Molecular cloning, characterization and expression of a masquerade-like serine proteinase homologue from black tiger shrimp Penaeus monodon

Fish & Shellfish Immunology 22 (2007) 535e546 www.elsevier.com/locate/fsi

Molecular cloning, characterization and expression of a masquerade-like serine proteinase homologue from black tiger shrimp Penaeus monodon Piti Amparyup a,b, Rungrat Jitvaropas b, Naritsara Pulsook b,c, Anchalee Tassanakajon b,* a

National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), 113 Paholyothin Road, Klong1, Klong Luang, Pathumthani 12120, Thailand b Shrimp Molecular Biology and Genomics Laboratory, Department of Biochemistry, Faculty of Science, Chulalongkorn University, Phayathai Road, Bangkok 10330, Thailand c Biotechnology Program, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand Received 24 April 2006; revised 15 July 2006; accepted 26 July 2006 Available online 1 August 2006

Abstract A full-length cDNA of a masquerade-like serine proteinase homologue (PmMasSPH) of Penaeus monodon was cloned and characterized by rapid amplification cDNA end (RACE) method. The complete cDNA sequence of 1958 bp contains an open reading frame (ORF) of 1572 bp, encoding a 523 amino acid protein including a 19 amino acid signal peptide. The calculated molecular mass of the mature protein (504 amino acids) is 51.58 kDa with an estimated pI of 4.86. PmMasSPH has most of the structural characteristics of insect prophenoloxidase activating factors (PPAFs) (the N-terminal clip domain and the C-terminal serine proteinase-like domain) but in the N-terminal region there are extensive glycine-rich repeats (LGGQGGG). Sequence comparison showed that the deduced amino acid of PmMasSPH has an overall similarity of 69%, 68% and 61% to those of Apis mellifera PPAF, Callinectes sapidus PPAF and Tenebrio molitor PPAF, respectively. A neighbour-joining tree revealed a clear differentiation of each species and also indicated that PmMasSPH and C. sapidus PPAF are closely related phylogenetically. In situ hybridisation and real-time RTePCR analyses showed that PmMasSPH transcript in haemocytes of P. monodon increased within 24 h after Vibrio harveyi injection. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: Shrimp; Penaeus monodon; Serine proteinase homologue; Masquerade; RACEePCR

1. Introduction The prophenoloxidase (ProPO) activation system is one of the major invertebrate immune responses. The process is controlled by the key enzyme, phenoloxidase (PO), which catalyses the early steps in the pathway to melanin synthesis [1]. PO catalyses the production of o-quinones that are intermediates for cuticle sclerotization and melanin * Corresponding author. Tel.: þ66 2 218 5439; fax: þ66 2 218 5414. E-mail address: [email protected] (A. Tassanakajon). 1050-4648/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2006.07.004

536

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

synthesis. Sclerotized cuticle presents a barrier to infection and melanization around pathogens help kill the pathogens. It is initiated by the recognition of lipopolysaccharides or peptidoglycans from bacteria and b-1,3-glucans from fungi. The activation of proPO is mediated by a serine proteinase cascade. The serine proteinases that catalyse the proteolysis of proPO to the active phenoloxidase (PO) have been named proPO-activating proteinases (PAPs) or proPO-activating enzymes (PPAEs). Four controlling mechanisms are known for PPAE regulation including gene induction upon microbial infection, activation by another proteinase, a requirement for masquerade-like serine proteinase homologues (SPHs) as cofactors and inhibition by serine proteinase inhibitors [2]. PPAEs, SPHs and proteinases that function on activating the PO system can be referred to as prophenoloxiase activating factors (PPAFs) [3]. The PPAFs contain a highly conserved C-terminal serine proteinase domain and one or more N-terminal clip domains. Clip domains, 30e65 residues long, include six strictly conserved cysteine residues that form three-disulfide bonds [4]. This structural unit is widely found in arthropod serine proteinases (SP) and serine proteinase homologues (SPHs) [5] and is believed to possess important regulatory functions of the enzymes through their interaction with other proteins. The serine proteinase domains of PPAEs and SPHs are similar in sequence to those of SP but the typical active-site serine residue of PPAE is changed to glycine in SPHs and thus, SPHs lack proteolytic activity. Several arthropod PPAFs have been found to be involved in the activation of the proPO system in the coleopteran, Holotrichia diomphalia [6e8], tobacco hornworm, Manduca sexta [9e11], and mealworm, Tenebrio moliter [6,12]. Three PPAFs (PPAF-I, -II, -III) in H. diomphalia have been cloned and characterized. All PPAFs are members of a clip domain serine protease family since they contain a clip domain at the N-terminus. PPAF-I is an ester-type serine proteinase and the actual proteolytic activator of proPO [7]. PPAF-II, which lacks enzymatic activity, belongs to a clip-SPH and serves as a cofactor for the serine proteinase PPAF-I [8]. PPAF-III is a catalytic serine proteinase that activates PPAF-II by cleavage [6]. In M. sexta, three PAPs (PAP-1, PAP-2, and PAP-3) and two cofactors (SPH-1 and SPH-2) were isolated and characterized [9e11]. These PAPs are composed of one or two clip domains at the amino terminus and a catalytic domain at the carboxyl terminus. In addition, two clip-SPHs were isolated and characterized in T. moliter [6,12]. In crustaceans, a PPAF, called prophenoloxidase-activating enzyme (ppA) of the freshwater crayfish Pacifastacus leniusculus, was purified [13] and cloned [14] from blood cells. The purified ppA is capable of cleaving proPO into active PO without additional protein cofactor [13,15]. The N-terminal half of ppA contains a cationic glycine-rich domain, a cationic proline-rich domain and a clip domain. The C-terminal half of ppA is composed of a typical serine proteinase domain [14]. A masquerade-like protein has been cloned from crayfish haemocytes but this protein binds bacteria and appears to function as a pattern recognition and cell adhesion protein rather than a PPAF [16,17]. In addition, a masquerade-like SPH (cMasII) has been isolated and cloned from granular haemocytes from a crayfish [18]. A cDNA encoding a PPAF has been cloned from the hypodermal tissue of the blue crab, Callinectes sapidus [3] whereas a cDNA encoding a pseudo-clip SPH of kuruma shrimp Marsupenaeus japonicus has been reported and characterized from the mRNA expression [19]. Recently, a shrimp clip domain serine protease homologue (c-SPH) of P. monodon has been reported as a cell adhesion molecule [20]. However, the molecular mechanism(s) by which crustacean serine proteinase homologues are involved in the regulation of the prophenoloxidase system is yet to be clarified. From the Peneaus monodon EST project (http://pmonodon.biotec.or.th), we identified a putative PPAF cDNA from the haemocyte cDNA library of P. monodon. A partial sequence of the cDNA (accession number BI784455) showed the highest similarity to a PPAF of C. sapidus (e-value of 6  1018). The aim of the present study was to clone and characterize the full-length sequence of this cDNA using the RACEePCR method, and to evaluate its mRNA expression in haemocytes of Vibrio-infected shrimp using in situ hybridisation and real-time PCR analyses. 2. Material and methods 2.1. Sample preparation Haemocytes of P. monodon (approximately 3 months old and 20 g in body weight) were collected from the ventral sinus at 0, 3, 6, 12, 24, 48 and 72 h after Vibrio harveyi injection (106 CFU) and saline injection using a 1-ml sterile syringe preloaded with 500 ml of an anti-coagulant solution (10% sodium citrate, w/v). Saline-injected shrimps were

