Molecular Cloning, Characterisation and Ligand-bound Structure of an Azoreductase from Pseudomonas aeruginosa

doi:10.1016/j.jmb.2007.08.048

J. Mol. Biol. (2007) 373, 1213–1228

Molecular Cloning, Characterisation and Ligand-bound Structure of an Azoreductase from Pseudomonas aeruginosa Chan-Ju Wang 1 , Christoph Hagemeier 1 , Nawreen Rahman 1 Edward Lowe 2 , Martin Noble 2 , Michael Coughtrie 3 , Edith Sim 1 and Isaac Westwood 1 ⁎ 1

Department of Pharmacology, University of Oxford, Mansfield Road, Oxford, OX1 3QT, UK 2

Laboratory of Molecular Biophysics, Department of Biochemistry, University of Oxford, South Parks Road, Oxford, OX1 3QU, UK 3 Division of Pathology and Neuroscience, University of Dundee, Ninewells Hospital and Medical School, Dundee, DD1 9SY, Scotland, UK

Received 15 June 2007; received in revised form 16 August 2007; accepted 21 August 2007 Available online 25 August 2007

The gene PA0785 from Pseudomonas aeruginosa strain PAO1, which is annotated as a probable acyl carrier protein phosphodiesterase (acpD), has been cloned and heterologously overexpressed in Escherichia coli. The purified recombinant enzyme exhibits activity corresponding to that of azoreductase but not acpD. Each recombinant protein molecule has an estimated molecular mass of 23,050 Da and one non-covalently bound FMN as co-factor. This enzyme, now identified as azoreductase 1 from Pseudomonas aeruginosa (paAzoR1), is a flavodoxin-like protein with an apparent molecular mass of 110 kDa as determined by gel-filtration chromatography, indicating that the protein is likely to be tetrameric in solution. The three-dimensional structure of paAzoR1, in complex with the substrate methyl red, was solved at a resolution of 2.18 Å by X-ray crystallography. The protein exists as a dimer of dimers in the crystal lattice, with two spatially separated active sites per dimer, and the active site of paAzoR1 was shown to be a well-conserved hydrophobic pocket formed between two monomers. The paAzoR1 enzyme is able to reduce different classes of azo dyes and activate several azo pro-drugs used in the treatment of inflammatory bowel disease (IBD). During azo reduction, FMN serves as a redox centre in the electron-transferring system by mediating the electron transfer from NAD(P)H to the azo substrate. The spectral properties of paAzoR1 demonstrate the hydrophobic interaction between FMN and the active site in the protein. The structure of the ligand-bound protein also highlights the π-stacking interactions between FMN and the azo substrate. © 2007 Elsevier Ltd. All rights reserved.

Edited by R. Huber

Keywords: azoreductase; azo dyes; azo pro-drugs; human intestinal flora; IBD

Introduction Different classes of bacteria that populate the human gastrointestinal tract have been reported to *Corresponding author. E-mail address: [email protected]. Abbreviations used: FMN, flavin mononucleotide; IBD, inflammatory bowel disease; MALDI-TOF, matrix-assisted laser desorption ionisation time-of-flight; PAABSA, p-aminoazobenzene sulfonamide; paAzoR1, azoreductase 1 from Pseudomonas aeruginosa; 5-ASA, 5-aminosalicylic acid.

express azoreductase,1–5 the enzymes metabolise azo compounds into aromatic amines by reductive cleavage of azo bonds. Azo compounds to which humans are most likely to be exposed can be divided into two categories: first, the azo dyes, which are ubiquitous in foods, plastics, textiles, paints, tattoo pigmentation and cosmetics.6–8 These azo dyes remain persistent pollutants and can generate potentially carcinogenic amines as downstream products.9–11 The second category is the azo prodrugs, which are the most commonly used drugs in the treatment of inflammatory bowel disease (IBD).12,13 Various azo pro-drugs have been developed with the aim of delivering the active anti-

0022-2836/$ - see front matter © 2007 Elsevier Ltd. All rights reserved.

1214 inflammatory agent 5-aminosalicylic acid (5-ASA) at the site of action by using an azo-bonded prodrug which is reductively cleaved in situ.14 In this formulation, 5-ASA is cross-linked to an inert carrier molecule via an azo bond to avoid early decomposition and systemic absorption before reaching the inflammatory site.15 These pro-drugs include sulfasalazine16,17 (5-ASA with sulfapyridine), balsalazide18 (5-ASA and 4-aminobenzoylβ-alanine), and olsalazine,19 which is a 5-ASA dimer linked by an azo bond. These pro-drugs are therapeutically inactive in their intact form and rely on azo reduction by azoreductases expressed by intestinal microflora for activation. Hence, azoreductases expressed by human intestinal microflora play a pivotal role in pro-drug delivery of IBD treatment. Early studies on intestinal bacteria that possess azoreductase activity include Escherichia coli, Streptococcus faecalis, LactoBacillus spp., Bacteroides fragilis, Bifidobacterium adolescentis, Proteus and several Clostridia species,1,20 Recently, more members of anaerobic intestinal bacteria such as Butyrivibrio sp., Eubacteria species and more Clostridia species have been reported to possess azo reduction activity.21,22 In 2004, Wang and co-workers reported the applica-

Azoreductase from Pseudomonas aeruginosa PAO1

tion of the microarray method for screening bacteria from human intestinal microflora and identified 40 species with anaerobic azoreductase activity.23 However, these anaerobic enteric bacteria constitute only a portion of the total gastrointestinal flora,24 and the information on aerobic azoreductase activity by human intestinal bacteria remained unavailable until Chen and colleagues reported an aerobic flavin mononucleotide (FMN)dependent azoreductase from Enterococcus faecalis and showed its capability of degrading a wide range of azo dyes.5 Another human intestinal bacterium, P. aeruginosa, has been shown to possess oxygen-insensitive azoreductase activity towards several azo dyes.25,26 Nevertheless, to our knowledge, despite the extensive application of azoreductase-mediated pro-drug activation in the treatment of IBD,27–30 there has been no determination of substrate specificity in relation to activation of azo pro-drugs by bacterial azoreductases, or structural and molecular characterisation of azoreductases from P. aeruginosa. Here, we describe the identification of aerobic azoreductase activity in P. aeruginosa strain PAO1. The gene encoding azoreductase 1 from P. aeruginosa PAO1 (paAzoR1), PA0785, has been identified,

Figure 1. Multiple sequence alignment of selected bacterial flavodoxin-like proteins. The sequence alignment was conducted with CLUSTAL W.58 The secondary structural elements were identified from the paAzoR1 structure by using ESPript.59 α-Helices, η-helices, β-sheets and strict β-turns are denoted α, η, β and TT respectively. PDB codes: 1V4B (azoreductase from E. coli), 1T5B (probable azoreductase from S. typhimurium) and 2HPV (azoreductase from E. faecalis). Similar amino acids are highlighted n boxes, and completely conserved residues are indicated by white lettering on a dark background.

1215

Azoreductase from Pseudomonas aeruginosa PAO1

Figure 2. Endogenous expression of paAzoR1 and purification of recombinant enzyme. (a) Culture of P. aeruginosa PAO1 obtained from serial dilutions (approximately ten cells per plate) were plated on to LB agar plate supplemented with 1 mM methyl red. The plates were incubated at 37 °C. (b) Ethidium bromide-stained 1% (w/v) agarose gel showing PA0785 and PA1962 are expressed at the mRNA level (lanes 4–6) as shown by RT-PCR with mRNA extracted from P. aeruginosa PAO1 as a template. The absence of genomic DNA contamination was confirmed by additional PCR under the same conditions as negative controls (lanes 1–3). PCR from genomic DNA extracted from P. aeruginosa PAO1 was applied as positive control (lanes 7–9). Loading order: PA0785 (655 bp)*, PA1962 (622 bp)*, PA3223 (655 bp)*. (c) Coomassie blue stained SDS–12% PAGE showing the overexpression and purification of paAzoR1. Lowrange molecular mass protein standard (BioRad) (lane M), whole cell lysate (60 μg, lane 1), insoluble lysate (60 μg, lane 2), soluble lysate (60 μg, lane 3), unbound lysate (5 μg, lane 4), 10 mM imidazole (IMZ) wash (1 μg, lane 5), 25 mM IMZ wash (1 μg, lane 6), 250 mM IMZ wash (2 μg, lane 7), after thrombin digestion (20 μg, lane 8). The asterisk (*) indicates the expected size as PCR products.

molecularly cloned, heterologously overexpressed and the structure of the protein in complex with the substrate methyl red has been resolved for the first time. The azoreductase enzyme exists as a homotetramer in solution, composed of two functional dimers, with one molecule of FMN as co-factor and one molecule of methyl red non-covalently bound to each monomer. We also compare the structure of the paAzoR1 protein in complex with methyl red with the published azoreductase structures from E. coli (PDB code 1V4B),31 Salmonella typhimurium (PDB code 1T5B) and E. faecalis (PDB code 2HPV).32 This is the first report on the crystal structure of an azoreductase in complex with one of its substrates.

munity Annotation Project (PseudoCAP) at Pseudomonas Genome Database†34 Growing P. aeruginosa PAO1 on LB agar plates supplemented with 1 mM methyl red has shown the ability of the organism to reduce methyl red by decolourising the dye, leaving clear rings around bacterial colonies (Figure 2(a)). When P. aeruginosa PAO1 was grown on LB medium, the genes encoding for PA0785 and PA1962 were found to be expressed at the mRNA level as demonstrated by RT-PCR and PCR analyses using Oligo(dT)20 and gene-specific primers (Figure 2(b)). The gene PA0785 encodes for a 212 amino acid residue protein, which displays 32% identity and 67% similarity to the azoreductases from E. coli and S. typhimurium, 30% identity and 63% similarity to azoreductase from E. faecalis.

