- Email: [email protected]
Molecular cloning, characterization and expression analysis of the protein arginine N-methyltransferase 1 gene (As-PRMT1) from Artemia sinica
Gene 565 (2015) 122–129
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Molecular cloning, characterization and expression analysis of the protein arginine N-methyltransferase 1 gene (As-PRMT1) from Artemia sinica Xue Jiang a,1, Feng Yao a,1, Xuejie Li a, Baolin Jia a, Guangying Zhong a, Jianfeng Zhang a, Xiangyang Zou b,⁎, Lin Hou a,⁎⁎ a b
College of Life Sciences, Liaoning Normal University, Dalian 116081, China Department of Biology, Dalian Medical University, Dalian 116044, China
a r t i c l e
i n f o
Article history: Received 17 December 2014 Received in revised form 17 February 2015 Accepted 1 April 2015 Available online 2 April 2015 Keywords: Artemia sinica Protein arginine N-methyltransferase 1 Clone and expression Early embryo development High salinity and low temperature stress
a b s t r a c t Protein arginine N-methyltransferase 1 (PRMT1) is an important epigenetic regulation factor in eukaryotic genomes. PRMT1 is involved in histone arginine loci methylation modification, changes in eukaryotic genomes' chromatin structure, and gene expression regulation. In the present paper, the full-length 1201-bp cDNA sequence of the PRMT1 homolog of Artemia sinica (As-PRMT1) was cloned for the first time. The putative AsPRMT1 protein comprises 346 amino acids with a SAM domain and a PRMT5 domain. Multiple sequence alignments revealed that the putative sequence of As-PRMT1 protein was relatively conserved across species, especially in the SAM domain. As-PRMT1 is widely expressed during embryo development of A. sinica. This is followed by a dramatic upregulation after diapause termination and then downregulation from the nauplius stage. Furthermore, As-PRMT1 transcripts are highly upregulated under conditions of high salinity and low temperature stress. These findings suggested that As-PRMT1 is a stress-related factor that might promote or inhibit the expression of certain genes, play a critical role in embryonic development and in resistance to low temperature and high salinity stress. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Artemia sinica (Arthropoda, Crustacea, Anostraca, Artemiidae, Artemia) is distributed widely in the inland salt lakes and coastal saltworks in China. It is the best live food for shrimp and fish, therefore, it is used in aquaculture as the initial feed for larval rearing of marine fishes, prawns and crabs (Abatzopoulos et al., 2002). Artemia (brine shrimp) shows a diapause phase during its embryonic development stages under stress conditions, such as γ-irradiation, pollutant exposure, low temperature and high salinity. During diapause, the embryo is arrested at the late gastrula stage and the female produced encysted embryos (dormant cysts) (Jiang et al., 2007). The molecular mechanism of diapause remains unknown, making it a research focus of Abbreviations: As-PRMT1, protein arginine N-methyltransferase 1 from Artemia sinica; SAM BD, S-adenosylmethionine binding domain; PRMT5, protein arginine Nmethyltransferase 5; PCR, polymerase chain reaction. ⁎ Correspondence to: X. Zou, Department of Biology, Dalian Medical University, Dalian 116044, China. ⁎⁎ Correspondence to: L. Hou, College of Life Sciences, Liaoning Normal University, No. 1, Liushu South Street, Dalian 116081, China. E-mail addresses: [email protected] (X. Zou), [email protected] (L. Hou). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.gene.2015.04.004 0378-1119/© 2015 Elsevier B.V. All rights reserved.
developmental biologists. When the embryonic development of brine shrimp is arrested, metabolic activity is greatly controlled and resistance to severe physiological stress is sharply increased (Zhou et al., 2008). Nuclear DNA and histones (H1, H2A, H3 and H4) form nucleosomes in eukaryotic genomes. The nucleosome core usually comprises eight core group histone proteins (Scorilas et al., 2000), which are frequently subjected to methylation, acetylation, phosphorylation (Pahlich et al., 2006), ADP ribose base and ubiquitin and various post-translational modifications (Osanai et al., 2003). These histone modifications not only influence and change the state of chromatin, but also regulate gene expression (Kirmizis et al., 2007). Histone methylation modification is mainly catalyzed by methyltransferases, which add methyls to lysine and arginine residues of H3 and H4 core proteins. The site of arginine methylation occurs mainly in the N-terminal region (e.g., H3 — R2/ R17/R26 and H4 — R3); (Pahlich et al., 2006). These modified loci usually affect target gene promoter regions, thereby affecting gene expression. Therefore, histone methylation has become one of the hot topics in the study of epigenetics in recent years (Peterson and Laniel, 2004). Arginine methyltransferase belongs to the methyltransferase gene family (Zhang and Cheng, 2003). Protein arginine methyltransferases (PRMTs) transfer the methyl group from S-adenosylmethionine to the
X. Jiang et al. / Gene 565 (2015) 122–129
terminal guanidino nitrogens of arginine residues, generating monomethyl-arginine, symmetric dimethylarginine, and asymmetric dimethyl-arginine (Fig. 1) (Niewmierzycka and Clarke, 1999). The PRMTs comprise a family of nine enzymes (Pawlak et al., 2000) that have been classified as either type I (PRMT1-4, -6, and -8) or type II (PRMT5, -7, and -9) (Frankel et al., 2002; Huang and Li, 2004) according to whether they promote the formation of asymmetric-NG,NGdimethylarginines or symmetric-NG,N′G-dimethylarginines, respectively (Gros et al., 2003; Onozato et al., 2008). Although all PRMTs contain a highly conserved methyltransferase domain of approximately 310 amino acids, each PRMT has distinct protein substrate specificities. Beyond their “core” region, each PRMT has a unique N-terminal region that varies considerably in length (Rawal et al., 1994). Protein arginine N-methyltransferase 1 (PRMT1) is the predominant member of the PRMTs (Pawlak et al., 2000) and was the first to be isolated, cloned and purified (Frankel et al., 2002). The methylation types and the substrate characteristics indicate that PRMT1 modulates various cellular processes, including signal transduction, RNA processing, DNA repair, and protein–protein interaction (Cook et al., 2006). PRMT1 is a type I catalytic enzyme (Krause et al., 2007), and is a histone methyltransferase that methylates Arg3 on histone H4 (H4R3) (see Fig. 1) which usually plays a role of activation of gene transcription (Cook et al., 2006; Katsanis et al., 1997). For example, methylation of histone R3 and H4 by prmt5 work together with the nuclear receptor coactivator p160 subunit to promote transcription of the androgen receptor (AR) (Koh et al., 2001). Until now, PRMT1 has only been studied in depth in higher vertebrates, especially in the area of the health, disease and inheritance (Cheng et al., 2004). However, the functions of PRMT1 in invertebrates remain unknown. To date, there have been few reports concerning the PRMT1 gene in invertebrates, with the exception of nematodes and a few arthropods. Thus, in the present study, we cloned the PRMT1 from A. sinica (As-PRMT1). We analyzed its expression pattern, cellular
123
location and potential roles during different embryonic development stages of A. sinica, and in response to high salinity and low temperature stress. 2. Materials and methods 2.1. Animal preparation Artemia sinica cysts were collected from the salt lake of Yuncheng in Shanxi Province, China. These cysts were hatched in filtered fresh seawater and 28‰ salinity treatment conditions in the laboratory, according to a previously described method (Zheng et al., 2011). The cysts were incubated for 30 min (designated 0 h) to acclimatize them to the laboratory conditions. Animal samples (about 50 mg) were collected at different times (5, 10, 15, 20 and 40 h, and 3, 5, and 7 days) for subsequent experiments. In the low-temperature assay, nauplius stage brine shrimps (20 h) cultured at 30 °C for 48 h were used as the control group, and nauplius stage Artemia (20 h) in the experimental group were maintained at 25 °C, 20 °C, 15 °C, 10 °C or 5 °C. In the salinitychallenge assay, specimens of A. sinica were reared for 20 h to the nauplius stage in 28‰ salinity seawater and then treated with a series of increasing concentrations of seawater (50‰, 100‰, 150‰, and 200‰ salinity) and put into separate vessels for subsequent experiments. The different salinities were produced by adding crude salt into natural seawater and then measuring the salinity using a salinometer. 2.2. Cloning of full-length As-PRMT1 cDNA Total RNAs were extracted from A. sinica cysts (0 h) using the Trizol Reagent (Tiangen, China), following the manufacturer's protocol. The RNA was then reverse transcribed into cDNA using an oligo(dT) primer and MLV reverse transcriptase, also following the manufacturer's protocol. The forward (prmt-1F, Table 1) and the reverse (prmt-1 R, Table 1)
Fig. 1. Catalytic process and classification of PRMTS. Under the action of PRMT, arginine can be methylated into monomethyl-Arg with the methyl provider S-adenosylmethionine (SAM), followed by a second methylation, generating asymmetric dimethyl-Arg or symmetric demethyl-Arg.
