Molecular cloning and protein characterization of swine 4-1BB

Veterinary Immunology and Immunopathology 153 (2013) 35–44

Contents lists available at SciVerse ScienceDirect

Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm

Research paper

Molecular cloning and protein characterization of swine 4-1BB Xinxin Zhao a , Huali Su a , Xiaoxi Huang a , Lili Xie a , Zhengzhu Liu c , Xianyong Liu a , Xun Suo a,b,∗ a b c

National Animal Protozoa Laboratory & College of Veterinary Medicine, China Agricultural University, Beijing 100193, China Key Laboratory of Animal Epidemiology and Zoonosis of Ministry of Agriculture, China Agricultural University, Beijing 100193, China College of Animal Science and Technology, Hebei Normal University of Science & Technology, Changli 066600, China

a r t i c l e

i n f o

Article history: Received 22 June 2012 Received in revised form 3 January 2013 Accepted 31 January 2013 Keywords: Swine 4-1BB cDNA sequence 5 regulatory sequence Structural domain Tissue distribution Protein localization

a b s t r a c t 4-1BB is expressed on activated T cells and other immune and non-immune cells. It plays important roles in human and mouse T cell function. However, the swine 4-1BB sequence remains unknown and its role in swine T cell response has not been studied. In the present study, we for the first time described the cloning of the swine 4-1BB gene and the property of the protein. Two 4-1BB variants were detected in swine. The coding sequences of variant 1 and variant 2 were 768 and 726 nucleotides in length, respectively, and both variants were coded by 7 exons in the swine genome. Comparison of nucleotide and amino acid sequences showed that both swine 4-1BB variants were more closely related to bovine and human sequences than to either the mouse or rat sequence. Prediction analysis showed that swine 4-1BB belonged to the tumor necrosis factor receptor (TNFR) superfamily like human and mouse 4-1BB and the tertiary structures of the swine 4-1BB variants were much more similar to mouse 4-1BB than to human 4-1BB. The 1556 bp 5 regulatory sequence cloned by nested PCR efficiently induced green fluorescent protein expression in porcine peripheral blood mononuclear cells (PBMC) post nucleofection. Moreover, 4-1BB protein was widely expressed in pig tissues and both variants of swine 4-1BB protein were transmembrane proteins and expressed on the membrane of porcine PBMCs. Crown Copyright © 2013 Published by Elsevier B.V. All rights reserved.

1. Introduction 4-1BB was first identified by a modified differential screening procedure from activated mouse T cells (Kwon

Abbreviations: TNFR, tumor necrosis factor receptor; PBMC, peripheral blood mononuclear cells; CDS, coding DNA sequence; GFP, green fluorescent protein; CHO, Chinese hamster ovary cells; CD, cluster of differentiation; DC, dendritic cell; NKT, natural killer T cell; TReg , regulatory T cell; IL, interleukin; PCR, polymerase chain reaction; RACE, Rapid Amplification of cDNA Ends; HA, hemagglutinin; RT-PCR, real-time reverse transcriptase PCR; IFA, indirect immunofluorescence assay; UTR, untranslated region; CRD, cysteine-rich domain; EGF, epidermal growth factor; DAPI, 4 ,6-Diamidine-2 -phenylindole dihydrochloride. ∗ Corresponding author at: National Animal Protozoa Laboratory & College of Veterinary Medicine, China Agricultural University, Beijing 100193, China. Tel.: +86 10 6273 4325; fax: +86 10 6273 4325. E-mail address: [email protected] (X. Suo).

and Weissman, 1989). The human homologue was then isolated from activated human peripheral blood T lymphocytes several years later (Schwarz et al., 1995). Mouse and human 4-1BB have cysteine-rich motifs and are classified as a member of the tumor necrosis factor receptor (TNFR) superfamily. Now we realized that 4-1BB is expressed on various types of cells including activated CD4+ and CD8+ T cells, FOXP3+ regulatory T cells (TReg ), dendritic cells (DC), monocytes, eosinophils, neutrophils, natural killer T cells (NKT) and NK cells (Croft, 2009; Wang et al., 2009) and plays multiple roles in inflammatory and immune responses in humans (Croft, 2003, 2009). Firstly, the signaling through 4-1BB could regulate the frequency of antigen-specific effector and memory CD4+ and CD8+ T cells and promote cytokine secretion, such as IL-2, IL-4 and IFN-␥ by providing strong proliferative and survival signals during the initiation and progression of T cell response (Cannons