Results

Expression and purification of the recombinant paAzoR1

Identification of P. aeruginosa PAO1 azoreductase genes

PA0785 from P. aeruginosa was successfully overexpressed in E. coli as indicated by SDS–PAGE (Figure 2(c)). The theoretical molecular mass of the recombinant paAzoR1 with a hexahistidine tag is estimated to be 25,040 Da; however, the migration of protein in SDS–PAGE corresponds to an approximate size of around 30 kDa. The identity of the hexahistidine-tagged recombinant paAzoR1 was

The sequence of the genome of P. aeruginosa strain PAO1 has been completed and published.33 Three azoreductase-like amino acid sequences in P. aeruginosa PAO1 were identified through a BLAST search (Figure 1), namely PA0785 (857,998 bp–858,636 bp), PA1962 (2,145,894 bp–2,146,502 bp) and PA3223 (3,611,254 bp–3,611,895 bp) according to the numbering system implemented by the P. aeruginosa Com-

† http://www.pseudomonas.com/

1216

Azoreductase from Pseudomonas aeruginosa PAO1

Table 1. Activity and recovery of recombinant paAzoR1 expressed in E. coli

Fraction

Mass of protein (mg)

Total activity1a (μM s− )

Specific activity*1 (μM s−1 mg − )

Fold of purification

65.3

304.5

4.7

1.0

41

62.5

1.5

0.3

3.5

4.6

1.3

0.3

1.9

12.5

6.6

1.4

9.4

221.7

23.6

5.1

Soluble lysate Unbound lysate 10 mM IMZ Wash 25 mM IMZ Wash 250 mM IMZ Wash

Yield (%)

73

Soluble lysate from 100 ml of bacterial culture was incubated with Ni-NTA agarose (4 °C for 5 min) and then washed with buffer (20 mM Tris–HCl (pH 8.0), 300 mM NaCl) containing increasing concentrations of imidazole (IMZ). Recombinant paAzoR1 was eluted with the final fraction of 250 mM IMZ. a Activities were determined with methyl red as the azo substrate.

confirmed by matrix-assisted laser desorption ionisation time-of-flight (MALDI-TOF) analysis following trypsin digestion of the protein. Purification procedures are summarised in Table 1. The recombinant protein was purified to apparent homogeneity, as determined by SDS–PAGE analysis, with a yield of 73% from the soluble cell lysate, and the specific activity of the final fraction was 23.6 units/mg protein with methyl red as substrate and NADPH as co-factor. The N-terminal hexahistidine tag was removed by thrombin cleavage (Figure 2(c)) before storage, although the presence of the 20 amino acid N-terminal tag does not appear to have an effect on the enzymic activity as the kcat before and after cleavage is 13 s−1 with methyl red as substrate (Table 2). The purified paAzoR1 without hexahistidine tag corresponds to an apparent molecular mass of 28 kDa on SDS–PAGE. The thrombin-cleaved protein has an additional three amino acid residues (G-S-H) at the N-terminus, which represent an artefact of the cloning process (see Materials and Methods). Characterisation of recombinant paAzoR1 The absorbance spectrum of purified paAzoR1 showed two distinct peaks with absorbance maxima

(λmax) at 379 nm and 458 nm. These peaks are shifted around 10 nm relative to the peaks at 372 nm and 445 nm of free FMN (Figure 3(a)). In addition, an apparent absorbance shoulder at 486 nm appeared in the spectrum of native paAzoR1, compared to the absorbance spectrum of the original FMN. The shifts in λmax and presence of a shoulder indicate that the paAzoR1 has a typical flavo-protein signature.35,36 Incubation of this protein in 1% (w/v) SDS for 15 min produced a dramatic spectral change at 486 nm, when the protein is denatured (Figure 3(b)). Similar results were obtained when the protein was denatured by 6 M urea or by heat (data not shown). Furthermore, when NADPH was added to the protein as a reducing agent, both colour change (yellow to colourless) and absorbance spectrum change were observed. The absorbance spectrum of NADPH reduced paAzoR1 resembles the reduced form of FMN: FMNH2, while free FMN remains in the oxidised form, even in the presence of NADPH in the solution (Figure 3(c)). The apparent molecular mass of the recombinant paAzoR1 was determined both by native PAGE and by gel filtration. The apparent molecular mass of purified paAzoR1 was 28 kDa as determined by SDS–PAGE (Figure 2(c)). When the protein was separated by native PAGE, a single band was observed at an apparent molecular mass of 56 kDa, relative to protein standards (Figure 4(a) and (b)). The apparent molecular mass of the protein, as determined by gel filtration chromatography on a pre-equilibrated Sephacryl-S200 XK-16/60 column, was approximately 110 kDa (Figure 4(c) and (d)). Enzymic activity and substrate profile of paAzoR1 Kinetic studies of paAzoR1 were carried out with various azo compounds, including common azo dyes (methyl red, p-aminoazobenzene sulfonamide (PAABSA), amaranth, tropaeolin, orange II, orange G, ponceau BS and ponceau S) and azo pro-drugs (Sulfasalazine, Balsalazide, Olsalazine). Apparent Km and Vmax values were obtained from Lineweaver–Burk plots (Table 2). The paAzoR1 possesses relatively high specific activity towards the reductive cleavage of the pro-drugs balsalazide (specific activity taken as 100%), sulfasalazine (20%) and olsalazine (5%), as well as decolourisation of azo dyes methyl red (51%) and PAABSA (23%) (Figure 5(a) and (b)). However, paAzoR1 has

Table 2. Apparent kinetic constants of paAzoR1 Apparent kinetic constant −1

−1

Vmax (μM.s mg protein ) Km (μM) kcat (s−1) Specificity constant (mM−1 s−1)

Methyl red

Sulfasalazine

Balsalazide

28 ± 1 76 ± 2 13 ± 0.5 171 ± 4

28 ± 1 69 ± 2 13 ± 0.5 188 ± 6

81 ± 2 124 ± 4 37 ± 1.1 303 ± 8

Olsalazine 5.4 ± 0.2 104 ± 3 2.5 ± 0.1 239 ± 6

NADH

NADPH

22 ± 1 464 ± 20 10 ± 0.5 218 ± 10

74 ± 3 1100 ± 50 34 ± 2 306 ± 9

Apparent values of Michaelis constants (Km), limiting rates (Vmax), turnover numbers (kcat) and specificity constants (kcat/Km) of purified recombinant paAzoR1 with different substrates. The values for methyl red, sulfasalazine, balsalazide and olsalazine were determined with NADPH (at 500 μM) as the electron donor, and the values for NADH and NADPH were determined with methyl red (at 50 μM) as the azo substrate.

