Molecular cloning, characterization, and functional analysis of pigeon (Columba livia) Toll-like receptor 5

Molecular cloning, characterization, and functional analysis of pigeon (Columba livia) Toll-like receptor 5 Dan Xiong,,∗,†,‡,§ Li Song,,∗,†,‡,§ Zhiming Pan,,∗,†,‡,§,1 and Xinan Jiao∗,†,‡,§,1 ∗

Jiangsu Key Laboratory of Zoonosis, Yangzhou University, Yangzhou, Jiangsu 225009, China; † Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou University, Yangzhou, Jiangsu 225009, China; ‡ Key Laboratory of Prevention and Control of Biological Hazard Factors (Animal Origin) for Agrifood Safety and Quality, Ministry of Agriculture of China, Yangzhou University, Yangzhou, Jiangsu 225009, China; and § Joint International Research Laboratory of Agriculture and Agri-product Safety of the Ministry of Education, Yangzhou University, Yangzhou, Jiangsu 225009, China sponses were measured by determining its effects on NF-κB activation and cytokine expression. The results showed that HEK293T cells transfected with PiTLR5 robustly activated the NF-κB response to flagellin, but not other TLR stimuli, and induced significant upregulation of IL-1β , IL-8, TNF-α, and IFN-γ , indicating that PiTLR5 is a functional TLR5 homolog. Additionally, following flagellin stimulation of pigeon splenic lymphocytes, the levels of TLR5, NF-κB, IL-6, IL-8, CCL5, and IFN-γ mRNA, assessed using qRT-PCR, were significantly upregulated. Besides, TLR5 knockdown resulted in the significantly downregulated expression of NF-κB and related cytokines/chemokines. Triggering pigeon TLR5 contributes to significant upregulation of inflammatory cytokines and chemokines, suggesting that pigeon TLR5 plays an important role in the innate immune responses.

ABSTRACT Toll-like receptors (TLRs) are pattern recognition receptors that are vital for the recognition of pathogen-associated molecular patterns. TLR5 is responsible for the recognition of bacterial flagellin to induce the NF-κB activation and innate immune responses. In this study, we cloned and identified the TLR5 gene from the King pigeon (Columba livia) designated as PiTLR5. Full-length PiTLR5 cDNA (2583 bp) encoded an 860-amino acid protein containing a signal peptide sequence, 10 leucine-rich repeat domains, a leucine-rich repeat C-terminal domain, a transmembrane domain, and an intracellular Toll-interleukin-1 receptor domain. Pigeon TLR5 mRNA expression was quantified by performing quantitative real-time PCR (qRT-PCR), which showed that PiTLR5 was broadly expressed in all examined tissues, with the highest expression in the liver, peripheral blood mononuclear cells, and spleen. PiTLR5-mediated innate immune re-

Key words: pigeon, Toll-like receptor 5, molecular cloning, characterization, flagellin 2018 Poultry Science 0:1–9 http://dx.doi.org/10.3382/ps/pey244

INTRODUCTION

(PAMPs) (Aderem and Ulevitch, 2000; Bell et al., 2003). To date, 13 TLRs have been identified in mammals and 10 have been found in avians, including the chicken, goose, and duck (Kaiser, 2010; Fang et al., 2012; Xiong et al., 2014). TLRs comprise a family of type I transmembrane receptors (Hashimoto et al., 1988), which are composed of a signal peptide, extracellular leucine-rich repeats (LRRs), a C-terminal capping region overlapping the last LRR (LRR-CT), a transmembrane domain, and a cytoplasmic Toll/interleukin-1 receptor (TIR) signaling domain (Medzhitov, 2001; Matsushima et al., 2007). The extracellular LRR region is responsible for the ligand recognition, whereas a cytoplasmic TIR domain is necessary for binding adaptor molecules involved in TLR signal transduction (Xu et al., 2000; Akira et al., 2006; H¨ acker et al., 2006). Recognition of PAMPs by TLRs rapidly triggers an array of antimicrobial immune responses through the induction of various

Toll-like receptors (TLRs) are a large family of pattern recognition receptors, which are the major cell-surface initiators of innate immune responses to invading pathogens by detecting their evolutionarily conserved pathogen-associated molecular patterns  C 2018 Poultry Science Association Inc. Received February 1, 2018. Accepted May 23, 2018. 1 Corresponding author: [email protected] (ZP); [email protected] (XJ) This work was supported by the National Key Research and Development Program Special Project (2016YFD0501607), the National Natural Science Foundation of China (31372415), the Program for High-end talents of Yangzhou University, the Yangzhou University Science and Technology Innovation Team, the “Six Talent Peaks Program” of Jiangsu Province (NY-028), the Postgraduate Research & Practice Innovation Program of Jiangsu Province, and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

1 Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey244/5045357 by University of Durham - Stockton Campus user on 27 June 2018

2

XIONG ET AL.