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

537

used as a control. The collected haemolymph was immediately centrifuged at 13,000 rpm for 10 min at 4  C to isolate the haemocytes from the plasma. A haemocyte pellet was resuspended in 200 ml of TRI REAGENTÒ (Molecular Research Center, USA). 2.2. Total RNA and mRNA isolation The total RNA from haemocytes of P. monodon was extracted using TRI REAGENT and further treated with DNase I (Promega, USA; 2 units/mg of the total RNA) at 37  C for 30 min. Messenger RNA (mRNA) was purified from the total RNA using a QuickPrep Micro mRNA Purification Kit (Pharmacia, USA). 2.3. Rapid amplification of cDNA ends (RACE)ePCR The full-length cDNA of a putative PPAF or later called PmMasSPH was isolated through RACEePCR. The 50 -rapid amplification of the cDNA end (RACE) reactions was performed with a SMART RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer’s instructions. Briefly, aliquots of mRNA (3.0 mg) obtained from shrimp haemocyte were pre-heated for 10 min at 80  C and immediately cooled on iced water for 10 min. The first strand cDNA was synthesized using PowerScript reverse transcriptase with 50 -RACE CDS primer for 2 h at 42  C. The 50 gene-specific primer (50 -RACE-PPAF) was designed from EST sequence (accession number BI784455) of a PPAF homologue from the haemocyte cDNA library of P. monodon. RACEePCR was performed in a 50-ml reaction volume containing 1 PCR buffer (10 mM TriseHCl pH 8.3, 50 mM KCl, 0.001% gelatin), 1.5 mM of MgCl2, 200 mM of each dNTP (dATP, dCTP, dGTP, and dTTP), 2.5% of DMSO, 0.4 mM of a 50 -RACE-specific primer, 2.0 unit of DyNAzymeÔ II EXT DNA Polymerase (Finnzymes, Finland), 5 ml of 10 UPM and 2.5 ml of 50 RACE-Ready cDNA template. PCR conditions were as follows: five cycles consisting of 94  C for 45 s, 68  C for 45 s and 72  C for 2 min; and 25 cycles consisting of 94  C for 45 s, 55  C for 45 s and 72  C for 2 min. The final extension was carried out at 72  C for 10 min. The RACEePCR product was electrophoretically analysed. The expected DNA fragments of 50 -RACEePCR product was eluted from agarose gel by QIAquickÒ Gel Extraction (Qiagen, Germany) and ligated to pGEMÒ-T Easy vector (Promega). The ligation product was transformed to Escherichia coli JM109. The recombinant clone was identified by colony PCR. Plasmid DNA was extracted by a QIAprepÒ Spin Miniprep Kit (Qiagen) and sequenced using an automatic sequencer (ABI310) at the Bioservice unit (BSU), National Science and Technology Development Agency (NSTDA), Thailand. 2.4. Amplification of a single fragment representing the full-length cDNAs of a PmMasSPH Primer primed at the 50 untranslated region, UTR (50 -UTR-PPAF) and the 30 -UTR (50 -RACE-PPAF) of a PmMasSPH was designed (Table 1). The amplification reaction for GC-rich amplicon of the full-length cDNA was performed using DyNAzyme II EXT DNA Polymerase (Finnzymes) in the presence of 2.5% DMSO under the following conditions: 3 min initial denaturation at 95  C; 30 cycles of a 94  C denaturation step for 1 min, a 68  C annealing step for 1 min and a 72  C extension step for 2 min. The final extension was carried out at 72  C for 10 min. The PCR product was electrophoretically analysed through 1.6% agarose gels and visualized under a UV transilluminator after ethidium bromide staining. The resulting PCR product was cloned and sequenced in both directions. Table 1 Primers and primer sequences used of amplification of a PPAF of P. monodon Primer 0

