Molecular cloning, characterization and gene expression of an antioxidant enzyme catalase (MrCat) from Macrobrachium rosenbergii

Fish & Shellfish Immunology 32 (2012) 670e682

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Molecular cloning, characterization and gene expression of an antioxidant enzyme catalase (MrCat) from Macrobrachium rosenbergii Jesu Arockiaraj a, Sarasvathi Easwvaran a, Puganeshwaran Vanaraja a, Arun Singh b, Rofina Yasmin Othman a, Subha Bhassu a, * a

Centre for Biotechnology in Agriculture Research, Division of Genetics & Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysia Centre for Aquaculture Research and Extension, St. Xavier’s College (Autonomous), Palayamkottai, Tamil Nadu 627002, India

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 15 November 2011 Received in revised form 7 January 2012 Accepted 13 January 2012 Available online 21 January 2012

In this study, we reported a full length of catalase gene (designated as MrCat), identified from the transcriptome database of freshwater prawn Macrobrachium rosenbergii. The complete gene sequence of the MrCat is 2504 base pairs in length, and encodes 516 amino acids. The MrCat protein contains three domains such as catalase 1 (catalase proximal heme-ligand signature) at 350-358, catalase 2 (catalase proximal active site signature) at 60-76 and catalase 3 (catalase family profile) at 20-499. The mRNA expressions of MrCat in healthy and the infectious hypodermal and hematopoietic necrosis virus (IHHNV) challenged M. rosenbergii were examined using quantitative real time polymerase chain reaction (qRTPCR). The MrCat is highly expressed in digestive tract and all the other tissues (walking leg, gills, muscle, hemocyte, hepatopancreas, pleopods, brain and eye stalk) of M. rosenbergii taken for analysis. The expression is strongly up-regulated in digestive tract after IHHNV challenge. To understand its biological activity, the recombinant MrCat gene was constructed and expressed in Escherichia coli BL21 (DE3). The recombinant MrCat existed in high thermal stability and broad spectrum of pH, which showed over 95% enzyme activity between pH 5 and 10.5, and was stable from 40
C to 70
C, and exhibited 85e100% enzyme activity from 30
C to 40
C. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Catalase Macrobrachium rosenbergii IHHNV Gene expression Protein characterization

1. Introduction Antioxidant enzymes play a major role in protecting organisms from the potentially deleterious effects of oxidative stress and have been implicated in pathophysiological processes such as cancer and aging [1e3]. Oxidative stress causes damage to various organs, and it was recently reported that reactive oxygen species are involved in Alzheimer’s disease, Parkinson’s disease and amyotrophic lateral sclerosis [4]. Reactive oxygen is not only the cause of such diseases, but it is also used to signal processes such as apoptosis [5], life span determination [6], cell differentiation [7,8] and pathogen defense [9]. The physiological level of reactive oxygen species (ROS) is maintained by an antioxidant defense system. A major component of the antioxidant defense system consists of three types of primary antioxidant enzymes, including the superoxide dismutases (SODs), catalases, and peroxidases. The first line of defense against ROS * Corresponding author. Tel.: þ60 3 79675829; fax: þ60 3 79675908. E-mail address: [email protected] (S. Bhassu). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2012.01.013

includes the enzymatic activity of SOD, which catalyzes the disproportionation of superoxide to hydrogen Peroxide (H2O2) and water [10,11]. The second involves removal of hydrogen peroxide to water and oxygen, which, in most cells, is normally achieved by catalase and various peroxidases [12,13]. Catalase is a more significant H2O2 scavenger at a higher steady-state concentration [14,15]. Hydrogen peroxide, superoxides and hydroxyl radicals are formed unavoidably during aerobic metabolism. All aerobic organisms have enzymatic and non-enzymatic detoxification systems to combat reactive oxygen. Catalase is a key antioxidant enzyme present in virtually all aerobic organisms. Catalase is one of the most potent catalysts known and its function is crucial to life. Catalase catalyzes conversion of H2O2, a powerful and potentially harmful oxidizing agent to water and molecular oxygen. Catalase also uses H2O2 to oxidize toxins including phenols, formic acid, formaldehyde and alcohols [16]. Catalase has one of the highest turnover numbers of all enzymes; one catalase molecule can convert 40 million molecules of H2O2 to water and oxygen each second [17]. Catalases, superoxide dismutases and peroxidases have a central role in enzymatic detoxification [18].

