Molecular cloning, characterization and expression modulation of four ferritins in black carp Mylopharyngodon piceus in response to Aeromonas hydrophila challenge

Aquaculture Reports 16 (2020) 100238

Contents lists available at ScienceDirect

Aquaculture Reports journal homepage: www.elsevier.com/locate/aqrep

Molecular cloning, characterization and expression modulation of four ferritins in black carp Mylopharyngodon piceus in response to Aeromonas hydrophila challenge

T

Shujian Chena,b, Chenglong Wua,*, Yuanyuan Xiea, Yuancai Wua, Shurong Daia, Xiaowen Wanga, Ronghua Lib, Jinyun Yea a b

School of Life Science, Huzhou University, 759 East 2nd Road, Huzhou 313000, PR China Key Laboratory of Applied Marine Biotechnology of Education, Ningbo University, Ningbo 315211, PR China

A R T I C LE I N FO

A B S T R A C T

Keywords: Ferritin Mylopharyngodon piceus Aeromonas hydrophila mRNA expression Immune regulation

As ubiquitous and conserved proteins, ferritin (FT) plays important roles in immune system and iron storage system. Four cDNAs encoding ferritin (MpFT) were cloned from black carp Mylopharyngodon piceus using homology cloning and rapid amplification of cDNA ends techniques. There were 177, 177, 176 and 173 amino acids in the MpFT-H1α, MpFT-H1β, MpFT-M and MpFT-L, respectively. BLAST analysis reveals that MpFTs shares high identities with other known FTs from zebrafish, Rainbow trout and Human, etc. A typical ironresponsive element (IRE) was predicted in the 5’-untranslated region (UTR) of MpFT-H1α and MpFT-M, respectively. The relative expression levels of MpFT1a were higher in the blood, liver and heart of black carp according to RT-PCR assays (P < 0.05). Higher expression levels of MpFT1b were shown in the liver and heart of black carp (P < 0.05). Relative higher transcriptional levels of MpFTL could be observed in the liver, blood and brain (P < 0.05). And higher expression levels of MpFTM were shown in the liver and intestine compared with these of in the muscle of black carp according to RT-PCR assays (P < 0.05). And the expression variations of FT-M and FT-L were more sensitive than these of FT-H1a and FT-H1b in the blood of black carp post infection. Similarly, the mRNA expression profiles of four FTs could also be differently upregulated and reached to the peak expression levels at 12h, 12h, 6h and 48h after Aeromonas hydrophila infection in the liver of black carp. In the intestine, all the transcription variations of four FTs were reached to highest levels at 24 h post infection in this study. As a whole, these results indicated that four MpFTs might play important roles in innate immune defense during A. hydrophila infection in this study.

1. Introduction As ubiquitous and highly conserved proteins, ferritin (FT) are present in all cells from vertebrates and invertebrates (Durand et al., 2004; Gammella et al., 2017; Harrison and Arosio, 1996). Generally, FTs play important roles during the iron metabolism and homeostasis (Aisen and Listowsky, 1980; Harrison and Arosio, 1996; Ponka et al., 1998; Richardson and Ponka, 1997). FTs can act as the major non-heme iron storage proteins and regulate iron metabolic balance and detoxification of iron overload since their ferroxidase activities (Torti and Torti, 2002). As acute phase reaction proteins, FTs have vital immune regulatory functions when pathogens invaded organisms (Neves et al., 2009a; Torti and Torti, 2002). And FTs could be resistant to bacteria (Kong et al., 2010a) and protect cells alleviating oxidative stress

⁎

(Epsztejn et al., 1999; Rocha and Smith, 2004; Wu et al., 2010). It is well-known that FT is composed of 24 subunits, which could form a hollow shell and mineralize about 4500 iron atoms in the cavity (Alkhateeb and Connor, 2010; Harrison and Arosio, 1996). Previous studies have found that FT is included heavy (H), light (L) and middle (M) subunits encoded by three different genes in animals (Andersen et al., 1995b; Oh et al., 2016; Sun et al., 2016; Zheng et al., 2010b). FTH could convert ferrous ions (Fe2+) into ferric ions (Fe3+) for its ferroxidase center, while FTL could facilitate iron nucleation through containing a site with a mineral core (Bai et al., 2015; Lawson et al., 1991; Levi et al., 1994). FTM contain ferroxidase center and micelle nucleation site ligands (Andersen et al., 1995b; Ding et al., 2017a; Sun et al., 2016; Zheng et al., 2010b). Previous results have demonstrated that FT could be regulated at both transcriptional and post translational levels

Corresponding authors. E-mail addresses: [email protected] (C. Wu), [email protected] (J. Ye).

https://doi.org/10.1016/j.aqrep.2019.100238 Received 9 April 2019; Received in revised form 9 October 2019; Accepted 15 October 2019 2352-5134/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Aquaculture Reports 16 (2020) 100238

S. Chen, et al.

Table 1 Nucleotide sequences of the primers used in this work. Primer

Sequence (5'–3')

Sequence information

Oligo(dT)-adaptor AAP UPM NUP M13-48 (forward) M13-47 (reverse) MpFerH1a

GGCCACGCGTCGACTAGTACT25 GGCCACGCGTCGACTAGTAC AAGCAGTGGTATCAACGCAGAGTACGCGGGG AAGCAGTGGTATCAACGCAGAGT GAGCGGATAACAATTTCACACAGG CGCCAGGGTTTTCCCAGTCACGAC GAMCATCTYTRCGAATAACACC AGCTGCTCTCYTTGCCRAGCGTG TGTATGCGTCCTACGTCTACCTTTCTATG GTTGGTCACCCAGTCGCCCAGTTCTT GAGCTGTATGCGTCCTACGTCTACC CTCTTCGTGGGACTGATGGTGG GGTGAGRCAGARCTTCCAYCAGGA GTCTAAGAGCTTTCYTTKCCCAG CATCAACAGACAGATTTACCTGGAGC GAGTTGCCACCTTGTGAAGTTCCAGTA GCAGAACCAAAGAGGAGGACG TCCAGAGCCAGAGCACATTCC ACTCACAGCTTCWGGAMGATCWGRA GGTGTGCTTGTCAAACARGTACTCYG GGAGCTTTACGCTGGCTACACTTACAC TAGCAACCAGCCCATTGTCCCACTCAT CGCTGGCTACACTTACACTTCCA CGCTCCTCCTCGCTGTTCTT GAGGCRAACATCAAYAARCTGATC AGATCTGAGYGGATSAGAGWGTGTG GCCCAGTCGTGATGATTGGAAAGGAGGT GATGAGGCGACTCAGACTGCCAACATAG CACCCAAATAATGAGGCAAACA AGAGCCACATCGTCCCTGTC TATCTTGTTCTCGCACCCAC CATCTTCACGTCCCGTTTCT