124
X. Jiang et al. / Gene 565 (2015) 122–129
2.4. Expression analysis of As-prmt-1 by real-time qPCR
Table 1 Oligonucleotide primers used in the study. Primer
Sequence (5′-3′)
Direction
PRMT1 F PRMT1 R 3′In-PRMT1 3′Ou-PRMT1 Probe-F Probe-R RT-prmt-1F RT-prmt-1R β-Actin F β-Actin R
TTGGCTGTGGAACTGGTA TGTCACGGGCATAAAGAA GTGTAAAGCCTGGGGTGCCT TTGGACACTGTTCTTTATGCC TTGGCTGTGGAACTGGTA TGTCACGGGCATAAAGAA GAAGAGGTTGAACTCCCAGAT AGCCATTTGTCACGGGCATAA AGCGGTTGCCATTTATTGTT GGTCGTGACTTGACGGACTATAT
Forward Reverse Forward Reverse Forward Reverse forward Reverse Forward Reverse
primers were designed using primer Premier 5.0, based on an Artemia franciscana prmt-1 expressed sequence tag (EST), and synthesized by Takara (Dalian, China). The primers were used for PCR as follows: initial denaturation at 94 °C for 5 min; followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and elongation at 72 °C for 1 min; with a final extension at 72 °C for 10 min. The PCR products were separated on 1.0% agarose/TAE gels and sequenced by Takara (Dalian, China). Thus, an expressed EST sequence of the As-prmt-1 was obtained. The full-length sequence of the As-prmt-1 was obtained using the rapid amplification of cDNA ends (RACE) method, based on the relevant sequence of GenBank gene Library from A. franciscana. The 3′ RACE was carried out with the 3′-Full RACE core set ver. 2.0 (Takara) and the 5′ RACE was carried out with the SMART RACE cDNA Amplification Kit following the manufacturer's instructions. An inner primer (3′In-prmt-1, Table 1) and outer primer (3′ Ou-prmt-1, Table 1) were designed from the A. sinica EST for 3′ RACE, and gene-specific primers (GSP, Table 1) were designed based on the EST for 5′ RACE, to amplify the 3′ end and 5′ end of the gene. The RACE-PCR products were purified from the gel and then cloned into the pMD-19T vector for sequencing. The 3′ and 5′ fragments were spliced together using DNAMAN 6.0.3.48 (Lynnon Biosoft) to obtain the full-length cDNA of As-prmt-1. The nucleotide sequence was submitted to GenBank with the accession number KJ708554.
2.4.1. Expression of As-PRMT1 during different developmental stages The total RNA was prepared from whole Artemia harvested from different embryo development periods (0, 5, 10, 15, 20, 40 h, 3 days, 5 days and 7 days) and used as a template for cDNA by the same protocol mentioned above. Two PCR primer sets specific for As-prmt-1 and β-actin were used to amplify cDNA products. The sense primer of As-prmt-1 was named RT-prmt-1F (Table 1), and antisense primer was RT-prmt1 R (Table 1), β-actin sense primer was named β-actin F (Table 1), and antisense primer was β-actin R (Table 1). Real-time qPCR was performed in triplicate for each sample using the SYBR Premix Ex Taq (TaKaRa, Dalian, China) and TaKaRa detection system TaKaRa TP800 (Dalian, China). Reaction conditions were 95 °C for 30 s, followed by 40 cycles each of 95 °C for 5 s, 58 °C for 30 s, and 95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s. The β-actin gene was used as a normalization control for each starting quantity of RNAs (Li et al., 2012). Gene expression data were analyzed with Thermal Cycler Dice Real Time system software (TaKaRa, Dalian, China), and quantified using the comparative CT method (2−ΔΔCt method) based on Ct values for both As-prmt-1 and β-actin to calculate the fold increase (Schmittgen and Livak, 2008). 2.4.2. Salinity and temperature stress assays The total RNA were collected from A. sinica, which were hatched in 28‰ salinity seawater for 20 h and treated with a series of concentrations of seawater (50‰, 100‰, 150‰, and 200‰ salinity) in separate vessels for 24 h. The salinity of the seawater was adjusted by adding crude salt to natural seawater and measuring with a salinometer. The two pairs of real-time qPCR primers (mentioned above) were used for the real-time quantitative PCR to check the relative expression value. The reaction conditions were the same as those mentioned above. The total RNA was extracted from the nauplius stage brine shrimp (20 h) which was cultured at 30 °C for 48 h, and nauplius stage Artemia (20 h) which were maintained at 25 °C, 20 °C, 15 °C, 10 °C or 5 °C, respectively. The two pairs of real-time qPCR primers (mentioned above) were used for the real-time quantitative PCR to check the relative expression value. The reaction conditions were the same as those mentioned above.
2.3. Bioinformatic analysis of As-PRMT1
2.5. Preparation of paraffin sections and in situ hybridization
The cloned nucleotide sequence was analyzed for identity and similarity using the National Center for Biotechnology Information (NCBI) online Search Tool (BLASTX) (http://www.ncbi.nlm.nih.gov/) and ORF of As-prmt-1 was found using the ORFfinder program at NCBI (http:// www.ncbi.nlm.nih.gov/gorf/orfig.cgi). The As-PRMT1-1 protein structure and functional domains were predicted using the prosite tools of ExPASy (http://prosite.expasy.org/prosite.html/) and SMART (http:// smart.embl-heidelberg.de/), respectively. The molecular weight and theoretical isoelectric point of the protein were predicted using the ProtParam tool of ExPASy (http://web.expasy.org/protparam/). The protein subcellular localization was predicted using the PSORT server (http://psort.hgc.jp/) and the iPSORT service (http://ipsort.hgc.jp/). SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/) was used for signal peptide prediction. To detect transmembrane helices, hydrophobicity and hydrophilicity, the Tmpred program (http://www.ch.embnet. org/software/TMPRED_form.html/) and the TMHMM Server 2.0 (http:// www.cbs.dtu.dk/services/TMHMM-2.0/) were used. Subsequently, multiple sequence alignments were performed of amino acid sequences of As-PRMT-1 and PRMT-1 sequences from different species using the ClustalX1.8 program and DNAMAN. Finally, MEGA4.1 software and clustalx1.8 were used to generate the phylogenetic tree of the PRMT-1 proteins from different species by the neighbor-joining (NJ) method. The statistical significance of groups within phylogenetic trees was evaluated using the bootstrap method, with 1000 replications.
The cDNA template for the probe, obtained by PCR (forward 5′-TGCG GACGAAACAGGAAG-3′, reverse 5′-GCTCAAACAGTGATGCCAGT-3′) and agarose gel electrophoresis was cloned into a pGM-T vector to add the T7 and SP6 polymerase binding sites to the gene. A DIG-labeled RNA probe was synthesized using a DIG RNA labeling kit (SP6/T7, Roche). The 0, 5 and 10 h samples were exuviated using 50% NaClO, and all samples were fully rinsed to remove surface salinity using phosphatebuffered saline (PBS) treated with diethylpyrocarbonate (DEPC). The samples were fixed in fresh 4% paraformaldehyde solution at 4 °C for 6–8 h. The samples were then cut into 10 μm-thick sections using a Radial Microtomes. Prehybridization of each sample was then performed at 37 °C for 2 h. The prehybridization buffer contained 1 × Denhardt's solution, 0.5 mg/ml of salmon sperm DNA, 50% deionized formamide (v/v), and 20× SSC. Hybridization was performed at 52 °C for 12–16 h by adding 10% dextran sulfate and 1 mg/ml DIG-labeled As-PRMT1 probe to the pre-hybridization buffer. Finally, the hybridization signal was detected using a DIG Nucleic Acid Detection Kit (Roche). 2.6. Statistical analyses The data obtained from real-time qPCR analysis were analyzed by least square difference (LSD) and significance was set at P b 0.05, as assessed by t-test using SPSS 16.0 software.