1217

Azoreductase from Pseudomonas aeruginosa PAO1

Effect of additional NaCl, FMN and temperature on protein stability and activity The rate of azo reduction by paAzoR1 increases when the salt concentration in the assay buffer is increased. The specific activity of paAzoR1 with methyl red and NADPH in assay buffer containing 20 mM Tris–HCl (pH8.0) was 5.9 μM s−1 mg protein−1. In the presence of 0.15 M NaCl, the specific activity was 21.8 μM s−1 mg protein−1, and was found to increase still further to 27.9 μM s−1 mg protein−1 in the presence of 0.3 M NaCl. Also, the addition of 20 μM FMN to the reaction mixture results in a diminution of the specific activity of azo reduction from 5.9 μM s−1 mg protein−1 to 3.2 μM s−1 mg protein−1 in the absence of NaCl in the assay buffer (20 mM Tris–HCl (pH8.0)). However, when 0.3 M NaCl was added, the additional FMN did not affect the reduction rate (26 μM s−1 mg protein−1 with FMN, compared with 27 μM s−1 mg protein−1 without added FMN). The recombinant paAzoR1 in 0.3 M NaCl, 20 mM Tris–HCl (pH8.0) is thermo-stable up to 10 min at temperatures up to 50 °C and 93% of its specific activity remained (relative to non heat-treated controls). However, after incubation at 60 °C for 10 min, the specific activity dropped to 7% of the non-heat-treated control. paAzoR1 possesses no AcpD activity The paAzoR1 was tested for acyl carrier protein phosphodiesterase activity as described.37 No trace of acpD activity was detected at any enzyme concentration tested up to 0.1 mg/ml. In contrast, the authentic E. coli acyl carrier protein phosphodiesterase, which was used as a positive control, catalysed the complete conversion of holo-ACP to apo-ACP at an enzyme concentration of 0.001 mg/ml. Figure 3. Spectral properties of paAzoR1. (a) Wavelength scans of paAzoR1 at 87 μM (2 mg/ml) (continuous line) and FMN at 22 μM (dashes). (b) Wavelength scans of paAzoR1 at 87 μM (continuous line), paAzoR1 treated with 1% SDS (dots) and FMN treated with 1% SDS (dashes). (c) Wavelength scans of paAzoR1 at 87 μM alone (continuous line), paAzoR1 at 87 μM in 0.5 mM NADPH (dots), and 22 μM FMN in 0.5 mM NADPH (dashes). Spectra were recorded with a Hitachi U2001 spectrophotometer.

poor activity towards other sulfonated azo dyes, such as amaranth, tropaeolin, orange II, orange G, ponceau S and ponceau BS (all below 1% of the specific activity relative to balsalazide). This enzyme can utilise either NADPH or NADH as electron donors in the azo reduction reaction, although more than threefold increase in Vmax and 1.5-fold increase in specificity constant were found with NADPH (Table 2), indicating that NADPH is the preferred electron donor for paAzoR1.

Structure determination The paAzoR1 heterologously produced in E. coli was purified and crystallised under aerobic conditions in the presence of its substrate, methyl red. The structure was solved by the molecular replacement method by using the structures of azoreductases from E. coli (PDB code 1V4B) and S. typhimurium (PDB code 1T5B) as search models, and it was finally refined at 2.18 Å resolution. Refinement converged at Rcryst of 19.4% and Rfree of 24.2% and the average temperature factor of 43.3 Å2 indicate that the structure is relatively flexible. The electron density clearly defined paAzoR1 as a homotetramer (Figure 6(a) and (b)), in agreement with size-exclusion chromatography experiments (Figure 4 (c) and (d)). The program PISA (protein interfaces, surfaces and assemblies; service at European Bioinformatics Institute‡), authored by E. Krissinel and K. Henrick) was used to predict the most likely, stable, ‡ http://www.ebi.ac.uk/msd-srv/prot_int/pistart. html

1218

Azoreductase from Pseudomonas aeruginosa PAO1

Figure 4. Determination of native molecular mass of paAzoR1. (a) Coomassie blue stained native polyacrylamide gel (12%, prepared with 25 mM Tris–HCl (pH 8.0)) loaded with 10 μg purified recombinant paAzoR1. (b) Laemmli plot56 with log molecular mass on the x-axis and relative mobility (Rf) on the y-axis. Low-range molecular mass protein markers (BioRad) were used as molecular mass standards, and the molecular masses of these marker proteins (⋄) correspond to the values shown in (a). The apparent molecular mass of the purified paAzoR1 protein (▴) is 56 kDa. (c) Determination of the apparent molecular maass of native paAzoR1 by gel filtration chromatography. The buffer used for gel filtration was 20 mM Tris–HCl (pH 8.0) containing 0.3 M NaCl. A single species of protein was detected at absorbance of 280 nm and 460 nm. (d) The peak observed corresponds to the paAzoR1 (▴) on the calibration graph, with elution volume (Ve) on the x-axis and log molecular mass kDa) on the y–axis. Molecular mass marker proteins (⋄) used were thyroglobulin (670 kDa), catalase (250 kDa), alcohol dehydrogenase (141 kDa), BSA (66 kDa) and trypsin inhibitor (21.5 kDa).

multimeric assemblies in solution, based on the X-ray crystal structure. The calculated Gibbs free energy of dissociation (ΔGdiss) of the tetramer was 11.1 kcal M−1, compared with the corresponding value of the A/B dimer of 0.4 kcal M−1 and of the A/A' and B/B' dimers, which had calculated values less than or equal to 0 kcal M−1, indicating probable instability as assemblies in solution. The tetramer, with a size of about 74 Å × 65 Å × 71 Å can be subdivided into a dimer of dimers, with the dimers composed of two tightly packed monomers (A/B and A'/B') that assemble around a 2-fold non-crystallographic axis. The dimers of the tetramer are linked by a 2-fold crystallographic axis (symmetry operator: y, x, -z). About 18.5% of the surface area of each monomer is involved in inter-subunit contacts: approximately 12.5% of the monomer surface participates in dimer formation and 6% is involved in contacts between the two dimers in the tetramer. Hydrogen bonds of residues in the loop regions between β1/α1, β2/α2 and residues that are part of the helices α4 and α5 are involved in the dimerisation of the two monomers. Additionally, a salt bridge between Glu53 of monomer B and Arg45 of monomer A is present in the crystal structure of the AzoR protein. Arg45 of monomer A also forms a salt bridge with Asp74 of monomer A'. The root-mean-square

deviation (rmsd) for the backbone Cα-atoms of the monomers in the asymmetric unit is 0.11 Å. The monomer of paAzoR1 consists of 209 residues, has a size of 57 Å × 38 Å × 30 Å, and adopts a flavodoxin-like fold (Figure 7). This fold is characterised by an open twisted α/β structure consisting of five parallel β strands (β1, β2, β3, β6 and β7) connected by α helices, which flank the sheet from the front (α1, α6) and the back (α3, α4, α5). In the dimer, the C-terminal ends of the central β sheets of the monomers face each other perpendicularly. The loop regions between β4 and β5 (residues A126– A127/B124–B129) and β7 and α6 (residues A187– A192/B187–B198) were too disordered and could therefore not be modelled. These unmodelled regions are the same as the regions of conformational change identified by Ito and colleagues for the E. coli azoreductase.31 The arrangement of the α-helices and β-strands is identical to the structures of azoreductase from E. coli (rmsd 1.1 Å, PDB code 1V4B),31 E. faecalis (rmsd 1.5 Å, PDB code 2HPV),32 and S. typhimurium (rmsd 1.1 Å, PDB code 1T5B). Ligand binding and active-site structure Each dimer contains two separate active sites that are located at the interfaces between the two

Azoreductase from Pseudomonas aeruginosa PAO1

1219

Figure 5. Catalytic activity and substrate profile of paAzoR1. (a) Azoreductase reduces 1 mol of methyl red (4′dimethylaminoazobenzene-2-carboxylic acid) into 1 mol of N-N′-dimethyl-p-phenylenediamine and 1 mol of 2aminobenzoic acid with consumption of 2 mol of NAD(P)H. FMN serves as the electron transporter between NAD(P)H and methyl red. (b) Substrate profile of the purified recombinant PA0785 against different azo substrates. The percentage specific activity relative to that of balsalazide was determined as described in Materials and Methods. Results are expressed as mean ± standard deviation from triplicate determinations. PAABSA, 4-aminoazobenzene-4′sulfonic acid.

monomers; hence, both monomers contribute to the scaffold for the catalytic centre. The active sites are linked by the 2-fold non-crystallographic axis, the

two redox active nitrogen atoms (N5; Figure 8) of the FMN molecules being located 24 Å apart. Since the protein was produced, purified and crystallised

Figure 6. (a) Molecular surface representation the paAzoR1 tetramer. The tetramer can be subdivided into two functional dimers, shown in blue and in red. FMN is depicted in yellow. (b) Ribbon diagram of the tetramer. The tetramer contains four molecules of non-covalently bound FMN. In the tetramer, each dimer is related to its partner dimer by a 2-fold crystallographic axis, and the monomers in the dimers are related to each other by a non-crystallographic axis.