3' RACE primer 5' RACE primer 5' RACE primer Vector primer Vector primer RT primer RT primer 3' RACE primer 5' RACE primer Real-time PCR primer Real-time PCR primer RT primer RT primer 3' RACE primer 5' RACE primer Real-time PCR primer Real-time PCR primer RT primer RT primer 3' RACE primer 5' RACE primer Real-time PCR primer Real-time PCR primer RT primer RT primer 3' RACE primer 5' RACE primer Real-time PCR primer Real-time PCR primer Real-time PCR primer Real-time PCR primer

MpFerH1b

MpFerM

MpFerL

β-actin

01F 01R 02F 02R 03F 03R 01F 01R 02F 02R 03F 03R 01F 01R 02F 02R 03F 03R 01F 01R 02F 02R 03F 03R 01F 01R

A,G＝R; A,C＝M; A,T＝W; C,G = S; C,T＝Y; G,T＝K; A,T,C＝H; G,T,C＝B; G,A,T = D; A,C,G = V.

could provide insight into the physiological role of FT in black carp.

(Alkhateeb and Connor, 2010; Chen et al., 2016; Ding et al., 2017a; Harrison and Arosio, 1996; Wu et al., 2010). And the expression levels of FT could be regulated by many inner or environmental factors, including dietary iron overload (Wu et al., 2010), waterborne heavy metals (De Zoysa and Lee, 2007; Li et al., 2008; Liu et al., 2017; Zhang et al., 2013), iron ion injection (Ren et al., 2014; Sun et al., 2014a, c), oxidative stress (Cairo et al., 1995; Tsuji et al., 2000b; Zheng et al., 2010b), temperature variation (Jin et al., 2011; Salinas-Clarot et al., 2011), hormones and cytokines (Rogers et al., 1990; Torti et al., 1989; Tran et al., 1997), different pathogen associated molecular patterns (PAMPs), infectious bacteria and virus (Ding et al., 2017a; Elvitigala et al., 2014; He et al., 2013; Liu et al., 2017; Oh et al., 2016; Ren et al., 2014; Sun et al., 2016, 2014c; Zheng et al., 2016). However, to our knowledge, except for seahorse Hippocampus abdominalis (Oh et al., 2016), little literature could be available on the comprehensive and comparative studies about all these FT subunits from a single fish species from Cyprinidae up to now. Black carp Mylopharyngodon piceus is an important economical aquaculture species since it possess abundant nutritional value and higher market demand in China (Wu et al., 2016a, c). Although its market production has achieved to 59.6 thousand tons (Fishery Bureau, 2016), black carp culture has suffered serious problems from infectious disease induced by Aeromonas hydrophila, which caused large economic losses and food safety problems in recent years (Zhang et al., 2010a). However, little information could be available about MpFT and their immune regulatory roles responding to A. hydrophila in black carp. Considering the pivotal functions mediated by FTs, it will give us a better understanding their corresponding roles in the immune defence system of black carp. Therefore, the first aim of the present study was to identify and characterize the cDNA sequence of FTs from black carp. The second aim was to investigate its expression patterns in different tissues, and in immune response to A. hydrophila challenge. The data

2. Materials and methods 2.1. Experimental animals Healthy black carp fingerlings (initial body weight: 18.6 ± 0.4 g) were purchased from a spawning in December 2017 at Shenshi Fisheries Co., Zhejiang, China. Prior to initiation of the challenge experiment, black carp fingerlings were acclimated to our laboratory conditions (pH 7.2 ± 0.3, 28 ± 1.5 °C, DO ≥ 4.5 mg L−1) in 500 L tanks for at least 2 weeks. These black carp were fed with an artificial feed made by our own lab with daily ration equal to 2% of the whole fish body weight. And uniform laboratory environmental settings were also maintained until the experiment end. 2.2. A. hydrophila challenge and sample collection In challenge experiments, A. hydrophila suspended in phosphate buffered saline (PBS; 100 μL animal−1) was used as pathogen in time courses. For pathogen challenge, two hundred and ten black carp fingerlings were intraperitoneally injected with A. hydrophila (about 6.85 × 107 cfu/mL) and the same amount of control PBS, respectively. During the experiment, the liver, intestine and blood samples from 4 black carp (n = 4 for each time frame) were excised at 0, 3, 6, 12, 24, 48 h and 72 h from the challenge and the control group, respectively. Four healthy black carp were used to isolate and examine the tissuespecific transcriptional levels of four MpFTs. After being anesthetized with ice, the brain, blood, gills, intestine, kidney, liver, muscle and spleen were collected. All these tissue samples were immediately snapfrozen in liquid nitrogen and stored at −80 °C for RNA isolation and subsequent analyses. 2

Aquaculture Reports 16 (2020) 100238

S. Chen, et al.

Fig. 1. Comparison of IRE sequence and stem-loop structure of black carp Mylopharyngodon piceus ferritins with other selected ferritins. A. IRE sequence alignment of black carp M. piceus ferritins with other selected ferritins, six nucleotides in the loop are shaded in underline. B. Predicted stem-loop structures of IREs from selected vertebrate ferritins. A six-nucleotide loop and an asymmetrical bulge are boxed, respectively.

3

Aquaculture Reports 16 (2020) 100238

S. Chen, et al.

Fig. 2. Multiple amino acid sequence alignment of ferritins alignment of black carp M. piceus with six known species: Golden line Barbell Sinocyclocheilus grahami, Zebrafish Danio rerio, Large yellow croaker Larimichthys crocea, frog Xenopus laevis, human Homo sapiens, seahorse Hippocampus abdominalis.

German). After sequencing and alignments, specific primer MpFT 02 F and AAP were used to get the 3’-end of MpFTs. MpFT 02Rs and upprimers (UPM and NUP) were used to get the 5’-end of MpFTs using 5’RACE system kit (Invitrogen).