X. Jiang et al. / Gene 565 (2015) 122–129
3. Results 3.1. Gene cloning and bioinformatic analysis of As-prmt-1 3′ and 5′ RACE technology was used to obtain a 1201-bp full-length cDNA of As-prmt-1 (GenBank accession: KJ708554), which contained a 1041 bp ORF (Fig. 2A), and 50-bp 5′- and 117-bp 3′-UTRs. As determined by prosite tools of ExPASy, the putative As-PRMT1 protein contains 346 amino acids, has a calculated molecular mass of 29 kDa and a pI of 5.42. A prmt superfamily domain was identified (Fig. 2B) using SMART analysis by the TMHMM Server 2.0, which also showed that As-PRMT1 has no transmembrane helices. The two transmembrane regions indicated that As-PRMT1 is an integral membrane protein. Protein sequence analysis and functional domain analysis showed a highly conserved S-adenosylmethionine binding domain (SAM BD) belonging to the protein-arginine methyltransferases superfamily. The protein also contains a PRMT5 domain which is characteristic of PRMT proteins and comprises the catalytic histone methylation domain (Smith et al., 1999). Prediction of the protein subcellular localization revealed that the As-PRMT1 protein is 39.1% likely to be located in endoplasmic reticulum, 60.9% cytoplasmic, 21.7% cytoskeletal, 8.7% in nuclear, and 4.3% respectively in the vacuolar and extracellular. Multiple protein sequence alignment analysis of As-PRMT-1 revealed conserved amino-acid homologous sequences between the proteins of different species, especially in the SAM BD and PRMT5 regions at the C-terminus (Fig. 3). As-PRMT-1 was found to share 35%–41% similarity to vertebrate sequences, 50%–55% similarity to invertebrates, and 60% similarity with Caligus rogercresseyi. This shows that AsPRMT1 was the most similar to arthropod PRMT1 sequences. To evaluate the evolutionary relationship of As-PRMT1 homologous sequences, we constructed a phylogenetic tree using Mega 4.1. Protein sequences from 23 species were used to produce an unrooted phylogenetic tree using the neighbor-joining method. The resulting phylogenetic tree
125
(Fig. 4) showed three main clusters: vertebrates, arthropods and nematodes, with As-PRMT1 clustered within the arthropods. Thus, the relationships displayed in the phylogenetic tree corresponded to their classification position. 3.2. Expression analysis of As-PRMT1 by real-time qPCR Real-time qPCR analysis was used to detect the transcript levels of As-PRMT1 during different stages of A. sinica development, from the gastrula to the sub-adult stage (Fig. 5). The expression level of As-PRMT1 increased notably during the developmental stages from 0 h to 40 h; thereafter, the expression level decreased significantly before stabilizing during the stages from 3 days to 5 days. The expression was highest at 40 h. Thus, As-PRMT1 expression was upregulated during early development and downregulated at the sub-adult stage. To determine the response of As-PRMT1 to temperature and salinity stress, real-time qPCR was employed. At the temperature stress assay, upregulation of expression from 5 °C to 30 °C was observed (Fig. 6). Salinity stress resulted in significant differences between the control and salinity-treated specimens at salinity concentrations ranging from 50‰ to 200‰. The lowest expression quantity of As-PRMT1 mRNA occurred at 50‰ salinity and the expression rose sharply with increasing salinity (Fig. 7). 3.3. Location of As-PRMT1 mRNA in A. sinica In situ hybridization was performed to determine the spatial expression patterns of As-PRMT1 in the eight developmental stages of A. sinica (Fig. 5). As-PRMT1 mRNA was observed throughout the embryo at stages 0 h, 5 h and 10 h (Fig. 5A, B and C) and gradually extended from the head to the tail in the umbrella stage at 15 h (Fig. 5D). During the developmental stage marked from 20 to 40 h, As-PRMT1 expression could be seen in the entire body of the larva after the nauplius larva
Fig. 2. (A) Sequence analysis of the cDNA and predicted peptide sequences of As-PRMT1. The numbering of the nucleotide and amino acid sequences is shown to the left and right. The start codon is indicated in purple; the stop codon is indicated in yellow; the blue letters represent the prmt superfamily domain; the gray area represents the prmt5 domain; the polyadenylation site (AATAAA) is indicated in red. (B) Domain analysis result of putative As-PRMT1 protein. The mature protein includes a PRMT1 domain in the C-terminus, and a prmt5 domain.
126
X. Jiang et al. / Gene 565 (2015) 122–129
Fig. 3. Protein sequence alignment of As-PRMT1 and 22-PRMT1 sequences of other species from GenBank. The sequences and their accession numbers are as follows: MdPRMT1, Musca domestica, XP_005175755; HaPRMT1, Harpegnathos saltator, EFN79080; PhPRMT1, Pediculus humanus corporis, XP_002425905; AaPRMT1, Aedes aegypti, XP_001656487; HsPRMT1, Homo sapiens, AF2226893; DmPRMT1, Drosophila melanogaster, NP_650017; DpPRMT1, Daphnia pulex, EFX63145; CgPRMT1, Crassostrea gigas, EKC18189; BmPRMT1, Bombyx mori, XP_004924094; OgPRMT1, Otolemur garnettii, XP_0038015250; XlPRMT1, Xenopus laevis, AAI06276; OdPRMT1, Odobenus rosmarus divergens, XP_004409949; DrPRMT1, Danio rerio, NP_956944; HvPRMT1, Hydra vulgaris, XP_002157035; SkPRMT1, Saccoglossus kowalevskii, NP_001171787; OnPRMT1, Oreochromis niloticus, XP_003456914; HcPRMT1, Haemonchus contortus, CDJ81919; BtPRMT1, Bos Taurus, NP_001015624; MmPRMT1, Mus musculus, EDL22778; AcPRMT1, Ancylostoma ceylanicum, EYC20939; CtPRMT1, Capitella teleta, ELU01488; and ApPRMT1, Acyrthosiphon pisum, NP_001156225.
hatched from the zona pellucida (Fig. 5D, E). At 3 days, As-PRMT1 expression across the entire body decreased, especially in the abdominal and cephalothorax region of the polypide (Fig. 5F). At days 5 and 7, As-PRMT1 mRNA was also detected in all parts, with internal tissue and external appendages developed, but at lower levels than at earlier time points (Fig. 5G, H). Under the same conditions, controlled trials were performed with the antisense probe, and no positive signal above background was detected (Fig. 5A1, B1, C1, D1, E1, F1, G1, H1). Our studies also showed that As-PRMT1 mRNA was expressed in almost all parts of A. sinica during different developmental stages (Fig. 8).
4. Discussion In this study, a full-length cDNA sequence of PRMT1 from A. sinica was obtained for the first time. As-prmtl is a small gene, with a 1208 bp full-length cDNA, which contains a 1041 bp ORF encoding a protein of 346 amino acids. As-PRMT1 lacks any known signal peptide sequences and transmembrane regions. However, As-PRMT1 contains a highly conservative SAM BD, belonging to the protein-arginine methyltransferases superfamily (Katsanis et al., 1997; Niewmierzycka and Clarke, 1999), and a PRMT5 domain, which is characteristic of PRMT
X. Jiang et al. / Gene 565 (2015) 122–129
127
Fig. 6. Quantitative real-time qPCR analysis of As-PRMT1 expression in response to low temperatures assay. The control group (red) was cultured at 30 °C. Each group was incubated at the indicated temperature for 24 h. Data are the mean ± SD of triplicate experiments. * Indicates a significant difference compared with the control (P b 0.05), while ** indicates a very significant difference compared with the control (P b 0.01).
Fig. 4. A phylogenetic tree of aligned amino acid sequences of As-PRMT1 and 22 PRMT1 proteins from other species. A neighbor-joining phylogenetic tree was constructed on the basis of the sequences from A. sinica and from GenBank, utilizing the sequence analysis tool MEGA 4.1. The sequences and their accession numbers of PRMT1 are the same as those in the legend to Fig. 2. A red rhombus (●) indicates As-PRMT1 from A. sinica.
relatively lower expression in adults. The site of histone arginine methylation plays an important role in gene transcription regulation, and can affect a variety of physiological process, such as cellular, enclosed DNA repair, signal transduction, cell growth and cancer (Zou et al., 2012).
proteins and contains the catalytic histone methylation region (Strahl et al., 2001). In situ hybridization results showed that the PRMT1 gene was transcribed in different tissues and PRMT1 mRNA was expressed in almost all parts of A. sinica during different developmental stages, with a
Fig. 5. Quantitative real-time qPCR analysis of As-PRMT1 expression during different developmental stages of A. sinica. The expression level at 0 h stage was set as the control level. The x-axis represents different development stages (0 h to 7 days). The y-axis represents the expression level of As-PRMT1 relative to that at 0 h. Data are means ± SD of triplicate experiments. * Indicates a significant difference compared with the control (P b 0.05), while ** indicates a very significant difference compared with the control (P b 0.01).
Fig. 7. Quantitative real-time qPCR analysis of As-cav-1 expression in the salinity challenge assay. The control group (red) was incubated in saline water at 28‰ salinity. Each group was incubated at the indicated salinity for 24 h. Data are the means ± SD of triplicate experiments. * Indicates a significant difference compared with the control (P b 0.05), while ** indicates a very significant difference compared with the control (P b 0.01).
128
X. Jiang et al. / Gene 565 (2015) 122–129
Fig. 8. In situ hybridization analysis of As-sdh expression during different developmental stages in A. sinica. A–H: experimental group; A1–H1: control group. A: gastrula stage (0 h); B, C: embryonic stage (5 and 10 h); D, E, F: nauplius stage (15, 20, and 40 h); G, H: metanauplius stage (3 and 5 day). Arrows indicate regions with positive hybridization signals.
Therefore, we concluded that As-PRMT1 has a ubiquitous and vital function during the development of A. sinica. The development of A. sinica consists of four main stages: the embryo, nauplius, metanauplius larva and the adult stage. In this experiment, 0–10 h corresponded to the embryo stage; 15–20 h corresponded to the nauplius stage; 40 h corresponded to the metanauplius larva stage; and 3 and 5 days corresponded to the pseudoadult stage (Gui et al., 2013). Real-time qPCR of embryos from different developmental stages showed that the level of As-prmtl transcripts remained stable during the developmental stages from 0 to 15 h and were upregulated from 20 to 40 h. They increased consistently until reaching a peak at the 40 h stage. By contrast, from days 3 to 5, the amount of As-prmtl transcripts began to decrease and expression remained at a low level, which implied that As-PRMT1 plays a prominent role during the nauplius stage. Early development is the most active stage for cell division and differentiation. It is also the stage during which large-scale transcription of zygotic genes is initiated. The expression of genes related to the development of quantity began to rise. In the key period of development, protein arginine N-methyltransferase 1 (PRMT1) is an important epigenetic regulation factor in eukaryotic genomes, mainly being involved in histone arginine loci methylation modification, which changes eukaryotic genomes' chromatin structure to regulate the expression of genes (Li et al., 2012). Therefore, we
speculated that As-PRMT1 was an indispensable gene in the early development of A. sinica. When conditions are suitable for survival, the embryo resumes development in adequate water, temperature and molecular oxygen conditions after 0 h. In a relatively stable developmental environment, the amount of As-PRMT1 transcripts remained stable between 0 h to 15 h. However, after 20 h, the nauplius larva had hatched from the zona pellucida and the larvae were free to swim instead of being enclosed, and the gut, the appendages and arthromere commence differentiation. The expression level of As-PRMT1 increased to regulate the expression of certain genes that protect individuals from stresses. In conclusion, histone methylation modification is a key epigenetic regulation mechanism that plays critical roles in early embryo developmental programs. Artemia live in hypersaline waters, so changes in salinity and temperature are the important environment factors for this invertebrate. The high salinity and low temperature routinely encountered by A. sinica were replicated in these experiments to study the expression of As-PRMT1 during stress. The expression of As-PRMT1 was highly upregulated with increasing salinity and decreasing temperature, indicating that a stress-activated response involving As-PRMT1 induction is invoked when Artemia is exposed to a suboptimal environment. These findings are consistent with previous data showing that PRMT1 is a ubiquitous enzyme induced by cellular stress.