0165-2427/$ – see front matter. Crown Copyright © 2013 Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetimm.2013.01.016

36

X. Zhao et al. / Veterinary Immunology and Immunopathology 153 (2013) 35–44

et al., 2000; Hendriks et al., 2005). 4-1BB thus becomes an important co-stimulatory receptor of T cells besides CD28. Secondly, 4-1BB signal pathway amplifies inflammation by regulating many inflammatory cells (Watts, 2005). Interaction between 4-1BB and its ligand results in IFN-␥ secretion by NK and NKT cells and the production of leukotrienes and histamine by mast cells (Kim et al., 2008). In addition, binding of 4-1BB to its ligand has been shown to block the suppressive activity of TReg -cells in culture systems that contained both inducible and natural TReg cells (Choi et al., 2004; Robertson et al., 2008). However, other studies have shown that 4-1BB can promote the proliferation or survival of CD4+ and CD8+ TReg cells (Zheng et al., 2004). So, 41BB might have dual regulatory effects on TReg cells which are required for the maintenance of immune homeostasis. Importantly, 4-1BB has been considered as a promising candidate for treating cancer and autoimmune diseases of humans (Melero et al., 1997; Polte et al., 2006; Seo et al., 2004). The 4-1BB gene in swine has not been studied and the swine 4-1BB sequence is not yet known. Here, we cloned the coding and regulatory sequences, predicted the structural domains of swine 4-1BB and determined the tissue distribution and protein localization of 4-1BB. 2. Materials and methods 2.1. Cloning and sequencing The published human 4-1BB cDNA sequence was aligned with the swine genome using the NCBI Blast Program, and then the coding DNA sequence (CDS) of swine 4-1BB was predicted. To clone the swine 4-1BB, primers targeting the predicted sequence were designed as follows: 5 -ATGGGAAATGGCTACTACAA-3 (4-1BB forward primer); 5 -TCATAGTTCACACTCGCCTT-3 (4-1BB reverse primer). Total RNA was extracted from peripheral blood mononuclear cells (PBMC) of two Wuzhishan pigs (Institute of Animal Science, Chinese Academy of Agricultural Science) using the Trizol reagent (Invitrogen, Carlsbad, CA). The extracted RNA was quantified using a spectrophotometer (Thermo Fisher Scientific Inc., USA), and the purity was assessed by the OD260/OD280 ratio. Next 1–2 ␮g of RNA from each sample was used to synthesis cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). Polymerase chain reactions (PCR) were performed with the Phusion DNA polymerase (New England Biolabs, Ipswich, MA) on Veriti 96 well thermal cycler (Applied Biosystems) with a running program of 98 ◦ C for 1 min, 30 cycles of 98 ◦ C for 10 s, 55 ◦ C for 30 s and 72 ◦ C for 30 s, and a final elongation step at 72 ◦ C for 10 min. The purified PCR amplicons were then ligated into the pEasy-simple-blunt vector (Beijing TransGen Biotech Co., Ltd., China), which was then transformed into TransT1 competent cells (Beijing TransGen Biotech Co., Ltd.). The 4-1BB gene fragment from the transformants was commercially sequenced by the AuGCT company (Beijing AuGCT DNA-SYN Biotechnology Co., Ltd., China) using the universal M13F and M13R primers. Then CDS of swine 4-1BB was translated using the DNAStar software (DNASTAR Inc., Madison, WI, USA). Sequence alignments and phylogenetic

Table 1 Primers used in the clone of 4-1BB 5 regulatory sequence and RT-PCR. Primer name

Sequence

4-1BB 5 F1 4-1BB 5 F2 4-1BB 5 F3 4-1BB 5 R1 4-1BB 5 R2 4-1BB RT F 4-1BB RT R

GCCTCATGCTGCTTATCCATTCTT CCCTGTCTCCTGTGGAAAAAGAAT ATTAATTCACCCTCCATCCCACCTTCA GTAGCCACTATGTTGTAGTAGCCA GTCGACTCTTGCATAGGTCTCGTAGCC GTCATCATCTTCTTTCTTGCAC CTTCAGAAACGGTTGTTTGAC