2.3. RNA extraction, cDNA synthesis and gene cloning Total RNA was extracted using Trizol Reagent (Invitrogen, USA), treated with RNase-Free DNase (Takara, China) to remove DNA contaminant, quantified and electrophoresed to test the integrity. And total RNA was subjected to cDNA synthesis by SuperScript™ II RT reverse transcriptase (Takara) with Oligo (dT)-adaptor primer (Table 1) and 6prandom primer (Takara) according to reagent’s instructions. The degenerate primers MpFT 01 F and 01R (Table 1) were used to get the fragment of MpFTs on an Eppendorf Mastercycler gradient (Eppendorf,

2.4. Sequence and phylogenetic analysis The characteristic motifs and domains were predicted by using the following online web server, including https://www.ebi.ac.uk/ interpro/sequencesearch/, http://www.smart.emblheidelberg.de/, 4

Aquaculture Reports 16 (2020) 100238

S. Chen, et al.

3.2. Characterization and homology of MpFTs’ sequences

http://www.kr.expasy.org/prosite/ and http://myhits.isb.sib.ch/ cigbin/motif_scan. The IRE in the 5’-UTR was predicted using SIREs Web Server 2.0 (http://ccbg.imppc.org/sires/). http://www.cbs.dtu. dk/services/SignalP/ was used for signal peptide region prediction. https://abi.inf.uni-tuebingen.de/Services/MultiLoc2 was used to predict the cellular location. After multiple sequence alignment with ClustalW Alignment program, an unrooted phylogenetic tree was constructed by MEGA 6 software with the bootstrapping of 1000 repetitions with Neighbor-Joining method.

According to the alignment of FTs, the structurally important amino acid residues characteristic for FT is present in the amino acid sequence of MpFT (Fig. 2). There are two tipical Fer iron-binding regions signature (58EEREHAEKLMKFQNQRGGR76, 123DPHMCDFIETHYLDEQVKSIK143), a ferroxidase diiron center (24E, 31Y, 58E, 59E, 62H, 104E, 138Q), a ferrihydrite nucleation center (54H, 57H, 58E, 61E), an iron ion channel (115H, 128D, 131E) and a N-glycosylation site (108NHSL111) in the amino acid sequence of MpFTH1a. Similarly, there are also two Fer ironbinding regions signature (58EEREHAEKLMSLQNQRGGR76, 123DPHVCDFLETHYLDEQVKSIK143), a ferroxidase diiron center (24E, 31Y, 58E, 59E, 62H, 104E, 138Q), a ferrihydrite nucleation center (54K, 57K, 58E, 61E), an iron ion channel (115H, 128D, 131E) and a N-glycosylation site (108NLSL111) in MpFTH1b. In addition, there are also two Fer ironbinding regions signature (58EEREHAEKFMEfQNKRGGR76, 123DPHLCDFLETHYLNEQVEAIK143), a ferroxidase diiron center (24E, 31Y, 58E, 59E, 62H, 104E, 138Q), a ferrihydrite nucleation center (54K, 57K, 58E, 61E), an iron ion channel (115H, 128D, 131E) and a N-glycosylation site (151NLSK154) in MpFTM. Although Fer iron-binding regions signature motif were not identified in MpFTL according to interpro program, there were a ferroxidase diiron center (23K, 30Y, 57K, 58E, 61Q, 103Q, 137S), a ferrihydrite nucleation center (53E, 56L, 57K, 60D), an iron ion channel (114H, 127D, 130E) and two N-glycosylation sites (46NFSK49, 107NQSL110) in MpFTL according to the interpro program and the PROSITE program. And there were no signal peptides in four MpFT according to the signal peptide region prediction Web Server. Based on the sequences of FTs, a phylogenetic tree was constructed using the programs of CLUSTAL X 1.83 and MEGA6.0. As illustrated in Fig. 3, the phylogenetic tree showed a clear clustering of sequences based on different subunit types including FTH, FTM, and FTL. Animal FTs were comprised with three distinct branches in the tree. In the branch of FTHs, all the fish FTHs were clustered together and formed a sister subgroup to the sub-branches from mammal, bird and amphibian species. However, animal FTL’s branches were closer to animal FTH branches than to animal FTM branches (Fig. 3). It could be observed there was a good agreement with traditional taxonomy from the phylogenic tree.

2.5. Quantification of MpFTs and statistical analysis Real-time PCR assays were carried out in a quantitative thermal cycler (BIO-RAD CFX96, BIO-RAD, USA) using SYBR green as fluorescent dye. Different MpFT 3 F/3R primers (Table 2) were designed according to the sequences and used to evaluate the transcriptional levels in different tissues of healthy fish as well as in challenged fish. βactin gene (Table 2) was used to normalize the template amount as an endogenous reference. All detection for each samples were performed in four replicates. To verify that the used primer pair produced only a single product, the dissociation curve of the product was also investigated by heating from 60 °C to 95 °C at the end of reaction. MpFTs’ expression levels were quantified relative to the expression of β-actin using the optimized comparative 2−ΔΔCT method (Livak and Schmittgen, 2001). Quantitative data were presented as mean ± S.E.M (standard error of the mean). All data were subjected to one-way analysis of variance using SPSS 19.0 software. Differences between the means were evalued by Tukey’s test after checking homogeneity of variances. Statistical significance was determined at 0.05.

