; PLAC ¼ placenta; SKM ¼ skeletal muscle; SPL ¼ spleen; UTE ¼ uterus; TES ¼ testis). Results shown are the averages and standard errors of three measurements per tissue. (B) Expression of MG61/PORC normalized with respect to b -actin levels in the same samples. Please refer to Section 2.5 for primer sequences.
www.stanford.edu/~rnusse/wntwindow.html_) indicates the evolutionary conservation of porcupine function. The detailed study of such function in vertebrates was, until recently, hindered by the lack of full length sequences and expression patterns of vertebrate porcupine genes. In their comprehensive and elegant study, Tanaka and co-workers (Tanaka et al., 2000) have identified and characterized the Xenopus and mouse homologues of porc, have determined the patterns of expression of the murine gene and have investigated the role of murine porcupine protein isoforms
in Wnt protein processing. In this report, we present the identification, characterization and quantitative expression analysis of the human homologue of porc, and we present the first evidence that a mammalian porc homologue can influence the activity of a Wnt factor in a specific bioassay. Through a bioinformatics approach, we were able to confirm that the MG61/PORC locus corresponds to the human homologue of Drosophila porc. The in silico characterization of the genomic locus revealed that the encoded protein (unlike the published MG61 protein sequence) is
156
A. Caricasole et al. / Gene 288 (2002) 147–157
homologous to the mouse protein in its entirety, and indicated the putative promoter and 3 0 UTR of the gene. The cloning of MG61/PORC cDNAs fully confirmed the prediction of the MG61/PORC coding sequence. Further, it confirmed the existence of alternatively MG61/PORC transcripts, as reported for the mouse and Xenopus genes (Tanaka et al., 2000). The difference between the MG61/PORC cDNA sequences presented here and the MG61 cDNA sequence remains unexplained. We compared the published MG61 cDNA sequence with mouse and human EST databases, but failed to obtain homology in the region where MG61 diverges from the Xenopus and mouse porcupine cDNAs and from our own MG61/PORC sequence (not shown). This evidence does not support the MG61 sequence as derived from a major MG61/PORC transcript. Northern blot analysis indicated brain-specific expression of porcupine sequences in the rat, and yielded transcript sizes for rat and human porcupine which are compatible with the MG61/PORC transcript predicted in silico. A more detailed analysis of MG61/PORC transcript distribution in human tissue samples confirmed that the brain is quantitatively the most important site of MG61/PORC expression. Specifically, the quantitative pattern of MG61/PORC expression in different brain areas indicated somewhat higher expression levels
in the amygdala, caudate nucleus, cerebellum, pituitary and thalamus. Expression in non-CNS tissues was relatively lower than in the CNS, with the exception of the heart. The distribution of transcripts encoding MG61/PORC isoforms in different tissues revealed that MG61/PORC D is the most abundant MG61/PORC isoform in the brain, although some individual brain areas (the substantia nigra) express other isoforms preferentially. These data are in broad agreement with those reported for the mouse (Tanaka et al., 2000). The known biological function of porcupine genes and the pattern of distribution of MG61/PORC expression in the adult human suggest that the human brain is a major site of Wnt protein processing and, by inference, of secretion of Wnt factors. This is consistent with published evidence on the distribution of Wnt transcripts in the mouse and human (Gavin et al., 1990) (http//www.stanford.edu/^rnusse/wntwindow.html). Indeed, we have shown that the MG61/PORC isoform most abundant in the CNS (MG61/PORC D; this manuscript) can influence the activity of an expression construct encoding Wnt7A, a Wnt factor expressed in the brain (Ikegawa et al., 1996), in PC12 cells. Presumably, these effects of MG61/ PORC are mediated at the level of Wnt7A protein processing and/or secretion in transfected cells, though further studies will be needed to demonstrate that PORC effects on Wnt7A bioactivity are mediated at these levels.
Fig. 8. PORC expression can modulate the activity of Wnt7A in PC12 cells. A TCF-responsive, luciferase reporter plasmid construct was employed in transient transfection assays to assess the induction of the Wnt signalling pathway by a transfected Wnt7A expression construct in PC12 cells. Co-expression of either sense or antisense human PORC D cDNA can influence the induction of the pathway by Wnt7A. tcf ¼ cells transfected with reporter plasmid (0.22 mg) and carrier plasmid (0.42 mg) DNA; tcf/PORC 1 ¼ cells transfected with reporter plasmid (0.22 mg), a human PORC D (sense) expression plasmid (0.21 mg) and carrier DNA (0.21 mg); tcf/W7A ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg) and carrier DNA (0.21 mg); tcf/ W7A/PORC 1 (1) ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg), a human PORC D (sense) expression plasmid (0.035 mg) and carrier DNA (0.385 mg); tcf/W7A/PORC 1 (6) ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg), a human PORC D (sense) expression plasmid (0.21 mg); tcf/PORC 2 ¼ cells transfected with reporter plasmid (0.22 mg), a human PORC D (antisense) expression plasmid (0.21 mg) and carrier DNA (0.21 mg); tcf/W7A/PORC 2 (1) ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg), a human PORC D (antisense) expression plasmid (0.035 mg) and carrier DNA (0.385 mg); tcf/W7A/PORC 2 (6) ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg), a human PORC D (antisense) expression plasmid (0.21 mg). Values shown are averages and standard errors of triplicate transfections.