X. Jiang et al. / Gene 565 (2015) 122–129
Genetic information encoded in DNA is largely identical in every cell of a eukaryote; however, cells in different tissues and organs can have widely different gene expression patterns and can exhibit specialized functions. Gene expression patterns in different cell types need to be appropriately induced and maintained, and also need to respond to developmental and environmental changes (Herrmann et al., 2005). However, whether gene expression is mainly controlled by the related enzymes in general (Ostareck-Lederer et al., 2006), remains to be determined. The results presented here showed that the expression level of protein arginine methyltransferase 1 altered in response to changes in the environment. Methyltransferase 1 plays a key role in the expression of certain resistance genes, which help A. sinica adapt to unfavorable environments of high salt and low temperature. Conflict of interest We declare that we have no conflict of interest. Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (31272644). We thank anonymous referees for their valuable comments on an earlier version of the manuscript. References Abatzopoulos, T., Beardmore, J., Clegg, J., Sorgeloos, P., 2002. Artemia: Basic and Applied Biology. Kluwer Academic. Cheng, D., Yadav, N., King, R.W., Swanson, M.S., Weinstein, E.J., Bedford, M.T., 2004. Small molecule regulators of protein arginine methyltransferases. J. Biol. Chem. 279, 23892–23899. Cook, J.R., Lee, J.-H., Yang, Z.-H., Krause, C.D., Herth, N., Hoffmann, R., Pestka, S., 2006. FBXO11/PRMT9, a new protein arginine methyltransferase, symmetrically dimethylates arginine residues. Biochem. Biophys. Res. Commun. 342, 472–481. Frankel, A., Yadav, N., Lee, J., Branscombe, T.L., Clarke, S., Bedford, M.T., 2002. The novel human protein arginine N-methyltransferase PRMT6 is a nuclear enzyme displaying unique substrate specificity. J. Biol. Chem. 277, 3537–3543. Gros, L., Delaporte, C., Frey, S., Decesse, J., de Saint-Vincent, B.R., Cavarec, L., Dubart, A., Gudkov, A.V., Jacquemin-Sablon, A., 2003. Identification of new drug sensitivity genes using genetic suppressor elements protein arginine N-methyltransferase mediates cell sensitivity to DNA-damaging agents. Cancer Res. 63, 164–171. Gui, S., Wooderchak-Donahue, W.L., Zang, T., Chen, D., Daly, M.P., Zhou, Z.S., Hevel, J.M., 2013. Substrate-induced control of product formation by protein arginine methyltransferase 1. Biochemistry 52, 199–209. Herrmann, F., Lee, J., Bedford, M.T., Fackelmayer, F.O., 2005. Dynamics of human protein arginine methyltransferase 1 (PRMT1) in vivo. J. Biol. Chem. 280, 38005–38010. Huang, C.M., Li, C., 2004. Identification and phylogenetic analyses of the protein arginine methyltransferase gene family in fish and ascidians. Gene 340, 179–187. Jiang, L., Hou, L., Zou, X., Zhang, R., Wang, J., Sun, W., Zhao, X., An, J., 2007. Cloning and expression analysis of p26 gene in Artemia sinica. Acta Biochim. Biophys. Sin. 39, 351–358. Katsanis, N., Yaspo, M.-L., Fisher, E.M., 1997. Identification and mapping of a novel human gene, HRMT1L1, homologous to the rat protein arginine N-methyltransferase 1 (PRMT1) gene. Mamm. Genome 8, 526–529.
129
Kirmizis, A., Santos-Rosa, H., Penkett, C.J., Singer, M.A., Vermeulen, M., Mann, M., Bähler, J., Green, R.D., Kouzarides, T., 2007. Arginine methylation at histone H3R2 controls deposition of H3K4 trimethylation. Nature 449, 928–932. Koh, S.S., Chen, D., Lee, Y.H., Stallcup, M.R., 2001. Synergistic enhancement of nuclear receptor function by p160 coactivators and two coactivators with protein methyltransferase activities. J. Biol. Chem. 276, 1089–1098.Regulation of Estrogen Rapid Signaling through Arginine Methylation by PRMT1. Mol. Cell 31, 212–221. Krause, C.D., Yang, Z.-H., Kim, Y.-S., Lee, J.-H., Cook, J.R., Pestka, S., 2007. Protein arginine methyltransferases: evolution and assessment of their pharmacological and therapeutic potential. Pharmacol. Ther. 113, 50–87. Li, Q., Zhang, Q., Han, L., Yuan, Z., Tan, J., Du, B., Zou, X., Hou, L., 2012. Molecular characterization and expression of As-nurp1 gene from Artemia sinica during development and in response to salinity and temperature stress. Biol. Bull. 222, 182–191. Niewmierzycka, A., Clarke, S., 1999. S-adenosylmethionine-dependent methylation in Saccharomyces cerevisiae. J. Biol. Chem. 274, 814–824. Onozato, M.L., Tojo, A., Leiper, J., Fujita, T., Palm, F., Wilcox, C.S., 2008. Expression of NG, NGdimethylarginine dimethylaminohydrolase and protein arginine N-methyltransferase isoforms in diabetic rat kidney effects of angiotensin II receptor blockers. Diabetes 57, 172–180. Osanai, T., Saitoh, M., Sasaki, S., Tomita, H., Matsunaga, T., Okumura, K., 2003. Effect of shear stress on asymmetric dimethylarginine release from vascular endothelial cells. Hypertension 42, 985–990. Ostareck-Lederer, A., Ostareck, D.H., Rucknagel, K.P., Schierhorn, A., Moritz, B., Huttelmaier, S., Flach, N., Handoko, L., Wahle, E., 2006. Asymmetric arginine dimethylation of heterogeneous nuclear ribonucleoprotein K by protein-arginine methyltransferase 1 inhibits its interaction with c-Src. J. Biol. Chem. 281, 11115–11125. Pahlich, S., Zakaryan, R.P., Gehring, H., 2006. Protein arginine methylation: cellular functions and methods of analysis. Biochim. Biophys. Acta, Proteins Proteomics 1764, 1890–1903. Pawlak, M.R., Scherer, C.A., Chen, J., Roshon, M.J., Ruley, H.E., 2000. Arginine Nmethyltransferase 1 is required for early postimplantation mouse development, but cells deficient in the enzyme are viable. Mol. Cell. Biol. 20, 4859–4869. Peterson, C.L., Laniel, M.-A., 2004. Histones and histone modifications. Curr. Biol. 14, R546–R551. Rawal, N., Rajpurohit, R., Paik, W.K., Kim, S., 1994. Purification and characterization of Sadenosylmethionine-protein-arginine N-methyltransferase from rat liver. Biochem. J. 300, 483–489. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108. Scorilas, A., Black, M.H., Talieri, M., Diamandis, E.P., 2000. Genomic organization, physical mapping, and expression analysis of the human protein arginine methyltransferase 1 gene. Biochem. Biophys. Res. Commun. 278, 349–359. Smith, J.J., Rücknagel, K.P., Schierhorn, A., Tang, J., Nemeth, A., Linder, M., Herschman, H.R., Wahle, E., 1999. Unusual sites of arginine methylation in poly (A)-binding protein II and in vitro methylation by protein arginine methyltransferases PRMT1 and PRMT3. J. Biol. Chem. 274, 13229–13234. Strahl, B.D., Briggs, S.D., Brame, C.J., Caldwell, J.A., Koh, S.S., Ma, H., Cook, R.G., Shabanowitz, J., Hunt, D.F., Stallcup, M.R., Allis, C.D., 2001. Methylation of histone H4 at arginine 3 occurs in vivo and is mediated by the nuclear receptor coactivator PRMT1. Curr. Biol. 11, 996–1000. Zhang, X., Cheng, X., 2003. Structure of the predominant protein arginine methyltransferase PRMT1 and analysis of its binding to substrate peptides. Structure 11, 509–520. Zheng, L.P., Hou, L., Chang, A.K., Yu, M., Ma, J., Li, X., Zou, X.-Y., 2011. Expression pattern of a Gram-negative bacteria-binding protein in early embryonic development of Artemia sinica and after bacterial challenge. Dev. Comp. Immunol. 35, 35–43. Zhou, Q., Wu, C., Dong, B., Liu, F., Xiang, J., 2008. The encysted dormant embryo proteome of Artemia sinica. Mar. Biotechnol. 10, 438–446. Zou, L., Zhang, H., Du, C., Liu, X., Zhu, S., Zhang, W., Li, Z., Gao, C., Zhao, X., Mei, M., 2012. Correlation of SRSF1 and PRMT1 expression with clinical status of pediatric acute lymphoblastic leukemia. J. Hematol. Oncol. 5, 42–44.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Molecular cloning, characterization and expression analysis of the protein arginine N-methyltransferase 1 gene (As-PRMT1) from Artemia sinica Xue Jiang a,1, Feng Yao a,1, Xuejie Li a, Baolin Jia a, Guangying Zhong a, Jianfeng Zhang a, Xiangyang Zou b,⁎, Lin Hou a,⁎⁎ a b
College of Life Sciences, Liaoning Normal University, Dalian 116081, China Department of Biology, Dalian Medical University, Dalian 116044, China
a r t i c l e
i n f o
Article history: Received 17 December 2014 Received in revised form 17 February 2015 Accepted 1 April 2015 Available online 2 April 2015 Keywords: Artemia sinica Protein arginine N-methyltransferase 1 Clone and expression Early embryo development High salinity and low temperature stress