5 -RACE-PPAF 50 UTR-PPAF PPAF-F1 PPAF-E2 PPAF-F PPAF-R EF1a-F EF1a-R

Sequence (50 e30 )

Note

TTCTCCCTTCCGAAAGCATCACTGGT TGGAGAGAGAGGAAGAGAGAAGGTCGCT TACGTACTCATTGATATCAGGTTTGG ATAAGAATGCGGCCGGCAAATAAATCTTCCGTAGTCCC TACGTACTCATTGATATCAGGTTTGG GCCTCGTTATCCTTGAATCCAGTGA GGTGCTGGACAAGATGAAGGA CGTTCCGGTGATCATGTTCTTGATG

RACE RACE Probe Probe Real-time Real-time Real-time Real-time

PCR PCR PCR PCR

538

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

2.5. DNA sequence analysis DNA sequences were further edited with GENETYX (Software Development Inc.) and blasted against data in the GenBank using BlastN and BlastX (http://www.ncbi.nlm.nih.gov). For the analysis of the potential cleavage site of the signal peptide, SignalP (http://www.cbs.dtu.dk/servics/SignalP) software was used. Multiple sequence alignments of nucleotide and translated amino acids were performed using Clustal W [21]. Aligned sequences were bootstrapped 1000 times using Seqboot. Sequence divergence between different PPAFs was calculated based on the two-parameter method [22] using PRODIST. Boostrapped neighbour-joining trees were constructed using Neighbour and Consense. All phylogenetic reconstruction programs are routine in PHYLIP [23]. Trees are appropriately illustrated using TREEVIEW (http://taxonomy.zoology.gla.ac.uk/rod.html). 2.6. In situ hybridisation Haemocyte specimens from Vibrio harveyi-injected shrimp and saline-injected shrimp (control), were resuspended and fixed immediately after being collected by incubation for 10 min on ice in Modified Alsever Solution, MAS (27 mM sodium citrate, 336 mM NaCl, 115 mM glucose, and 9 mM EDTA, pH 7.0) containing 4% paraformaldehyde. After centrifugation, the haemocyte pellets were washed twice with PBS and resuspended in MAS. The total number of haemocytes was determined by a haemocytometer. Using the cyto-centrifuge, the 2  105 haemocytes were centrifuged onto a poly-L-lysine-coated slide at 1000  g for 5 min. The haemocytes were dried at room temperature for few minutes. The slides were incubated in 0.2 M TriseHCl, pH 7.4, for 10 min. The cells were rinsed with PBS for 5 min and fixed with 4% paraformaldehyde in PBS containing 5 mM MgCl2 for 15 min and then washed with PBS (0.1 M phosphate buffer, pH 7.4 containing 0.9% NaCl). The fixed sample was incubated in 0.25% acetic anhydride in 100 mM triethanolamine (pH 8.0) and washed with 1 SSC. The cells were dehydrated in 100% ethanol. A DNA fragment of PmMasSPH was amplified with PPAF-F and PPAF-R primers, which correspond to a clip domain and a SPH domain in the N-terminal and C-terminal sequence, respectively. A DNA band migrating at 1025 bp was isolated, cloned and transformed into E. coli DH5a. A pGEMÒ-T Easy plasmid containing a 1025 bp of PmMasSPH cDNA was used as a template for the preparation of antisense or sense RNA probe using DIG RNA Labelling Kit (Boehringer-Mannheim-Roche, Germany). The negative control used the same amount of sense RNA probe labelled by digoxigenin. In the hybridisation step, the sample was incubated in a hybridisation buffer (HB buffer) containing 50% formamide, 10% dextran sulphate, 10 Denhardt’solution, 2 SSC, 100 mM DTT, and 0.5 mg ml1 yeast tRNA (Sigma, USA), and 0.5 mg ml1 denatured salmon sperm DNA. The DIG-labelled riboprobes (100 ng) were diluted in the HB buffer and hybridisation was carried out at 55  C overnight. In the washing step, the haemocytes were rinsed twice for 15 min in 2 SSC at 55  C. the haemocyte cells were treated with 20 g/ml RNase A in 2 SSC at 37  C for 30 min and then consecutively washed twice in 1 SSC, 0.5 SSC, 0.1 SSC supplemented with 0.07% of 2-mercaptoethanol at room temperature for 10 min. In the final step, cells were incubated at 55  C with 0.1 SSC for 30 min. After washing, the probe was revealed using alkaline phosphatase-conjugated antibodies (Boehringer-Mannheim-Roche) and BCIP/NBP. 2.7. Real-time RTePCR First-strand cDNAs were generated from 1 mg of DNA-free total RNA sample and 0.5 mg of oligo(dT)18 primers and ImProm-IIÔ Reverse Transcriptase System kit (Promega) according to the manufacturer’s protocol. A real-time RTePCR analysis was performed on the iCycler-iQÔ system (Bio-Rad Laboratories, USA) by SYBR Green I dye detection. The amplification was performed in a 96-well plate in a 20-ml reaction volume containing 10 ml of 2 SYBR Green supermix (Bio-Rad), 2.5 ml of PPAF-F and PPAF-R primers (12 mM), and 5 ml of 1:50 diluted cDNA template. The thermal profile for SYBR Green real-time RTePCR was 95  C for 5 min followed by 40 cycles of denaturation (95  C for 30 s), annealing (55  C for 30 s) and extension (72  C for 30 s). The specificity of PCR was verified by measuring the melting curve of the PCR product at the end of the reaction. The reaction was incubated at 95  C for 1 min and subsequently 50  C for 1 min, followed by 80 repeats of heating for 10 s starting at 50  C with 0.5  C increments. Fluorescent data are specified for collection during primer extension. The relative cDNA ratio was calculated using the value of the threshold cycles. Each sample had three replicates