A. Caricasole et al. / Gene 288 (2002) 147–157
Despite the diversity of Wnt proteins (e.g. see Patapoutian and Reichardt, 2000) in vertebrates, porcupine homologues are encoded by a single copy gene (Tanaka et al., 2000). However, protein diversity in vertebrate porcupine homologues is provided by the existence of multiple isoforms generated through alternative splicing (Tanaka et al., 2000; this manuscript). Although the functional consequence of this diversity remains unclear, vertebrate porcupine isoforms appear to be differentially expressed in mouse and man (Tanaka et al., 2000; this manuscript). It is possible that different PORC isoforms may affect the processing and secretion of different Wnt factors. Although the four mouse porcupine isoforms appear to have the same activity on the synthesis of individual Wnt factors (Tanaka et al., 2000), further studies are required in order to determine the specificity of PORC isoforms for the many members of this class of secreted glycoproteins. The recent identification of Xenopus and mouse porcupine homologues (Tanaka et al., 2000) promises to shed light on the mechanisms controlling the specificity and efficiency of Wnt protein expression in vivo. The identification and characterization of MG61/PORC cDNAs (this manuscript) should enable an investigation into the roles of porcupine function in human development and disease. Acknowledgements We thank Federico Faggioni for his excellent technical assistance with DNA sequencing and Ezio Bettini for providing the TCF-responsive reporter construct, advice and discussions. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Auffray, C., Rougeon, F., 1980. Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur. J. Biochem. 107, 303–314. Bettini, E., Magnani, E., Terstappen, G.C., 2002. Lithium induces gene expression through lymphoid enhancer-binding factor/T-cell factor responsive element in PC12 cells. Neurosci. Lett. 317, 50–52. Burrus, L.W., McMahon, A.P., 1995. Biochemical analysis of murine Wnt proteins reveals both shared and distinct properties. Exp. Cell Res. 220, 363–373. Dale, T.C., 1998. Signal transduction by the Wnt family of ligands. Biochem. J. 329, 209–223. Gavin, B.J., McMahon, J.A., McMahon, A.P., 1990. Expression of multiple novel Wnt-1/int-1-related genes during fetal and adult mouse development. Genes Dev. 4, 2319–2332. Hofmann, K., 2000. A superfamily of membrane-bound O-acyltransferases with implications for wnt signaling. Trends Biochem. Sci. 25, 111–112. Ikegawa, S., Kumano, Y., Okui, K., Fujiwara, T., Takahashi, E., Nakamura, Y., 1996. Isolation, characterization and chromosomal assignment of the human WNT7A gene. Cytogenet. Cell Genet. 74, 149–152. Kadowaki, T., Wilder, E., Klingensmith, J., Zachary, K., Perrimon, N., 1996. The segment polarity gene porcupine encodes a putative multitransmembrane protein involved in Wingless processing. Genes Dev. 10, 3116–3128.
157
Kuhl, M., Sheldahl, L.C., Park, M., Miller, J.R., Moon, R.T., 2000. The Wnt/Ca 21 pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet. 16, 279–283. Lin, X., Perrimon, N., 1999. Dally cooperates with Drosophila Frizzled 2 to transduce Wingless signalling [see comments]. Nature 400, 281–284. Patapoutian, A., Reichardt, L.F., 2000. Roles of Wnt proteins in neural development and maintenance. Curr. Opin. Neurobiol. 10, 392–399. Piccolo, S., Agius, E., Leyns, L., Bhattacharyya, S., Grunz, H., Bouwmeester, T., De Robertis, E.M., 1999. The head inducer Cerberus is a multifunctional antagonist of Nodal, BMP and Wnt signals. Nature 397, 707– 710. Pinson, K.I., Brennan, J., Monkley, S., Avery, B.J., Skarnes, W.C., 2000. An LDL-receptor-related protein mediates Wnt signalling in mice [in process citation]. Nature 407, 535–538. Polakis, P., 2000. Wnt signaling and cancer [in process citation]. Genes Dev. 14, 1837–1851. Prestridge, D.S., 1995. Predicting Pol II promoter sequences using transcription factor binding sites. J. Mol. Biol. 249, 923–932. Rees, S., Coote, J., Stables, J., Goodson, S., Harris, S., Lee, M.G., 1996. Bicistronic vector for the creation of stable mammalian cell lines that predisposes all antibiotic-resistant cells to express recombinant protein. Biotechniques 20, 102–110. Sala, C.F., Formenti, E., Terstappen, G.C., Caricasole, A., 2000. Identification, gene structure, and expression of human frizzled-3 (FZD3). Biochem. Biophys. Res. Commun. 273, 27–34. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY. Sasaki, K., Maruyama, K., Nishimura, E., Tsukada, T., Yamaguchi, K., 1997. Differentiation of cultured neuroblastoma induced by staurosporine and cyclic AMP: methods for assessing a neuronal phenotype. Brain Res. Brain Res. Protoc. 1, 399–405. Seidensticker, M.J., Behrens, J., 2000. Biochemical interactions in the wnt pathway. Biochim. Biophys. Acta 1495, 168–182. Shackleford, G.M., Willert, K., Wang, J., Varmus, H.E., 1993. The Wnt-1 proto-oncogene induces changes in morphology, gene expression, and growth factor responsiveness in PC12 cells. Neuron 11, 865–875. Sokol, S.Y., 1999. Wnt signaling and dorso-ventral axis specification in vertebrates. Curr. Opin. Genet. Dev. 9, 405–410. Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess, F., Saint-Jeannet, J.P., He, X., 2000. LDL-receptor-related proteins in Wnt signal transduction [in process citation]. Nature 407, 530–535. Tanaka, K., Okabayashi, K., Asashima, M., Perrimon, N., Kadowaki, T., 2000. The evolutionarily conserved porcupine gene family is involved in the processing of the Wnt family. Eur. J. Biochem. 267, 4300–4311. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. van den Heuvel, M., Harryman-Samos, C., Klingensmith, J., Perrimon, N., Nusse, R., 1993. Mutations in the segment polarity genes wingless and porcupine impair secretion of the wingless protein [published erratum appears in EMBO J. 1994 Jun 15;13(12):2950]. EMBO J. 12, 5293–5302. Wang, Y., Macke, J.P., Abella, B.S., Andreasson, K., Worley, P., Gilbert, D.J., Copeland, N.G., Jenkins, N.A., Nathans, J., 1996. A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. J. Biol. Chem. 271, 4468–4476. Wehrli, M., Dougan, S.T., Caldwell, K., O’Keefe, L., Schwartz, S., VaizelOhayon, D., Schejter, E., Tomlinson, A., DiNardo, S., 2000. Arrow encodes an LDL-receptor-related protein essential for Wingless signalling [in process citation]. Nature 407, 527–530. Xu, Q., D’Amore, P.A., Sokol, S.Y., 1998. Functional and biochemical interactions of Wnts with FrzA, a secreted Wnt antagonist. Development 125, 4767–4776.