trees were constructed using DNAMAN 6.0 software (Lynnon Corporation, Quebec, Canada). 2.2. 5 RACE and 3 RACE To confirm sequences at both ends of the cloned 4-1BB sequence and clone the 5 and 3 untranslated region (UTR), 5 and 3 Rapid Amplification of cDNA Ends (RACE) were carried out using the 5 -Full RACE and 3 -Full RACE Kit (Takara Bio Inc.). The outer primer and inner primer for 5 race and 3 race were designed as follows: 5 -TGAGGGACAAGGCATACAAAGC-3 (5 RACE outer primer); 5 -TCATGACCAGCAGCACAGTAGC -3 (5 RACE inner primer); 5 -TTGTCCTGGTATCCTACCTG-3 (3 RACE outer primer); 5 -AAGAGGAAGATGCCTGCAGCT-3 (3 RACE inner primer). The RACE products were cloned to the pEasy-simple-blunt vector (Beijing TransGen Biotech Co., Ltd.) and sequenced commercially. 2.3. Clone and characterization of the regulatory sequence of swine 4-1BB The 5 regulatory sequence of swine 4-1BB was cloned from the swine genome by nested PCR. The designed primers were listed in Table 1. Three forward primers were designed based on the swine genome sequence and two reverse primer was designed based on the 5 UTR and CDS of swine 4-1BB, respectively. Subsequently, to verify the validity of the 5 regulatory sequence, the cloned 5 regulatory sequence was inserted to the plasmid pEGFP-N1 at Ase1-Sac1 site to replace the CMV promoter. Porcine PBMCs were then transfected with the constructed plasmid pN1-4-1BBP-EGFP via nucleofection as described previously (Zhao et al., 2011). Briefly, 5 × 106 freshly prepared PBMCs were nucleofected with 4 ␮g pN1-4-1BBP-EGFP, pMax-GFP (Lonza Group Ltd., Switzerland) or without plasmids using the X001 program of the nucleofector device (Lonza Group Ltd.). Green fluorescent protein (GFP) expression was measured by a laser scanning confocal microscope (Leica TCS SP5 II; Leica Microsystems) 24 h post nucleofection. 2.4. Prediction of the secondary structure domains and tertiary structures of swine 4-1BB The signal peptide cleavage sites of the two swine 4-1BB proteins were predicted using the SignalP 4.0 Server (Emanuelsson et al., 2007). The secondary structural domains including transmembrane regions and protein prosites were predicted on the PredictProtein Server

X. Zhao et al. / Veterinary Immunology and Immunopathology 153 (2013) 35–44

(http://www.predictprotein.org). In addition, the tertiary structures of human, mouse variant1 and two swine 4-1BB variants were predicted by the SWISS-MODEL Workspace (Bordoli et al., 2009; Schwede et al., 2003), and then visualized and manipulated using RasWin Molecular Graphics Program (RasMol, version 2.7.3). 2.5. Tissue RNA extraction and real-time PCR Pig tissue samples including heart, liver, spleen, lung, kidney, small intestine, muscle and testis were separated from two 35 day old Large White pigs and stored in RNAstore reagent (TIANGEN, China). At least three copies were collected from each tissue. Then tissue RNA was prepared by Trizol reagent (Invitrogen). The purified RNA samples were then treated with DNaseI (NEB Inc., USA) at 37 ◦ C for 10 min to remove any contaminating genomic DNA. Next 4 ␮g of RNA from each sample was used to generate cDNA using the High Capacity cDNA Reverse Transcription Kit (Ambion, Inc., Austin, TX, USA). For real-time reverse transcriptase PCR (RT-PCR), we designed one pair of primers for porcine 4-1BB with the PerlPrimer software (http://perlprimer.sourceforge.net/), which are shown in Table 1. The primers used to amplify the housekeeping gene (porcine GAPDH) have been described previously (Pilon et al., 2009). The expression levels of 41BB in different tissues were assessed by RT-PCR on the 7500 Real Time PCR System (Ambion, Inc.). Amplifications of the GAPDH and 4-1BB gene from each sample were run in parallel on the same PCR plate with a program of 50 ◦ C for 2 min, 95 ◦ C for 10 min, 40 cycles of 95 ◦ C for 15 s, and 60 ◦ C for 1 min following the instruction for the SYBR Green PCR master mix (Ambion, Inc.). The analysis of relative expression level (relative to 4-1BB in testis) of target gene was based on the 2−Ct method (Livak and Schmittgen, 2001). 2.6. Plasmid construction The pMax-4-1BBV1-HA and pMax-4-1BBV2-HA plasmids were constructed as follows: the sequence of hemagglutinin (HA) tag was added to the 3 end of the two 4-1BB sequences by PCR and then the open reading frame of the 4-1BBV1-HA and 4-1BBV2-HA sequences were inserted into the pMaxGFP plasmid (Lonza Group Ltd.) between the Kpn1 and Sal1 sites, replacing the GFP sequence by the 4-1BBV1-HA or 4-1BBV2-HA sequence. 2.7. Indirect immunofluorescence assay (IFA) Chinese hamster ovary (CHO) cells were transfected with pMax-4-1BBV1-HA, pMax-4-1BBV2-HA, pMax-GFP or without plasmids using the Lipofectamine 2000 reagent (Invitrogen). Porcine PBMCs were nucleofected with the plasmid pMax-4-1BBV1-HA, pMax-4-1BBV2-HA or without plasmids as described in Section 2.3. The 4-1BB expression in CHO cells and porcine PBMCs was measured by indirect immunofluorescence assay (IFA) 48 h and 24 h post transfection, respectively, as described previously (Huang et al., 2011). Briefly, the transfected cells were fixed on the slide with absolute ethyl alcohol at −20 ◦ C for