inflammatory cytokines, chemokines, and type I interferons (Kumar et al., 2011). Flagellin from Gram-negative bacteria involves a direct interaction with LRRs in TLR5 (Mizel et al., 2003) and activates a range of inflammatory cells via a TLR5-dependent signaling pathway (Hayashi et al., 2001; Mizel and Snipes, 2002). Activation of signal transduction pathways by TLR5, such as the nuclear factor κB (NF-κB) pathway, leads to the expression of various immune-related genes that function in host defense (Feuillet et al., 2006). TLR5-deficient mice lack the flagellin-induced pulmonary inflammatory responses and are more susceptible to Escherichia coli infection of the urinary tract (Feuillet et al., 2006; Andersen-Nissen et al., 2007). Goose TLR5 can recognize flagellin and induce upregulation of NF-κB in transfected HEK293 cells (Fang et al., 2012). The TLR5 R392∗ mutant protein functions as a dominant-negative receptor that severely impairs TLR5-mediated signaling and is associated with susceptibility to pneumonia (Hawn et al., 2003). Collectively, these data indicate that TLR5 plays a role in innate immune responses in mammals, chickens, and geese. However, in other avians, such as pigeon, TLR5 has not yet been cloned and its function has not been reported. In this study, we cloned and analyzed the pigeon (Columba livia) TLR5 sequence, quantified its expression in various tissues, and evaluated its immune function in response to flagellin. Pigeon TLR5 could mediate the activation of NF-κB, and induce the expression of inflammatory cytokines and chemokines in flagellinstimulated splenocytes. These data expand our knowledge of the relationship between TLR5 and the innate immunity in avians, including pigeon, chicken, goose, and other species.

MATERIALS AND METHODS

white goose (Anser anser; GenBank ID: JN641303). PCR was performed using the designed primers (Table 1) and pigeon genomic DNA as a template. PCR was carried out using a Bio-Rad PCR Thermal Cycler in 50 μL reaction volume consisting of 1.25 U of PrimeSTAR Hot Start (HS) DNA Polymerase (Takara), 200 ng of genomic DNA, 1× PrimeSTAR Buffer (Mg2+ plus), 4 μL of 2.5 mM dNTPs, and 0.2 μM of forward and reverse primers. The PCR cycle profile was performed as follows: initial denaturation at 98◦ C for 5 min, followed by 30 cycles of denaturation at 98◦ C for 10 s, annealing at 60◦ C for 15 s, elongation at 72◦ C for 3 min, and final elongation at 72◦ C for 10 min. The PCR products were analyzed by electrophoresis on 1% agarose gel. The amplified PCR product was purified, cloned into pCR2.1-T with a TA Cloning Kit (Invitrogen, CA, USA), and sequenced by Genscript (Nanjing, China).

Bioinformatics Analysis The nucleotide and deduced amino acid sequences of pigeon TLR5 were analyzed using DNAstar software. Simple Modular Architecture Research Tool (SMART; http://smart.embl-heidelberg.de) was used to predict the protein domain structures of pigeon TLR5. TLR5 sequences from different species were compared by the NCBI BLAST search program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Amino acid sequences of human, mouse, chicken, duck, and pigeon were compared by performing multiple sequence alignment with ClustalW (http://www.ebi.ac.uk/clustalw/), and edited with the Genedoc program. Phylogenetic tree was constructed using neighbor-joining method with MEGA 5.1 software using a Poisson correction model with 1000 bootstrap replicates.

Molecular Cloning of Pigeon TLR5 King pigeons (Columba livia) were purchased from Jiangyin Wei Tekai Pigeon Co. (Wuxi, China), housed in isolators, and fed with a pathogen-free diet and water. The procedures described in this study were approved by the Committee on the Ethics of Animal Experiments of Yangzhou University (Approval ID: SYXK [Su] 2012-0029). As TLR5 consists of a single exon in mammalian and birds (Iqbal et al., 2005b; Fang et al., 2012); therefore, its open reading frame (ORF) could be cloned from the genomic DNA from pigeon tissues. Genomic DNA was extracted from the whole blood of the pigeon using a Universal Genomic DNA Extraction Kit Ver. 3.0 (Takara, Dalian, China) according to the manufacturer’s instructions. To clone the pigeon TLR5 gene, primer pairs covering the entire ORF were designed based on the predicted pigeon TLR5 nucleotide (GenBank ID: XM 02,129,9623) and the well-conserved upstream and downstream sequences of TLR5 from chicken (Gallus gallus; GenBank ID: HM747028) and

Tissue Expression Pattern of Pigeon TLR5 In order to determine the pigeon TLR5 transcriptional distribution among the different tissues, total RNA was extracted from spleen, liver, lung, kidney, heart, small intestine, large intestine, cecum, brain, peripheral blood mononuclear cells (PBMCs), and bone of King pigeons using a total RNeasy Plus Mini kit (Qiagen, Hilden, Germany), and cDNA was synthesized from mRNA using a PrimeScrip RT reagent Kit (Takara) according to the manufacturer’s instructions. The concentration and purity of the extracted cDNA were measured using a NanoDrop ND-1000 (Thermo Scientific, Wilmington, DE, USA), and cDNA was subsequently stored at –80◦ C until use. Distribution of pigeon TLR5 mRNA in the tissues was analyzed by performing quantitative real-time PCR (qRT-PCR) with primers PiTLR5-F and PiTLR5-R with the endogenous control of pigeon β -actin (Table 1).