a b s t r a c t Protein arginine N-methyltransferase 1 (PRMT1) is an important epigenetic regulation factor in eukaryotic genomes. PRMT1 is involved in histone arginine loci methylation modification, changes in eukaryotic genomes' chromatin structure, and gene expression regulation. In the present paper, the full-length 1201-bp cDNA sequence of the PRMT1 homolog of Artemia sinica (As-PRMT1) was cloned for the first time. The putative AsPRMT1 protein comprises 346 amino acids with a SAM domain and a PRMT5 domain. Multiple sequence alignments revealed that the putative sequence of As-PRMT1 protein was relatively conserved across species, especially in the SAM domain. As-PRMT1 is widely expressed during embryo development of A. sinica. This is followed by a dramatic upregulation after diapause termination and then downregulation from the nauplius stage. Furthermore, As-PRMT1 transcripts are highly upregulated under conditions of high salinity and low temperature stress. These findings suggested that As-PRMT1 is a stress-related factor that might promote or inhibit the expression of certain genes, play a critical role in embryonic development and in resistance to low temperature and high salinity stress. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Artemia sinica (Arthropoda, Crustacea, Anostraca, Artemiidae, Artemia) is distributed widely in the inland salt lakes and coastal saltworks in China. It is the best live food for shrimp and fish, therefore, it is used in aquaculture as the initial feed for larval rearing of marine fishes, prawns and crabs (Abatzopoulos et al., 2002). Artemia (brine shrimp) shows a diapause phase during its embryonic development stages under stress conditions, such as γ-irradiation, pollutant exposure, low temperature and high salinity. During diapause, the embryo is arrested at the late gastrula stage and the female produced encysted embryos (dormant cysts) (Jiang et al., 2007). The molecular mechanism of diapause remains unknown, making it a research focus of Abbreviations: As-PRMT1, protein arginine N-methyltransferase 1 from Artemia sinica; SAM BD, S-adenosylmethionine binding domain; PRMT5, protein arginine Nmethyltransferase 5; PCR, polymerase chain reaction. ⁎ Correspondence to: X. Zou, Department of Biology, Dalian Medical University, Dalian 116044, China. ⁎⁎ Correspondence to: L. Hou, College of Life Sciences, Liaoning Normal University, No. 1, Liushu South Street, Dalian 116081, China. E-mail addresses: [email protected] (X. Zou), [email protected] (L. Hou). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.gene.2015.04.004 0378-1119/© 2015 Elsevier B.V. All rights reserved.
developmental biologists. When the embryonic development of brine shrimp is arrested, metabolic activity is greatly controlled and resistance to severe physiological stress is sharply increased (Zhou et al., 2008). Nuclear DNA and histones (H1, H2A, H3 and H4) form nucleosomes in eukaryotic genomes. The nucleosome core usually comprises eight core group histone proteins (Scorilas et al., 2000), which are frequently subjected to methylation, acetylation, phosphorylation (Pahlich et al., 2006), ADP ribose base and ubiquitin and various post-translational modifications (Osanai et al., 2003). These histone modifications not only influence and change the state of chromatin, but also regulate gene expression (Kirmizis et al., 2007). Histone methylation modification is mainly catalyzed by methyltransferases, which add methyls to lysine and arginine residues of H3 and H4 core proteins. The site of arginine methylation occurs mainly in the N-terminal region (e.g., H3 — R2/ R17/R26 and H4 — R3); (Pahlich et al., 2006). These modified loci usually affect target gene promoter regions, thereby affecting gene expression. Therefore, histone methylation has become one of the hot topics in the study of epigenetics in recent years (Peterson and Laniel, 2004). Arginine methyltransferase belongs to the methyltransferase gene family (Zhang and Cheng, 2003). Protein arginine methyltransferases (PRMTs) transfer the methyl group from S-adenosylmethionine to the
X. Jiang et al. / Gene 565 (2015) 122–129
terminal guanidino nitrogens of arginine residues, generating monomethyl-arginine, symmetric dimethylarginine, and asymmetric dimethyl-arginine (Fig. 1) (Niewmierzycka and Clarke, 1999). The PRMTs comprise a family of nine enzymes (Pawlak et al., 2000) that have been classified as either type I (PRMT1-4, -6, and -8) or type II (PRMT5, -7, and -9) (Frankel et al., 2002; Huang and Li, 2004) according to whether they promote the formation of asymmetric-NG,NGdimethylarginines or symmetric-NG,N′G-dimethylarginines, respectively (Gros et al., 2003; Onozato et al., 2008). Although all PRMTs contain a highly conserved methyltransferase domain of approximately 310 amino acids, each PRMT has distinct protein substrate specificities. Beyond their “core” region, each PRMT has a unique N-terminal region that varies considerably in length (Rawal et al., 1994). Protein arginine N-methyltransferase 1 (PRMT1) is the predominant member of the PRMTs (Pawlak et al., 2000) and was the first to be isolated, cloned and purified (Frankel et al., 2002). The methylation types and the substrate characteristics indicate that PRMT1 modulates various cellular processes, including signal transduction, RNA processing, DNA repair, and protein–protein interaction (Cook et al., 2006). PRMT1 is a type I catalytic enzyme (Krause et al., 2007), and is a histone methyltransferase that methylates Arg3 on histone H4 (H4R3) (see Fig. 1) which usually plays a role of activation of gene transcription (Cook et al., 2006; Katsanis et al., 1997). For example, methylation of histone R3 and H4 by prmt5 work together with the nuclear receptor coactivator p160 subunit to promote transcription of the androgen receptor (AR) (Koh et al., 2001). Until now, PRMT1 has only been studied in depth in higher vertebrates, especially in the area of the health, disease and inheritance (Cheng et al., 2004). However, the functions of PRMT1 in invertebrates remain unknown. To date, there have been few reports concerning the PRMT1 gene in invertebrates, with the exception of nematodes and a few arthropods. Thus, in the present study, we cloned the PRMT1 from A. sinica (As-PRMT1). We analyzed its expression pattern, cellular
123
location and potential roles during different embryonic development stages of A. sinica, and in response to high salinity and low temperature stress. 2. Materials and methods 2.1. Animal preparation Artemia sinica cysts were collected from the salt lake of Yuncheng in Shanxi Province, China. These cysts were hatched in filtered fresh seawater and 28‰ salinity treatment conditions in the laboratory, according to a previously described method (Zheng et al., 2011). The cysts were incubated for 30 min (designated 0 h) to acclimatize them to the laboratory conditions. Animal samples (about 50 mg) were collected at different times (5, 10, 15, 20 and 40 h, and 3, 5, and 7 days) for subsequent experiments. In the low-temperature assay, nauplius stage brine shrimps (20 h) cultured at 30 °C for 48 h were used as the control group, and nauplius stage Artemia (20 h) in the experimental group were maintained at 25 °C, 20 °C, 15 °C, 10 °C or 5 °C. In the salinitychallenge assay, specimens of A. sinica were reared for 20 h to the nauplius stage in 28‰ salinity seawater and then treated with a series of increasing concentrations of seawater (50‰, 100‰, 150‰, and 200‰ salinity) and put into separate vessels for subsequent experiments. The different salinities were produced by adding crude salt into natural seawater and then measuring the salinity using a salinometer. 2.2. Cloning of full-length As-PRMT1 cDNA Total RNAs were extracted from A. sinica cysts (0 h) using the Trizol Reagent (Tiangen, China), following the manufacturer's protocol. The RNA was then reverse transcribed into cDNA using an oligo(dT) primer and MLV reverse transcriptase, also following the manufacturer's protocol. The forward (prmt-1F, Table 1) and the reverse (prmt-1 R, Table 1)
Fig. 1. Catalytic process and classification of PRMTS. Under the action of PRMT, arginine can be methylated into monomethyl-Arg with the methyl provider S-adenosylmethionine (SAM), followed by a second methylation, generating asymmetric dimethyl-Arg or symmetric demethyl-Arg.