Molecular cloning and initial characterization of the MG61/PORC gene, the human homologue of the Drosophila segment polarity gene Porcupine Andrea Caricasole 1, Teresa Ferraro, Joseph M. Rimland, Georg C. Terstappen* GlaxoSmithKline, Medicines Research Centre, Via Fleming 4, 37135 Verona, Italy Received 10 July 2001; received in revised form 5 October 2001; accepted 4 February 2002 Received by M. D’Urso
Abstract Insect and vertebrate Porcupine genes encode multi-pass endoplasmic reticulum proteins involved in the processing of Wnt (wingless and int homologue) proteins, a class of secreted glycoprotein factors homologous to the Drosophila melanogaster segment polarity gene Wingless (Wg). Here we report the cloning of cDNAs encoding the human homologue of the Drosophila gene Porcupine (Porc), the characterization of its genomic structure and the quantitative analysis of its expression in a comprehensive panel of human tissues. The human Porcupine locus (MG61/PORC) spans 15 exons over approximately 12 kb of genomic sequence on Xp11.23. Real-time quantitative expression analysis reveals that MG61/PORC transcripts are expressed in multiple tissues, but are particularly abundant in the brain. Like its mouse and Xenopus homologues, MG61/PORC encodes four protein isoforms (A–D) generated through alternative splicing and expressed in a tissue-specific fashion. Finally, we present evidence indicating that MG61/PORC can influence the activity of a human Wnt7A expression construct in a T-cell factor-responsive reporter assay. q 2002 Elsevier Science B.V. All rights reserved. Keywords: Wnt (wingless and int homologue processing); TaqMan; Isoforms; Expression pattern; Functional analysis
1. Introduction The Wnt (wingless and int homologue) family comprises a set of relatively large (ca 40 kDa), structurally related, secreted glycoproteins homologous to the Drosophila segment polarity gene Wingless (Wg) (Dale, 1998; Seidensticker and Behrens, 2000). Wnt genes have been described from invertebrate and vertebrate organisms, where they have been shown to play important roles in developmental processes as well as in carcinogenesis in man (Dale, 1998; Sokol, 1999; Polakis, 2000; Seidensticker and Behrens, 2000). They exert their effects through interaction with a family of seven-transmembrane (7-TM) receptors homolo-
Abbreviations: bp, base pair(s); cDNA, DNA complementary to RNA; dNTP, deoxyribonucleoside triphosphate; ds, double stranded; FAM, carboxyfluorescein; kDa, kiloDaltons or 1000 Daltons; kb, kilobase pair(s) or 1000 bp; mRNA, messenger RNA; mg, microgram; ng, nanogram; p, plasmid; PCR, polymerase chain reaction; Porc, porcupine; ss, single stranded; TCF, T-cell factor; Wg, wingless; Wnt, wingless and int homologue * Corresponding author. Tel.: 139-45-921-8957; fax: 139-45-921-8047. E-mail address: [email protected] (G.C. Terstappen). 1 Present address: Department of Human Physiology and Pharmacology, University of Rome ‘La Sapienza’, Piazzale Aldo Moro 5, 00185 Rome, Italy.
gous to the Drosophila segment polarity gene frizzled, which relay the signal inside the cell by activating at least two signal transduction pathways (Wang et al., 1996; Dale, 1998; Kuhl et al., 2000; Seidensticker and Behrens, 2000). Interaction of Wnt factors with frizzled receptors is modulated by a wide variety of soluble (Xu et al., 1998; Piccolo et al., 1999) and membrane-bound (Lin and Perrimon, 1999; Tamai et al., 2000) (Pinson et al., 2000) (Wehrli et al., 2000) molecules. Biochemical studies of Wnt signalling have often involved the transfection of cell lines with Wnt DNA complementary to RNAs (cDNAs), and have revealed that the processing and secretion of Wnt factors appears to be relatively inefficient (Burrus and McMahon, 1995; Tanaka et al., 2000). In Drosophila, the segment polarity gene porcupine (Porc) has been characterized as essential for Wg processing and secretion (Kadowaki et al., 1996). Porc encodes a multipass endoplasmic reticulum (ER) transmembrane protein, necessary for the correct distribution of Wg protein in the fly embryo (Kadowaki et al., 1996). A recent bioinformatics analysis (Hofmann, 2000) has suggested that porcupine proteins may belong to a wider family of membrane-bound O-acyltransferases, suggesting potential mechanisms by which Porc proteins may be involved in the processing of Wg-related ligands.
0378-1119/02/$ - see front matter q 2002 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(02)00467-5
148
A. Caricasole et al. / Gene 288 (2002) 147–157
In porc mutant flies, Wg accumulates in the endoplasmic reticulum, in a manner very similar to that observed for recombinant Wnt expression in transfected mammalian cell lines (Burrus and McMahon, 1995). Porcupine proteins are structurally and functionally conserved throughout evolution (van den Heuvel et al., 1993; Tanaka et al., 2000). Therefore, porcupine genes are predicted to be necessary for correct processing and secretion of Wnt molecules in as diverse organisms as flies, worms and vertebrates. In contrast to Drosophila porcupine, Xenopus and mouse homologues of the fly gene give rise to four proteins through alternative transcript splicing (Tanaka et al., 2000). Murine porcupine transcripts are particularly abundant in brain and lung, organs where many Wnt genes are expressed (Gavin et al., 1990), but the exact function of individual porcupine isoforms remains unclear. Although a partial cDNA encoding a human homologue of Drosophila porcupine has been identified (MG61, GenBank Accession No. L08239), this sequence significantly deviated from the other vertebrate porcupine genes at its 5 0 end (Tanaka et al., 2000). Here we report the cloning and characterization of the human homologue (MG61/PORC) of Drosophila porcupine and show that the predicted MG61/PORC protein is homologous to Xenopus and mouse porcupine genes in its entirety. As for other vertebrate porcupine genes, there are four transcripts generated by alternative splicing. The organization of the MG61/PORC genomic locus, the pattern of expression of transcripts encoding individual MG61/PORC isoforms, the quantitative analysis of MG61/PORC expression in a comprehensive panel of human tissues and an initial functional analysis of MG61/PORC in Wnt signalling are also reported.
2. Materials and methods
2.2. Polymerase chain reaction (PCR) amplification employing a proofreading thermostable DNA polymerase, and automated DNA sequencing PCR amplification was carried out employing the GeneAmp XL PCR kit (PE Biosystems, Branchburg, NJ, USA), using cDNA from adult human hippocampus (see below) or cDNA from the human neuroblastoma cell line NB-OK-1 (Sasaki et al., 1997) as a template. Reaction conditions (for primers, dNTP and enzyme) were according to manufacturer’s protocol, with a final Mg(OAc)2 concentration of 0.8 mM. Primer sequences were as follows: 5 0 primer 5 0 TGGGGGTCTGCAATGGCCACCTTTAGC3 0 ; 3 0 primer: 5 0 CAGAACCCATTGGTCATGGGCTCTGCC3 0 . Reaction details were as follows: 948C/3 0 ; 45 £ (948C/30 0 ; 558C/ 30 0 ; 728C/5 0 ); 728C/20 0 . PCR products were analyzed by electrophoresis on a 1% agarose gel poured and run in 1 £ TAE buffer (Sambrook et al., 1989). Products were cloned using the TOPO TA Cloning system (Invitrogen BV, Groningen, NL). Plasmid DNA was recovered and subjected to automated DNA sequencing by standard protocols using an ABI377 machine (PE Biosystems, Branchburg, NJ, USA). Nucleotide sequences and predicted amino acid sequences have been deposited in GenBank (Accession Nos. AF317058, AF317059, AF317060, AF317061). A human Wnt7A cDNA encompassing the entire coding sequence was amplified from cDNA derived from adult human brain as described above (Section 2.2) using the following PCR primers: forward primer 5 0 -TTGATATCACCATGAACCGGAAAGCGCTG-3 0 and reverse primer 5 0 -TTTCTAGAGGTCCAGTCCTCCCAGCAATC-3 0 . PCR reaction conditions were as follows: 948C/3 0 ; 45 cycles of (948C/30 0 ; 558C/ 30 0 ; 728C/1 0 ); 728C/10 0 . The resulting PCR product was cloned and sequenced to verify identity with the deposited human Wnt7A cDNA sequence (GenBank Accession No. D83175).