37

20 min, and then incubated with 0.1% saponin for 10 min at room temperature. The cells were stained with mouse anti-HA tag mAb (EarthOx, LLC, USA) at 4 ◦ C overnight. After three washes with PBS, the cells were further incubated with Cy3-anti-mouse IgG (Proteintech Group Inc., USA) for 1 h at room temperature. After another three washes, 4 ,6-Diamidine-2 -phenylindole dihydrochloride (DAPI, Roche Diagnostics, Germany) was used to label the cell nuclei for 10 min, before examination under a laser scanning confocal microscope (Leica TCS SP5 II; Leica Microsystems).

3. Results 3.1. Cloning and analysis of swine 4-1BB sequences Two variants of swine 4-1BB gene were cloned from Wuzhishan pigs. One CDS was 768 bp (variant 1) and the other 726 bp (variant 2) in length. As shown in Fig. 1A, 42 bp continuous nucleotides near the 3 end (505–546 of variant 1) was absent in the shorter variant 2 sequence. Both 4-1BB CDSs were aligned with the swine genomic contig and were found to be located at chromosome 6 and both variants were coded by seven exons spanning 6 introns (Fig. 1B). The two CDSs of swine 4-1BB were compared with the known 4-1BB sequences of other species using the DNAMAN software. The results showed that the CDS of variant 1 shared 83.3%, 79.8%, 64.5%, 64.1% and 49.6% homology with 4-1BB gene of bovine, human, rat, mouse variant 1 and mouse variant 2, respectively; the CDS of variant 2 shared 79.0%, 76.4%, 61.8%, 62.3% and 53.1% homology with 4-1BB gene of bovine, human, rat, mouse variant 1 and mouse variant 2, respectively. In addition, the cloned 5 UTR and 3 UTR of swine 4-1BB were 190 and 971 nucleotides in length, respectively. The 3 UTR contained a potential polyadenylation site (AATAA) near the end. Also, the cloned sequences resulted from the 5 RACE and 3 RACE validated the primers used for cloning the CDSs of swine 4-1BB. The entire swine 4-1BB gene spanned approximately 17 kb of swine chromosome 6. The 4-1BB gene consisted of 8 exons and 7 introns, in which there were two exons for 5 UTRs and the first 98 nucleotides of CDS, one exon for 3 UTR and the last 88 nucleotides of CDS, and five exons for the remaining CDS. The two exons for 5 UTR sequences were found to be separated by an intron 812 bp in length. Moreover, the two complete cDNA variant sequences were deposited in the GenBank (accession numbers JQ663442 and JQ663443, respectively). The 768 bp CDS of swine 4-1BB variant 1 was predicted to encode a 255 amino acid polypeptide with a calculated molecular weight of approximately 28.2 kDa. The 726 bp swine 4-1BB variant 2 was predicted to encode a 241 amino acid polypeptide with a calculated molecular weight of approximately 26.4 kDa. Alignments of swine 4-1BB amino acid sequences with that of other species and cladogram comparison of the amino acid sequences showed that both swine variants were more closely related to human and bovine sequences than to either the mouse or the rat sequence (Fig. 2A and B), which was consistent with the alignments of nucleotide sequences.