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

539

in each plate. Sterile-water replaced the template as the negative control. The fluorescence signal of the amplified products was analysed by the data analysis software of the iCycler iQÔ Real-time Detection system (Bio-Rad) using the PCR baseline Subtracted curve fit method. The relative quantification analyses the amount of target transcript relative to an internal standard (elongation factor-1alpha gene, EF-1a) in the same sample of V. harveyi-injected shrimp haemocytes. The Ct values of V. harveyi-injected samples at each time point were normalized with saline-injected samples. A mathematical model [24] was used to determine the relative expression ratio according to the equation: Real expression ratio ðRÞ ¼ Etarget


DCttarget ðcontrol-sampleÞ

= Eref


DCtref ðcontrol-sampleÞ

Etarget is the real-time PCR efficiency of target gene transcript; Eref is the real-time PCR efficiency of reference gene transcript; DCttarget is the Ct deviation of control (saline-injected)  sample (V. harveyi-injected) of the target gene transcript; DCtref is the Ct deviation of control (saline-injected)  sample (V. harveyi-injected) of the reference gene transcript. 3. Results 3.1. Sequence analysis of a PmMasSPH from P. monodon A full-length sequence of a putative PPAF cDNA of P. monodon was obtained by RACEePCR. The cDNA sequence and deduced amino acid sequence have been submitted to the NCBI GenBank as accession number DQ455050. The full-length cDNA consisted of 1958 bp, containing 79 bp in the 50 -untranslated region (UTR), 1572 bp in an open reading frame (ORF) and 293 bp in 30 -UTR with a poly(A) tail (Fig. 1). The translation initiation sequence (nucleotides 77e83, AAGATGC) was in agreement with the Kozak consensus sequence [25] of C. sapidus PPAF (AAGATGC). A non-consensus sequence of poly(A)þ signal AATATA existed 15 bp upstream of a poly(A) tail. The 50 -region nucleotide sequence is GC-rich (70%) containing 11 repeats with a core sequence, CTCGG(G/A) GGTCAAGG(G/A)GG(C/A)GG(T/C). The ORF encoded a polypeptide of 523 amino acids. Analysis of the SignalP program indicated the presence of a cleavage site between amino acids 19 and 20 (SRG-CFF). The calculated molecular mass of the mature protein (504 amino acids) was 51.58 kDa with a predicted isoelectric point (pI) of 4.86. Two putative N-glycosylation sites, NDT (aa position 28) and NDT (aa position 203), were found, suggesting that it is a glycoprotein. Interestingly, the N-terminal domain of the mature protein contains 11 glycine-rich repeats (LGGQGGG), one Nterminal clip domain and the C-terminal domain contains a serine proteinase-like domain from residues 250 to 498. The serine proteinase domain exhibits feature characteristic of a typical serine proteinase, including the conserved His (aa position 301) and Asp (aa position 351) except for Ser (aa position 452) residue that is replaced by glycine, suggesting that the protein is a non-catalytic serine proteinase. Since the involvement in the prophenoloxidase system of the protein has not yet been determined, it is henceforth called a masquerade-like serine proteinase homologue (PmMasSPH). 3.2. Sequence alignment and phylogenetic analysis PmMasSPH was found to be the most similar to a family of arthropod PPAF proteins containing a C-terminal serine proteinase domain and a N-terminal clip domain. Comparison of the PmMasSPH deduced amino acid sequences showed similarity of 69%, 68%, 63%, 62% and 61% to those of Apis mellifera PPAF (accession no. XP623150), C. sapidus PPAF (accession no. AAS60227), Bombyx mori masquerade-like SPH (accession no. AAN77090), Lonomia obliqua PPAF1 (accession no. AAV91458) and T. molitor PPAF (accession no. CAC12696), respectively. Multiple sequence alignment of clip and serine proteinase domains was compared among crustacean SPHs and SPs (Fig. 2). The results revealed that PmMasSPH had higher similarity to crab C. sapidus PPAF (58% identity/68% similarity) than to P. monodon clip-SPH (37% identity/53% similarity), Pacifastacus leniusculus Mas-SPH (40% identity/ 50% similarity), Marsupenaeus japonicus SPH (31% identity/43% similarity), P. monodon SP (31% identity/43% similarity) and Litopenaeus vannamei SP (24% identity/39% similarity), which confirms that PmMasSPH is different from the shrimp proteinases reported previously.