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey244/5045357 by University of Durham - Stockton Campus user on 27 June 2018

3

TOLL-LIKE RECEPTOR 5 GENE IN COLUMBA LIVIA Table 1. PCR primers used in this study.1 Primer Name

Primer Sequences (5 →3 )

Size (bp)

Application

exPiTLR5 F exPiTLR5 R Piβ -actin F Piβ -actin R PiTLR5 F PiTLR5 R PiNF-κ B F PiNF-κ B R PiIL-6 F PiIL-6 R PiIL-8 F PiIL-8 R PiCCL5 F PiCCL5 R PiIFN-γ F PiIFN-γ R Huβ -actin F Huβ -actin R HuIL-1β F HuIL-1β R HuIL-8 F HuIL-8 R HuTNF-α F HuTNF-α R HuIFN-γ F HuIFN-γ R

ACGCGTCGACCATGTTACGTCAACAGCTAGTACTTG CCGCTCGAGATCAATGTGAGACCGTTGTTACAGTC ATGAAGCCCAGAGCAAAAGAG GGGGTGTTGAAGGTCTCAAAC GCATCCACAAGCAGCAGATA TCGAAATGGCATCACGAATA CGTACGATGGGACAACTCCT ACCACTGTTGCCTCATAGGG AGCGTCGATTTGCTGTGCT GATTCCTGGGTAGCTGGGTCT CTGTCCTGGCTCTTTTCCTG CTGCCGTCCTTCAGAGTAGC GTGAAGGACTATTTCTACACCAGCA GCGTCAGGGTTTGCACAGA CAGACGTAGCTGATGGTGGAC AAGCTTTGCCAGATCCTTGAG CATCGTGATGGACTCTGGTG AGGGCAACATAGCACAGCTT GGGCCTCAAGGAAAAGAATC TTCTGCTTGAGAGGTGCTGA TAGCAAAATTGAGGCCAAGG AAACCAAGGCACAGTGGAAC TCCTTCAGACACCCTCAACC AGGCCCCAGTTTGAATTCTT TCCCATGGGTTGTGTGTTTA AAGCACCAGGCATGAAATCT

2583

Amplification of Pigeon TLR5 ORF

223

Quantitative real-time PCR

206

Quantitative real-time PCR

247

Quantitative real-time PCR

107

Quantitative real-time PCR

199

Quantitative real-time PCR

95

Quantitative real-time PCR

233

Quantitative real-time PCR

213

Quantitative real-time PCR

205

Quantitative real-time PCR

227

Quantitative real-time PCR

173

Quantitative real-time PCR

198

Quantitative real-time PCR

The underlined parts in exPiTLR5 F/R represent the introduced SalI and XhoI restriction enzyme sites.

DNA Construct The plasmid pCR2.1-PiTLR5, containing the fulllength of pigeon TLR5 ORF, was digested with SalI and XhoI (Takara) and then subcloned into the eukaryotic expression vector pCMV-Myc (Takara) predigested with the same enzymes. The resulting construct was designated as pCMV-Myc-PiTLR5.

Cell Culture, Transfection, and Stimulation HEK293T cells were grown in 24-well tissue culture plates in DMEM supplemented with 10% fetal bovine serum (FBS) at 37◦ C in an atmosphere of 5% CO2 . After incubation for 12–24 h until 70% confluence was reached, cells were washed with PBS before transfection, and then the medium was replaced with OptiMEM (Gibco, Carlsbad, CA, USA) medium. Transient transfection was performed with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. The NF-kB reporter plasmid pGL4.32[luc2P/NFκB-RE/Hygro] (Promega, Madison, WI, USA) was used in the NF-κB luciferase assay, which contains 5 copies of an NF-κB response element (NF-κB-RE) that drives transcription of the luciferase reporter gene luc2P. Equal amounts of DNA constructs, including pCMV-Myc-PiTLR5 or pCMV-Myc, and 200 ng of reporter plasmid DNA were transfected into HEK293T cells. After transfection for 24 h, cells were harvested for western blotting to verify the expression of pigeon TLR5, or stimulated with different TLR ligands (Invivogen, San Diego, CA, USA) following

the manufacturer’s instructions, including Pam3CSK4 (1 μg/mL), Poly(I: C) (2.5 μg/mL), LPS (100 ng/mL), flagellin (100 ng/mL), R848 (2.5 μg/mL), or CpG (2 μM), respectively. After stimulation for 5 h, cells were harvested for subsequent NF-κB luciferase assay. For PiTLR5-mediated activation of innate immune responses, cells were stimulated with flagellin (100 ng/mL) for 5 h, and harvested to quantify the cytokine expression by qRT-PCR.