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

Catalases are the most important enzymes to degrade H2O2, and they are classified into three separate families: Mn-catalases [19], catalase-peroxidases and mono-functional catalases. The monofunctional catalases are the best characterized, and they are homo tetrameric and heme-containing enzymes. As catalases are found in organisms from eubacteria to eukaryotes [9,20e26], they are essential, strongly expressed, and tightly regulated [27]. Catalase comprises four ferriphotophorphyrin groups per molecule, and its enzymatic activity in tissues varies greatly [28,29]. Each monomer harbors a single heme and nicotinamide adenine dinucleotide phosphate (NADPH). The NADPH is bound on the surface of each monomer by 12 amino acid residues [30] and protects the enzyme from oxidation by its H2O2 substrate. However, phagocytosis increases the consumption of oxygen and induces the production of ROS [31]. Catalase is a very highly conserved enzyme that has been identified from numerous species including bacteria, fungi, plants and animals. This enzyme is ubiquitous and present in archaea [22], prokaryotes and eukaryotes [32e35]. To date, much information about the structure and regulation of catalase genes and proteins has been accumulated in mammals [36,37], plants [38] and bacteria [39]. Antioxidant related enzymes, including catalase, are known to be involved in crustaceans’ innate immune reaction [40e43]. It is reported [41,44] that white spot syndrome virus (WSSV) infection decreased the activity of antioxidant enzymes including catalase in Fenneropenaeus indicus and also [42] that the activity of catalase changed in Penaeus monodon after WSSV infection. However, the genetic information about catalase in freshwater giant prawn Macrobrachium rosenbergii is very limited. In our earlier findings, we reported [45,46] that freshwater giant prawn M. rosenbergii industry is affected all over the World due to various viral and bacterial pathogens. However, infectious diseases mainly, infectious hypodermal and hematopoietic necrosis virus (IHHNV) have affected the M. rosenbergii industry enormously. Thus, research into freshwater prawn defense mechanisms is important to develop disease control strategies, but the detailed functions and characterization of immune genes in M. rosenbergii are poorly understood. Since the antioxidant related enzymes, including catalase, are known to be involved in crustaceans’ innate immune reaction, we obtained a full-length antioxidant enzyme, catalase gene from the constructed M. rosenbergii transcriptome unigenes by Illumina’s Solexa sequencing technology. In this study we characterized full-length catalase gene from M. rosenbergii (designated as MrCat), at molecular level and investigated the related mRNA expression profile after IHHNV infection and in addition to the functional activities of purified recombinant MrCat. The results of this article will assist subsequent research on the adaptive responses of M. rosenbergii to conditions of oxidative stress and environmental toxicity. 2. Materials and methods