540

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

Fig. 1. The full-length nucleotide (above) and deduced amino acid (below) sequences of a PmMasSPH cDNA from the black tiger shrimp, P. monodon. The start codon, stop codon, putative polyadenylation signal (AATATA) and N-linked glycosylation site (NXS/T) are in bold and underlined. The conserved serine proteinase domain is underlined. Glycine-rich regions are in bold and italicized. Cysteine residues forming the clip domain are boxed. The sites of catalytic triad of serine proteinase are circled.

A phylogenetic analysis of the serine proteinase domain of PPAFs was performed at the amino acid level using PHYLIP by neighbour-joining (NJ) method (Fig. 3). Based on NJ analysis, arthropod PPAEs, SPHs and SPs can be classified into three major groups: (1) PPAEs, (2) shrimp SPH and SPs, and (3) SPHs. The latter group can be classified into two subgroups; one subgroup containing arthopod MasSPHs (AmPPAF, TmPPAF, DmSPH35, BmMasSPH, TmMasSPH, HdPPAFII, PmMasSPH, CsPPAF, PlMasSPH and PmCSPH) and another subgroup containing signal crayfish Pacifastacus leniusculus masquerade-like protein (PlMas).

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

541

Fig. 2. Multiple alignments of amino acid sequence of a clip domain serine proteinase homologue: Penaeus monodon MasSPH (PmMasSPH; accession no. DQ455050), Callinectes sapidus PPAF (CsPPAF; accession no. AAS60227), Penaeus monodon clip-SPH (PmCSPH; accession no. AY600627), Pacifastacus leniusculus MasSPH (PlMasSPH; accession no. AY861652), Marsupenaeus japonicus SPH (MjSPH; accession no. AB161692), Penaeus monodon SP (PmSP; accession no. AAQ93679) and Litopenaeus vannamei SP (LvSP; accession no. AAQ92356). Six-conserved cysteines (C1eC6) of a clip domain are shaded and boxed. The serine proteinase homologue motif is boxed. The amino acid residues corresponding to the catalytic triad of serine proteinases are shaded.

542

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

AmPPAF 399

TmPPAF

414

DmSPH35

658

BmMasSPH

430

PmMasSPH

577

998

CsPPAF TmMasSPH

952

808

HdPPAFII PmCSPH

999

999

PlMasSPH PlMas MsPAP1 1000

SlPPAE1

392

BmPPAF3

632

HdPPAFI 576

HdPPAFIII

658

MsPAP2 955

BmPPAE

1000

779

999

MsPAP3 SlPPAE3

PlppA PmSP 997

LvSP

999 100

MjSPH

Fig. 3. A bootstrapped neighbour-joining tree illustrating relationships between different families of PPAFs. Values at the node (deduced amino acid) indicated the percentage of times that the particular node occurred in 1000 trees generated by bootstrapping the original deduced protein sequences. PmMasSPH: Penaeus monodon masquerade-like SPH (DQ455050); PmCSPH: P. monodon clip-SPH (AY600627); CsPPAF: Callinectes sapidus PPAF (AY555734); PlMasSPH: Pacifastacus leniusculus MasSPH (AY861652); PlMas: P. leniusculus masquerade-like protein (Y11145); TmPPAF: Tenebrio molitor PPAF (AJ400904); TmMasSPH: T. molitor masquerade-like SPH (AB084067); DmSPH35: Drosophila melanogaster SPH35 (AAF52904); AmPPAF: Apis mellifera PPAF (XM_623147); BmMasSPH: Bombyx mori masquerade-like SPH (AAN77090); BmPPAF3: B. mori PPAF3 (AY061936); BmPPAE; B. mori PPAE (AB009670); HdPPAFI: Holotrichia diomphalia PPAFI (AB013088); HdPPAFII: H. diomphalia PPAFII (AJ400903); HdPPAFIII: H. diomphalia PPAFIII (AB079666); SlPPAE1: Spodoptera litura PPAE1 (AY677081); SlPPAE3: S. litura PPAE3 (AY677082); MsPAP2: Manduca sexta PAP2 (AY077643); MsPAP3: M. sexta PAP3 (AY188445); MsPAP1: M. sexta PAP1 (AY789465); MjSPH: Marsupenaeus japonicus SPH (AB161692); PmSP: Penaeus monodon (AAQ93679) and LvSP: Litopenaeus vannamei (AAQ92356).

3.3. PmMasSPH expression in haemocytes of Vibrio harveyi -injected P. monodon by in situ hybridisation The localization and expression level of PmMasSPH transcripts in saline-injected (control) and Vibrio-injected shrimp was determined by in situ hybridisation. P. monodon haemocytes were probed with DIG labelled PmMasSPH antisense and sense riboprobes and detected with alkaline phosphatase-conjugated anti-DIG antibodies. The sense probe was used as a control for signal specificity. Hybridisation signals of PmMasSPH mRNAs were detected in the cytocentrifuged haemocytes (Fig. 4) of control shrimp in which PmMasSPH was expressed in a small amount. An expression of PmMasSPH genes at various times (0, 6, 12, 24, and 72 h) after microbial injections was also determined by in situ hybridisation within shrimp

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

543

Fig. 4. In situ hybridisation of haemocytes of control P. monodon (A and C) and 6 h post V. harveyi infection (B and D) probed with DIG-labelled PmMasSPH-antisense riboprobe (A and B) and DIG-labelled PmMasSPH-sense riboprobe (C and D), and time-course analysis of percentage of PmMasSPH expressing haemocyte after V. harveyi challenge at 0, 6, 24, 48, and 72 h (E).