38

X. Zhao et al. / Veterinary Immunology and Immunopathology 153 (2013) 35–44

Fig. 1. Coding sequences (A) and intron/exon structure (B) of swine 4-1BB gene.

3.2. Prediction of the secondary structural domains and tertiary structures of the swine 4-1BB The signal peptide cleavage sites for both swine 41BB variants were between residues 23 and 24 (TRS-VP, Fig. 2A). The two 4-1BB variants were predicted as type I transmembrane proteins including an extracellular region (V1: 1–190; V2: 1–176) containing the amino-terminus of the protein, a transmembrane region (V1: 191–210; V2: 177–196) and an intracellular region (V1: 211–255; V2: 197–241). There were two N-glycosylation sites, a iron–sulfur binding site, a epidermal growth factor (EGF)like domain and a cysteine-rich domain (CRD) consisting of 39 amino acids, in the extracellular region of both

4-1BB variants (Fig. 2A). The CRD is the hallmark of the TNFR superfamily, indicating that swine 4-1BB is also a member of the TNFR superfamily like human and mouse 4-1BB. In addition, the two swine 4-1BB variants had an amidation site and two signaling motifs including a protein kinase C phosphorylation site and a casein kinase II phosphorylation site in the intracellular region (Fig. 2A). In addition, the tertiary structures of mouse and swine 4-1BB were predicted by the ‘automated mode’ of SWISSMODEL Workspace, which selects suitable templates based on a Blast E-value limit (Arnold et al., 2006). The reports produced by SWISS-MODEL showed that the crystal structure of human tumor necrosis factor receptor superfamily member 14 (TNFRSF14) was used as a template for mouse

X. Zhao et al. / Veterinary Immunology and Immunopathology 153 (2013) 35–44

39

Fig. 2. Alignments of the amino acids of swine 4-1BB with cattle (NM 001035336.1), human (NM 001561.5), mouse (NM 011612.2 and NM 001077508.1) and rat (NM 001025773.1) sequences (A), prediction of the secondary structural domains of the swine 4-1BB amino acids (A) and construction of the phylogenetic tree of the above species (B). Symbols in Fig. 1A represent different prosites. Thin solid line (—): signal peptide; thick solid line (—): transmembrane region; #: N-glycosylation site; *: cysteine-rich domain; &: amidation site; @: EGF-like domain; ˆ: iron–sulfur binding site; +: protein kinase C phosphorylation site; %: Casein kinase II phosphorylation site.

and swine 4-1BB structure prediction, and TNFRSF21 for human 4-1BB structure prediction. As shown in Fig. 3, all three species 4-1BB had a CRD in the extracellular region. However, the tertiary structure of swine 4-1BB was much more similar to that of mouse 4-1BB than to human 4-1BB.

3.3. Cloning of swine 4-1BB regulatory sequences and characterization of 4-1BB tissue distribution The cloned 5 regulatory sequence of swine 4-1BB were 1556 nucleotides in length including the 5 UTR sequence,

40

X. Zhao et al. / Veterinary Immunology and Immunopathology 153 (2013) 35–44

Fig. 3. The predicted tertiary structures of human, mouse and swine 4-1BB. The tertiary structures of extracellular domain residues of human, mouse and swine 4-1BB were predicted by the SWISS-MODEL Workspace and were read using “RASWIN” molecular graphics viewer. Cartoon displays of structure models were shown. The yellow, magenta, pale blue and white refer to ␤-sheets, ␣-helices, turns and all other residues, respectively. Brackets represent cysteine-rich domains (CRD).

the first intron and 561 nucleotides upside the first exon of 5 UTR (data not shown). As shown in Fig. 4, the GFP protein was highly expressed in porcine PBMCs under the control of the cloned 5 sequences (Fig. 4A), indicating that the essential promote was present in the sequence. The expression of the swine 4-1BB gene in various tissues was also analyzed by real-time PCR (RT-PCR). 4-1BB was expressed in all detected tissues including heart, liver, spleen, lung, kidney, small intestine, muscle and testis, but the expression level in these tissues was quite different. The 4-1BB expression level was highest in spleen and lowest in testis. Compared to 4-1BB expression in testis, the 41BB expression levels in other tissues were approximately 4–1200 times higher (Fig. 4B). 3.4. Both swine 4-1BB variants were transmembrane proteins and expressed in the membrane of porcine PBMCs As shown in Fig. 5, positive red fluorescences were observed both on the cell membrane and in the cytoplasm of CHO cells transfected with either pMax-41BBV1-HA or pMax-4-1BBV2-HA. In contrast, GFP was only expressed in the cytoplasm of control cells transfected with pMaxGFP. This demonstrated that both swine 4-1BB proteins could