2.1. Bioinformatics analysis
2.3. cDNA synthesis and RT-PCR studies
Human genomic sequences containing the complete PORC gene were retrieved by BLAST (Altschul et al., 1990) as follows. The mouse Porcupine amino acid sequence (isoform D, GenBank L08239) was compared to genomic sequences using NCBI’s Human Genome TBLASTN facility. The pairwise alignments between the mouse protein and the human genomic sequences dynamically translated in all six frames were used to deduce the intron/exon positions on the genomic sequences. The splice site consensus sequence prediction was carried out using the WWW interface of Neural Network Splice Site Prediction Tool (NNSPLICE0.9, http://www.fruitfly.org/seq_tools/splice.html). The multiple alignment program CLUSTALW (Thompson et al., 1994) was used for nucleotide or protein sequence comparisons. The PROSCAN program (Prestridge, 1995) was employed to define putative promoter regions within the analyzed human genomic sequences.
Human polyadenylated RNA from various human tissues was purchased from Clontech (Palo Alto, CA, USA). A total of 1 mg polyadenylated RNA from each tissue was converted to cDNA employing Superscript II reverse transcriptase (Life Tech. Inc., MD, USA) and oligodT and random hexamer oligonucleotide (250 ng each) in a final volume of 20 ml, according to manufacturer’s instructions. Following first strand cDNA synthesis, the reaction volume was increased to 100 and 1 ml of this was used for each PCR reaction. Assuming a 50% efficiency in the reverse transcription (RT) reaction, approximately 5 ng of cDNA were employed in each RT-PCR and TaqMan (see below) reaction. For the analysis of the distribution of transcripts encoding the four PORC isoforms conditions were as follows: forward primer: 5 0 CCTTGTGCTGTCCACTTGCGT3 0 and reverse primer: 5 0 CTGAAGTGGAAGGAGACAGCA3 0 . PCR conditions were: 948C/3 0 ; 45 cycles of (948C/30 0 ; 558C/30 0 ; 728C/30 0 );
A. Caricasole et al. / Gene 288 (2002) 147–157
728C/10 0 . For b-actin amplification, PCR conditions were the same except that primers were 5 0 TGAACCCTA-AGGCCAACCGTG3 0 and 5 0 GCTCATAGCTCTTCTCCAGGG3 0 . 2.4. Cell culture, RNA isolation and Northern blotting Cell lines (Neuro2A mouse neuroblastoma, rat PC12 pheochromocytoma, human neuroblastoma NB-OK-1 and human HepG2 hepatoma) were cultured essentially as described (Sasaki et al., 1997; Sala et al., 2000). Polyadenylated RNA was extracted from subconfluent cell monolayers using a modified oligo-dT cellulose binding protocol (Sambrook et al., 1989). In order to isolate messenger RNA (mRNA) from rat organs, total RNA was first isolated according to (Auffray and Rougeon, 1980), followed by extraction of polyadenylated RNA by the oligo-dT cellulose binding protocol (Sambrook et al., 1989). Northern blotting, hybridization with radioactively labelled probes and autoradiography were carried out according to standard protocols (Sambrook et al., 1989). 2.5. Real-time quantitative analysis of gene expression (TaqMan) Real time quantitative PCR analysis of PORC and b-actin expression was carried out with the aid of an ABI7700 machine (PE Biosystems, Branchburg, NJ, USA). A 2 £ stock cocktail of reagents comprising all necessary TaqMan PCR components except primers and probe was purchased from PE Biosystems and employed according to manufacturer’s instructions. TaqMan MG61/PORC-specific primers were as follows: 5 0 primer: 5 0 CCCTGGCTTTTATCACTTACGTG3 0 ; 3 0 primer: 5 0 AGGCACTGAGGATCCG-AGC3 0 . The TaqMan MG61/PORC- specific probe was 5 0 AGCATGTCCTCCGGAAGCGCC3 0 , and was FAM labelled at its 5 0 end. Final primers and probe concentrations were 300 nM each primer and 200 nM, respectively. Reaction parameters were 508C/2 0 ; 958C/10 0 ; 35 £ (958C/15 0 ; 538C/ 1 0 ). Three measurements per sample were carried out in each of two independent experiments. Results were analyzed with the ABI Sequence Detector software version 1.6.3 (PE Biosystems, Branchburg, NJ, USA). Quantitation was carried out relative to a standard curve of MG61/PORC cDNA (isoform D). For b-actin quantitation, a b-actin detection kit was purchased (PE Biosystems, Branchburg, NJ, USA) and employed according to manufacturer’s instructions. 2.6. Transient transfection assays The Wnt7A cDNA obtained as described in Section 2.2 was subcloned into the pCIN4 mammalian expression vector (Rees et al., 1996). A human MG61/PORC cDNA comprising the entire coding sequence for the D isoform was similarly subcloned into pCIN4. The pTCF construct comprised four copies of a TCF response element upstream
149
of a TATA element-luciferase coding sequence transcriptional unit (Bettini et al., 2002). Transient transfections were carried out in triplicate employing LipofectAMINE 2000 (Life Tech. Inc.) according to manufacturer’s instructions. Approximately 50,000 cells/well were seeded into 96-well plates. A total of 0.64 mg/well DNA was transfected into each well, including luciferase reporter plasmid, expression constructs and carrier plasmid DNA as appropriate. Luciferase assays were carried out employing the Packard Luclite Luciferase reporter gene assay kit (Packard Bioscience) according to manufacturer’s instructions, and chemiluminescence was measured in a Packard Topcount counter.