haemocytes. At 6 h after V. harveyi injection, the number of haemocytes expressing PmMasSPH increased dramatically in shrimp haemocytes (P < 0.05) with higher hybridisation signals than those observed in control animals. These revealed that PmMasSPH mRNAs were synthesized in circulating haemocytes and were up regulated upon microbial injection. The expression level of PmMasSPH transcripts in haemocytes was further verified by a real-time PCR analysis. 3.4. PmMasSPH expression in haemocytes of Vibrio harveyi -injected P. monodon by a real-time RTePCR Expression of PmMasSPH mRNA was determined in the haemocytes of Vibrio harveyi-injected shrimp and salineinjected shrimp (control) using real-time RTePCR at the beginning (0 h) and after 3, 6, 12, 24, 48 and 72 h post injection. The pooled cDNAs of three individuals at each time point were prepared from the total RNA of haemocytes of the challenged shrimp and the control shrimp. The elongation factor-1a (EF1-a) mRNA was used as a reference gene. For an accurate assessment of gene expression by real-time PCR, the PCR efficiency and the PCR specificity of gene must be taken into consideration. Real-time PCR efficiency was calculated from the slope, obtained from the curve plotted between five dilutions of cDNA (log scale) of normal animal and the threshold cycle (Ct) (data not shown), using the equation E ¼ 10[1/slope]. The specificity of the products amplified by SYBR Green PCR was monitored by analysing the corresponding dissociation curve of each amplicon. The dissociation curve showed a single

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

544

peak at expected melting temperature indicating that a PmMasSPH gene was specifically amplified and there was no non-specific amplification or primer-dimer (data not shown). The mRNA expression level of a gene was determined by normalizing the Ct values of the pooled sample of V. harveyi-injected shrimp haemocytes with salineinjected shrimp haemocytes. The expression ratios of certain genes at each time point after injection were calculated relative to EF-1a (data not show). The temporal expression of the PmMasSPH transcript in V. harveyi-challenged shrimps is shown in Fig. 5. The transcription level of PmMasSPH mRNA was decreased at 3 and 12 h after V. harveyi injection (P < 0.05), the lowest expression was observed at 12 h post infection (hpi) (0.33 times compared with relative expression at 0 hpi.). After reaching the lowest level, the expression level of PmMasSPH was significantly increased between 24 and 48 h. The highest expression was observed at 24 hpi (4.13 times compared with relative expression at 0 hpi.). 4. Discussion Here, we report the full-length cDNA encoding a masquerade-like serine proteinase homologue (PmMasSPH) from black tiger shrimp P. monodon isolated using the RACEePCR technique. Some difficulties of RACE technology were encountered and these may probably have resulted from the strong secondary structure of the PmMasSPH mRNA. In the first round of 50 -RACEePCR, only a 800 bp DNA fragment was obtained representing still a partial cDNA. When the second round of RACE was conducted using the GC-rich PCR condition which contains DMSO, it resulted in the production of a RACEePCR product containing the complete 50 end of the mRNA of a PmMasSPH. Analysis of the 50 -nucleotide sequence of PmMasSPH cDNA (175 bp in length) reveals very interesting characteristics. The sequence has a high GC content (73%) and the corresponding mRNA can form a peculiar structure in vivo. Computer modelling of the possible secondary structure was performed using the GeneBee software package (http://www.genebee.msu.su/services/rna2_reduced.html). The prediction shows the formation of a very stable (DG ¼ 57.3 kcal/mol) stem-loop structure, suggesting that the secondary structure existed in PmMasSPH mRNA of P. monodon (data not shown). The presence of such a structure could explain the difficulties that we encountered in isolating the 50 end of this cDNA. It is very likely that the stable secondary structure of the PmMasSPH mRNA made it difficult for the reverse transcriptase and polymerase to copy the 50 end of this molecule [26]. In light of these results, it promised to be quite interesting to verify whether the peculiar sequences that found in the 50 region of PmMasSPH mRNA might play an important role in the regulation of gene expression by means of post-transcriptional or translational control. The PmMasSPH contains a highly conserved C-terminal proteinase domain and one N-terminal clip domain like most of the known arthropod PPAF. The amino acid sequence of the C-terminal serine proteinase domain of PmMasSPH also shares significant homology with those of typical arthropod PPAFs, such as PPAF of C. sapidus, PPAF of A. mellifera, SP-like protein 4 of M. sexta, masquerade-like SPH of B. mori and PPAF of T. molitor. The phylogenetic tree clearly indicates that PmMasSPH is more closely related to non-catalytic PPAFs rather than to the active serine proteinase PPAFs. PmMasSPH and C. sapidus PPAF showed the same branch pattern indicated that PmMasSPH is the closest to C. sapidus PPAF among the examined species. Moreover, both have a glycine not a serine at the putative catalytic site suggesting that they are serine proteinase homologues not active enzymes.

Relative expression

2.5 1.90 2.0 1.5 1.0

0.82 0.46

0.19

0.42

0.40

0.5

0.15

0.0 0

3

6

12

24

48

72

Time interval post injection (hr) Fig. 5. Expression analysis of PmMasSPH mRNA in haemocyte of V. harveyi-injected shrimp by SYBR Green real-time RTePCR. Time-course analysis of PmMasSPH transcripts in haemocyte of P. monodon after V. harveyi challenge at 0, 3, 6, 12, 24, 48, and 72 h.