3. Results 3.1. Sequence analysis of MpFT In this study, four MpFT were successfully cloned from black carp with degenerate PCR and RACE techniques. The complete cDNA sequence of four MpFT cDNA were 1101, 1194, 1047 and 1156 bp in MpFTH1a, MpFTH1b, MpFTM and MpFTL, respectively. And there were 177 (MpFTH1a), 177 (MpFTH1b), 176 (MpFTM) and 173 (MpFTL) amino acids, respectively. The calculated molecular weight of MpFTs are 20.8, 20.64, 20.43 and 19.72 kDa with a theoretical isoelectric point of 5.46, 5.53, 5.22 and 5.65 in MpFTH1a, MpFTH1b, MpFTM and MpFTL, respectively. All these obtained FTs and TF’ sequences of black carp were submitted to GenBank with accession numbers (MpFTH1a: KY926439; MpFTH1b: KY926440; MpFTM: KY926441; MpFTL: KY926442), respectively. According to SIREs Web Server 2.0, an iron responsive element (IRE) was identified in the 5’-UTR of MpFTH1a and MpFTM, respectively (Fig. 1). Alignment of the MpFTH1a’s IRE sequences showed higher identity to other known IREs of human (Homo sapiens, FTL: 74.1%), mouse (Mus musculus, FTH: 90.3%, FTL: 77.4%), chicken (Gallus gallus, FTH: 80.6%) and frog (Xenopus laevis, FTH: 80.6%) than that of human FTH’s IRE (Homo sapiens, FTH: 32.2%) (Fig. 1A). Similarly, MpFTM’s IRE sequences also showed higher identity to known IREs of human (Homo sapiens, FTL: 83.8%), mouse (Mus musculus, FTH: 87%, FTL: 87%), chicken (Gallus gallus, FTH: 83.8%) and frog (Xenopus laevis, FTH: 93.5%) than that of human FTH’s IRE (Homo sapiens, FTH: 38.7%) (Fig. 2A). The characteristic stem-loop structure of IRE concluded two double-stranded helixes (upper and lower stem), a six-nucleotides loop secondary structure with a consensus sequence 5’-CAGUGN-3’ (where N is C, U or A) and an asymmetrical bulge structure between the upper and lower stem (Fig. 2B). However, the stem segment linked with the loop is separated by a single G bulge instead of C, as is found in human (Fig. 1B).

3.3. Expression of black carp MPFT genes in different tissues The distribution of black carp ferritins expression in the different tissues were performed by RT-PCR. In this study, β-actin was chosen as the internal control because of it is one of the most commonly used reference and expressed in almost tissues at a constant expression level. Tissues including liver, intestine, kidney, gill, heart, spleen, muscle, blood and brain were collected from six healthy black carp. Tissues were independent used to isolated total RNA. The results showed that MpFTH1a, MpFTH1b, MpFTL and MpFTM transcripts could be detectable in all the examined tissues, with the highest expression of MpFTH1a were observed in blood and liver (Fig 4A), in contrast, the highest expression of MpFTH1b was found in heart, moderate expressions were observed in liver (Fig 4B). The expression of MpFTL showed that the highest was liver, low levels in intestine, kidney, gill, heart, spleen and muscle (Fig 4C). And the expression of MpFTM showed that the higher rate of expression was founded in liver and intestine, followed were almost at same extent in kidney, gill, heart, spleen, blood and brain, with the lowest in muscle (Fig 4D). 3.4. Expressional variations of MpFTs in response to A. hydrophila challenge Real-time quantitative PCR were used to investigate the mRNA levels of MpFerritin genes, different tissues including liver, intestine and blood were then collected at intervals (0, 3, 6, 12, 24, 48 and 72 h) for quantification of ferritins mRNA with qRT-PCR. As shown in Fig. 5, the 5

Aquaculture Reports 16 (2020) 100238

S. Chen, et al.

(P < 0.05) respectively and reached the highest at 3 h post-challenge. In the liver, MpFTH1a and MpFTH1b mRNA were up-regulated at the similar trend and reached their peaks to 22.43-fold (P < 0.05) and 3.24-fold (P < 0.05) respectively at 12 h after challenge and then decreased. Differently, MpFTM mRNA was up-regulated at 12 h postchallenge then stayed stably at this level to the next times. The mRNA level of MpFTL in liver was acutely up-regulated and reached peak level at the 6 h post-infection, but dropped to the original levels at 48 h after challenge (Fig. 6) Compare with blood and liver, the transcript of MpFTH1a, MpFT1b, MpFTL and MpFTM in intestine were gradually increase and peaked at 24 h post-challenge to 17.5-fold, 16.5-fold, 22fold and 7-fold (P < 0.05), respectively, and then gradually decreased (Fig. 7). 4. Discussion In this study, we cloned, identified and characterized four ferritin subunits from M. piceus. Bioinformatics analysis further showed that MpFTs typical characteristics of all FT H, M and L subunits, respectively, which showed these FT proteins were indeed ferritin orthologs. Phylogenetic results showed that ferritin H, M and L subunits were separately clustered into three different clusters, suggesting MpFTH, MpFTM and MpFTL were encoded by different genes, which is agree with previous reports on rock bream (Oplegnathus fasciatus) and blunt snout bream (M. amblycephala) (Ding et al., 2017a; Elvitigala et al., 2013, 2014; Sun et al., 2016). In addition, we also identified two FT H subunits, namely MpFTH1a and MpFTH1b, which is only agree with reports in zebrafish (Danio rerio). However, the same reports were not shown in rock bream (O. fasciatus) and blunt snout bream (M. amblycephala) (Ding et al., 2017a; Elvitigala et al., 2013, 2014; Sun et al., 2016). And these data suggested these four FT subunits were likely to be the common ancestor of vertebrate FTs. It could be observed that conservative “IRE-like elements” were only presented in the 5’-UTR of MpFTH1a and MpFTM gene. And their nucleotide sequence of “IREs” had higher similarity with other IRE motifs from mammals, bird, amphibia and fish (Ding et al., 2017a; Sun et al., 2016). The IRE’ predicted secondary structure contains a typical “stem-loop” structure, which act as the binding site for iron regulatory protein (IRP) (Ding et al., 2017a; Durand et al., 2004; Sun et al., 2016; Wu et al., 2010). The similar C-bulge structure of IRE in mammals and fish was used to adopt a specific bend in the IRE structure, and interfere the translational regulation of FT (Hentze and Kuhn, 1996; Sun et al., 2016). Therefore, the conserved bulge structure indicated that MpFTH1a and MpFTM might mediate post-transcriptional regulation function. In this study, we described the tissue specific expression profiles of MpFTH1a, MpFT1b, MpFTL and MpFTM from black carp and challenge-induced expression by A. hydrophila. We found that the four ferritin subunit mRNAs were expressed in all detected tissues of black carp. MpFTH1a expression was higher in blood and liver, which was consistent with previous results in other species (Andersen et al., 1995a; Hu et al., 2010). MpFTH1b was mostly expressed in heart, liver and brain, previous studies showed that fish ferritin H could be detected in a wide range of tissues, under normal physiological conditions, and mostly expressed in the liver or blood (Ding et al., 2017b; Neves et al., 2009b). In this study, in the case of MpFTH1a and MpFTH1b, the results were somewhat similar to other fish. In addition, we found that MpFTL was highly expressed in liver followed in blood and brain, and weakly expressed in intestine, kidney, gill, heart, spleen and muscle. In mammals, FerL subunits are act as iron reservoirs abundantly in the liver, where is a well-known center of iron metabolism and storage organ in animals (Anderson and Frazer, 2005; Harrison and Arosio, 1996). Therefore high expression founded in these tissues is consistent with its major role in iron storage and metabolism. As for the MpFTM, tissues expression is species-specific with the highest expression founded in the liver and blood in red drum (Hu et al., 2010), in the muscle and spleen