3. Results 3.1. In silico identification and characterization of MG61/ PORC Human sequences homologous to the longest of the mouse porcupine cDNAs and protein (PORC D, Accession No. AB036749) were retrieved from GenBank (GenBank ESThum, GenBank-Pri and GenBank-humHTG subdivisions) using the BLASTN and TBLASTN programs. A partial cDNA sequence previously identified as encoding part of the human homologue of mouse PORC D (MG61, Accession No. L08239; Tanaka et al., 2000) and a number of ESTs (e.g. BE530168, AI922683, AA907337, AA928142, AA010594) were identified within the expressed human genome complement. The predicted amino acid sequence of MG61 is highly homologous to mouse PORC D (93% in the region comprised between nucleotides 105–1312), except for the amino terminalmost sequence which appears to be entirely unrelated (Tanaka et al., 2000). An alignment of the mouse porc D cDNA with the genomic sequence of MG61 revealed the entire coding exon complement of the human PORC protein (Fig. 1A). The locus spans approximately 12 kb of genomic sequence, and is organized into 15 exons, of which exons 2– 15 are coding. Exons 1 and 2 comprise 5 0 UTR sequences, while exon 15 includes the 3 0 UTR region. All predicted exons display splice donor and acceptor sites which conform to the AG/GT rule (Fig. 1B). This analysis also partly explained the discrepancy between the 5 0 portion of the MG61 protein (L08239) and mouse porc (e.g. see Tanaka et al., 2000). The discrepancy appears to reside in the fact that the first annotated exon for the MG61 gene (corresponding to the second coding exon of the PORC/ MG61 locus described in the present work) has been assigned a different splice acceptor site (nucleotide position 104,711). If the splice acceptor site located at position 104,659 is considered instead, then the homology between the predicted GenBank MG61 protein and mouse PORC stretches for a further 17 amino acids upstream reaching the 5 0 end of the second coding exon, coinciding with a splice acceptor site predicted by the Neural Network Splice
150
A. Caricasole et al. / Gene 288 (2002) 147–157
Fig. 1. Predicted structure of the human MG61/PORC locus. (A) Exon-intron structure of the MG61/PORC gene. The 15 exons are represented by boxes (shaded when coding) separated by lines (introns). Exon sizes are indicated above the boxes, while intron sizes are displayed below the lines. (B) The intron/ exon splice junctions are indicated, together with their scores as evaluated by the Neural Network Splice Site Prediction Tool (see text). N.R.: score below 0.05.
Site Prediction Tool at position 104,662 (Fig. 2). The joining of this exon with the first predicted human MG61/PORC coding exon (exon 2) yields the full coding complement for human MG61/PORC (not shown) as supported by the homology with the mouse PORC cDNA sequence and by the existence of a matching human EST (Accession No. BE531068). Further upstream in the MG61/PORC locus, an alignment of the mouse PORC D cDNA with the genomic sequence AF196972 revealed the possible presence of a 5 0 non-coding exon at position 102,348–102,470. The existence of this exon is again supported by the presence of a human EST (Accession No. BE531068) which comprises almost 800 bp of MG61/PORC sequence, including a 5 0 UTR (Fig. 3). In order to identify candidate promoter regions upstream of this exon, 1000 bp of genomic region 5 0 of exon 1 was subjected to analysis using the PROSCAN program (Prestridge, 1995). This analysis identified a putative promoter region (score 89.97) comprising a TATA box and several potential SP1 binding elements (Fig. 3). The predicted transcript initiation site on the human genomic MG61/PORC sequence lies very close to the predicted start of exon 1, in proximity to the 5 0 end of a human EST sequence and the 5 0 UTR of the mouse PORC cDNA. This
indicates this region as a strong candidate promoter for the human MG61/PORC locus. In order to predict in silico the 3 0 UTR of the MG61/PORC gene, a representative number of human MG61/PORC ESTs (AI922683, AA907337, AA928142, AA010594) were aligned with the genomic sequence of the region comprising the last coding exon, exon 14 (AF196972; position 113,758– 114,238). This alignment (not shown) indicated that these ESTs terminated at similar positions, 14–19 nucleotides downstream a consensus polyadenylation signal (AATAAA) located at position 114,154, which can therefore be considered as a probable signal for transcription termination. Thus, the 3 0 UTR of MG61/PORC may extend to this candidate polyadenylation signal 315 bp downstream of the stop codon. Interestingly, the characterized polyadenylation signal for the mouse PORC gene is located 306 bp downstream of the stop codon (see GenBank AB036749). With respect to the coding exon complement of the MG61/PORC locus, the two alternatively spliced exons which in the mouse and in Xenopus laevis give rise to the four PORC isoforms (Tanaka et al., 2000) are of particular interest. These are also conserved in man (exons 7 and 8; Fig. 4) indicating the possibility that MG61/PORC might be
A. Caricasole et al. / Gene 288 (2002) 147–157
151
Fig. 2. Sequence of a portion of human genomic DNA from AF196972 comprising exon 2 of MG61/PORC (boxed). The splice acceptor and donor sequences resulting in the correct processing of exon 2 are italicized. The splice acceptor signal yielding the MG61 transcript is underlined. Numbers refer to the position of the indicated sequence within AF196972.
expressed as four isoforms (A–D) arising from alternative splicing of these exons. The predicted MG61/PORC D protein shares a high degree of homology with the mouse and Xenopus proteins (97 and 89%, respectively).
3.2. Cloning of full length human MG61/PORC cDNAs Following the in silico characterization of the MG61/ PORC locus, a set of PCR primers were designed to include
Fig. 3. Predicted structure of the putative promoter, 5 0 and 3 0 UTRs of the MG61/PORC locus. Alignment of genomic sequences from AF196972 with BE531068 (human EST) and mouse PORC D (AB036749). The human genomic sequences from AF196972 comprise the predicted promoter sequence and the first predicted exon (position 102,095–102,470) joined to the second exon (position 103,151–103,322). The promoter region predicted by the PROSCAN program (see text) includes a TATA element (boxed) and several SP1 binding elements. The putative transcript initiation site is indicated by an arrow. The MG61/PORC translation initiation codon is also boxed.
152
A. Caricasole et al. / Gene 288 (2002) 147–157
the initiation (ATG) and stop codons of MG61/PORC. These were employed in an RT-PCR reaction using a proofreading polymerase to characterize the expressed coding complement of the MG61/PORC locus, using cDNA from human adult hippocampus or from the human neuroblastoma cell line NB-OK-1 (see (Sasaki et al., 1997) and references therein). The resulting PCR products were cloned and subjected to double pass DNA sequencing. Of seven sequenced clones encompassing the MG61/PORC full length coding sequence from adult human hippocampus, four were 1386 bp in length and comprised both exons 6 and 7 (thus encoding MG61/PORC D), two were 1353 bp in length and lacked both exons (thus encoding MG61/PORC A) and one (1371 bp) comprised exon 6 only (thus encoding MG61/PORC B). Three clones amplified from cDNA obtained from the NB-OK-1 neuroblastoma cell line were sequenced and all three (1353 bp) lacked both exons (thus encoding MG61/PORC A). This indicates that alternative splicing of MG61/PORC exons 7 and 8 gives rise to at least three of the four isoforms characterized in mouse and Xenopus (Tanaka et al., 2000). The sequencing data entirely
confirmed the coding exon structure predicted in silico, with MG61/PORC proteins predicted from cDNA sequence and from in silico analysis being 100% identical (not shown). We found no evidence of a cDNA similar in structure to L08239 (MG61).