be expressed on the cell membrane and suggested that the red fluorescence observed in the cytoplasm might be the processing or transmitting 4-1BB protein. Besides, positive red fluorescence was also seen on the cell membrane of porcine PBMCs, demonstrating that swine 4-1BB was also expressed on the membrane of porcine PBMCs (Fig. 6). In combination with the predicted transmembrane region, we concluded that both swine 4-1BB variants were transmembrane proteins, the same as human 4-1BB and mouse 4-1BB variant 1.

4. Discussion 4-1BB has been found to play multiple roles in human and mouse immune responses since it was first identified in activated mouse T cells. 4-1BB, as an important member of the TNFR superfamily, has emerged as a key costimulatory receptor in T cell response, especially in CD8+ T cells. 4-1BB deficiency impairs the primary CD8+ T cell response in acute infection of vesicular stomatitis virus, lymphocytic choriomeningitis virus and some strains of influenza virus (Wang et al., 2009). Signaling through 4-1BB/4-1BBL stimulates T cell activation and survival by upregulation of prosurvival members of the Bcl-2 family (Lee et al., 2002)

X. Zhao et al. / Veterinary Immunology and Immunopathology 153 (2013) 35–44

41

Fig. 4. Characterization of cloned 4-1BB 5 regulatory sequence and analysis of tissue distribution of swine 4-1BB. (A) Freshly prepared porcine PBMCs (5 × 106 ) were nucleofected with or without 4 ␮g pN1-4-1BBP-EGFP or pMax-GFP, then GFP expressions were observed by the confocal microscope 24 h post transfection. The bar in the picture represented 5 ␮m. (B) The expression levels of 4-1BB in heart, liver, spleen, lung, kidney, small intestine, muscle and testis were determined by real-time PCR. The data represented one of two independent experiments with essentially the same results and were expressed as the mean of there samples each tissue ± SD.

and downregulation of the proapoptotic molecule Bim (Sabbagh et al., 2008). In this study, we for the first time cloned the 4-1BB CDSs and regulatory sequences in swine. Two swine 4-1BB variants were identified, and they were more closely related to the bovine or human sequences than to the rat or mouse sequences. However, the predicted tertiary structures of

the two swine 4-1BB variants were much more similar to that of mouse 4-1BB variant 1 than to human 4-1BB. Prediction analysis of the secondary structural domain showed that the two variants were type 1 transmembrane proteins and had similar structural domains although the variant 1 had two more predicted N-myristoylation sites than variant 2 (data not shown). The CRD in the extracellular domain

42

X. Zhao et al. / Veterinary Immunology and Immunopathology 153 (2013) 35–44

Fig. 5. Protein localization of two swine 4-1BB variants in CHO cells. CHO cells were transfected with pMax-41BBV1-HA, pMax-41BBV2-HA or the positive plasmid – pMax-GFP using the Lipofectamine 2000 reagent. 4-1BB protein localization was determined by IFA 48 h post transfection. The CHO cells were stained with mouse anti-HA tag monoclonal antibody and Cy3-anti mouse IgG as the secondary antibody. The cells were observed by confocal microscopy. The bar in the picture represented 5 ␮m.

indicated that the two swine 4-1BB variants belonged to the TNFR superfamily like human and mouse homologues and might also exert co-stimulatory functions in porcine T cells. In addition, swine 4-1BB had two kinase phosphorylation sites which might be involved in the transmembrane signaling. Murine 4-1BB was shown to associate with the protein tyrosine kinase p56lck (Kim et al., 1993). The consensus sequence (Cys-X-Cys-Pro) for the p56lck binding site is in the intracellular region of murine 4-1BB, but not present in the swine 4-1BB. In swine 4-lBB, the last proline is replaced with arginine. This phenomenon suggested that the cytoplasmic domains of the TNFR superfamily are not conserved and diversity in the transmembrane signaling. In addition, although the cloned 5 regulatory sequence of swine 4-1BB could induce GFP expression in porcine