1220

Azoreductase from Pseudomonas aeruginosa PAO1

Figure 7. Ribbon diagram of the paAzoR1 monomer. Each monomer contains one FMN, which is bound to the C-terminal end of the β-sheet. β-Strands are shown in yellow, α-helices in red and loop regions are depicted in green. The numbering of the secondary structure elements is according to Figure 1.

under aerobic conditions, we assumed the FMN to be in the entirely oxidised state, the conjecture being supported by the yellow colour of the crystals, and

by the spectrum of the protein used for crystallisation. The FMN found in the structure has an essentially planar isoalloxazine ring, which is

Figure 8. (a) Interactions of FMN with the protein matrix. The redox-active nitrogen N5 of the isoalloxazine ring and the atoms N1 and C2 are labelled. (b) Binding mode of methyl red in the active site of paAzoR1. In (a) and (b) hydrogen bonds are shown as green broken lines with distances in given in Å. Red broken lines indicate hydrophobic interactions. The Figure was prepared with LigPlot.71

1221

Azoreductase from Pseudomonas aeruginosa PAO1

compatible with FMN being in either the oxidised state or the reduced state.38 FMN is bound to the monomers via a large number of polar contacts to the C-terminal end of the five-stranded β-sheet (Figures 7 and 8), indicating a rigid binding mode. The phosphate moiety is hydrogen bonded to SerA10, ArgA12, SerA16, GlnA17 and SerA18. The ribityl group forms hydrogen bonds to SerA145, MetA97 and via a water cluster to TyrA98. Whereas the Re face of the FMN isoalloxazine ring system is attached to MetA97 and TyrA98, and its ribityl and phosphate moieties are anchored by the hydrogen bonds described above, its Si face is exposed to a strongly hydrophobic part of the active site, which is comprised of the residues Val51, Val55, Val56, Phe60, Val114, Leu116, Phe120, Phe122, Tyr131 and Phe173 of chain B, as well as Phe100 and Phe151 of chain A. The substrate methyl red is bound in this hydrophobic pocket and is oriented to the Si face of the FMN, forming hydrophobic interactions with the residues Val56, Phe60, Tyr131 and Phe173 of chain B and to Gly147 of chain A (Figures 8 and 9), as well as ð-stacking interactions with the isoalloxazine ring of FMN (Figures 8, 9 and 10). Its carboxyl group also forms a hydrogen bond to a hydroxyl group of the ribityl moiety of the flavin.

Discussion Our studies identified three homologous genes in P. aeruginosa PAO1 encoding for azoreductases (PA0785, PA1962 and PA3223). The first two genes are expressed when the bacterium is grown in LB. The gene PA0785 has been cloned and expressed to generate sufficient pure recombinant azoreductase for in vitro enzyme characterisations and X-ray crystallographic studies. Under denaturing conditions, such as heat, urea or SDS treatment, the FMN falls out as a result of protein unfolding, suggesting that FMN binding is non-covalent. This is in concordance with the crystal structure, which shows that FMN molecule is non-covalently bound, with a highly polar region on one face and a hydrophobic pocket on the other (Figure 9). Under spectral analyses, this protein shows a typical flavoprotein signature with absorbance maxima shifted 7–10 nm to longer wavelengths,35 and a characteristic shoulder with apparent λmax of 486 nm.36 The isoalloxazine ring of the FMN is bound in a hydrophobic pocket, which promotes a stable and highly negative redox potential for its electron transporting activity, and is essential for azoreductase activity.39 The relative reduction in molar

Figure 9. Section of an electron-density map of paAzoR1 at 2.18 Å resolution showing methyl red and FMN. The electron density map around methyl red is an omit Fo–Fc map contoured at 0.1 e.Å−3 (green). The electron density around the FMN is a 2Fo–Fc map contoured at 0.45 e.Å−3 (blue). The hydrophobic patch of residues that constitutes the wall of the active site is also shown. Electron density has been omitted from these residues for clarity. The Figure was prepared with CCP4MG.72

1222

Azoreductase from Pseudomonas aeruginosa PAO1

Figure 10. Surface representation of the active site conservation of paAzoR1. Monomer A is shown in dark blue, monomer B in light blue, FMN and methyl red are depicted in white and red, respectively. Residues that are strictly conserved in all aligned sequences (Figure 1) are coloured in yellow. Figures 6–8 and 10 were prepared with PyMOL [W.L. DeLano, The PyMOL Molecular Graphics System (2002): http://www.pymol.org].

absorption coefficient of FMN upon binding (hypochromism; Figure 3) is most likely due to the hydrophobicity of the FMN binding pocket. This hypothesis is supported by the X-ray crystallographic studies, which also confirmed the expected 1:1 stoichiometry of flavin binding. This hypochromic effect has previously been documented for flavin-binding proteins.40 The paAzoR1 was found to be an active azoreductase enzyme. The azo substrates of paAzoR1 may be classified into two types, based upon their usage: these are the azo pro-drugs, including sulfasalazine, balsalazide and olsalazine, and the azo dyes, such as methyl red and amaranth. Interestingly, the specific activity of paAzoR1 with balsalazide was twofold greater than with methyl red, which itself appears to be the best azo-dye substrate for all azoreductases reported to date. This study is the first of its kind to investigate the azoreductase activity of a pure enzyme towards the azo pro-drugs described, and we have shown that,

for the paAzoR1 enzyme, the catalytic efficiency with the azo pro-drugs is generally greater than with the azo dyes. The kinetic constants for the reduction of methyl red with NAD(P)H by azoreductases from Enterbacter agglomerans,41 Staphylococcus aureus42 and Rhodobacter sphaeroides43 are shown in Table 3. The values of the Michaelis constants for methyl red and NADPH for paAzoR1 fall within the range described for other azoreductases (Table 3). Likewise, the limiting rate of reaction (Vmax) with paAzoR1 is approximately within an order of magnitude of each of the reported limiting rates for the other three enzymes. The similarity of these kinetic constants is surprising in the light of the fact that, in the studies of these four different azoreductases, differing experimental conditions were employed: including temperature, buffer composition and ionic strength. During the determination of the apparent molecular mass of paAzoR1, different sizes were

1223

Azoreductase from Pseudomonas aeruginosa PAO1 Table 3. Comparison of the kinetic constants determined for various azoreductases Enzyme paAzoR1 E. agglomerans AzoR41 S. aureus AzoR42 R. sphaeroides AzoR43

Electron donor NADPH NADH NADPH NADH

Km,Methyl

Red

76 ± 2 29.4 57 420

(μM)

Km,NAD(P)H (μM)

Vmax (μM.s−1.mg protein)a

1100 ± 50 58.9 74 2300

28 ± 1 307 3.3 543

a The limiting rates from the literature were converted into units of μM s−1.mg−1 for comparison with the present study with methyl red as substrate.

observed. Under the denaturing conditions of SDS– PAGE, the apparent molecular mass of the protein was 28 kDa. By native PAGE analysis, the apparent molecular mass was 56 kDa, and by gel filtration chromatography, the apparent molecular masswas 110 kDa. These results suggest that paAzoR1 is a monomer under denaturing conditions. In the low salt conditions of native PAGE, it exists as a dimer. When the ionic strength is high (0.3 M NaCl) in the conditions used for gel filtration, the protein forms a tetramer. This suggestion correlates with the observed differences in protein activity in solutions of different ionic strengths. The enzyme activity was found to increase with salt strength. In addition, upon crystallisation (conditions: 0.1 M NaCl, 0.1 M Hepes and 1.6 M (NH4)2SO4), a tetrameric form was found in the crystal. These results can be explained by reduced repulsion between the negative charges at the protein surface and by enhanced hydrophobic interactions in the presence of high concentrations of NaCl.44,45 Since both monomers of a dimer are involved in providing the scaffold for the active site, the dimer can be considered as the smallest catalytic unit of paAzoR1. As revealed by the 3D structure of paAzoR1, the amino acids that interact with both parts of FMN molecule are highly conserved within the azoreductases or acpD-like proteins from intestinal bacteria, including E. coli,4 P. aeruginosa, S. typhimurium and E. faecalis,5 e.g. seven amino acids out of 15 in the FMN binding interaction are strictly conserved (Figures 1 and 10). In the paAzoR1 structure, Gly147 and Phe173 are key residues for methyl red binding. It is very likely that the substrate specificity profile depends on the association of substrate with the enzyme; the low substrate specificities observed with other sulfonated azo dyes are likely to be due to weaker interactions between protein and ligand. The paAzoR1 enzyme is unique in its ability to utilise either NADH or NADPH as the electron donor in the reductive cleavage of azo bonds, as most azoreductases from bacteria reported so far are dependent on only one or the other co-factor, specifically. For instance, azoreductases from Bacillus sp. OY1-2,46 Staphylococcus aureus42 and B. subtilis (ATCC6633 and ISW1214)47 are NADPH-dependent azoreductase, azoreductases from Bacillus sp. Strain SF,48 Enterobacter agglomerans,41 E. faecalis,5 E. coli4 and R. sphaeroides43 are NADH-dependent azoreductases. The use of either NADH or NADPH may be due to the conformational flexibility of the paAzoR1 active site, which allows either electron