3.3. Expression of MG61/PORC in rodent and human tissues and cell lines In order to determine the approximate transcript size of MG61/PORC transcripts in rodents and man, a Northern blot of polyadenylated RNA from rat organs and mouse, rat and human cell lines was probed with a MG61/PORC cDNA (Fig. 5). The results suggested that PORC genes are expressed as a main transcript of ca 1.8 kb in rat (PC12) and human cell lines. This transcript size is consistent with a predicted full length cDNA of at least 1877 bp (exons 1–15). By Northern blotting analysis, expression of the rat PORC gene appeared to be restricted to the brain with two transcripts sized ca 1.8 and 3.5 kb being apparent.
Fig. 4. Predicted structure of the four MG61/PORC isoforms, generated by alternative splicing of exons 7 and 8. The splicing event giving rise to transcripts encoding each isoform is indicated, together with the amino acids involved. Exons (numbered) are represented by boxes and are separated by introns (lines). Exon sizes are indicated below each box, and intron sizes are indicated above each line.
A. Caricasole et al. / Gene 288 (2002) 147–157
153
richest source of MG61/PORC transcripts, consistent with findings in the mouse (Tanaka et al., 2000). 3.6. MG61/PORC expression can influence Wnt7Amediated activation of the Wnt pathway in PC12 cells
Fig. 5. Expression of MG61/PORC transcripts in rodent tissues and cell lines and in human cell lines. Northern blot of polyadenylated RNA from rat tissues (adrenal, heart, brain, kidney, liver and testis) and from mouse (Neuro2A), rat (PC12) and human (NB-OK-1, HepG2) cell lines. The blot was probed with a full length MG61/PORC cDNA, stripped and re-probed with a b -actin probe to control for mRNA loading.
3.4. Four MG61/PORC isoforms (A–D) are differentially expressed in human tissues A set of RT-PCR primers were designed to confirm the existence of the four MG61/PORC isoforms (A–D). The primers were designed to amplify the region across the alternatively spliced exons, as in Tanaka et al. (2000), in order to distinguish between the four MG61/PORC transcripts after separation of the PCR products (A: 107 bp; B:124 bp; C: 121 bp; D: 140 bp; see Fig. 4) upon separation by agarose gel electrophoresis (Fig. 6A). The existence of isoform C was confirmed by diagnostic restriction enzyme digestion of PCR products amplified from heart cDNA (data not shown). MG61/PORC is expressed in several human tissues, including the brain, heart, kidney, lung, skeletal muscle, spleen, uterus and testis. Within the adult human brain, expression was observed in all structures analyzed. Analysis of the results indicated that transcripts encoding the four MG61/PORC isoforms were differentially expressed in the available human tissues (Fig. 6B).
3.5. Quantitative expression analysis of MG61/PORC in human tissues Real time quantitative PCR technology (Sala et al., 2000) was employed in order to quantitatively analyze the pattern of expression of MG61/PORC in different human tissues. A set of primers and probe was designed to detect MG61/ PORC transcripts in the available panel of human tissues. The results (Figs. 7A,B) are consistent with the widespread pattern of PORC expression suggested by the RT-PCR studies and with the studies carried out in the mouse (Tanaka et al., 2000). MG61/PORC transcripts are expressed at about 0.001% of polyadenylated-derived cDNA, suggesting that the gene is expressed at a very low level (e.g. see Sala et al., 2000). The brain appeared to be the
Rat PC12 cells have often been employed as a model neuronal cell system capable of responding to stimulation by Wnt factors (Shackleford et al., 1993). The overexpression of Wnt factors in mammalian cells is known to be relatively inefficient, with much Wnt protein accumulating within the transfected cells (Burrus and McMahon, 1995), a situation which resembles that observed in Drosophila cells lacking porc activity. Vertebrate PORC proteins have already been demonstrated to affect the processing of Wnt ligands (Tanaka et al., 2000), though no effects on Wnt bioactivity were reported. In order to determine whether expression of MG61/PORC can influence the Wnt bioactivity of a Wnt7A expression construct in PC12 cells, a series of transient expression assays was conducted employing a TCFresponsive reporter construct to measure Wnt pathway activation. This construct was previously shown to be responsive to treatment with lithium or Wnt7A in PC12 cells (Bettini et al., 2002). The results (Fig. 8) indicate that overexpression of at least one isoform of MG61/PORC (isoform D) can enhance the activity of a Wnt7A expression construct as measured by the TCF-responsive reporter assay. On the basis of the known function of Drosophila porc, this effect is likely to be due to enhanced processing and secretion of Wnt7A in transfected cells. Conversely, overexpression of an MG61/PORC D cDNA in the antisense orientation can result in an almost complete inhibition of Wnt7A-mediated activation of the reporter construct. This may be explained through antisense inhibition of endogenous expression of PORC in PC12 cells (which express porcupine transcripts, see Section 3.3), presumably leading to decreased processing and secretion of Wnt7A in transfected cells. In cells transfected with the highest amount of PORC D expression construct a somewhat reduced efficacy of the Wnt7A expression construct is observed, which may be due to a number of reasons (for instance, competition between the two expression constructs for endogenous (limiting) transcription factors, or to nonspecific effects of excessive PORC D production on protein processing and secretion). The activation of reporter activity by Wnt7A in the presence of maximal amounts of the expression construct encoding sense PORC D is however still greater than that observed in the comparable sample transfected with maximal amounts of antisense PORC D expression construct. 4. Discussion Expression of biologically active Wnt factors is dependent upon a number of events, including the correct processing, post-translational modification and secretion of the prepropeptide. Studies in Drosophila melanogaster have
154
A. Caricasole et al. / Gene 288 (2002) 147–157
Fig. 6. Expression of transcripts encoding MG61/PORC isoforms in different human tissues. (A) RT-PCR carried out using primers specific for MG61/PORC exons 6 and 9, enabling the distinction of MG61/PORC transcripts encoding different isoforms according to the size of resulting PCR products. Expected product sizes are: MG61/PORC A: 107 bp; MG61/PORC B: 124 bp; MG61/PORC C: 121 bp and MG61/PORC D: 140 bp. The marker is a 100 bp ladder, of which only the 200 bp fragment is visible. An RT-PCR was carried out on the same cDNA templates with primers specific for b -actin to control for cDNA integrity (400 bp product). (B) Table summarizing the results illustrated in A.