124
X. Jiang et al. / Gene 565 (2015) 122–129
2.4. Expression analysis of As-prmt-1 by real-time qPCR
Table 1 Oligonucleotide primers used in the study. Primer
Sequence (5′-3′)
Direction
PRMT1 F PRMT1 R 3′In-PRMT1 3′Ou-PRMT1 Probe-F Probe-R RT-prmt-1F RT-prmt-1R β-Actin F β-Actin R
TTGGCTGTGGAACTGGTA TGTCACGGGCATAAAGAA GTGTAAAGCCTGGGGTGCCT TTGGACACTGTTCTTTATGCC TTGGCTGTGGAACTGGTA TGTCACGGGCATAAAGAA GAAGAGGTTGAACTCCCAGAT AGCCATTTGTCACGGGCATAA AGCGGTTGCCATTTATTGTT GGTCGTGACTTGACGGACTATAT
Forward Reverse Forward Reverse Forward Reverse forward Reverse Forward Reverse
primers were designed using primer Premier 5.0, based on an Artemia franciscana prmt-1 expressed sequence tag (EST), and synthesized by Takara (Dalian, China). The primers were used for PCR as follows: initial denaturation at 94 °C for 5 min; followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and elongation at 72 °C for 1 min; with a final extension at 72 °C for 10 min. The PCR products were separated on 1.0% agarose/TAE gels and sequenced by Takara (Dalian, China). Thus, an expressed EST sequence of the As-prmt-1 was obtained. The full-length sequence of the As-prmt-1 was obtained using the rapid amplification of cDNA ends (RACE) method, based on the relevant sequence of GenBank gene Library from A. franciscana. The 3′ RACE was carried out with the 3′-Full RACE core set ver. 2.0 (Takara) and the 5′ RACE was carried out with the SMART RACE cDNA Amplification Kit following the manufacturer's instructions. An inner primer (3′In-prmt-1, Table 1) and outer primer (3′ Ou-prmt-1, Table 1) were designed from the A. sinica EST for 3′ RACE, and gene-specific primers (GSP, Table 1) were designed based on the EST for 5′ RACE, to amplify the 3′ end and 5′ end of the gene. The RACE-PCR products were purified from the gel and then cloned into the pMD-19T vector for sequencing. The 3′ and 5′ fragments were spliced together using DNAMAN 6.0.3.48 (Lynnon Biosoft) to obtain the full-length cDNA of As-prmt-1. The nucleotide sequence was submitted to GenBank with the accession number KJ708554.
2.4.1. Expression of As-PRMT1 during different developmental stages The total RNA was prepared from whole Artemia harvested from different embryo development periods (0, 5, 10, 15, 20, 40 h, 3 days, 5 days and 7 days) and used as a template for cDNA by the same protocol mentioned above. Two PCR primer sets specific for As-prmt-1 and β-actin were used to amplify cDNA products. The sense primer of As-prmt-1 was named RT-prmt-1F (Table 1), and antisense primer was RT-prmt1 R (Table 1), β-actin sense primer was named β-actin F (Table 1), and antisense primer was β-actin R (Table 1). Real-time qPCR was performed in triplicate for each sample using the SYBR Premix Ex Taq (TaKaRa, Dalian, China) and TaKaRa detection system TaKaRa TP800 (Dalian, China). Reaction conditions were 95 °C for 30 s, followed by 40 cycles each of 95 °C for 5 s, 58 °C for 30 s, and 95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s. The β-actin gene was used as a normalization control for each starting quantity of RNAs (Li et al., 2012). Gene expression data were analyzed with Thermal Cycler Dice Real Time system software (TaKaRa, Dalian, China), and quantified using the comparative CT method (2−ΔΔCt method) based on Ct values for both As-prmt-1 and β-actin to calculate the fold increase (Schmittgen and Livak, 2008). 2.4.2. Salinity and temperature stress assays The total RNA were collected from A. sinica, which were hatched in 28‰ salinity seawater for 20 h and treated with a series of concentrations of seawater (50‰, 100‰, 150‰, and 200‰ salinity) in separate vessels for 24 h. The salinity of the seawater was adjusted by adding crude salt to natural seawater and measuring with a salinometer. The two pairs of real-time qPCR primers (mentioned above) were used for the real-time quantitative PCR to check the relative expression value. The reaction conditions were the same as those mentioned above. The total RNA was extracted from the nauplius stage brine shrimp (20 h) which was cultured at 30 °C for 48 h, and nauplius stage Artemia (20 h) which were maintained at 25 °C, 20 °C, 15 °C, 10 °C or 5 °C, respectively. The two pairs of real-time qPCR primers (mentioned above) were used for the real-time quantitative PCR to check the relative expression value. The reaction conditions were the same as those mentioned above.
2.3. Bioinformatic analysis of As-PRMT1
2.5. Preparation of paraffin sections and in situ hybridization
The cloned nucleotide sequence was analyzed for identity and similarity using the National Center for Biotechnology Information (NCBI) online Search Tool (BLASTX) (http://www.ncbi.nlm.nih.gov/) and ORF of As-prmt-1 was found using the ORFfinder program at NCBI (http:// www.ncbi.nlm.nih.gov/gorf/orfig.cgi). The As-PRMT1-1 protein structure and functional domains were predicted using the prosite tools of ExPASy (http://prosite.expasy.org/prosite.html/) and SMART (http:// smart.embl-heidelberg.de/), respectively. The molecular weight and theoretical isoelectric point of the protein were predicted using the ProtParam tool of ExPASy (http://web.expasy.org/protparam/). The protein subcellular localization was predicted using the PSORT server (http://psort.hgc.jp/) and the iPSORT service (http://ipsort.hgc.jp/). SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/) was used for signal peptide prediction. To detect transmembrane helices, hydrophobicity and hydrophilicity, the Tmpred program (http://www.ch.embnet. org/software/TMPRED_form.html/) and the TMHMM Server 2.0 (http:// www.cbs.dtu.dk/services/TMHMM-2.0/) were used. Subsequently, multiple sequence alignments were performed of amino acid sequences of As-PRMT-1 and PRMT-1 sequences from different species using the ClustalX1.8 program and DNAMAN. Finally, MEGA4.1 software and clustalx1.8 were used to generate the phylogenetic tree of the PRMT-1 proteins from different species by the neighbor-joining (NJ) method. The statistical significance of groups within phylogenetic trees was evaluated using the bootstrap method, with 1000 replications.
The cDNA template for the probe, obtained by PCR (forward 5′-TGCG GACGAAACAGGAAG-3′, reverse 5′-GCTCAAACAGTGATGCCAGT-3′) and agarose gel electrophoresis was cloned into a pGM-T vector to add the T7 and SP6 polymerase binding sites to the gene. A DIG-labeled RNA probe was synthesized using a DIG RNA labeling kit (SP6/T7, Roche). The 0, 5 and 10 h samples were exuviated using 50% NaClO, and all samples were fully rinsed to remove surface salinity using phosphatebuffered saline (PBS) treated with diethylpyrocarbonate (DEPC). The samples were fixed in fresh 4% paraformaldehyde solution at 4 °C for 6–8 h. The samples were then cut into 10 μm-thick sections using a Radial Microtomes. Prehybridization of each sample was then performed at 37 °C for 2 h. The prehybridization buffer contained 1 × Denhardt's solution, 0.5 mg/ml of salmon sperm DNA, 50% deionized formamide (v/v), and 20× SSC. Hybridization was performed at 52 °C for 12–16 h by adding 10% dextran sulfate and 1 mg/ml DIG-labeled As-PRMT1 probe to the pre-hybridization buffer. Finally, the hybridization signal was detected using a DIG Nucleic Acid Detection Kit (Roche). 2.6. Statistical analyses The data obtained from real-time qPCR analysis were analyzed by least square difference (LSD) and significance was set at P b 0.05, as assessed by t-test using SPSS 16.0 software.