donor to bind, albeit with a more stable interaction with NADPH. Several authors have reported that addition of flavins to the azoreductase reaction mixture enhances the rate of azo reduction.22,48,49 With the present work on paAzoR1, however, we found that addition of FMN does not increase the rate of azo reduction. The previously observed increase in reaction rate in the presence of excess FMN may be due to a FMN-occupancy of lower than 1 in the prepared protein samples. However, in our study, the FMN was found to occupy all available sites in the X-ray crystal structure, which is in agreement with the observation that excess FMN does not increase the rate of reaction. Conversely, addition of 20 μM FMN to the reaction mixture in the absence of NaCl resulted in a reduction of the specific activity by approximately half. The presence of salt serves to stabilise the hydrophobic interactions of the tetrameric protein assembly, and also increases the enzymic rate of reaction. Additionally, in the presence of 0.3 M NaCl, no differences in the rate of reaction were observed when additional FMN was present in the assay mixture. Due to the ionic strength dependence of this inhibitory effect, it is likely that the primary binding mode of the excess FMN is hydrophilic, rather than hydrophobic in nature. Two loop regions in the crystal structure of paAzoR1 showed high flexibility and could therefore not be modelled. Interestingly, those loop regions are located close to the active site entrance and might therefore regulate the accessibility of the substrates to the active site. Such mobile loops located at the entrance to active sites have been described for several flavoenzymes.31,50 The substrate methyl red is bound to the Si face of the isoalloxazine ring of the FMN. So far, it has not been possible to resolve a crystal structure with NAD(P)H bound. Given that the Re face of FMN is tightly packed against the protein matrix, and that methyl red binds to the Si face, it is clear that the two substrates, methyl red and NAD(P)H, cannot bind at the same time, and that the reaction does not involve a ternary complex kinetic mechanism. Our findings support the Ping Pong Bi Bi mechanism previously postulated for azoreductase.51 Since the reduction of methyl red to N, N'-dimethyl-p-phenylenediamine and 2-aminobenzoate requires four electrons, and NAD(P)H + H+ is a two-electron carrier, two Ping Pong Bi Bi cycles are necessary for the complete reaction (Figure 5(a)).

1224 In the observed binding orientation of methyl red, the azo bond of methyl red is not suitably located to accept a hydride ion from the N5 atom of FMN, as it is situated approximately 4.0 Å from the N10 atom of FMN (FMN numbering according to the Protein Data Bank convention). That the methyl red appears to be bound in an orientation which is not suitable for reaction is not surprising, as the binding of the second substrate to the native protein is a substrate inhibition step in the Ping Pong Bi Bi reaction mechanism; we have not observed substrate inhibition experimentally. Despite this caveat, the ligandbound structure highlights some key residues which are likely to be mechanistically important. Firstly, Tyr131 of monomer A is situated approximately 3.5 Å above the N,N-dimethylphenyl ring of methyl red, and is suitably located to provide a proton during the course of the reduction reaction. The corresponding tyrosine residue (Tyr196) in Old Yellow Enzyme was found to be required for efficient proton transfer during the oxidative halfreaction.52 In contrast, Khan and colleagues showed that a Tyr-Phe mutation of the corresponding residue in pentaerythritol tetranitrate reductase did not prevent reduction of the substrate, 2-cyclohexen1-one.53 While it is most likely that Tyr131 is required for catalytic activity in the oxidative halfreaction of azoreductase, especially as there are no alternative acids in the vicinity, further experiments are required to investigate the role of Tyr131. Upon reduction of the protein-bound FMN, it is probable that a conformational change occurs which allows the binding of methyl red deeper in the active site pocket, such that the azo bond is located closer to the N5 atom of FMN than in the present structure. The pyrimidine in the centre of the oxidised FMN (N5) can be considered as “electron poor”, and the electrophilicity of this nitrogen atom may be increased by the presence of a positively charged residue near to the positions N1-C2_O2 of the uracil moiety of the FMN. The effects of a positively charged residue in this position are to lower the redox potential of the oxidised FMN,50,54 and to stabilise the negative charge formed upon reduction of FMN by NAD(P)H. In paAzoR1, Arg146 is ideally located to provide this activation/stabilisation of the FMN, albeit in an alternative side-chain conformation in the ligand-bound structure. Interestingly, in this same region, a phenylalanine residue is found in position 151 of chain B, whereas in the E. coli azoreductase structure, this residue is a histidine (His144). As with the E. coli azoreductase, there are no proton donors near the N1 position of FMN; however, the presence of the neutral Phe151 in paAzoR1 instead of the positively charged His144 in E. coli azoreductase further supports the hypothesis that Arg146 is involved in stabilising reduced FMN. The possible effects of mutating these residues on the redox potential of azoreductase-bound FMN is worthy of further investigation. To summarise, PA0785 (GenBank accession no. AAG04174), which was originally annotated as a probable acyl carrier protein phosphodiesterase, is

Azoreductase from Pseudomonas aeruginosa PAO1

now experimentally proven to encode for an azoreductase. This enzyme, paAzoR1, contains a tightly but non-covalently bound FMN and exists as a tetrameric complex both in solution and in crystals. This enzyme preferentially utilises NADPH as electron donor in catalysing the reductive cleavage of azo bonds under aerobic conditions. The three-dimensional structure of the protein in complex with the environmental pollutant methyl red has revealed residues that are involved in substrate binding. The structure also provides support for the proposed Ping Pong Bi Bi kinetic mechanism, as well as allowing the identification of key residues involved in catalysis. In addition to their role in the decolourisation of environmentally polluting azo dyes, azoreductases are intimately involved in the site-specific delivery of azo pro-drugs in the treatment of inflammatory bowel disease. Our results provide structural insights into the mechanistic function of this important class of enzymes.

Materials and Methods Materials Chemicals were purchased from Sigma-Aldrich, unless otherwise stated. Reagents for Molecular Biology were purchased from Promega, DNA primers for gene amplifications were synthesized by Sigma-Aldrich. The pH of buffer solutions was adjusted at the appropriate temperature. Bacterial strains, plasmid and media Bacterial strain P. aeruginosa PAO1 was kindly provided by Dr Gail Preston, Department of Plant Sciences, Oxford University, UK. All bacteria cultures were grown in Luria-Bertani (LB) liquid medium or LB agar plate with additional supplements stated. The pET28b(+) plasmid vector (Novagen), E. coli JM109 and E. coli BL21(DE3)pLysS (Promega) were used for DNA and recombinant expression work. For selection of positive cloning outcomes, suitable antibiotics were supplemented according to manufacturer's instructions. RNA isolation and reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was isolated from a 6 ml culture of P. aeruginosa PAO1 using RNeasy (Qiagen). The cDNA was synthesized from 1 μg of total RNA template using the ThermoScript RT-PCR system (Invitrogen) and applied as a template for gene-specific primed PCR amplification using following primers: PA0785 forward (NdeI) (5′ gatacatATGagtagaattcttgcagtgc 3′), reverse (XhoI) (5′ tggcctcgagTCAggccgaccgcgccagcg 3′), PA1962 forward (NdeI) (5′ gagcgacatATGaaacttttgcatatcg 3′), reverse (EcoRI) (5′ gaatTCAggccgcggcgaactgcccgg 3′), PA3223 forward (NdeI) (5′ gatacatATGtcccgtgtcctggttatgg 3′), reverse (EagI) (5′ cccggccgtcacaccggcaaccat 3′), with the restriction enzyme recognition sites underlined and start/ stop codons in capital letters. The amplification mixtures