PBMCs, the transfection efficiency triggered by the 5 regulatory sequence was much lower than that triggered by the control CMV promoter. So there are much more work to be done for selecting more efficiently regulatory elements, such as the enhancer, to elevate gene expression efficiency and provide new opportunities to study gene function. It is worth noting that there are also two 4-1BB variants in the mouse (Setareh et al., 1995), one of which is a membrane protein, and the other is a secretory protein. We showed that the two variants in swine were both cell membrane proteins and expressed on the membrane of porcine PBMCs. It was possible that variant 2 was derived from variant 1 through post-translation modification considering the high homology and the almost identical structural domains of the two variants.

X. Zhao et al. / Veterinary Immunology and Immunopathology 153 (2013) 35–44

43

Fig. 6. Both swine 4-1BB variants were expressed on the cell membrane of porcine PBMCs. Freshly prepared porcine PBMCs (5 × 106 ) were nucleofected with or without 4 ␮g pMax-4-1BBV1-HA or pMax-4-1BBV2-HA, respectively. 4-1BB protein localization was determined by IFA 24 h post transfection. The PBMCs were stained with mouse anti-HA tag monoclonal antibody and Cy3-anti mouse IgG as the secondary antibody. The cells were then observed by confocal microscopy. The bar in the picture represented 2.5 ␮m.

In summary, our study provided fundamental information on swine 4-1BB, including the coding and regulatory sequences, the potential structural domains and laid the foundation of further researches on the function of 4-1BB in porcine immune responses. In human, 4-1BB has become an exciting new target for the treatment of autoimmunity and cancer. Further studies on the role of 4-1BB in T cell response will undoubtedly discover new vaccine therapy of swine infection.

Acknowledgments We thank Jun Zou, Ximeng Sun, Guangwen Yin, Yongsheng Ji, Qing Yin, Yunzhou Wang and Xinlei Yan in our laboratory for generous assistance during the study, Jinan Li for assistance with the confocal microscope, and Dr. Jin Zhu (University of Canberra, Australian Capital Territory, Australia) for helpful advice and review of the manuscript. This research was supported by the National Transgenic Major Program (No. 2009ZX08009-152B) and Innovation Fund for Graduate Student of China Agricultural University (KYCX2010053).

References Arnold, K., Bordoli, L., Kopp, J., Schwede, T., 2006. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22, 195–201. Bordoli, L., Kiefer, F., Arnold, K., Benkert, P., Battey, J., Schwede, T., 2009. Protein structure homology modeling using SWISS-MODEL workspace. Nat. Protoc. 4, 1–13. Cannons, J.L., Choi, Y., Watts, T.H., 2000. Role of TNF receptor-associated factor 2 and p38 mitogen-activated protein kinase activation during 4-1BB-dependent immune response. J. Immunol. 165, 6193–6204. Choi, B.K., Bae, J.S., Choi, E.M., Kang, W.J., Sakaguchi, S., Vinay, D.S., Kwon, B.S., 2004. 4-1BB-dependent inhibition of immunosuppression by activated CD4+ CD25+ T cells. J. Leukoc. Biol. 75, 785–791. Croft, M., 2003. Co-stimulatory members of the TNFR family: keys to effective T-cell immunity? Nat. Rev. 3, 609–620. Croft, M., 2009. The role of TNF superfamily members in T-cell function and diseases. Nat. Rev. 9, 271–285. Emanuelsson, O., Brunak, S., von Heijne, G., Nielsen, H., 2007. Locating proteins in the cell using TargetP, SignalP and related tools. Nat. Protoc. 2, 953–971. Hendriks, J., Xiao, Y., Rossen, J.W., van der Sluijs, K.F., Sugamura, K., Ishii, N., Borst, J., 2005. During viral infection of the respiratory tract, CD27, 4-1BB, and OX40 collectively determine formation of CD8+ memory T cells and their capacity for secondary expansion. J. Immunol. 175, 1665–1676. Huang, X., Zou, J., Xu, H., Ding, Y., Yin, G., Liu, X., Suo, X., 2011. Transgenic Eimeria tenella expressing enhanced yellow fluorescent protein targeted to different cellular compartments stimulated dichotomic immune responses in chickens. J. Immunol. 187, 3595–3602.