Western Blotting Cells were lysed in 2× Laemmli buffer (Sigma, St. Louis, MO, USA), and the lysates were separated in 12% Tris/glicine SDS gel and transferred to a nitrocellulose membrane. The membranes were blocked with blocking buffer (1% BSA and 0.05% Tween-20 in PBS) at room temperature for 2 h, and probed with a monoclonal antibody against the Myc tag (1:2000 diluted in blocking buffer, Sigma) at 4◦ C overnight. After washing 4 times with PBST, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (1:5000 diluted in blocking buffer, Calbiochem, San Diego, CA, USA) at 37◦ C for 1 h. Images were acquired with ECL chemiluminescence substrate (Thermo Scientific) using Amersham Imager 600 Imaging System (GE Healthcare Life Sciences, Pittsburgh, PA, USA).

Luciferase Assay Luciferase assays were performed using the BrightGlo Luciferase Assay System (Promega) according

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey244/5045357 by University of Durham - Stockton Campus user on 27 June 2018

4

XIONG ET AL.

to the manufacturer’s instructions. Cells were cotransfected with the NF-κB luciferase reporter and the pCMV-Myc-PiTLR5 plasmid. The firefly luciferase levels were measured and NF-κB fold inductions were calculated by comparison to the unstimulated cells.

Synthesis of Small Interfering RNA Based on the sequence of pigeon TLR5, small interfering RNA (siRNA) was synthesized from Invitrogen. The siRNAs used were TLR5-siRNA (siTLR5, 5 -GGCUAGCAAGAAGUGAUCUUCAUUU3 ), and the negative control-siRNA (siCtrl, 5 CAAUCGUGAUCAUGUUACGUCAGAA-3 ).

using the 2−ΔΔCT approach and reported as values normalized to the expression level of the housekeeping gene β -actin.

Statistical Analysis Statistical analysis was performed by Student’s t-test with Instat version 5.0 (GraphPad Software, San Diego, CA, USA). Significance differences between groups were determined at ∗ P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001. For the pigeon TLR5 transcription levels between various tissues, different lowercase letters indicated the significant difference (P < 0.05).

RESULTS

Preparation and Stimulation of Pigeon Splenocytes

Molecular Characteristics of Pigeon TLR5 Gene

Pigeon splenocytes were isolated from the spleen of the King pigeon via density gradient centrifugation by using Lymphoprep (specific gravity 1.077; Sigma) according to the manufacturer’s instructions. Splenocytes were suspended and cultured in 24-well microtiter plates filled with complete Roswell Park Memorial Institute 1640 medium containing 10% FBS and 1% penicillin-streptomycin/L-glutamine (Gibco) at a final concentration of 2 × 106 cells/mL. After plating, cells were incubated at 41◦ C overnight and then washed with PBS to remove non-adherent cells. Cells were either not transfected or transfected with siRNA (30 nM) using Lipofectamine RNAiMAX transfection reagent (Invitrogen), respectively, and then stimulated with the TLR5 agonist flagellin at the concentration of 100 ng/mL. After incubation for either 12 or 24 h, cells were harvested for RNA extraction. The expression levels of cytokines and chemokines by cells were evaluated via qRT-PCR.

Full-length pigeon (Columba livia) TLR5 gene was successfully cloned from pigeon genomic DNA. Sequencing results showed that pigeon TLR5 contains an ORF of 2583 bp encoding a protein of 860 amino acids. The sequence was submitted to GenBank and assigned the accession numbers KM086723. The deduced amino acid sequence of the pigeon TLR5 was aligned with sequences from human, mouse, chicken, and duck using ClustalW. A multiple sequence alignment illustrated that the amino acid sequences of pigeon TLR5 shared 51.9% identity with human, 50.5% with mouse, 83.8% with chicken, and 80.2% with duck (Figure 1A). Prediction of protein domains by SMART revealed that pigeon TLR5 amino acid sequence consisted of a signal peptide encompassing the N-terminal 20 amino acid residues, 10 LRR domains including 3 LRR˙TYP, a LRR-CT domain, a transmembrane domain, and a 158-amino acid TIR domain at residues 693–850 in the C-terminus (Figure 1B).

RNA Extraction and qRT-PCR Total mRNA and cDNA preparations of HEK293T cells and splenic lymphocytes were performed as described above and previously (Xiong et al., 2015). qRTPCR was performed to detect the mRNA expression levels of cytokines and chemokines using the ABI 7500 instrument (Applied Biosystems, Foster, CA, USA) and Fsu SYBR Green Master (Roche, Indianapolis, IN, USA). Sequences of primers used for qRT-PCR are shown in Table 1. Amplification was performed in a total volume of 20 μL containing 10 μL of 2× Fsu SYBR Green Master, 2 μL of the diluted cDNA (40 ng/μL), and 0.6 μL of each primer. The real-time PCR program was performed using the following temperature profile: 1 cycle of denaturing at 95◦ C for 30 s, 40 cycles of 95◦ C for 5 s, and 60◦ C for 34 s. Dissociation analysis of amplifications was conducted to confirm that only one PCR product was amplified. Data were calculated