Fig. 3. Phylogenetic relationship of FTs from Black carp and other species. Black carp Mylopharyngodon piceus (FTH1a: KY926439; FTH1b: KY926440; FTM: KY926441; FTL: KY926442); Golden line Barbell Sinocyclocheilus grahami (FTH: XP_016135903; FTH1b: XP_016086224; FTM: XP_016124596; FTL: XP_016096077); Zebrafish Danio rerio (FTH1a: NP_571660; FTH1b: NP_001004562; FTM: NP_001002378; FTL: AAH71455); Grouper Epinephelus coioides (FTH: AEW43728; FTL: AEA39704); Rock bream Oplegnathus fasciatus (FTH: AIM17892; FTM: BAM37460); Salmon Salmo salar (FTH: NP_001117129; FTH1b: ACN10128; FTM: ACI67714; FTL: ACI69368); Channel catfish Ictalurus punctatus (FTH: ADE09343; FTM: ADO29006); Large yellow croaker Larimichthys crocea (FTH: KKF28100; FTL: KKF34024); Turbot Scophthalmus maximus (FTH: ADI24353); African clawed frog Xenopus laevis (FTH: NP_001083072; FTL: NP_001079927); Tropical frog Xenopus tropicalis (FTH: NP_001005135); Wuchang bream Megalobrama amblycephala (FTM AKA58770); European seabass Dicentrarchus labrax (FTL: CBN81347); Chicken Gallus gallus (FTH: CAA75004); Human Homo sapiens (FTH: NP_002023; FTL: AAH13928); Mouse Mus musculus (FTH: NP_034369; FTL: NP_034370); Seahorse Hippocampus abdominalis (FTL: KP780176; FTM: KP780175; FTH: KP780174); Escherichia coli (FT: KCW96004). The tree is based on an alignment made of 40 representative complete FTs sequences using ClustalW and MEGA (5.0), and was constructed using the neighbour-joining method and the 1000-replicate bootstrap test.

results showed that the mRNA expression level of MpFTH1a, MpFTH1b, MpFTL and MpFTM in the blood were significantly increased in the first 3 h after injection with Aeromonas hydrophila and reached 4.34-fold (P < 0.05), 4.18-fold (P < 0.05), 9.18-fold (P < 0.05) and 12.4-fold 6

Aquaculture Reports 16 (2020) 100238

S. Chen, et al.

Fig. 4. MpFTs mRNA expression levels in different tissues of black carp M. piceus without any treatments were detected by real time-PCR assay. MpFTs transcript level in blood (B), brain (BR), gill (G), intestine (I), kidney (K), liver (L), muscle (M) and spleen (S). All values represent the mean ± S.E.M. (n = 4). Bars bearing different letters are significantly different (p < 0.05; Tukey’s test).

the bioavailability of iron to invading pathogenic microorganisms (Beck et al., 2002; Kong et al., 2010b; Sun et al., 2014b). Blood, liver and intestine play an important role in iron metabolism and storage (YongHua et al., 2010), and MPFTs are highky expressed in these tissues. Previous studies showed that ferritin 1 was highly expressed in both blood and liver, which was similar to our research (Yong-Hua et al.,

in turbot (Zheng et al., 2010a). In the present research, however, not like the fish mentioned above, the expression of MpFTM was abundant expressed in liver and intestine relative to other tissues. FTs from different species have been reported to be involved in host defense against pathogens, because of FT has iron withholding ability and could serve as a component in host innate immunity by restricting

Fig. 5. Temporal expression of MpFTH1a, MpFT1b, MpFTL and MpFTM transcripts in blood after A. hydrophila challenge as measure by RT-PCR. Vertical bars represent the mean ± S.E. (n = 4). 7

Aquaculture Reports 16 (2020) 100238

S. Chen, et al.

Fig. 6. Temporal expression of MpFTH1a, MpFT1b, MpFTL and MpFTM transcripts in liver after A. hydrophila challenge as measure by RT-PCR. Vertical bars represent the mean ± S.E. (n = 4).

Fig. 7. Temporal expression of MpFTH1a, MpFT1b, MpFTL and MpFTM transcripts in intestine after A. hydrophila challenge as measure by RT-PCR. Vertical bars represent the mean ± S.E. (n = 4).