671

technology. Briefly, unigenes obtained from the assembly of the Illumina Solexa short reads from the RNA sequencing of the muscle, gill and hepatopancreas transcriptomes of M. rosenbergii were mined for sequences which had been identified as catalase gene through BLAST homology search against the NCBI database (http:// blast.ncbi.nlm.nih.gov/Blast). 2.3. Bioinformatic analysis The full-length MrCat sequence was compared with other sequences available in NCBI database and the similarities were analyzed. The open reading frame (ORF) and amino acid sequence of MrCat was obtained by using DNAssist 2.2. Characteristic domains or motifs were identified using the PROSITE profile database [47]. Identity, similarity and gap percentages were calculated using FASTA program [48]. The N-terminal transmembrane sequence was determined by DAS transmembrane prediction program (http://www.sbc.su.se/wmiklos/DAS). Signal peptide analysis was done using the SignalP worldwide P server (http:// www.cbs.dtu.dk). Pair-wise and multiple sequence alignment were analyzed using the ClustalW version 2 program [49]. The phylogenetic relationship of MrCat was determined using the Neighbor-Joining (NJ) Method and PHYLIP (3.69). The presumed tertiary structures were established for MrCat [50] using the SWISS-MODEL prediction algorithm (http://swissmodel.expasy. org/). 2.4. Gene expression analysis of MrCat mRNA after IHHNV infection For IHHNV induced mRNA expression analysis, the prawns were injected with IHHNV, as described by Dhar et al. [51]. Briefly, IHHNV infected prawn tail tissue, tested positive by nested PCR was homogenized in sterile 2% NaCl (1:10, w/v) solution and centrifuged in a tabletop centrifuge at 5000 rpm for 5 min at 4
C. The supernatant was filtered through 0.45 mm filter and used for injecting (100 ml per 10 g prawn) the animals. Samples were collected before (0 h), and after injection (3, 6, 12, 24 and 48 h) and were immediately snap-frozen in liquid nitrogen and stored at 80
C until the total RNA was isolated. Using a sterilized syringe, the hemolymph (0.2e0.5 mL per prawn) was collected from the prawn heart and immediately centrifuged at 3000 g for 10 min at 4
C to allow hemocyte collection for total RNA extraction. Tissue homogenate prepared from healthy tail muscle served as control. All samples were analyzed in three duplications and the results are expressed as relative fold of one sample as mean  standard deviation. 2.5. Total RNA isolation and cDNA conversion Total RNA was isolated from the tissues of each animal using TRI Reagent following manufacturer’s protocol (Guangzhou

2.1. M. rosenbergii Healthy prawns (average body weight 10 g) were obtained from the Bandar Sri Sendayan, Negeri Sembilan, Malaysia. Prawns were maintained in flat-bottomed glass tanks (300 L) with aerated and filtered freshwater at 28  1
C in the laboratory. All prawns were acclimatized for 1 week before challenge to IHHNV. A maximum of 15 prawns per tank were maintained during the experiment.

Table 1 Details of primers used in this study. Name

Target

Sequence (50 -30 direction)

MrCat (F1) MrCat (R2) b-actin (F3)

ACTACAACCAGGAAAGTGCTCCCA TGGCGTTCCTCTTCGTTCATGACT ACCACCGAAATTGCTCCATCCTCT

2.2. Identification of full-length MrCat

MrCat (F5)

qRT-PCR amplification qRT-PCR amplification qRT-PCR internal control qRT-PCR internal control ORF amplification

A full-length MrCat gene was identified from the M. rosenbergii transcriptome unigenes obtained by Illumina’s Solexa sequencing

MrCat (R6)

ORF amplification

b-actin (R4)

ACGGTCACTTGTTCACCATCGGCATT GAGAGAgaattcTCAGAAGAGGAACCC AGCAACACA EcoRI GAGAGActgcag ATGGCGATGGGTGTC ATTGTAGGA PstI

Fig. 1. Nucleotide and deduced amino acid sequences of M. rosenbergii catalase (MrCat). The nucleotide sequence is numbered from 50 end, and the single letter amino acid code is shown below the corresponding codon. The start codon (ATG) and the end codon (TAA) is bolded. In amino acid sequence, the catalase family profile (catalase 3) is available between 20 and 499 and it is highlighted in gray color. The termination code is marked with an asterisk.

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

673

Fig. 1. (continued).

Dongsheng Biotech, China). Total RNA was treated with RNase free DNA set (5 Prime GmbH, Hamburg, Germany) to remove the contaminating DNA. The total RNA concentration was measured spectrophotometrically (NanoVue Plus Spectrophotometer, GE Healthcare UK Ltd., England). First-strand cDNA was synthesized from total RNA by M-MLV reverse transcriptase (Promega, USA) following the manufacturer’s protocol with AOLP primer (50 GGCCACGCGTCGACTAGTAC(T)16(A/C/G)30 ).