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

545

Clip domains are features found only in arthropod proteinase. They are cleaved from the proteinase domain upon the activation of the pro-protein but remain attached by disulfide bridges. The clip-domain of PmMasSPH has six cysteine residues involving disulfide bridge formation. This domain is very similar to the clip domain of C. sapidus. The functions of clip domain in arthropod serine proteinases are not yet well established. It seems likely that they are implicated in regulating the function of the enzymes through their interaction with other proteins [4]. The clip domain in the crayfish proteinase exhibits antibacterial activity towards Gram-positive bacteria [14]. Clip domains linked to serine proteinases may have multiple functions in arthropod immune responses. Amio acid alignment of a PmMasSPH with crustacean SPHs (P. monodon clip-SPHs; C. sapidus PPAF; Pacifastacus leniusculus Mas-SPH and M. japonicus SPH) and penaeid SPs (P. monodon and P. vannamei SPs) revealed that PmMasSPH has the highest sequence similarity to C. sapidus PPAF. Although SPs of P. monodon and P. vannamei and SPH of M. japonicus have most of the structural characteristics of SP and clip domains, there are only four and five instead of the six conservative cysteines. These modified domains have been named pseudo-clips [19,27]. The N-terminal amino acid sequence of PmMasSPH is highly hydrophobic and represents a putative signal sequence, which is similar to the C. sapidus PPAF [3]. Two potential of the N-glycosylation site were found, suggesting that PmMasSPH is a glycoprotein. In the N-terminal half of PmMasSPH mature protein, 11 glycine-rich repeat domains (LGGQGGG, residues 81e157 with 71% glycine residues) are present, which are separated by a putative clip domain. No sequence homology with any other known proteins has been found within the glycine-rich repeat domain. However, we found that the number of glycine residues in this domain is similar to novel glycine-rich anti-microbial peptide (acanthoscurrin) constitutively expressed in the haemocytes of the spider, Acanthoscurris gomesiana [28]. Acanthoscurrins are linear cationic peptides with a high glycine (72e73%) amino acid composition and presence of the threefold repeats of 26 amino acid residues (GGGLGGGGLGGGGLGGGKGLGGGGLG) [28]. It is therefore possible that the glycine-rich repeat domain might exhibit antibacterial activity. Moreover, the N-terminal domain of the crayfish masquerade-like protein, a SPH, has a seven-repeated region of a 31-amino acid sequence that contains a high number of glycine residues [16]. This suggests that the glycine-rich repeat region in the N-terminal region of serine proteinase homologues may have an important function for this protein. Therefore, the role of the repeated glycine-rich region of a PmMasSPH protein requires further investigation. The immune reaction of shrimp and crustaceans is mainly achieved through circulating haemocytes and many immune factors located in haemocytes or released into plasma from haemocytes [29]. In situ hybridisation analysis showed that the PmMasSPH was synthesized in haemocyte and PmMasSPH transcription of P. monodon displayed up-regulation after V. harveyi injection. This result was in agreement with that obtained from the real-time RTe PCR, which showed the highest expression of PmMasSPH at 24 h after injection with V. harveyi (4.13-fold difference compared with relative expression at 0 hpi). These results suggest that PmMasSPH protein is an inducible protein by bacterial injection. Kwon et al. [6] investigated the expression of H. diomphalia masquerade-like SPH (45 kDa SPH) mRNA at various times after E. coli injection by Northern blot analysis. The results showed that small amounts of mRNA were detected but mRNA levels were increased at 8 h after E. coli injection and the expression continued for 48 h. In summary, we have cloned and characterized the PmMasSPH cDNA from the black tiger shrimp, P. monodon. The results suggest that PmMasSPH is a non-catalytic PPAF and an immune-inducible gene associated with bacterial infection. However, its biochemical characteristics, expression and regulation patterns, and roles of PmMasSPH in defence mechanisms require further study.

Acknowledgements This work was supported by grants from the National Center for Genetic Engineering and Biotechnology (BIOTEC), the National Science and Technology Development Agency (NSTDA) (BIOTEC Grant no. BT-B-06-SG-094603), and partially supported by Chulalongkorn University under the Ratchadaphisek Somphot Endowment to Shrimp Molecular Biology and Genomics Laboratory. The Postdoctoral Fellowship to P.A. from BIOTEC is gratefully acknowledged. A student fellowship granted to R.J. by the Royal Golden Jubilee Ph.D Program, Thailand Research Fund, is acknowledged.