8

Aquaculture Reports 16 (2020) 100238

S. Chen, et al.

Declaration of Competing Interest

2010; Zhang et al., 2010b). In animal, it is well known that hemocytes or blood are play a vital role in the host immune defense. In order to further understand the role of the ferritin isoforms in black carp immune response, our subsequent examination in black carp were injected with Aeromonas hydrophila, the gene expression levels of MpFTH1a, MpFTH1b, MpFTL and MpFTM were analyzed by real-time PCR. We found that ferritins from black carp were transcriptionally upregulated in blood, liver and intestine after challenge with A. hydrophila and reached their peak values at 6 h, 12 h and 24 h after challenge, respectively. Our date suggested that the ferritins from black carp participated the immune response to bacterial challenge, and the immune response of each tissues are tissues-specific. Previous studies have pointed out that multiple factors such as iron (Cairo et al., 1985), hormones (Colucci-D’Amato et al., 1989), cytokines (Torti et al., 1988) and oxidants (Tsuji et al., 2000a) could effected the transcription of ferritin.Plasma ferritin is an important extracellular iron storage molecular, and could increase drastically in cancer and infection to reduce cytosolic iron content for the invading bacteria (Ong et al., 2005). Previous studies also found that LPS or bacterial challenge could induce the transcriptional up-regulation of the horseshoe plasma ferritin and hypothesised the possible involvement of plasma ferritin in host defense system of the horseshoe crab (Ong et al., 2005).these might be the reasons that MpFTH1a, MpFTH1b, MpFTL and MpFTM genes in blood were up-regulated drastically and reached their peak at 3 h after challenge, it was more effectively than liver and intestine. After that, the ferritin in blood gradually disappeared between 24 h and 72 h after challenge. In contrast, the expression of MpFTH1a, MpFTH1b, MpFTL and MpFTM in liver showed different patterns. To our knowledge, the liver is a central to metabolism and can carries out many processes such as immune response, energy metabolism and have a vital in iron metabolism, storage and synthesis of related proteins (Lee et al., 2014), and also closely related to synthesis and secretion of serum proteins (Martin et al., 2010; Wu et al., 2016b). In this study, the expression of MpFTL in liver was peaked at 6 h after challenge, and disappeared in the next time. Differently, MpFTM which was also expressed abundantly in liver, it was up-regulated at 12 h and then stayed stably at this level to the next times. The present study revealed that the expression of MpFTM was more stable than that of MpFTL. In addition, after infected with pathogens, the expression of MpFTH1a was gradually up-regulated and peaked at 12 h after challenge, then decreased but still in high level compared with these in control groups which infected with PBS, there are somewhat consistent with the results in blunt snout bream challenge with A. hydrophila (Ding et al., 2017b). However, the expression of MpFTH1b in liver appeared two significant transcriptional up-regulations. In the first up-regulation, the expression of MpFTH1b reached peak at 12 h post-challenge, while the second founded at 72 h postchallenge but did not reach the highest level within the next experimental period. The different expression patterns between the ferritin chains suggested the possibility of complex roles for ferritins during an immune response. In order to further understand the distinct of ferritins in different tissues, we analyzed it expression in intestine after stimulated A. hydrophila. Previous reports showed that intestinal mucosal immune system is the first line of defense against intestinal pathogen infection (Pitman and Blumberg, 2000). Under the normal physiological condition, furthermore, the intestine is constant exposure to the ROS which induced by food, faeces and bacterial (Halliwell et al., 2000; Wu et al., 2016b). It was observed that MpFTH1a, MpFTH1b, MpFTL and MpFTM expression in intestine were gradually increased and peaked at 48 h post-infected in the intestine. Collectively, these MPFTs are likely to participate in immune response in the intestine of black carp. In summary, the results of this study suggested that MpFTH1a, MpFTH1b, MpFTL and MpFTM were widely expressed in difference tissues. Moreover, we have confirmed that ferritins from black carp plays vital role in immune response after challenge with A. hydrophila.

None. Acknowledgements This research was financially supported by grants from the National Natural Science Foundation of China (No. 31672669, No. 31202008) and the Earmarked Fund for China Agriculture Research System (CARS46). References Aisen, P., Listowsky, I., 1980. Iron transport and storage proteins. Annu. Rev. Biochem. 49, 357–393. Alkhateeb, A.A., Connor, J.R., 2010. Nuclear ferritin: a new role for ferritin in cell biology. Biochim. Biophys. Acta 1800, 793–797. Andersen, O., Dehli, A., Standal, H., Giskegjerde, T.A., Karstensen, R., Rørvik, K.A., 1995a. Two ferritin subunits of Atlantic salmon (Salmo salar): cloning of the liver cDNAs and antibody preparation. Mol. Mar. Biol. Biotechnol. 4, 164–170. Andersen, O., Dehli, A., Standal, H., Giskegjerde, T.A., Karstensen, R., Rorvik, K.A., 1995b. Two ferritin subunits of Atlantic salmon (Salmo salar): cloning of the liver cDNAs and antibody preparation. Mol. Mar. Biol. Biotechnol. 4, 164–170. Anderson, G.J., Frazer, D.M., 2005. Hepatic iron metabolism. Semin. Liver Dis. 25, 420–432. Bai, L., Xie, T., Hu, Q., Deng, C., Zheng, R., Chen, W., 2015. Genome-wide comparison of ferritin family from Archaea, Bacteria, Eukarya, and Viruses: its distribution, characteristic motif, and phylogenetic relationship. Naturwissenschaften 102, 64. Beck, G., Ellis, T.W., Habicht, G.S., Schluter, S.F., Marchalonis, J.J., 2002. Evolution of the acute phase response: iron release by echinoderm (Asterias forbesi) coelomocytes, and cloning of an echinoderm ferritin molecule. Dev. Comp. Immunol. 26, 11–26. Cairo, G., Bardella, L., Schiaffonati, L., Arosio, P., Levi, S., Bernelli-Zazzera, A., 1985. Multiple mechanisms of iron-induced ferritin synthesis in HeLa cells. Biochem. Biophys. Res. Commun. 133, 314–321. Cairo, G., Tacchini, L., Pogliaghi, G., Anzon, E., Tomasi, A., Bernelli-Zazzera, A., 1995. Induction of ferritin synthesis by oxidative stress. J. Biol. Chem. 270, 700–703. Chen, G., Zhang, C., Wang, Y., Guo, C., Sang, F., Wang, C., 2016. Identification and characterization of a ferritin gene involved in the immune defense response of scallop Chlamys farreri. Fish Shellfish Immunol. 55, 1–9. Colucci-D’Amato, L.G., Ursini, M.V., Colletta, G., Cirafici, A., Franciscis, V.D., 1989. Thyrotropin stimulates transcription from the ferritin heavy chain promoter. Biochem. Biophys. Res. Commun. 165, 506–511. De Zoysa, M., Lee, J., 2007. Two ferritin subunits from disk abalone (Haliotis discus discus): cloning, characterization and expression analysis. Fish Shellfish Immunol. 23, 624–635. Ding, Z., Zhao, X., Zhan, Q., Cui, L., Sun, Q., Wang, W., Liu, H., 2017a. Comparative analysis of two ferritin subunits from blunt snout bream (Megalobrama amblycephala): characterization, expression, iron depriving and bacteriostatic activity. Fish Shellfish Immunol. 66, 411–422. Ding, Z., Zhao, X., Zhan, Q., Lei, C., Sun, Q., Wang, W., Hong, L., 2017b. Comparative analysis of two ferritin subunits from blunt snout bream (Megalobrama amblycephala): characterization, expression, iron depriving and bacteriostatic activity. Fish Shellfish Immunol. 66, 411–422. Durand, J.P., Goudard, F., Pieri, J., Escoubas, J.M., Schreiber, N., Cadoret, J.P., 2004. Crassostrea gigas ferritin: cDNA sequence analysis for two heavy chain type subunits and protein purification. Gene 338, 187–195. Elvitigala, D.A., Premachandra, H.K., Whang, I., Oh, M.J., Jung, S.J., Park, C.J., Lee, J., 2013. A teleostean counterpart of ferritin M subunit from rock bream (Oplegnathus fasciatus): an active constituent in iron chelation and DNA protection against oxidative damage, with a modulated expression upon pathogen stress. Fish Shellfish Immunol. 35, 1455–1465. Elvitigala, D.A., Priyathilaka, T.T., Lim, B.S., Whang, I., Yeo, S.Y., Choi, C.Y., Lee, J., 2014. Molecular profile and functional characterization of the ferritin H subunit from rock bream (Oplegnathus fasciatus), revealing its putative role in host antioxidant and immune defense. Dev. Comp. Immunol. 47, 104–114. Epsztejn, S., Glickstein, H., Picard, V., Slotki, I.N., Breuer, W., Beaumont, C., Cabantchik, Z.I., 1999. H-ferritin subunit overexpression in erythroid cells reduces the oxidative stress response and induces multidrug resistance properties. Blood 94, 3593–3603. Fishery Bureau, 2016. China Fishery Statistical Yearbook. China Agricultural Press, Beijing. Gammella, E., Buratti, P., Cairo, G., Recalcati, S., 2017. The transferrin receptor: the cellular iron gate. Metallomics. Halliwell, B., Zhao, K., Whiteman, M., 2000. The gastrointestinal tract: a major site of antioxidant action? Free Radic. Res. Commun. 33, 819–830. Harrison, P.M., Arosio, P., 1996. The ferritins: molecular properties, iron storage function and cellular regulation. Biochim. Biophys. Acta 1275, 161–203. He, S., Peng, K., Hong, Y., Wang, J., Sheng, J., Gu, Q., 2013. Molecular properties and immune defense of two ferritin subunits from freshwater pearl mussel, Hyriopsis schlegelii. Fish Shellfish Immunol. 34, 865–874. Hentze, M.W., Kuhn, L.C., 1996. Molecular control of vertebrate iron metabolism: mRNAbased regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc. Natl. Acad. Sci. U. S. A. 93, 8175–8182.