Table 1. After the PCR program, data were analyzed with ABI 7500 SDS software (Applied Biosystems). To maintain consistency, the baseline was set automatically by the software. The comparative CT method (2ddCT method) was used to analyze the expression level of MrCat [52].

2.6. qRT-PCR analysis of MrCat

All the cloning experiments were carried out according to Sambrook et al. [53] with slight modifications [45]. The primer set of MrCat was designed with the corresponding restriction enzyme sites for EcoRI and PstI at the N- and C-termini respectively (Table 1) in order to clone the coding sequence into the expression vector, pMAL-c2X (New England Biolabs UK Ltd, United Kingdom). Using plasmid DNA of MrCat as a template and Taq DNA polymerase (Invitrogen BioServices India Pvt. Ltd., Bangalore, India), PCR was carried out to amplify the coding sequence. The PCR product was purified using the QIAquick Gel Extraction Kit (QIAGEN India Pvt. Ltd., New Delhi, India). Then, both insert and vector were digested with the respective restriction enzymes. The ligated product was transformed into XL1 blue cells and the correct recombinant product (as confirmed by restriction enzyme digestion and sequencing) was transformed into competent Escherichia coli BL21 (DE3) cells for protein expression.

The relative expression of MrCat in the hemocytes, pleopods, walking legs, eye stalk, gill, hepatopancreas, stomach, intestine, brain and muscle were measured by quantitative real time polymerase chain reaction (qRT-PCR). qRT-PCR was carried out using a ABI 7500 Real time Detection System (Applied Biosystems) in 20 ml reaction volume containing 4 ml of cDNA from each tissue, 10 ml of Fast SYBRÒ Green Master Mix, 0.5 ml of each primer (20 pmol/ml) and 5 ml dH2O. The qRT-PCR cycle profile was 1 cycle of 95
C for 10 s, followed by 35 cycles of 95
C for 5 s, 58
C for 10 s and 72
C for 20 s and finally 1 cycle of 95
C for 15 s, 60
C for 30 s and 95
C for 15 s. The same qRT-PCR cycle profile was used for the internal control gene, b-actin. The b-actin primers were designed based on EST of 1357 bp (GenBank Accession No. AY651918) from M. rosenbergii. The primer details of gene specific primer (MrCat) and internal control (b-actin) are presented in

2.7. Cloning of MrCat gene into the pMAL expression vector system

Fig. 2. Multiple sequence alignments of M. rosenbergii catalase with five other homologous catalase amino acid sequences. Catalase of fleshy prawn F. chinensis (ABW82155), Pacific white shrimp L. vannamei (AAR99908), mud crab S. paramamosain (ACX46120), gazami crab P. trituberculatus (ACI13850) and pearl oyster P. fucata (ADW08700) are shown. Asterisk marks indicate identical amino acids and numbers to the right indicate the amino acid position of catalase in the corresponding species. Conserved substitutions are indicated by (:) and semi-conserved substitutions are indicated by (.). Deletions are indicated by dashes. GenBank accession numbers for the amino acid sequences of catalase given in the parentheses. The proximal active site signature (FDRERIPERVVHAKGAGA) is highlighted in green color. The proximal heme-ligand signature (RLFSYNDT) is highlighted in blue color. The conserved catalytic amino acids (His71, Asn144 and Tyr354) are boxed in blue color. Peroxysome targeting signal (AKL) is boxed in red color. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

675

Fig. 2. (continued).