1225

Azoreductase from Pseudomonas aeruginosa PAO1 (2 mM Mg2+, 200 μM dNTPs each, 6% (v/v) dimethyl sulfoxide (DMSO), 1 μM each primer, 1 μg genomic DNA, 2.5 units Pfu DNA polymerase (Promega) in a total 100 μl) were subjected to the following thermo-cycling protocol: one cycle of 95 °C denaturation for 2 min, 30 cycles of elongation (1 min of melting at 95 °C, 30 s of annealing at 60 °C, and 1 min 30 s of extension at 72 °C), an extra cycle of extension at 72 °C for 10 min, and a final cooling cycle at 4 °C for 5 min. The PCR products were separated by gel electrophoresis in ethidium bromidestained agarose (1.0%, w/v). Cloning of PA0785 from P. aeruginosa PAO1 The gDNA isolated from of P. aeruginosa PAO1 was used as the template for the amplification of the gene PA0785 by PCR reaction described above. PCR products were purified from 1.0% (w/v) agarose gel electrophoresis with the QIAquick Gel Extraction Kit (Qiagen) and restriction digested followed by ligation into pET28b(+) plasmid vector, generating an PA0785-containing expression vector. Chemically competent E. coli JM109 were transformed with the PA0785-containing vector, and the transformed constructs were verified by sequencing analysis. The correct plasmid constructs were subsequently transformed into host expression strain E. coli BL21(DE3)pLysS by the heat shock method. Heterologous overexpression and purification of recombinant PA0785 Recombinant paAzoR1 was produced in LB-sorbitol (LB containing 1 M sorbitol and 2.5 mM betaine) supplemented with 30 μg/ml of kanamycin (180 rpm, 37 °C and 25 °C after induction with 0.5 mM isopropyl-βD-thiogalactopyranoside (IPTG) when cell optical density reached 0.4–0.6). Bacterial culture was supplemented with 0.1 mM FMN as additional source of flavin co-factor. The hexahistidine tag of the purified recombinant paAzoR1 was cleaved by thrombin digestion (2 units per mg protein, 16 h at 4 °C) and removed by using a 10 kDa cut-off protein concentrator (Amicon Ultra-15; Millipore). Pure recombinant protein was stored at −80 °C in the presence of 5% (v/v) glycerol. Determination of protein concentration The protein content of bacterial lysate and eluates was estimated using the Bradford assay with bovine serum albumin (BSA) as standard. The concentration of purified recombinant azoreductase was determined by measuring absorption at 280 nm with an extinction coefficient of 15,470 M−1 cm−1, as calculated by ExPASy ProtParam.55 Gel electrophoresis Polyacrylamide gel electrophoresis (PAGE) was performed by the method of Laemmli,56 with slight modifications for native PAGE (12% polyacrylamide gel; Bio-Rad), i.e. SDS and β-mercaptoethanol were omitted. The gel solution was prepared in 25 mM Tris–HCl (pH 8.0) with no added NaCl. Polyacrylamide gels were stained with Coomassie blue R-250. Protein marker: low-range molecular mass protein markers (Bio-Rad), were used as standards for SDS–PAGE.

Size exclusion chromatography Size-exclusion gel filtration was carried out on a Sephacryl S-200 (Amersham Biosciences) XK16/60 column (Pharmacia), connected to an ÄKTA Purifier system (Amersham Pharmacia Biotech). The column was equilibrated with 20 mM Tris–HCl (pH 8.0) containing 0.3 M NaCl. A 200 μl sample containing 0.8 mg purified paAzoR1 was loaded onto the column and eluted with buffer described above at a flow rate of 0.5 ml/min at 4 °C. The eluate was monitored at wavelengths of 280 and 460 nm. Molecular mass standards applied were: thyroglobulin (670 kDa), catalase (250 kDa), alcohol dehydrogenase (141 kDa), BSA (66 kDa) and trypsin inhibitor (21.5 kDa), all at 5 mg/ml. Enzymic activity assays and substrate profiles The activity of purified recombinant paAzoR1 was determined by following the decrease in absorbance due to the reductive cleavage of the coloured azo substrates.4 Decrease of optical density of each azo compound was measured with a U-2001 spectrophotometer (Hitachi) at the following wavelengths: amaranth (519 nm), ponceau S (511 nm), ponceaus BS (505 nm), orange II (485 nm), orange G (478 nm), tropaeolin (447 nm), methyl red (435 nm), 4-aminoazobenzene-4′-sulfonic acid (PAABSA), sulfasalazine, balsalazide, and olsalazine (405 nm). The enzymatic reaction was initiated by adding 0.5 mM NAD(P)H to a mixture of (50 μM azo substrate, 10 μg enzyme, 20 mM Tris–HCl (pH 8.0), 0.3 M NaCl). The final reaction volume was 200 μl. Initial velocities of enzymic reaction were obtained by varying the concentrations of one substrate, azo compounds (from 5 μM – 200 μM) or NAD(P)H (from 0.1 mM–1.0 mM), while the concentration of the other substrate kept constant. Apparent Vmax and Km values were determined by non-linear regression with the program KyPlot§. Thermostability of paAzoR1 was measured with methyl red as substrate in the assay described above, with the enzyme pre-incubated for 10 min at temperatures ranging from 4 °C–90 °C and then equilibrated for 1 min on ice. The acyl carrier protein phosphodiesterase activity was measured as described, and the acyl carrier protein phosphodiesterase from E. coli was used as a positive control.37,57 Spectral properties of paAzoR1 Denaturation of paAzoR1 was achieved by incubating enzyme with 1% (w/v) SDS for 15 min. β-NADPH was supplied as reducing agents for FMN. Flavin standard was dissolved in 20 mM Tris–HCl (pH 8.0), 0.3 M NaCl. Spectra were recorded with a U-2001 spectrophotometer (Hitachi) across the wavelength of 635 nm to 300 nm. Bioinformatics and sequence alignment Amino acid sequences were identified by BLAST search∥ of the database by using the protein sequence of the azoreductase from E. coli JM109 as the query. Peptide § http://www.woundedmoon.org/win32/kyplot.html ∥ http://www.ncbi.nlm.nih.gov/BLAST/

1226

Azoreductase from Pseudomonas aeruginosa PAO1

Table 4. Crystal parameters, X-ray data collection and refinement statistics Space group Cell dimensions a, b, c (Å) α, β, γ (°)

P31 2 1 82.55, 82.55, 108.65 90, 90, 120

Data collection statistics Wavelength (Å) Resolution (Å) No. unique reflections Rsymb I/σ(I) Completeness (%) Redundancy

0.97630 34.0–2.18 (2.30–2.18)a 20,681 (2462) 0.055 (0.46) 9.7 (1.6) 97.4 (88.8) 3.5 (2.3)

Refinement and model statistics Resolution (Å) No. reflections used (working set) Rworkc Rfreec Number of residues (chain A/B) Number of water molecules Additional molecules Total number of atoms rmsd bond lengths (Å) rmsd bond angles (°) Mean B factor

34.0–2.18 (2.23–2.18) 38,938 19.4 (32.7) 24.2 (34.4) 203/193 171 3 × glycerol 3364 0.017 0.98 43.3

Ramachandran statistics (%) Core region Additional allowed region Generously allowed Disallowed

92.5 7.5 0.0 0.0

a Numbers in the parentheses are for the highest resolution P P shell. h j jIh;j  hIh ij b P P Rsym ¼ ; where Ih,j is the intensity of the jth h j Ih;j observation of uniqueP reflection h. jjFoh j  jFch jj c for the working set and Rwork and Rfree ¼ h P h jFoh j test set (5%) of reflections, where Foh and Fch are the observed and calculated structure factor amplitudes for reflection h.

sequences were downloaded from Research Collaboratory for Structural Bioinformatics Protein Data Bank (RCSB PDB). Sequences were aligned with CLUSTAL W¶,58 and Figure 1 was generated with Espript 2.2a.59 X-ray structure determination The pure recombinant paAzoR1 protein was concentrated to 23 mg/ml with Amicon ultracentrifugation concentrators (Millipore, Watford, UK). Crystals of paAzoR1 with the substrate methyl red were grown at 19 °C by the sitting-drop vapour diffusion method. Equal volumes (0.15 μl) of protein solution (23 mg/ml in 20 mM Tris–HCl buffer (pH 8.0) with 2 mM methyl red) were mixed with mother liquor (Molecular Dimensions Screen II condition 14: 1.6 M (NH4)2SO4, 0.1 M Hepes (pH 7.5)) by using a Mosquito crystallisation robot (TTP Labtech, Royston, UK). Crystals of approximate dimensions 30 μm × 30μm × 30 μm grew typically in two to five days. Crystals were briefly transferred to a cryo-protectant solution of 1 : 3 glycerol/mother liquor prior to snapreezing in liquid nitrogen. Data were collected at ¶ http://www.ebi.ac.uk/clustalw/ http://espript.ibcp.fr/ESPript/ESPript/

a

beamlines ID29 and ID14-eh3 at the European Synchrotron Radiation Facility (ESRF, Grenoble) with a Quantum ADSC detector. Data were integrated with iMosflm v0.5.2,60 and scaled and merged with SCALA.61 The Laue group was determined with Pointless,61 and discrimination between the two most likely space groups (P31 2 1 and P32 2 1) was made following molecular replacement with the program PHASER.62 An ensemble of proteins (RCSB Protein Data Bank accession codes 1V4B and 1T5B) was used for molecular replacement. Iterative model building and refinement was performed with Coot63 and Refmac 5.3.64 Initial translation, libration and screw (TLS) parameters were determined with the program TLSMD,65 and TLS refinement was performed within Refmac. Tight non-crystallographic symmetry (NCS) restraints were applied to the two protein chains in the asymmetric unit. Water molecules were added with Coot and with Arp/Warp.66 A final refinement step was performed in PHENIX.67 Model validation was performed with PROCHECK68 and molprobity,69 and multimer analysis was performed by using PISA.b70 The data collection and refinement statistics are shown in Table 4. Protein Data Bank accession code The structure of paAzoR1 has been deposited at the RCSB Protein Data Bank (PDB accession code: 2v9c).