9

Aquaculture Reports 16 (2020) 100238

S. Chen, et al.

of a Macrobrachium nipponense ferritin subunit regulated by iron ion and pathogen challenge. Fish Shellfish Immunol. 40, 288–295. Sun, S., Gu, Z., Fu, H., Zhu, J., Xuan, F., Ge, X., 2014b. Identification and characterization of a Macrobrachium nipponense ferritin subunit regulated by iron ion and pathogen challenge. Fish Shellfish Immunol. 40, 288–295. Sun, S., Zhu, J., Ge, X., Zhang, W., 2016. Molecular characterization and gene expression of ferritin in blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 57, 87–95. Sun, Y., Zhang, Y., Fu, X., Zhang, R., Zou, J., Wang, S., Hu, X., Zhang, L., Bao, Z., 2014c. Identification of two secreted ferritin subunits involved in immune defense of Yesso scallop Patinopecten yessoensis. Fish Shellfish Immunol. 37, 53–59. Torti, F.M., Torti, S.V., 2002. Regulation of ferritin genes and protein. Blood 99, 3505–3516. Torti, F.M., Torti, S.V., Larrick, J.W., Ringold, G.M., 1989. Modulation of adipocyte differentiation by tumor necrosis factor and transforming growth factor beta. J. Cell Biol. 108, 1105–1113. Torti, S.V., Kwak, E.L., Miller, S.C., Miller, L.L., Ringold, G.M., Myambo, K.B., Young, A.P., Torti, F.M., 1988. The molecular cloning and characterization of murine ferritin heavy chain, a tumor necrosis factor-inducible gene. J. Biol. Chem. 263, 12638. Tran, T.N., Eubanks, S.K., Schaffer, K.J., Zhou, C.Y., Linder, M.C., 1997. Secretion of ferritin by rat hepatoma cells and its regulation by inflammatory cytokines and iron. Blood 90, 4979–4986. Tsuji, Y., Ayaki, H., Whitman, S.P., Morrow, C.S., Torti, S.V., Torti, F.M., 2000a. Coordinate transcriptional and translational regulation of ferritin in response to oxidative stress. Mol. Cell. Biol. 20, 5818. Tsuji, Y., Ayaki, H., Whitman, S.P., Morrow, C.S., Torti, S.V., Torti, F.M., 2000b. Coordinate transcriptional and translational regulation of ferritin in response to oxidative stress. Mol. Cell. Biol. 20, 5818–5827. Wu, C., Gao, J., Cao, F., Lu, Z., Chen, L., Ye, J., 2016a. Molecular cloning, characterization and mRNA expression of six peroxiredoxins from Black carp Mylopharyngodon piceus in response to lipopolysaccharide challenge or dietary carbohydrate. Fish Shellfish Immunol. 50, 210–222. Wu, C., Gao, J., Cao, F., Lu, Z., Chen, L., Ye, J., 2016b. Molecular cloning, characterization and mRNA expression of six peroxiredoxins from Black carp Mylopharyngodon piceus in response to lipopolysaccharide challenge or dietary carbohydrate. Fish Shellfish Immunol. 50, 210–222. Wu, C., Ye, J., Gao, J., Chen, L., Lu, Z., 2016c. The effects of dietary carbohydrate on the growth, antioxidant capacities, innate immune responses and pathogen resistance of juvenile Black carp Mylopharyngodon piceus. Fish Shellfish Immunol. 49, 132–142. Wu, C., Zhang, W., Mai, K., Xu, W., Wang, X., Ma, H., Liufu, Z., 2010. Transcriptional upregulation of a novel ferritin homolog in abalone Haliotis discus hannai Ino by dietary iron. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 152, 424–432. Yong-Hua, H., Wen-Jiang, Z., Li, S., 2010. Identification and molecular analysis of a ferritin subunit from red drum (Sciaenops ocellatus). Fish Shellfish Immunol. 28, 678–686. Zhang, B., Zeng, L.B., Luo, X.S., Xu, J., Xiao, Y., Zhou, Y., 2010a. Isolation and identification of pathogen from Enteric Septicemia of Black Carp (Mylopharyngodon piceus). J. Huazhong Agric. Univ. 29, 607–612 (in Chinese with English abstract). Zhang, L., Sun, W., Cai, W., Zhang, Z., Gu, Y., Chen, H., Ma, S., Jia, X., 2013. Differential response of two ferritin subunit genes (VpFer1 and VpFer2) from Venerupis philippinarum following pathogen and heavy metals challenge. Fish Shellfish Immunol. 35, 1658–1662. Zhang, X., Wei, W., Wu, H., Xu, H., Chang, K., Zhang, Y., 2010b. Gene cloning and characterization of ferritin H and M subunits from large yellow croaker (Pseudosciaena crocea). Fish Shellfish Immunol. 28, 735–742. Zheng, L., Liu, Z., Wu, B., Dong, Y., Zhou, L., Tian, J., Sun, X., Yang, A., 2016. Ferritin has an important immune function in the ark shell Scapharca broughtonii. Dev. Comp. Immunol. 59, 15–24. Zheng, W.J., Hu, Y.H., Sun, L., 2010a. Identification and analysis of a Scophthalmus maximus ferritin that is regulated at transcription level by oxidative stress and bacterial infection. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 156, 222–228. Zheng, W.J., Hu, Y.H., Sun, L., 2010b. Identification and analysis of a Scophthalmus maximus ferritin that is regulated at transcription level by oxidative stress and bacterial infection. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 156, 222–228.