identified mutant flies whose phenotype closely resembled that of Wg mutants (van den Heuvel et al., 1993). In these flies, however, Wg protein is produced but is not secreted from the cells. The identification of the genes involved in this phenotype led to the discovery of porcupine (porc) an
endoplasmic reticulum transmembrane protein whose function appears to be that of promoting wingless secretion. The existence of a Caenorhabditis elegans homologue and of vertebrate ESTs homologous to porc (see _ HYPERLINK http://www.stanford.edu/~rnusse/wntwindow.html __http://
A. Caricasole et al. / Gene 288 (2002) 147–157
155
Fig. 7. Real-time quantitative PCR (TaqMan) analysis of MG61/PORC expression in different human tissues. (A) Absolute quantitation of MG61/PORC expression in the various samples (FB ¼ foetal brain; AB ¼ adult brain; CN ¼ caudate nucleus; CBL ¼ cerebellum; CC ¼ corpus callosum; HIP ¼ hippocampus; SN ¼ substantia nigra; PIT ¼ pituitary; THA ¼ thalamus; SPC ¼ spinal cord; BM ¼ bone marrow; HEA ¼ heart; KID ¼ kidney; LIV ¼ liver; LUN ¼ lung; PAN ¼ pancreas; PLAC ¼ placenta; SKM ¼ skeletal muscle; SPL ¼ spleen; UTE ¼ uterus; TES ¼ testis). Results shown are the averages and standard errors of three measurements per tissue. (B) Expression of MG61/PORC normalized with respect to b -actin levels in the same samples. Please refer to Section 2.5 for primer sequences.
www.stanford.edu/~rnusse/wntwindow.html_) indicates the evolutionary conservation of porcupine function. The detailed study of such function in vertebrates was, until recently, hindered by the lack of full length sequences and expression patterns of vertebrate porcupine genes. In their comprehensive and elegant study, Tanaka and co-workers (Tanaka et al., 2000) have identified and characterized the Xenopus and mouse homologues of porc, have determined the patterns of expression of the murine gene and have investigated the role of murine porcupine protein isoforms
in Wnt protein processing. In this report, we present the identification, characterization and quantitative expression analysis of the human homologue of porc, and we present the first evidence that a mammalian porc homologue can influence the activity of a Wnt factor in a specific bioassay. Through a bioinformatics approach, we were able to confirm that the MG61/PORC locus corresponds to the human homologue of Drosophila porc. The in silico characterization of the genomic locus revealed that the encoded protein (unlike the published MG61 protein sequence) is
156
A. Caricasole et al. / Gene 288 (2002) 147–157
homologous to the mouse protein in its entirety, and indicated the putative promoter and 3 0 UTR of the gene. The cloning of MG61/PORC cDNAs fully confirmed the prediction of the MG61/PORC coding sequence. Further, it confirmed the existence of alternatively MG61/PORC transcripts, as reported for the mouse and Xenopus genes (Tanaka et al., 2000). The difference between the MG61/PORC cDNA sequences presented here and the MG61 cDNA sequence remains unexplained. We compared the published MG61 cDNA sequence with mouse and human EST databases, but failed to obtain homology in the region where MG61 diverges from the Xenopus and mouse porcupine cDNAs and from our own MG61/PORC sequence (not shown). This evidence does not support the MG61 sequence as derived from a major MG61/PORC transcript. Northern blot analysis indicated brain-specific expression of porcupine sequences in the rat, and yielded transcript sizes for rat and human porcupine which are compatible with the MG61/PORC transcript predicted in silico. A more detailed analysis of MG61/PORC transcript distribution in human tissue samples confirmed that the brain is quantitatively the most important site of MG61/PORC expression. Specifically, the quantitative pattern of MG61/PORC expression in different brain areas indicated somewhat higher expression levels
in the amygdala, caudate nucleus, cerebellum, pituitary and thalamus. Expression in non-CNS tissues was relatively lower than in the CNS, with the exception of the heart. The distribution of transcripts encoding MG61/PORC isoforms in different tissues revealed that MG61/PORC D is the most abundant MG61/PORC isoform in the brain, although some individual brain areas (the substantia nigra) express other isoforms preferentially. These data are in broad agreement with those reported for the mouse (Tanaka et al., 2000). The known biological function of porcupine genes and the pattern of distribution of MG61/PORC expression in the adult human suggest that the human brain is a major site of Wnt protein processing and, by inference, of secretion of Wnt factors. This is consistent with published evidence on the distribution of Wnt transcripts in the mouse and human (Gavin et al., 1990) (http//www.stanford.edu/^rnusse/wntwindow.html). Indeed, we have shown that the MG61/PORC isoform most abundant in the CNS (MG61/PORC D; this manuscript) can influence the activity of an expression construct encoding Wnt7A, a Wnt factor expressed in the brain (Ikegawa et al., 1996), in PC12 cells. Presumably, these effects of MG61/ PORC are mediated at the level of Wnt7A protein processing and/or secretion in transfected cells, though further studies will be needed to demonstrate that PORC effects on Wnt7A bioactivity are mediated at these levels.
Fig. 8. PORC expression can modulate the activity of Wnt7A in PC12 cells. A TCF-responsive, luciferase reporter plasmid construct was employed in transient transfection assays to assess the induction of the Wnt signalling pathway by a transfected Wnt7A expression construct in PC12 cells. Co-expression of either sense or antisense human PORC D cDNA can influence the induction of the pathway by Wnt7A. tcf ¼ cells transfected with reporter plasmid (0.22 mg) and carrier plasmid (0.42 mg) DNA; tcf/PORC 1 ¼ cells transfected with reporter plasmid (0.22 mg), a human PORC D (sense) expression plasmid (0.21 mg) and carrier DNA (0.21 mg); tcf/W7A ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg) and carrier DNA (0.21 mg); tcf/ W7A/PORC 1 (1) ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg), a human PORC D (sense) expression plasmid (0.035 mg) and carrier DNA (0.385 mg); tcf/W7A/PORC 1 (6) ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg), a human PORC D (sense) expression plasmid (0.21 mg); tcf/PORC 2 ¼ cells transfected with reporter plasmid (0.22 mg), a human PORC D (antisense) expression plasmid (0.21 mg) and carrier DNA (0.21 mg); tcf/W7A/PORC 2 (1) ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg), a human PORC D (antisense) expression plasmid (0.035 mg) and carrier DNA (0.385 mg); tcf/W7A/PORC 2 (6) ¼ cells transfected with reporter plasmid (0.22 mg), Wnt7A expression construct (0.21 mg), a human PORC D (antisense) expression plasmid (0.21 mg). Values shown are averages and standard errors of triplicate transfections.