Sequence Analysis of Pigeon TLR5 In order to reveal the molecular evolutionary relationship of pigeon TLR5 with others, a phylogenetic tree based on the amino acid sequences was constructed using the neighbor-joining method. The resulting phylogenetic tree, consisting of 16 protein sequences, was composed of 3 major branches (Figure 2). TLR5 protein sequences from the avian species, Columba livia, Gallus gallus, Anas platyrhynchos, and Anser cygnoides, were in the same subgroup. The sequences from the mammals of Bison bonasus, Ovis aries, Sus scrofa, Macaca mulatta, Pongo pygmaeus, Homo sapiens, Rattus norvegicus, and Mus musculus formed a cluster. The piscine TLR5 protein sequences, including Rainbow trout, Takifugu rubripes, Danio rerio, and Cyprinus carpio, were in another subgroup. The pigeon, chicken, duck, and goose TLR5 sequences were the most closely

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey244/5045357 by University of Durham - Stockton Campus user on 27 June 2018

TOLL-LIKE RECEPTOR 5 GENE IN COLUMBA LIVIA

5

Figure 1. Alignment of TLR5 amino acid sequences and putative domains of pigeon TLR5. (A) Alignment of TLR5 amino acid sequences. Hu, Mo, Ch, Du, and Pi are short for human, mouse, chicken, duck, and pigeon (Columba livia), respectively. Sequences were aligned using ClustalW and edited using Genedoc. In the pigeon sequence, the predicted signal peptide and leucine-rich repeat C-terminal (LRR-CT) domain are underlined. The double continuous lines denote leucine-rich repeats, the single continuous line indicates a transmembrane domain, and the dotted line represents the TIR domain. Shading was performed using the conserved mode (black shading for conserved residues and light gray shading for similar residues). (B) Putative domains of pigeon TLR5 based on the structure-predicting software SMART. Pigeon TLR5 consists of a signal peptide, 10 LRR domains including 3 LRR TYP, a LRR-CT domain, a transmembrane domain, and a 158-amino acid TIR domain in the C-terminus. GenBank accession numbers for the aligned sequences: pigeon (Columba livia) AIK67343, chicken ACR26254, duck AGR50898, human NP 0,03259, and mouse NP 05,8624.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey244/5045357 by University of Durham - Stockton Campus user on 27 June 2018

6

XIONG ET AL.

Figure 2. Phylogenetic tree of the TLR5 amino acid sequences from different species. The tree was constructed by the neighbor-joining method based on the Poisson correction model with 1000 bootstrap replicates using MEGA 5.1 software. The numbers at the nodes indicate bootstrap values. The bar (0.05) indicates the genetic distance. GenBank accession numbers: Gallus gallus (GenBank ID: ACR26254), Anas platyrhynchos (GenBank ID: AGR50898), Anser cygnoides (GenBank ID: AEP71331), Columba livia (GenBank ID: AIK67343), Bison bonasus (GenBank ID: XP 01,085,1131), Ovis aries (GenBank ID: NP 0,011,29398), Sus scrofa (GenBank ID: NP 0,013,35700), Pongo pygmaeus (GenBank ID: BAG55046), Homo sapiens (GenBank ID: NP 0,03259), Macaca mulatta (GenBank ID: NP 0,011,23901), Mus musculus (GenBank ID: NP 05,8624), Rattus norvegicus (GenBank ID: NP 0,011,39300), Danio rerio (GenBank ID: AAI63185), Rainbow trout (GenBank ID: NP 0,011,18216), Cyprinus carpio (GenBank ID: AGH15501), and Takifugu rubripes (GenBank ID: AAW69374).

related, as expected. The observed relationships within the clusters based on TLR5 reflected the taxonomic positions of these species.

Expression Distribution of Pigeon TLR5 mRNA in Different Tissues To analyze the TLR5 tissue distribution, qRTPCR was performed to determine the pigeon TLR5 mRNA expression in the examined tissues. As shown in Figure 3, the pigeon TLR5 gene was highly expressed in the spleen, PBMCs, and liver; moderately expressed in the kidney, cecum, and heart; and minimally expressed in the small intestine, lung, brain, large intestine, and bone.

Immunoblotting To verify the expression of TLR5 in HEK293T cells transfected with pCMV-Myc-PiTLR5 plasmid, an antiMyc tag monoclonal antibody was used in western blotting. The result showed that pigeon TLR5 was successfully expressed in PiTLR5-transfected cells with the presence of a 98 kDa protein band (Figure 4).

Figure 3. The expression distribution of pigeon TLR5 in different tissues conducted by qRT-PCR. Total RNA was extracted from different tissues of the pigeons (Columba livia) and reverse transcribed to cDNA. The expression levels of pigeon TLR5 were determined by qRT-PCR. β -actin was served as the internal reference. The data were shown as (mean ± SEM) of 3 replicates. Different lowercase letters indicated the significant difference (P < 0.05).