44

X. Zhao et al. / Veterinary Immunology and Immunopathology 153 (2013) 35–44

Kim, Y.J., Pollok, K.E., Zhou, Z., Shaw, A., Bohlen, J.B., Fraser, M., Kwon, B.S., 1993. Novel T cell antigen 4-1BB associates with the protein tyrosine kinase p56lck1. J. Immunol. 151, 1255–1262. Kim, D.H., Chang, W.S., Lee, Y.S., Lee, K.A., Kim, Y.K., Kwon, B.S., Kang, C.Y., 2008. 4-1BB engagement costimulates NKT cell activation and exacerbates NKT cell ligand-induced airway hyperresponsiveness and inflammation. J. Immunol. 180, 2062–2068. Kwon, B.S., Weissman, S.M., 1989. cDNA sequences of two inducible T-cell genes. Proc. Natl. Acad. Sci. U. S. A. 86, 1963–1967. Lee, H.W., Park, S.J., Choi, B.K., Kim, H.H., Nam, K.O., Kwon, B.S., 2002. 4-1BB promotes the survival of CD8+ T lymphocytes by increasing expression of Bcl-xL and Bfl-1. J. Immunol. 169, 4882–4888. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25, 402–408. Melero, I., Shuford, W.W., Newby, S.A., Aruffo, A., Ledbetter, J.A., Hellstrom, K.E., Mittler, R.S., Chen, L., 1997. Monoclonal antibodies against the 41BB T-cell activation molecule eradicate established tumors. Nat. Med. 3, 682–685. Pilon, C., Levast, B., Meurens, F., Le Vern, Y., Kerboeuf, D., Salmon, H., Velge-Roussel, F., Lebranchu, Y., Baron, C., 2009. CD40 engagement strongly induces CD25 expression on porcine dendritic cells and polarizes the T cell immune response toward Th1. Mol. Immunol. 46, 437–447. Polte, T., Foell, J., Werner, C., Hoymann, H.G., Braun, A., Burdach, S., Mittler, R.S., Hansen, G., 2006. CD137-mediated immunotherapy for allergic asthma. J. Clin. Invest. 116, 1025–1036. Robertson, S.J., Messer, R.J., Carmody, A.B., Mittler, R.S., Burlak, C., Hasenkrug, K.J., 2008. CD137 costimulation of CD8+ T cells

confers resistance to suppression by virus-induced regulatory T cells. J. Immunol. 180, 5267–5274. Sabbagh, L., Pulle, G., Liu, Y., Tsitsikov, E.N., Watts, T.H., 2008. ERK-dependent Bim modulation downstream of the 4-1BB-TRAF1 signaling axis is a critical mediator of CD8 T cell survival in vivo. J. Immunol. 180, 8093–8101. Schwarz, H., Valbracht, J., Tuckwell, J., von Kempis, J., Lotz, M., 1995. ILA, the human 4-1BB homologue, is inducible in lymphoid and other cell lineages. Blood 85, 1043–1052. Schwede, T., Kopp, J., Guex, N., Peitsch, M.C., 2003. SWISS-MODEL: an automated protein homology-modeling server. Nucleic Acids Res. 31, 3381–3385. Seo, S.K., Choi, J.H., Kim, Y.H., Kang, W.J., Park, H.Y., Suh, J.H., Choi, B.K., Vinay, D.S., Kwon, B.S., 2004. 4-1BB-mediated immunotherapy of rheumatoid arthritis. Nat. Med. 10, 1088–1094. Setareh, M., Schwarz, H., Lotz, M., 1995. A mRNA variant encoding a soluble form of 4-1BB, a member of the murine NGF/TNF receptor family. Gene 164, 311–315. Wang, C., Lin, G.H., McPherson, A.J., Watts, T.H., 2009. Immune regulation by 4-1BB and 4-1BBL: complexities and challenges. Immunol. Rev. 229, 192–215. Watts, T.H., 2005. TNF/TNFR family members in costimulation of T cell responses. Annu. Rev. Immunol. 23, 23–68. Zhao, X., Su, H., Yin, G., Liu, X., Liu, Z., Suo, X., 2011. High transfection efficiency of porcine peripheral blood T cells via nucleofection. Vet. Immunol. Immunopathol. 144, 179–186. Zheng, G., Wang, B., Chen, A., 2004. The 4-1BB costimulation augments the proliferation of CD4+ CD25+ regulatory T cells. J. Immunol. 173, 2428–2434.