X. Jiang et al. / Gene 565 (2015) 122–129
3. Results 3.1. Gene cloning and bioinformatic analysis of As-prmt-1 3′ and 5′ RACE technology was used to obtain a 1201-bp full-length cDNA of As-prmt-1 (GenBank accession: KJ708554), which contained a 1041 bp ORF (Fig. 2A), and 50-bp 5′- and 117-bp 3′-UTRs. As determined by prosite tools of ExPASy, the putative As-PRMT1 protein contains 346 amino acids, has a calculated molecular mass of 29 kDa and a pI of 5.42. A prmt superfamily domain was identified (Fig. 2B) using SMART analysis by the TMHMM Server 2.0, which also showed that As-PRMT1 has no transmembrane helices. The two transmembrane regions indicated that As-PRMT1 is an integral membrane protein. Protein sequence analysis and functional domain analysis showed a highly conserved S-adenosylmethionine binding domain (SAM BD) belonging to the protein-arginine methyltransferases superfamily. The protein also contains a PRMT5 domain which is characteristic of PRMT proteins and comprises the catalytic histone methylation domain (Smith et al., 1999). Prediction of the protein subcellular localization revealed that the As-PRMT1 protein is 39.1% likely to be located in endoplasmic reticulum, 60.9% cytoplasmic, 21.7% cytoskeletal, 8.7% in nuclear, and 4.3% respectively in the vacuolar and extracellular. Multiple protein sequence alignment analysis of As-PRMT-1 revealed conserved amino-acid homologous sequences between the proteins of different species, especially in the SAM BD and PRMT5 regions at the C-terminus (Fig. 3). As-PRMT-1 was found to share 35%–41% similarity to vertebrate sequences, 50%–55% similarity to invertebrates, and 60% similarity with Caligus rogercresseyi. This shows that AsPRMT1 was the most similar to arthropod PRMT1 sequences. To evaluate the evolutionary relationship of As-PRMT1 homologous sequences, we constructed a phylogenetic tree using Mega 4.1. Protein sequences from 23 species were used to produce an unrooted phylogenetic tree using the neighbor-joining method. The resulting phylogenetic tree
125
(Fig. 4) showed three main clusters: vertebrates, arthropods and nematodes, with As-PRMT1 clustered within the arthropods. Thus, the relationships displayed in the phylogenetic tree corresponded to their classification position. 3.2. Expression analysis of As-PRMT1 by real-time qPCR Real-time qPCR analysis was used to detect the transcript levels of As-PRMT1 during different stages of A. sinica development, from the gastrula to the sub-adult stage (Fig. 5). The expression level of As-PRMT1 increased notably during the developmental stages from 0 h to 40 h; thereafter, the expression level decreased significantly before stabilizing during the stages from 3 days to 5 days. The expression was highest at 40 h. Thus, As-PRMT1 expression was upregulated during early development and downregulated at the sub-adult stage. To determine the response of As-PRMT1 to temperature and salinity stress, real-time qPCR was employed. At the temperature stress assay, upregulation of expression from 5 °C to 30 °C was observed (Fig. 6). Salinity stress resulted in significant differences between the control and salinity-treated specimens at salinity concentrations ranging from 50‰ to 200‰. The lowest expression quantity of As-PRMT1 mRNA occurred at 50‰ salinity and the expression rose sharply with increasing salinity (Fig. 7). 3.3. Location of As-PRMT1 mRNA in A. sinica In situ hybridization was performed to determine the spatial expression patterns of As-PRMT1 in the eight developmental stages of A. sinica (Fig. 5). As-PRMT1 mRNA was observed throughout the embryo at stages 0 h, 5 h and 10 h (Fig. 5A, B and C) and gradually extended from the head to the tail in the umbrella stage at 15 h (Fig. 5D). During the developmental stage marked from 20 to 40 h, As-PRMT1 expression could be seen in the entire body of the larva after the nauplius larva
Fig. 2. (A) Sequence analysis of the cDNA and predicted peptide sequences of As-PRMT1. The numbering of the nucleotide and amino acid sequences is shown to the left and right. The start codon is indicated in purple; the stop codon is indicated in yellow; the blue letters represent the prmt superfamily domain; the gray area represents the prmt5 domain; the polyadenylation site (AATAAA) is indicated in red. (B) Domain analysis result of putative As-PRMT1 protein. The mature protein includes a PRMT1 domain in the C-terminus, and a prmt5 domain.
126
X. Jiang et al. / Gene 565 (2015) 122–129
Fig. 3. Protein sequence alignment of As-PRMT1 and 22-PRMT1 sequences of other species from GenBank. The sequences and their accession numbers are as follows: MdPRMT1, Musca domestica, XP_005175755; HaPRMT1, Harpegnathos saltator, EFN79080; PhPRMT1, Pediculus humanus corporis, XP_002425905; AaPRMT1, Aedes aegypti, XP_001656487; HsPRMT1, Homo sapiens, AF2226893; DmPRMT1, Drosophila melanogaster, NP_650017; DpPRMT1, Daphnia pulex, EFX63145; CgPRMT1, Crassostrea gigas, EKC18189; BmPRMT1, Bombyx mori, XP_004924094; OgPRMT1, Otolemur garnettii, XP_0038015250; XlPRMT1, Xenopus laevis, AAI06276; OdPRMT1, Odobenus rosmarus divergens, XP_004409949; DrPRMT1, Danio rerio, NP_956944; HvPRMT1, Hydra vulgaris, XP_002157035; SkPRMT1, Saccoglossus kowalevskii, NP_001171787; OnPRMT1, Oreochromis niloticus, XP_003456914; HcPRMT1, Haemonchus contortus, CDJ81919; BtPRMT1, Bos Taurus, NP_001015624; MmPRMT1, Mus musculus, EDL22778; AcPRMT1, Ancylostoma ceylanicum, EYC20939; CtPRMT1, Capitella teleta, ELU01488; and ApPRMT1, Acyrthosiphon pisum, NP_001156225.
hatched from the zona pellucida (Fig. 5D, E). At 3 days, As-PRMT1 expression across the entire body decreased, especially in the abdominal and cephalothorax region of the polypide (Fig. 5F). At days 5 and 7, As-PRMT1 mRNA was also detected in all parts, with internal tissue and external appendages developed, but at lower levels than at earlier time points (Fig. 5G, H). Under the same conditions, controlled trials were performed with the antisense probe, and no positive signal above background was detected (Fig. 5A1, B1, C1, D1, E1, F1, G1, H1). Our studies also showed that As-PRMT1 mRNA was expressed in almost all parts of A. sinica during different developmental stages (Fig. 8).
4. Discussion In this study, a full-length cDNA sequence of PRMT1 from A. sinica was obtained for the first time. As-prmtl is a small gene, with a 1208 bp full-length cDNA, which contains a 1041 bp ORF encoding a protein of 346 amino acids. As-PRMT1 lacks any known signal peptide sequences and transmembrane regions. However, As-PRMT1 contains a highly conservative SAM BD, belonging to the protein-arginine methyltransferases superfamily (Katsanis et al., 1997; Niewmierzycka and Clarke, 1999), and a PRMT5 domain, which is characteristic of PRMT
X. Jiang et al. / Gene 565 (2015) 122–129
127
Fig. 6. Quantitative real-time qPCR analysis of As-PRMT1 expression in response to low temperatures assay. The control group (red) was cultured at 30 °C. Each group was incubated at the indicated temperature for 24 h. Data are the mean ± SD of triplicate experiments. * Indicates a significant difference compared with the control (P b 0.05), while ** indicates a very significant difference compared with the control (P b 0.01).
Fig. 4. A phylogenetic tree of aligned amino acid sequences of As-PRMT1 and 22 PRMT1 proteins from other species. A neighbor-joining phylogenetic tree was constructed on the basis of the sequences from A. sinica and from GenBank, utilizing the sequence analysis tool MEGA 4.1. The sequences and their accession numbers of PRMT1 are the same as those in the legend to Fig. 2. A red rhombus (●) indicates As-PRMT1 from A. sinica.
relatively lower expression in adults. The site of histone arginine methylation plays an important role in gene transcription regulation, and can affect a variety of physiological process, such as cellular, enclosed DNA repair, signal transduction, cell growth and cancer (Zou et al., 2012).
proteins and contains the catalytic histone methylation region (Strahl et al., 2001). In situ hybridization results showed that the PRMT1 gene was transcribed in different tissues and PRMT1 mRNA was expressed in almost all parts of A. sinica during different developmental stages, with a
Fig. 5. Quantitative real-time qPCR analysis of As-PRMT1 expression during different developmental stages of A. sinica. The expression level at 0 h stage was set as the control level. The x-axis represents different development stages (0 h to 7 days). The y-axis represents the expression level of As-PRMT1 relative to that at 0 h. Data are means ± SD of triplicate experiments. * Indicates a significant difference compared with the control (P b 0.05), while ** indicates a very significant difference compared with the control (P b 0.01).
Fig. 7. Quantitative real-time qPCR analysis of As-cav-1 expression in the salinity challenge assay. The control group (red) was incubated in saline water at 28‰ salinity. Each group was incubated at the indicated salinity for 24 h. Data are the means ± SD of triplicate experiments. * Indicates a significant difference compared with the control (P b 0.05), while ** indicates a very significant difference compared with the control (P b 0.01).
128
X. Jiang et al. / Gene 565 (2015) 122–129
Fig. 8. In situ hybridization analysis of As-sdh expression during different developmental stages in A. sinica. A–H: experimental group; A1–H1: control group. A: gastrula stage (0 h); B, C: embryonic stage (5 and 10 h); D, E, F: nauplius stage (15, 20, and 40 h); G, H: metanauplius stage (3 and 5 day). Arrows indicate regions with positive hybridization signals.
Therefore, we concluded that As-PRMT1 has a ubiquitous and vital function during the development of A. sinica. The development of A. sinica consists of four main stages: the embryo, nauplius, metanauplius larva and the adult stage. In this experiment, 0–10 h corresponded to the embryo stage; 15–20 h corresponded to the nauplius stage; 40 h corresponded to the metanauplius larva stage; and 3 and 5 days corresponded to the pseudoadult stage (Gui et al., 2013). Real-time qPCR of embryos from different developmental stages showed that the level of As-prmtl transcripts remained stable during the developmental stages from 0 to 15 h and were upregulated from 20 to 40 h. They increased consistently until reaching a peak at the 40 h stage. By contrast, from days 3 to 5, the amount of As-prmtl transcripts began to decrease and expression remained at a low level, which implied that As-PRMT1 plays a prominent role during the nauplius stage. Early development is the most active stage for cell division and differentiation. It is also the stage during which large-scale transcription of zygotic genes is initiated. The expression of genes related to the development of quantity began to rise. In the key period of development, protein arginine N-methyltransferase 1 (PRMT1) is an important epigenetic regulation factor in eukaryotic genomes, mainly being involved in histone arginine loci methylation modification, which changes eukaryotic genomes' chromatin structure to regulate the expression of genes (Li et al., 2012). Therefore, we
speculated that As-PRMT1 was an indispensable gene in the early development of A. sinica. When conditions are suitable for survival, the embryo resumes development in adequate water, temperature and molecular oxygen conditions after 0 h. In a relatively stable developmental environment, the amount of As-PRMT1 transcripts remained stable between 0 h to 15 h. However, after 20 h, the nauplius larva had hatched from the zona pellucida and the larvae were free to swim instead of being enclosed, and the gut, the appendages and arthromere commence differentiation. The expression level of As-PRMT1 increased to regulate the expression of certain genes that protect individuals from stresses. In conclusion, histone methylation modification is a key epigenetic regulation mechanism that plays critical roles in early embryo developmental programs. Artemia live in hypersaline waters, so changes in salinity and temperature are the important environment factors for this invertebrate. The high salinity and low temperature routinely encountered by A. sinica were replicated in these experiments to study the expression of As-PRMT1 during stress. The expression of As-PRMT1 was highly upregulated with increasing salinity and decreasing temperature, indicating that a stress-activated response involving As-PRMT1 induction is invoked when Artemia is exposed to a suboptimal environment. These findings are consistent with previous data showing that PRMT1 is a ubiquitous enzyme induced by cellular stress.