Hu, Y.H., Zheng, W.J., Sun, L., 2010. Identification and molecular analysis of a ferritin subunit from red drum (Sciaenops ocellatus). Fish Shellfish Immunol. 28, 678–686. Jin, C., Li, C., Su, X., Li, T., 2011. Identification and characterization of a Tegillarca granosa ferritin regulated by iron ion exposure and thermal stress. Dev. Comp. Immunol. 35, 745–751. Kong, P., Wang, L., Zhang, H., Zhou, Z., Qiu, L., Gai, Y., Song, L., 2010a. Two novel secreted ferritins involved in immune defense of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 28, 604–612. Kong, P.F., Wang, L.L., Zhang, H., Zhi, Z., Qiu, L.M., Gai, Y.C., Song, L.S., 2010b. Two novel secreted ferritins involved in immune defense of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 28, 604–612. Lawson, D.M., Artymiuk, P.J., Yewdall, S.J., Smith, J.M., Livingstone, J.C., Treffry, A., Luzzago, A., Levi, S., Arosio, P., Cesareni, G., et al., 1991. Solving the structure of human H ferritin by genetically engineering intermolecular crystal contacts. Nature 349, 541–544. Lee, J.H., Pooley, N.J., Mohd-Adnan, A., Martin, S.A., 2014. Cloning and characterisation of multiple ferritin isoforms in the Atlantic salmon (Salmo salar). PLoS One 9, e103729. Levi, S., Santambrogio, P., Cozzi, A., Rovida, E., Corsi, B., Tamborini, E., Spada, S., Albertini, A., Arosio, P., 1994. The role of the L-chain in ferritin iron incorporation. Studies of homo and heteropolymers. J. Mol. Biol. 238, 649–654. Li, M., Saren, G., Zhang, S., 2008. Identification and expression of a ferritin homolog in amphioxus Branchiostoma belcheri: evidence for its dual role in immune response and iron metabolism. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 150, 263–270. Liu, Q.N., Xin, Z.Z., Liu, Y., Wang, Z.F., Chen, Y.J., Zhang, D.Z., Jiang, S.H., Chai, X.Y., Zhou, C.L., Tang, B.P., 2017. A ferritin gene from Procambarus clarkii, molecular characterization and in response to heavy metal stress and lipopolysaccharide challenge. Fish Shellfish Immunol. 63, 297–303. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408. Martin, S.A., Douglas, A., Houlihan, D.F., Secombes, C.J., 2010. Starvation alters the liver transcriptome of the innate immune response in Atlantic salmon (Salmo salar). BMC Genomics 11, 418. Neves, J.V., Wilson, J.M., Rodrigues, P.N., 2009a. Transferrin and ferritin response to bacterial infection: the role of the liver and brain in fish. Dev. Comp. Immunol. 33, 848–857. Neves, J.V., Wilson, J.M., Rodrigues, P.N.S., 2009b. Transferrin and ferritin response to bacterial infection: the role of the liver and brain in fish. Dev. Comp. Immunol. 33, 848–857. Oh, M., Umasuthan, N., Elvitigala, D.A., Wan, Q., Jo, E., Ko, J., Noh, G.E., Shin, S., Rho, S., Lee, J., 2016. First comparative characterization of three distinct ferritin subunits from a teleost: evidence for immune-responsive mRNA expression and iron depriving activity of seahorse (Hippocampus abdominalis) ferritins. Fish Shellfish Immunol. 450–460. Ong, D.S., Wang, L., Zhu, Y., Ho, B., Ding, J.L., 2005. The response of ferritin to LPS and acute phase of Pseudomonas infection. J. Endotoxin Res. 11, 267. Pitman, R.S., Blumberg, R.S., 2000. First line of defense: the role of the intestinal epithelium as an active component of the mucosal immune system. J. Gastroenterol. 35, 805–814. Ponka, P., Beaumont, C., Richardson, D.R., 1998. Function and regulation of transferrin and ferritin. Semin. Hematol. 35, 35–54. Ren, C., Chen, T., Jiang, X., Wang, Y., Hu, C., 2014. Identification and functional characterization of a novel ferritin subunit from the tropical sea cucumber, Stichopus monotuberculatus. Fish Shellfish Immunol. 38, 265–274. Richardson, D.R., Ponka, P., 1997. The molecular mechanisms of the metabolism and transport of iron in normal and neoplastic cells. Biochim. Biophys. Acta 1331, 1–40. Rocha, E.R., Smith, C.J., 2004. Transcriptional regulation of the Bacteroides fragilis ferritin gene (ftnA) by redox stress. Microbiology 150, 2125–2134. Rogers, J.T., Bridges, K.R., Durmowicz, G.P., Glass, J., Auron, P.E., Munro, H.N., 1990. Translational control during the acute phase response. Ferritin synthesis in response to interleukin-1. J. Biol. Chem. 265, 14572–14578. Salinas-Clarot, K., Gutierrez, A.P., Nunez-Acuna, G., Gallardo-Escarate, C., 2011. Molecular characterization and gene expression of ferritin in red abalone (Haliotis rufescens). Fish Shellfish Immunol. 30, 430–433. Sun, S., Gu, Z., Fu, H., Zhu, J., Xuan, F., Ge, X., 2014a. Identification and characterization

10