546

P. Amparyup et al. / Fish & Shellfish Immunology 22 (2007) 535e546

References [1] Sritunyalucksana K, So¨derha¨ll K. The proPO and clotting system in crustaceans. Aquaculture 2000;191:53e9. [2] Wang Y, Jiang H. Purification and characterization of Manduca sexta serpin-6: a serine proteinase inhibitor that selectively inhibits prophenoloxidase-activating proteinase-3. Insect Biochem Mol Biol 2004;34:387e95. [3] Buda ES, Shafer TH. Expression of a serine proteinase homolog prophenoloxidase-activating factor from the blue crab, Callinectes sapidus. Comp Biochem Physiol B 2005;140:521e31. [4] Jiang H, Kanost MR. The clip-domain family of serine proteases in arthropods. Insect Biochem Mol Biol 2000;30:95e105. [5] Ross J, Jiang H, Kanost MR, Wang Y. Serine proteases and their homologs in the Drosophila melanogaster genome: an initial analysis of sequence conservation and phylogenetic relationships. Gene 2003;304:117e31. [6] Kwon TH, Kim MS, Choi HW, Joo CH, Cho MY, Lee BL. A masquerade-like serine proteinase homologue is necessary for phenoloxidase activity in the coleopteran insect, Holotrichia diomphalia larvae. Eur J Biochem 2000;267:6188e96. [7] Lee SY, Cho MY, Hyun JH, Lee KM, Homma K-I, Natori S, et al. Molecular cloning of cDNA for pro-phenol-oxidase-activating factor I, a serine protease is induced by lipopolysaccharide or 1,3-beta-glucan in coleopteran insect, Holotrichia diomphalia larvae. Eur J Biochem 1998;257:615e21. [8] Kim MS, Baek MJ, Lee MH, Park JW, Lee SY, So¨derha¨ll K, et al. A new ester-type serine protease cleaves a masquerade-like protein during prophenoloxidase activation in Holotrichia diomphalia larvae. J Biol Chem 2002;277:39999e40004. [9] Jiang H, Wang Y, Kanost MR. Pro-phenol oxidase activating proteinase from an insect, Manduca sexta: a bacteria-inducible protein similar to Drosophila ester. Proc Natl Acad Sci USA 1998;95:12220e5. [10] Jiang H, Wang Y, Yu X-Q, Kanost MR. Prophenoloxidase-activating proteinase-2 from hemolymph of Manduca sexta: a bacteria-inducible serine proteinase containing two clip domains. J Biol Chem 2003;278:3552e61. [11] Jiang H, Wang Y, Yu X-Q, Zhu Y, Kanost MR. Prophenoloxidase-activating proteinase-3 (PAP-3) from Manduca sexta hemolymph: a clip-domain serine proteinase regulated by serpin-1J and serine proteinase homologs. Insect Biochem Mol Biol 2003;33:1049e60. [12] Lee KY, Zhang R, Kim MS, Park JW, Park HY, Kawabata S-I, et al. A zymogen form of masquerade-like serine proteinase homologue is cleaved during pro-phenoloxidase activation by Ca2þ in coleopteran and Tenebrio molitor larvae. Eur J Biochem 2002;269:4375e83. [13] Aspa´n A, So¨derha¨ll K. Purification of prophenoloxidase from crayfish blood cells and its activating by an endogenous serine proteinase. Insect Biochem 1991;21:363e73. [14] Wang R, Lee SY, Cerenius L, So¨derha¨ll K. Properties of the prophenoloxidase activating enzyme of the freshwater crayfish, Pacifastacus leniusculus. Eur J Biochem 2001;268:895e902. [15] Aspa´n A, Huang T-S, Cerenius L, So¨derha¨ll K. cDNA cloning of prophenoloxidase from the freshwater crayfish Pacifastacus leniusculus and its activation. Proc Natl Acad Sci USA 1995;92:939e43. [16] Huang T-S, Wang H, Lee SY, Johansson MW, So¨derha¨ll K, Cerenius L. A cell adhesion protein from the crayfish Pacifastacus leniusculus, a serine proteinase homologue similar to Drosophila masquerade. J Biol Chem 2000;275:9996e10001. [17] Lee SY, So¨derha¨ll K. Characterization of a pattern recognition protein, a masquerade-like protein, in the freshwater crayfish Pacifastacus leniusculus. J Immunol 2001;166:7319e26. [18] Sricharoen S, Kim JJ, Tunkijjanukij S, So¨derha¨ll I. Exocytosis and proteomic analysis of the vesicle content of granular hemocytes from a crayfish. Dev Comp Immunol 2005;29:1017e31. [19] Rattanachai A, Hirono I, Ohira T, Takahashi Y, Aoki T. Peptidoglycan inducible expression of a serine proteinase homologue from kuruma shrimp (Marsupenaeus japonicus). Fish Shellfish Immunol 2005;18:39e48. [20] Lin C-Y, Hu K-Y, Ho S-H, Song Y-L. Cloning and characterization of a shrimp clip domain serine protease homolog (c-SPH) as a cell adhesion molecule. Dev Comp Immunol 2006;30:1132e44. [21] Thompson JD, Higgins DG, Gibson TJ, Clustal W. improving the sensitivity of progressive multiple sequence weighting, position-specific gap penalties and weight metric choices. Nucleic Acids Res 1994;22:4673e80. [22] Kimura M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980;16:111e20. [23] Felsenstein J. PHYLIP (Phylogenetic Inference Package) version 3.5c. Distributed by the author. Seattle: Department of Genetics, University of Washington; 1993. [24] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:2004e7. [25] Kozak M. Point mutations define a sequence flanking the AUG initiation codon that modulates translation by eukaryotic ribosomes. Cell 1986;44:283e92. [26] Pan H, Halpe J. Cloning, expression, and characterization of chicken transforming growth factor 4. Biochem Biophys Res Commun 2003;303:24e30. [27] Jimenez-Vega F, Vargas-Albores F, So¨derha¨ll K. Characterization of a serine proteinase from Penaeus vannamei haemocytes. Fish Shellfish Immunol 2005;18:101e8. [28] Lorenzini DM, da Silva PI, Fogaca AC, Bulet P, Daffre S. Acanthoscurrin: a novel glycine-rich antimicrobial peptide constitutively expressed in the hemocytes of the spider Acanthoscurria gomesiana. Dev Comp Immunol 2003;27:781e91. [29] Bachere E. Shrimp immunity and disease control. Aquaculture 2000;191:3e11.