X. Jiang et al. / Gene 565 (2015) 122–129
Genetic information encoded in DNA is largely identical in every cell of a eukaryote; however, cells in different tissues and organs can have widely different gene expression patterns and can exhibit specialized functions. Gene expression patterns in different cell types need to be appropriately induced and maintained, and also need to respond to developmental and environmental changes (Herrmann et al., 2005). However, whether gene expression is mainly controlled by the related enzymes in general (Ostareck-Lederer et al., 2006), remains to be determined. The results presented here showed that the expression level of protein arginine methyltransferase 1 altered in response to changes in the environment. Methyltransferase 1 plays a key role in the expression of certain resistance genes, which help A. sinica adapt to unfavorable environments of high salt and low temperature. Conflict of interest We declare that we have no conflict of interest. Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (31272644). We thank anonymous referees for their valuable comments on an earlier version of the manuscript. References Abatzopoulos, T., Beardmore, J., Clegg, J., Sorgeloos, P., 2002. Artemia: Basic and Applied Biology. Kluwer Academic. Cheng, D., Yadav, N., King, R.W., Swanson, M.S., Weinstein, E.J., Bedford, M.T., 2004. Small molecule regulators of protein arginine methyltransferases. J. Biol. Chem. 279, 23892–23899. Cook, J.R., Lee, J.-H., Yang, Z.-H., Krause, C.D., Herth, N., Hoffmann, R., Pestka, S., 2006. FBXO11/PRMT9, a new protein arginine methyltransferase, symmetrically dimethylates arginine residues. Biochem. Biophys. Res. Commun. 342, 472–481. Frankel, A., Yadav, N., Lee, J., Branscombe, T.L., Clarke, S., Bedford, M.T., 2002. The novel human protein arginine N-methyltransferase PRMT6 is a nuclear enzyme displaying unique substrate specificity. J. Biol. Chem. 277, 3537–3543. Gros, L., Delaporte, C., Frey, S., Decesse, J., de Saint-Vincent, B.R., Cavarec, L., Dubart, A., Gudkov, A.V., Jacquemin-Sablon, A., 2003. Identification of new drug sensitivity genes using genetic suppressor elements protein arginine N-methyltransferase mediates cell sensitivity to DNA-damaging agents. Cancer Res. 63, 164–171. Gui, S., Wooderchak-Donahue, W.L., Zang, T., Chen, D., Daly, M.P., Zhou, Z.S., Hevel, J.M., 2013. Substrate-induced control of product formation by protein arginine methyltransferase 1. Biochemistry 52, 199–209. Herrmann, F., Lee, J., Bedford, M.T., Fackelmayer, F.O., 2005. Dynamics of human protein arginine methyltransferase 1 (PRMT1) in vivo. J. Biol. Chem. 280, 38005–38010. Huang, C.M., Li, C., 2004. Identification and phylogenetic analyses of the protein arginine methyltransferase gene family in fish and ascidians. Gene 340, 179–187. Jiang, L., Hou, L., Zou, X., Zhang, R., Wang, J., Sun, W., Zhao, X., An, J., 2007. Cloning and expression analysis of p26 gene in Artemia sinica. Acta Biochim. Biophys. Sin. 39, 351–358. Katsanis, N., Yaspo, M.-L., Fisher, E.M., 1997. Identification and mapping of a novel human gene, HRMT1L1, homologous to the rat protein arginine N-methyltransferase 1 (PRMT1) gene. Mamm. Genome 8, 526–529.
129
Kirmizis, A., Santos-Rosa, H., Penkett, C.J., Singer, M.A., Vermeulen, M., Mann, M., Bähler, J., Green, R.D., Kouzarides, T., 2007. Arginine methylation at histone H3R2 controls deposition of H3K4 trimethylation. Nature 449, 928–932. Koh, S.S., Chen, D., Lee, Y.H., Stallcup, M.R., 2001. Synergistic enhancement of nuclear receptor function by p160 coactivators and two coactivators with protein methyltransferase activities. J. Biol. Chem. 276, 1089–1098.Regulation of Estrogen Rapid Signaling through Arginine Methylation by PRMT1. Mol. Cell 31, 212–221. Krause, C.D., Yang, Z.-H., Kim, Y.-S., Lee, J.-H., Cook, J.R., Pestka, S., 2007. Protein arginine methyltransferases: evolution and assessment of their pharmacological and therapeutic potential. Pharmacol. Ther. 113, 50–87. Li, Q., Zhang, Q., Han, L., Yuan, Z., Tan, J., Du, B., Zou, X., Hou, L., 2012. Molecular characterization and expression of As-nurp1 gene from Artemia sinica during development and in response to salinity and temperature stress. Biol. Bull. 222, 182–191. Niewmierzycka, A., Clarke, S., 1999. S-adenosylmethionine-dependent methylation in Saccharomyces cerevisiae. J. Biol. Chem. 274, 814–824. Onozato, M.L., Tojo, A., Leiper, J., Fujita, T., Palm, F., Wilcox, C.S., 2008. Expression of NG, NGdimethylarginine dimethylaminohydrolase and protein arginine N-methyltransferase isoforms in diabetic rat kidney effects of angiotensin II receptor blockers. Diabetes 57, 172–180. Osanai, T., Saitoh, M., Sasaki, S., Tomita, H., Matsunaga, T., Okumura, K., 2003. Effect of shear stress on asymmetric dimethylarginine release from vascular endothelial cells. Hypertension 42, 985–990. Ostareck-Lederer, A., Ostareck, D.H., Rucknagel, K.P., Schierhorn, A., Moritz, B., Huttelmaier, S., Flach, N., Handoko, L., Wahle, E., 2006. Asymmetric arginine dimethylation of heterogeneous nuclear ribonucleoprotein K by protein-arginine methyltransferase 1 inhibits its interaction with c-Src. J. Biol. Chem. 281, 11115–11125. Pahlich, S., Zakaryan, R.P., Gehring, H., 2006. Protein arginine methylation: cellular functions and methods of analysis. Biochim. Biophys. Acta, Proteins Proteomics 1764, 1890–1903. Pawlak, M.R., Scherer, C.A., Chen, J., Roshon, M.J., Ruley, H.E., 2000. Arginine Nmethyltransferase 1 is required for early postimplantation mouse development, but cells deficient in the enzyme are viable. Mol. Cell. Biol. 20, 4859–4869. Peterson, C.L., Laniel, M.-A., 2004. Histones and histone modifications. Curr. Biol. 14, R546–R551. Rawal, N., Rajpurohit, R., Paik, W.K., Kim, S., 1994. Purification and characterization of Sadenosylmethionine-protein-arginine N-methyltransferase from rat liver. Biochem. J. 300, 483–489. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108. Scorilas, A., Black, M.H., Talieri, M., Diamandis, E.P., 2000. Genomic organization, physical mapping, and expression analysis of the human protein arginine methyltransferase 1 gene. Biochem. Biophys. Res. Commun. 278, 349–359. Smith, J.J., Rücknagel, K.P., Schierhorn, A., Tang, J., Nemeth, A., Linder, M., Herschman, H.R., Wahle, E., 1999. Unusual sites of arginine methylation in poly (A)-binding protein II and in vitro methylation by protein arginine methyltransferases PRMT1 and PRMT3. J. Biol. Chem. 274, 13229–13234. Strahl, B.D., Briggs, S.D., Brame, C.J., Caldwell, J.A., Koh, S.S., Ma, H., Cook, R.G., Shabanowitz, J., Hunt, D.F., Stallcup, M.R., Allis, C.D., 2001. Methylation of histone H4 at arginine 3 occurs in vivo and is mediated by the nuclear receptor coactivator PRMT1. Curr. Biol. 11, 996–1000. Zhang, X., Cheng, X., 2003. Structure of the predominant protein arginine methyltransferase PRMT1 and analysis of its binding to substrate peptides. Structure 11, 509–520. Zheng, L.P., Hou, L., Chang, A.K., Yu, M., Ma, J., Li, X., Zou, X.-Y., 2011. Expression pattern of a Gram-negative bacteria-binding protein in early embryonic development of Artemia sinica and after bacterial challenge. Dev. Comp. Immunol. 35, 35–43. Zhou, Q., Wu, C., Dong, B., Liu, F., Xiang, J., 2008. The encysted dormant embryo proteome of Artemia sinica. Mar. Biotechnol. 10, 438–446. Zou, L., Zhang, H., Du, C., Liu, X., Zhu, S., Zhang, W., Li, Z., Gao, C., Zhao, X., Mei, M., 2012. Correlation of SRSF1 and PRMT1 expression with clinical status of pediatric acute lymphoblastic leukemia. J. Hematol. Oncol. 5, 42–44.