Acknowledgements The authors thank Dr James Graham and Dr Lee Sweetlove (Department of Plant Sciences, University of Oxford) for trypsin digestion and MALDI-TOF analysis. Jacob Thomas (Department of Microbiology and Biochemistry, University of Illinois) kindly performed acyl carrier protein phosphodiesterase activity assays. The authors also thank Lori Hu for preliminary bioinformatic analysis.

Supplementary Data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.jmb.2007.08.048

References 1. Chung, K. T., Fulk, G. E. & Egan, M. (1978). Reduction of azo dyes by intestinal anaerobes. Appl. Environ. Microbiol. 35, 558–562. 2. Brown, J. P. (1981). Reduction of polymeric azo and nitro dyes by intestinal bacteria. Appl. Environ. Microbiol. 41, 1283–1286. 3. Nakamura, J., Kubota, Y., Miyaoka, M., Saitoh, T., Mizuno, F. & Benno, Y. (2002). Comparison of four microbial enzymes in Clostridia and Bacteroides isolated from human feces. Microbiol. Immunol. 46, 487–490. 4. Nakanishi, M., Yatome, C., Ishida, N. & Kitade, Y. (2001). Putative ACP phosphodiesterase gene(acpD) encodes an azoreductase. J. Biol. Chem. 276, 46394–46399.

Azoreductase from Pseudomonas aeruginosa PAO1 5. Chen, H., Wang, R. F. & Cerniglia, C. E. (2004). Molecular cloning, overexpression, purification, and characterization of an aerobic FMN-dependent azoreductase from Enterococcus faecalis. Protein Expr. Purif. 34, 302–310. 6. Bäumler, W., Eibler, E. T., Hohenleutner, U., Sens, B., Sauer, J. & Landthaler, M. (2000). Q-switch laser and tattoo pigments: first results of the chemical and photophysical analysis of 41 compounds. Lasers Surg. Med. 26, 13–21. 7. Collins, T. F. & McLaughlin, J. (1972). Teratology studies on food colourings. I. Embryotoxicity of amaranth (FD & C red No. 2) in rats. Food Cosmet. Toxicol. 10, 619–624. 8. Zollinger, H. (2003). Color Chemistry: Syntheses, Properties and Applications of Organic Dyes and Pigments, 3 edit., pp. 165–241, Wiley-VCH, Zurich. 9. Platzek, T., Kratke, R., Klein, G. & Schulz, C. (2005). [Cosmetic colorants. Toxicology and regulation]. Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz, 48, 76–83. 10. Platzek, T., Lang, C., Grohmann, G., Gi, U. S. & Baltes, W. (1999). Formation of a carcinogenic aromatic amine from an azo dye by human skin bacteria in vitro. Hum. Exp. Toxicol. 18, 552–559. 11. Pielesz, A., Baranowska, I., Rybakt, A. & Wlochowicz, A. (2002). Detection and determination of aromatic amines as products of reductive splitting from selected azo dyes. Ecotoxicol. Environ. Saf. 53, 42–47. 12. Hanauer, S. B. (1996). Inflammatory bowel disease. N. Engl. J. Med. 334, 841–848. 13. Dissanayake, A. S. & Truelove, S. C. (1973). A controlled therapeutic trial of long-term maintenance treatment of ulcerative colitis with sulphazalazine (Salazopyrin). Gut, 14, 923–926. 14. Klotz, U. (2005). Colonic targeting of aminosalicylates for the treatment of ulcerative colitis. Dig. Liver Dis. 37, 381–388. 15. Rafii, F. & Coleman, T. (1999). Cloning and expression in Escherichia coli of an azoreductase gene from Clostridium perfringens and comparison with azoreductase genes from other bacteria. J. Basic Microbiol. 39, 29–35. 16. Svartz, N. (1988). Sulfasalazine: II. Some notes on the discovery and development of salazopyrin. Am. J. Gastroenterol. 83, 497–503. 17. Brown, J. P., McGarraugh, G. V., Parkinson, T. M., Wingard, R. E., Jr & Onderdonk, A. B. (1983). A polymeric drug for treatment of inflammatory bowel disease. J. Med. Chem. 26, 1300–1307. 18. Chan, R. P., Pope, D. J., Gilbert, A. P., Sacra, P. J., Baron, J. H. & Lennard-Jones, J. E. (1983). Studies of two novel sulfasalazine analogs, ipsalazide and balsalazide. Dig. Dis. Sci. 28, 609–615. 19. Willoughby, C. P., Aronson, J. K., Agback, H., Bodin, N. O. & Truelove, S. C. (1982). Distribution and metabolism in healthy volunteers of disodium azodisalicylate, a potential therapeutic agent for ulcerative colitis. Gut, 23, 1081–1087. 20. Gingell, R. & Walker, R. (1971). Mechanisms of azo reduction by Streptococcus faecalis. II. The role of soluble flavins. Xenobiotica, 1, 23123–23129. 21. Chung, K. T., Stevens, S. E., Jr & Cerniglia, C. E. (1992). The reduction of azo dyes by the intestinal microflora. Crit. Rev. Microbiol. 18, 175–190. 22. Rafii, F., Franklin, W. & Cerniglia, C. E. (1990). Azoreductase activity of anaerobic bacteria isolated from human intestinal microflora. Appl. Environ. Microbiol. 56, 2146–2151.

1227 23. Wang, R. F., Chen, H., Paine, D. D. & Cerniglia, C. E. (2004). Microarray method to monitor 40 intestinal bacterial species in the study of azo dye reduction. Biosens. Bioelectron. 20, 699–705. 24. Simon, G. L. & Gorbach, S. L. (1986). The human intestinal microflora. Dig. Dis. Sci. 31, 147S–162S. 25. Nachiyar, C. V. & Rajakumar, G. S. (2005). Purification and characterization of an oxygen insensitive azoreductase from Pseudomonas aeruginosa. Enzyme Microb. Technol. 36, 503–509. 26. Nachiyar, C. V. & Rajakumar, G. S. (2006). Biodegradation of 8-anilino-1-naphthalenesulfonic acid by Pseudomonas aeruginosa. J. Ind. Microbiol. Biotechnol. 33, 845–849. 27. Chourasia, M. K. & Jain, S. K. (2003). Pharmaceutical approaches to colon targeted drug delivery systems. J. Pharm. Pharmaceut. Sci. 6, 33–66. 28. Kinget, R., Kalala, W., Vervoort, L. & van den Mooter, G. (1998). Colonic drug targeting. J. Drug Target. 6, 129–149. 29. van den Mooter, G., Samyn, C. & Kinget, R. (1992). Azo polymers for colon-specific drug delivery. Int. J. Pharm. 87, 37–46. 30. Hanauer, S. B. (2004). Review article: aminosalicylates in inflammatory bowel disease. Aliment. Pharmacol. Ther. 20, 60–65. 31. Ito, K., Nakanishi, M., Lee, W. C., Sasaki, H., Zenno, S., Saigo, K. et al. (2006). Three-dimensional structure of AzoR from Escherichia coli. An oxidereductase conserved in microorganisms. J. Biol. Chem. 281, 20567–20576. 32. Liu, Z. J., Chen, H., Shaw, N., Hopper, S. L., Chen, L., Chen, S. et al. (2007). Crystal structure of an aerobic FMN-dependent azoreductase (AzoA) from Enterococcus faecalis. Arch. Biochem. Biophys. 463, 68–77. 33. Stover, C. K., Pham, X. Q., Erwin, A. L., Mizoguchi, S. D., Warrener, P., Hickey, M. J. et al. (2000). Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature, 406, 959–964. 34. Winsor, G. L., Lo, R., Sui, S. J., Ung, K. S., Huang, S., Cheng, D. et al. (2005). Pseudomonas aeruginosa Genome Database and PseudoCAP: facilitating community-based, continually updated, genome annotation. Nucl. Acids Res. 33, D338–D343. 35. Zenno, S., Koike, H., Kumar, A. N., Jayaraman, R., Tanokura, M. & Saigo, K. (1996). Biochemical characterization of NfsA, the Escherichia coli major nitroreductase exhibiting a high amino acid sequence homology to Frp, a Vibrio harveyi flavin oxidoreductase. J. Bacteriol. 178, 4508–4514. 36. Duurkens, R. H., Tol, M. B., Geertsma, E. R., Permentier, H. P. & Slotboom, D. J. (2007). Flavin binding to the high affinity riboflavin transporter RibU. J. Biol. Chem. 282, 10380–10386. 37. Thomas, J., Rigden, D. J. & Cronan, J. E. (2007). Acyl carrier protein phosphodiesterase (AcpH) of Escherichia coli is a non-canonical member of the HD phosphatase/phosphodiesterase family. Biochemistry, 46, 129–136. 38. Moonen, C. T., Vervoort, J. & Muller, F. (1984). Reinvestigation of the structure of oxidized and reduced flavin: carbon-13 and nitrogen-15 nuclear magnetic resonance study. Biochemistry, 23, 4859–4867. 39. Liger, D., Graille, M., Zhou, C. Z., Leulliot, N., Quevillon-Cheruel, S., Blondeau, K. et al. (2004). Crystal structure and functional characterization of yeast YLR011wp, an enzyme with NAD(P)H-FMN and ferric iron reductase activities. J. Biol. Chem. 279, 34890–34897.