Pigeon TLR5-mediated Activation of NF-κB and Cytokines To evaluate the innate immune responses of pigeon TLR5 to flagellin, the NF-κB activation induced by

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey244/5045357 by University of Durham - Stockton Campus user on 27 June 2018

TOLL-LIKE RECEPTOR 5 GENE IN COLUMBA LIVIA

Figure 4. Immunoblotting of pigeon TLR5 in HEK293T cells transfected with pCMV-Myc-PiTLR5. The HEK293T cells transfected with the empty vector pCMV-Myc (Lane 1) or plasmid pCMV-MycPiTLR5 (Lane 2) were harvested and then the proteins were subjected to Western blotting analysis using the anti-Myc tag monoclonal antibody.

7

Figure 6. Pigeon TLR5-mediated cytokine expression by flagellin stimulation. HEK293T cells were transfected with an expression vector (pCMV-Myc-PiTLR5 or pCMV-Myc). Twenty-four hours posttransfection, cells were stimulated with 100 ng/mL of flagellin. After stimulation for 5 h, the expression levels of IL-1β , IL-8, TNF-α , and IFN-γ were measured by qRT-PCR. Data represent the mean ± SEM of 3 independent experiments. ∗ P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001.

Induction of Inflammatory Cytokines and Chemokines in flagellin-stimulated Splenocytes

Figure 5. Pigeon TLR5-mediated activation of NF-κ B by flagellin stimulation. HEK293T cells were transfected with an expression vector (pCMV-Myc-PiTLR5 or pCMV-Myc) and a reporter vector (pGL4.32[luc2P/NF-κ B-RE/Hygro]). Twenty-four hours posttransfection, cells were stimulated with different TLR ligands, including Pam3CSK4 (1 μ g/mL), Poly(I: C) (2.5 μ g/mL), LPS (100 ng/mL), flagellin (100 ng/mL), R848 (2.5 μ g/mL), or CpG (2 μ M), and NFκ B luciferase activity was measured after stimulation for 5 h. Data represent the mean ± SEM of 3 independent experiments. ∗∗ P < 0.01.

flagellin was determined. Pigeon TLR5 ORF was cloned into the pCMV-Myc expression vector and transfected into HEK293T cells. NF-κB-induced luciferase activity was then assayed following stimulation with different TLR ligands for 5 h. As shown in Figure 5, the induction level of NF-κB activity in TLR5-transfected cells after flagellin stimulation was 21-fold higher than that of cells transfected with empty vector control (P < 0.01). However, other TLR ligands had no effects on pigeon TLR5-mediated NF-κB activation. Furthermore, pigeon TLR5-mediated cytokine expression was also determined following flagellin stimulation. The results showed that flagellin induced significantly upregulation of IL-1β (6.9-fold, P < 0.01), IL-8 (9.4-fold, P < 0.001), TNF-α (4.2-fold, P < 0.01), and IFN-γ (3.5fold, P < 0.05) in PiTLR5-transfected cells compared with the control (Figure 6).

To determine the effects of flagellin on pigeon splenocytes, the expression of TLR5, NF-κB, the inflammatory cytokines and chemokines following flagellin stimulation was analyzed. The results showed that the expression of TLR5 and NF-κB increased significantly, especially after 24 h following flagellin stimulation. The inflammatory cytokine IL-6 increased 2.6and 4.9-fold at 12 and 24 h post injection (h.p.i.), respectively, compared with medium-treated controls. The expression of chemokine IL-8 showed about 4-fold increase at both time points, and CCL5 showed a 2.4fold upregulation at 12 h.p.i., followed by an increase at 24 h.p.i. (4.3-fold). The IFN-γ expression was significantly upregulated at 12 h.p.i. (9.3-fold) and then decreased at 24 h.p.i. (3.7-fold). Furthermore, the siRNA interfering assay showed that pigeon TLR5 mRNA levels were downregulated efficiently at both 12 and 24 h by siTLR5 as compared with that in the siCtrl group. TLR5 knockdown also resulted in the significant downregulation of NF-κB and other related cytokines/chemokines (Figure 7).

DISCUSSION TLRs are the key components of the innate immune system and play a critical role by triggering downstream signaling cascades to initiate immune responses against invading pathogens (Schnare et al., 2001). In contrast to mammalian TLR5 orthologs, little is known about the sequence and biological function of avian TLR5. The demonstrated response of chicken and goose TLR5 to flagellin implicates a similar role for avian TLR5 homologs in the immune response of birds (Iqbal et al., 2005b; Fang et al., 2012). In this study, we cloned the pigeon TLR5 gene, same as mammalian TLR5, which mainly consists of

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey244/5045357 by University of Durham - Stockton Campus user on 27 June 2018

8

XIONG ET AL.