A. Caricasole et al. / Gene 288 (2002) 147–157
Despite the diversity of Wnt proteins (e.g. see Patapoutian and Reichardt, 2000) in vertebrates, porcupine homologues are encoded by a single copy gene (Tanaka et al., 2000). However, protein diversity in vertebrate porcupine homologues is provided by the existence of multiple isoforms generated through alternative splicing (Tanaka et al., 2000; this manuscript). Although the functional consequence of this diversity remains unclear, vertebrate porcupine isoforms appear to be differentially expressed in mouse and man (Tanaka et al., 2000; this manuscript). It is possible that different PORC isoforms may affect the processing and secretion of different Wnt factors. Although the four mouse porcupine isoforms appear to have the same activity on the synthesis of individual Wnt factors (Tanaka et al., 2000), further studies are required in order to determine the specificity of PORC isoforms for the many members of this class of secreted glycoproteins. The recent identification of Xenopus and mouse porcupine homologues (Tanaka et al., 2000) promises to shed light on the mechanisms controlling the specificity and efficiency of Wnt protein expression in vivo. The identification and characterization of MG61/PORC cDNAs (this manuscript) should enable an investigation into the roles of porcupine function in human development and disease. Acknowledgements We thank Federico Faggioni for his excellent technical assistance with DNA sequencing and Ezio Bettini for providing the TCF-responsive reporter construct, advice and discussions. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Auffray, C., Rougeon, F., 1980. Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur. J. Biochem. 107, 303–314. Bettini, E., Magnani, E., Terstappen, G.C., 2002. Lithium induces gene expression through lymphoid enhancer-binding factor/T-cell factor responsive element in PC12 cells. Neurosci. Lett. 317, 50–52. Burrus, L.W., McMahon, A.P., 1995. Biochemical analysis of murine Wnt proteins reveals both shared and distinct properties. Exp. Cell Res. 220, 363–373. Dale, T.C., 1998. Signal transduction by the Wnt family of ligands. Biochem. J. 329, 209–223. Gavin, B.J., McMahon, J.A., McMahon, A.P., 1990. Expression of multiple novel Wnt-1/int-1-related genes during fetal and adult mouse development. Genes Dev. 4, 2319–2332. Hofmann, K., 2000. A superfamily of membrane-bound O-acyltransferases with implications for wnt signaling. Trends Biochem. Sci. 25, 111–112. Ikegawa, S., Kumano, Y., Okui, K., Fujiwara, T., Takahashi, E., Nakamura, Y., 1996. Isolation, characterization and chromosomal assignment of the human WNT7A gene. Cytogenet. Cell Genet. 74, 149–152. Kadowaki, T., Wilder, E., Klingensmith, J., Zachary, K., Perrimon, N., 1996. The segment polarity gene porcupine encodes a putative multitransmembrane protein involved in Wingless processing. Genes Dev. 10, 3116–3128.
157
Kuhl, M., Sheldahl, L.C., Park, M., Miller, J.R., Moon, R.T., 2000. The Wnt/Ca 21 pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet. 16, 279–283. Lin, X., Perrimon, N., 1999. Dally cooperates with Drosophila Frizzled 2 to transduce Wingless signalling [see comments]. Nature 400, 281–284. Patapoutian, A., Reichardt, L.F., 2000. Roles of Wnt proteins in neural development and maintenance. Curr. Opin. Neurobiol. 10, 392–399. Piccolo, S., Agius, E., Leyns, L., Bhattacharyya, S., Grunz, H., Bouwmeester, T., De Robertis, E.M., 1999. The head inducer Cerberus is a multifunctional antagonist of Nodal, BMP and Wnt signals. Nature 397, 707– 710. Pinson, K.I., Brennan, J., Monkley, S., Avery, B.J., Skarnes, W.C., 2000. An LDL-receptor-related protein mediates Wnt signalling in mice [in process citation]. Nature 407, 535–538. Polakis, P., 2000. Wnt signaling and cancer [in process citation]. Genes Dev. 14, 1837–1851. Prestridge, D.S., 1995. Predicting Pol II promoter sequences using transcription factor binding sites. J. Mol. Biol. 249, 923–932. Rees, S., Coote, J., Stables, J., Goodson, S., Harris, S., Lee, M.G., 1996. Bicistronic vector for the creation of stable mammalian cell lines that predisposes all antibiotic-resistant cells to express recombinant protein. Biotechniques 20, 102–110. Sala, C.F., Formenti, E., Terstappen, G.C., Caricasole, A., 2000. Identification, gene structure, and expression of human frizzled-3 (FZD3). Biochem. Biophys. Res. Commun. 273, 27–34. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY. Sasaki, K., Maruyama, K., Nishimura, E., Tsukada, T., Yamaguchi, K., 1997. Differentiation of cultured neuroblastoma induced by staurosporine and cyclic AMP: methods for assessing a neuronal phenotype. Brain Res. Brain Res. Protoc. 1, 399–405. Seidensticker, M.J., Behrens, J., 2000. Biochemical interactions in the wnt pathway. Biochim. Biophys. Acta 1495, 168–182. Shackleford, G.M., Willert, K., Wang, J., Varmus, H.E., 1993. The Wnt-1 proto-oncogene induces changes in morphology, gene expression, and growth factor responsiveness in PC12 cells. Neuron 11, 865–875. Sokol, S.Y., 1999. Wnt signaling and dorso-ventral axis specification in vertebrates. Curr. Opin. Genet. Dev. 9, 405–410. Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess, F., Saint-Jeannet, J.P., He, X., 2000. LDL-receptor-related proteins in Wnt signal transduction [in process citation]. Nature 407, 530–535. Tanaka, K., Okabayashi, K., Asashima, M., Perrimon, N., Kadowaki, T., 2000. The evolutionarily conserved porcupine gene family is involved in the processing of the Wnt family. Eur. J. Biochem. 267, 4300–4311. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. van den Heuvel, M., Harryman-Samos, C., Klingensmith, J., Perrimon, N., Nusse, R., 1993. Mutations in the segment polarity genes wingless and porcupine impair secretion of the wingless protein [published erratum appears in EMBO J. 1994 Jun 15;13(12):2950]. EMBO J. 12, 5293–5302. Wang, Y., Macke, J.P., Abella, B.S., Andreasson, K., Worley, P., Gilbert, D.J., Copeland, N.G., Jenkins, N.A., Nathans, J., 1996. A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. J. Biol. Chem. 271, 4468–4476. Wehrli, M., Dougan, S.T., Caldwell, K., O’Keefe, L., Schwartz, S., VaizelOhayon, D., Schejter, E., Tomlinson, A., DiNardo, S., 2000. Arrow encodes an LDL-receptor-related protein essential for Wingless signalling [in process citation]. Nature 407, 527–530. Xu, Q., D’Amore, P.A., Sokol, S.Y., 1998. Functional and biochemical interactions of Wnts with FrzA, a secreted Wnt antagonist. Development 125, 4767–4776.