1228

Azoreductase from Pseudomonas aeruginosa PAO1

40. Choi, J. D. & McCormick, D. B. (1980). The interaction of flavins with egg white riboflavin-binding protein. Arch. Biochem. Biophys. 204, 41–51. 41. Moutaouakkil, A., Zeroual, Y., Zohra Dzayri, F., Talbi, M., Lee, K. & Blaghen, M. (2003). Purification and partial characterization of azoreductase from Enterobacter agglomerans. Arch. Biochem. Biophys. 413, 139–146. 42. Chen, H., Hopper, S. L. & Cerniglia, C. E. (2005). Biochemical and molecular characterization of an azoreductase from Staphylococcus aureus, a tetrameric NADPH-dependent flavoprotein. Microbiology, 151, 1433–1441. 43. Bin, Y., Jiti, Z., Jing, W., Cuihong, D., Hongman, H., Zhiyong, S. & Yongming, B. (2004). Expression and characteristics of the gene encoding azoreductase from Rhodobacter sphaeroides AS1.1737. FEMS Microbiol. Letters, 236, 129–136. 44. Hagemeier, C. H., Shima, S., Thauer, R. K., Bourenkov, G., Bartunik, H. D. & Ermler, U. (2003). Coenzyme F420-dependent methylenetetrahydromethanopterin dehydrogenase (Mtd) from Methanopyrus kandleri: a methanogenic enzyme with an unusual quarternary structure. J. Mol. Biol. 332, 1047–1057. 45. Mamat, B., Roth, A., Grimm, C., Ermler, U., Tziatzios, C., Schubert, D. et al. (2002). Crystal structures and enzymatic properties of three formyltransferases from archaea: environmental adaptation and evolutionary relationship. Protein Sci. 11, 2168–2178. 46. Suzuki, Y., Yoda, T., Ruhul, A. & Sugiura, W. (2001). Molecular cloning and characterization of the gene coding for azoreductase from Bacillus sp. OY1-2 isolated from soil. J. Biol. Chem. 276, 9059–9065. 47. Sugiura, W., Yoda, T., Matsuba, T., Tanaka, Y. & Suzuki, Y. (2006). Expression and characterization of the genes encoding azoreductases from Bacillus subtilis and Geobacillus stearothermophilus. Biosci. Biotechnol. Biochem. 70, 1655–1665. 48. Maier, J., Kandelbauer, A., Erlacher, A., Cavaco-Paulo, A. & Gubitz, G. M. (2004). A new alkali-thermostable azoreductase from Bacillus sp. strain SF. Appl. Environ. Microbiol. 70, 837–844. 49. Mallett, A. K., King, L. J. & Walker, R. (1982). A continuous spectrophotometric determination of hepatic microsomal azo reductase activity and its dependence on cytochrome P-450. Biochem. J. 201, 589–595. 50. Fraaije, M. W. & Mattevi, A. (2000). Flavoenzymes: diverse catalysts with recurrent features. Trends Biochem. Sci. 25, 126–132. 51. Nakanishi, M., Yatome, C., Ishida, N. & Kitade, Y. (2001). Putative ACP phosphodiesterase gene (acpD) encodes an azoreductase. J. Biol. Chem. 276, 46394–46399. 52. Kohli, R. M. & Massey, V. (1998). The oxidative halfreaction of Old Yellow Enzyme. The role of tyrosine 196. J. Biol. Chem. 273, 32763–32770. 53. Khan, H., Barna, T., Bruce, N. C., Munro, A. W., Leys, D. & Scrutton, N. S. (2005). Proton transfer in the oxidative half-reaction of pentaerythritol tetranitrate reductase. Structure of the reduced enzyme-progesterone complex and the roles of residues Tyr186, His181, His184. FEBS J. 272, 4660–4671. 54. Ghisla, S. & Massey, V. (1989). Mechanisms of flavoprotein-catalyzed reactions. Eur. J. Biochem. 181, 1–17. 55. Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, A.,

Wilkins, M., Appel, R. D. & Bairoch, A. (2005). Protein identification and analysis tools on the ExPASy server. In The Proteomics Protocols Handbook (Walker, J. M., ed), pp. 571–607, Humana Press, Totowa. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685. Thomas, J. & Cronan, J. E. (2005). The enigmatic acyl carrier protein phosphodiesterase of Escherichia coli: genetic and enzymological characterization. J. Biol. Chem. 280, 34675–34683. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673–4680. Gouet, P., Courcelle, E., Stuart, D. I. & Metoz, F. (1999). ESPript: multiple sequence alignments in PostScript. Bioinformatics, 15, 305–308. Leslie, A. G. W. (1992). Recent changes to the MOSFLM package for processing film and image plate data. Joint CCP4 + ESF-EAMCB Newsletter on Protein Crystallography, 26. Bailey, S. (1994). The Ccp4 suite - programs for protein crystallography. Acta Crystallog. sect. D, 50, 760–763. Read, R. J. (2001). Pushing the boundaries of molecular replacement with maximum likelihood. Acta Crystallog. sect. D, 57, 1373–1382. Emsley, P. & Cowtan, K. (2004). Coot: model-building tools for molecular graphics. Acta Crystallog. sect. D, 60, 2126–2132. Murshudov, G. N., Vagin, A. A. & Dodson, E. J. (1997). Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallog. sect. D, 53, 240–255. Painter, J. & Merritt, E. A. (2006). Optimal description of a protein structure in terms of multiple groups undergoing TLS motion. Acta Crystallog. sect. D, 62, 439–450. Morris, R. J., Perrakis, A. & Lamzin, V. S. (2003). ARP/ wARP and automatic interpretation of protein electron density maps. Macromol. Crystallog., Pt D, 374, 229–244. Adams, P. D., Grosse-Kunstleve, R. W., Hung, L. W., Ioerger, T. R., McCoy, A. J., Moriarty, N. W. et al. (2002). PHENIX: building new software for automated crystallographic structure determination. Acta Crystallog. sect. D, 58, 1948–1954. Laskowski, R. A., MacArthur, M. W., Moss, D. S. & Thornton, J. M. (1993). PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Crystallog. 26, 283–291. Lovell, S. C., Davis, I. W., Adrendall, W. B., de Bakker, P. I. W., Word, J. M., Prisant, M. G. et al. (2003). Structure validation by C alpha geometry: phi,psi and C beta deviation. Proteins:Struct. Funct. Genet. 50, 437–450. Krissinel, E. & Henrick, K. (2005). Detection of protein assemblies in crystals. Comp. Life Sci. Proc. 3695, 163–174. Wallace, A. C., Laskowski, R. A. & Thornton, J. M. (1995). LIGPLOT: a program to generate schematic diagrams of protein-ligand interactions. Protein Eng. 8, 127–134. Potterton, E., McNicholas, S., Krissinel, E., Cowtan, K. & Noble, M. (2002). The CCP4 molecular-graphics project. Acta Crystallog. sect. D, 58, 1955–1957.

56. 57.

58.

59. 60.

61. 62. 63. 64.

65.

66.

67.

68.

69.

70. 71.

72.