Figure 7. Levels of TLR5 (A), NF-κ B (B), IL-6 (C), IL-8 (D), CCL5 (E), and IFN-γ (F) mRNAs in pigeon splenocytes following flagellin stimulation. Pigeon splenocytes were isolated from the spleens of healthy King pigeons. Cells were either not transfected or transfected with siRNA (30 nM) using Lipofectamine RNAiMAX transfection reagent, respectively, and then stimulated with a TLR5 agonist flagellin for 12 and 24 h, respectively. The mRNA expression levels were determined by qRT-PCR. Data represent the mean ± SEM of 3 independent experiments. ∗ P < 0.05, ∗∗ P < 0.01.

extracellular LRRs, a transmembrane and an intracellular TIR domain. LRRs are found in a diverse set of proteins in which they are involved in ligand recognition and signal transduction (Kobe and Kajava, 2001). The structures of LRRs in TLRs are speculated to mediate recognition of specific PAMPs (Liu et al., 2008). The gene expression pattern of TLR5 in pigeon tissues was assessed in this study. TLR5 was expressed in all tissues examined, although the expression levels varied (Figure 3). This is consistent with the finding that chicken TLR5 is expressed in a broad range of tissues and cell types (Iqbal et al., 2005a, b). In this study, high expression levels of pigeon TLR5 mRNA were observed in spleen, PBMCs and liver, whereas the weaker expression was observed in other tissues. The expres-

sion profile of pigeon TLR5 differs from that of chicken TLR5, where high expression was observed in the lungs, thymus, and liver (Slawi´ nska et al., 2013). These findings illustrate species-based differences in the tissue distribution of TLR5 expression. These results imply that the pigeon TLR5 is predominantly expressed in the main immune-related tissues. We can infer that the high expression of pigeon TLR5 in the spleen may be attributed to its importance in the host immunity, since spleen tissues show wide prevalence of the macrophages, dendritic cells, T cells, and B cells (St Paul et al., 2011). Upon activation, TLRs induced MyD88-dependent NF-kB activation, leading to the production of proinflammatory cytokines or chemokines (Takeda et al., 2003). To evaluate the specific response of pigeon

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey244/5045357 by University of Durham - Stockton Campus user on 27 June 2018

TOLL-LIKE RECEPTOR 5 GENE IN COLUMBA LIVIA

TLR5 to flagellin, we determined the effect of flagellin stimulation on NF-κB activity. After stimulation with flagellin, NF-κB-induced luciferase activity in pigeon TLR5-transfected HEK293T cells was significantly higher than that of cells transfected with an empty vector control, indicating that PiTLR5 is a functional TLR5 homolog. However, pigeon TLR5 could not be activated by other TLR ligands, showing the specific recognition of particular PAMP. Our results suggest that pigeon TLR5 is a pathogen receptor that plays a role in the recognition of flagellin. Following flagellin stimulation of pigeon splenocytes, the expression levels of the inflammatory cytokines and chemokines were significantly upregulated, and TLR5 knockdown resulted in the significantly downregulated expression of NF-κB and related cytokines/chemokines, suggesting pigeon TLR5 plays an important role in the innate immune responses (Figure 7). Exposure of chicken TLR5+ cells to flagellin induced upregulation of chicken IL-1β , and an aflagellar Salmonella typhimurium mutant exhibited an enhanced ability to establish systemic infection (Iqbal et al., 2005b). Additional studies to dissect the functional differences and intracellular mechanism between different TLR5 may provide deeper insights into the structure and biological function of pigeon TLR5. In summary, a full-length TLR5 was cloned and identified from the King pigeon (Columba livia), which covered 2583 bp encoding 860 amino acids. We characterized its protein domains and determined that its mRNA is predominantly expressed in the immune-related tissues. We also investigated the function of pigeon TLR5 in response to the agonist, and found flagellin stimulation resulted in the robust activation of NF-κB, and induced significant upregulation of inflammatory cytokines and chemokines, suggesting that pigeon TLR5 plays an important role in the innate immune responses. These results provide a foundation for performing further studies to determine the mechanism underlying the immune-activating effect of pigeon TLR5 at the cellular level, which will benefit research into the innate immune response of avian species.

REFERENCES Aderem, A., and R. J. Ulevitch. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782–787. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124:783–801. Andersen-Nissen, E., T. R. Hawn, K. D. Smith, A. Nachman, A. E. Lampano, S. Uematsu, S. Akira, and A. Aderem. 2007. Cutting edge: Tlr5−/− mice are more susceptible to Escherichia coli urinary tract infection. J. Immunol. 178:4717–4720. Bell, J. K., G. E. Mullen, C. A. Leifer, A. Mazzoni, D. R. Davies, and D. M. Segal. 2003. Leucine-rich repeats and pathogen recognition in Toll-like receptors. Trends Immunol. 24:528–533. Fang, Q., Z. Pan, S. Geng, X. Kang, J. Huang, X. Sun, Q. Li, Y. Cai, and X. Jiao. 2012. Molecular cloning, characterization and expression of goose Toll-like receptor 5. Mol. Immunol. 52:117– 124. Feuillet, V., S. Medjane, I. Mondor, O. Demaria, P. P. Pagni, J. E. Gal´ an, R. A. Flavell, and L. Alexopoulou. 2006. Involvement

9

of Toll-like receptor 5 in the recognition of flagellated bacteria. Proc. Natl. Acad. Sci. 103:12487–12492. H¨acker, H., V. Redecke, B. Blagoev, I. Kratchmarova, L. C. Hsu, G. G. Wang, M. P. Kamps, E. Raz, H. Wagner, G. H¨ acker, M. Mann, and M. Karin. 2006. Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6. Nature 439:204–207. Hashimoto, C., K. L. Hudson, and K. V. Anderson. 1988. The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein. Cell 52:269–279. Hawn, T. R., A. Verbon, K. D. Lettinga, L. P. Zhao, S. S. Li, R. J. Laws, S. J. Skerrett, B. Beutler, L. Schroeder, A. Nachman, A. Ozinsky, K. D. Smith, and A. Aderem. 2003. A common dominant TLR5 stop codon polymorphism abolishes flagellin signaling and is associated with susceptibility to legionnaires’ disease. J. Exp. Med. 198:1563–1572. Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill, and A. Aderem. 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410:1099–1103. Iqbal, M., V. J. Philbin, and A. L. Smith. 2005. Expression patterns of chicken Toll-like receptor mRNA in tissues, immune cell subsets and cell lines. Vet. Immunol. Immunopathol. 104:117–127. Iqbal, M., V. J. Philbin, G. S. Withanage, P. Wigley, R. K. Beal, M. J. Goodchild, P. Barrow, I. McConnell, D. J. Maskell, J. Young, N. Bumstead, Y. Boyd, and A. L. Smith. 2005. Identification and functional characterization of chicken Toll-like receptor 5 reveals a fundamental role in the biology of infection with Salmonella enterica serovar typhimurium. Infect. Immun. 73:2344–2350. Kaiser, P. 2010. Advances in avian immunology-prospects for disease control: a review. Avian Pathol. 39:309–324. Kobe, B., and A. V. Kajava. 2001. The leucine-rich repeat as a protein recognition motif. Curr. Opin. Struct. Biol. 11:725–732. Kumar, H., T. Kawai, and S. Akira. 2011. Pathogen recognition by the innate immune system. Int. Rev. Immunol. 30:16–34. Liu, L., I. Botos, Y. Wang, J. N. Leonard, J. Shiloach, D. M. Segal, and D. R. Davies. 2008. Structural basis of Toll-Like Receptor 3 signaling with double-stranded RNA. Science 320:379–381. Matsushima, N., T. Tanaka, P. Enkhbayar, T. Mikami, M. Taga, K. Yamada, and Y. Kuroki. 2007. Comparative sequence analysis of leucine-rich repeats (LRRs) within vertebrate toll-like receptors. BMC Genomics 8:124–144. Medzhitov, R. 2001. Toll-like receptors and innate immunity. Nat. Rev. Immunol. 1:135–145. Mizel, S. B., and J. A. Snipes. 2002. Gram-negative flagellin-induced self-tolerance is associated with a block in interleukin-1 receptorassociated kinase release from toll-like receptor 5. J. Biol. Chem. 277:22414–22420. Mizel, S. B., A. P. West, and R. R. Hantgan. 2003. Identification of a sequence in human toll-like receptor 5 required for the binding of Gram-negative flagellin. J. Biol. Chem. 278:23624–23629. Schnare, M., G. M. Barton, A. C. Holt, K. Takeda, S. Akira, and R. Medzhitov. 2001. Toll-like receptors control activation of adaptive immune responses. Nat. Immunol. 2:947–950. Slawi´ nska, A., M. D’Andrea, F. Pilla, M. Bednarczyk, and M. Siwek. 2013. Expression profiles of Toll-like receptors 1, 2 and 5 in selected organs of commercial and indigenous chickens. J. Appl. Genetics 54:489–492. St Paul, M., A. I. Mallick, K. Haq, S. Orouji, M. F. Abdul-Careem, and S. Sharif. 2011. In vivo administration of ligands for chicken toll-like receptors 4 and 21 induces the expression of immune system genes in the spleen. Vet. Immunol. Immunopathol. 144:228– 237. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21:335–376. Xiong, D., Z. Pan, X. Kang, J. Wang, L. Song, and X. Jiao. 2014. Molecular cloning and functional analysis of duck Toll-like receptor 5. Res. Vet. Sci. 97:43–45. Xiong, D., L. Song, Z. Pan, X. Chen, S. Geng, and X. Jiao. 2015. Identification and immune functional characterization of pigeon TLR7. IJMS 16:8364–8381. Xu, Y., X. Tao, B. Shen, T. Horng, R. Medzhitov, J. L. Manley, and L. Tong. 2000. Structural basis for signal transduction by the Toll/interleukin-1 receptor domains. Nature 408:111–115.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey244/5045357 by University of Durham - Stockton Campus user on 27 June 2018