2.8. Induction of recombinant MrCat protein expression in E. coli BL21 Transformed E. coli BL21 (DE3) cells were incubated in ampicillin (100 mg/mL) Luria broth (LB) overnight. This culture was then used to inoculate 100 mL of LB broth in 0.2% glucose-rich medium with ampicillin at 37
C until cell density reached 0.7 at OD600. E. coli BL21 (DE3) harboring pMAL-c2x-MrCat was induced for over expression with 1 mM isopropyl-b-thiogalactopyranoside (IPTG)

and incubated at 15
C for 4 h. Cells were harvested by centrifugation (4000 g for 20 min at 4
C). E. coli BL21 (DE3) uninduced culture was used as a negative control. Then the cells were resuspended in column buffer (TriseHCl, pH 7.4, 200 mM NaCl) and frozen at 20
C overnight. After thawing on ice, cells were disrupted by sonication. The crude MrCat fusion protein fused with maltose binding protein (MBP) was purified using pMALÔ protein fusion and purification system protocol (New England Biolabs UK Ltd, United Kingdom). Further, DEAE-SepharoseÔ ion exchange

676

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

chromatography method used to purify the recombinant MrCat protein away from MBP and the protease, and we also provided an additional purification step for removing trace contaminants according to the manufacture’s protocol (New England Biolabs UK Ltd, United Kingdom). Then the purity of the expressed enzyme was verified by 12% SDS-PAGE and the molecular weight of target protein was evaluated using protein molecular weight standards. Proteins were visualized by staining with 0.05% Coomassie blue R250. The concentrations of purified proteins were determined by the method of Bradford using bovine serum albumin (BSA) as the standard [54]. The purified enzyme was kept at 80
C until determination of enzymatic activity. 2.9. Catalase enzyme activity and functional properties of MrCat Catalase enzyme activity assay and their functional properties of recombinant MrCat protein (rMrCat) experiments were carried out according to Aebi [55] with slight modifications [15]. Briefly, catalase enzyme activity was evaluated by the rate of H2O2 decomposition measured at 240 nm. The purified recombinant MrCat protein (0.5 mg) was added to 1 mL of 70 mM potassium phosphate buffer (pH 6.5) containing 15 mM H2O2. The decrease in absorbance at 240 nm was observed at 30
C. One unit was defined as the amount of enzyme capable of catalyzing the degradation of 1 mmol of H2O2 min1. The concentration of protein was measured following the methodology of Lowry et al. [56]. The rMrCat enzyme activity was observed at different temperatures (30
Ce100
C) and pH (3.0e10.5) to find out the optimum temperature and pH. The acetate, phosphate and glycine-NaOH buffers were used to adjust the pH. The activity assay was carried out in three replicates, and the average measurement was taken for the final calculation. 2.10. Statistics For comparison of relative MrCat mRNA expression, statistical analysis was performed using one-way ANOVA and mean comparisons were performed by Tukey’s Multiple Range Test using SPSS 11.5 at the 5% significant level. 3. Results 3.1. Identification and sequence analysis of MrCat A full-length gene MrCat was identified from the M. rosenbergii transcriptome unigenes obtained by Illumina’s Solexa sequencing technology. The nucleotide and deduced amino acid structure of MrCat is given in Fig. 1. The MrCat nucleotide sequence has been deposited in GenBank under accession number HQ668089. The complete nucleotide sequence of MrCat is 2504 base pairs (bp), which consisted of a 50 untranslated region (UTR) of 107 bp, an open reading frame of 1548 bp encoding 516 amino acid (aa) residues and a 30 UTR of 849 bp. This putative MrCat amino acid sequence does not have either signal peptide region or transmembrane region. The deduced mature MrCat protein had a theoretical mass of 59 kDa and an isoelectric point of 6.6. 3.2. Bioinformatic analysis of MrCat Prosite analysis showed that MrCat amino acid contains three catalase domains. They are catalase 1 (catalase proximal hemeligand signature) at 350-358, catalase 2 (catalase proximal active site signature) at 60-76 and catalase 3 (catalase family profile) at 20-499 (Fig. 1). There are another 28 high probability motifs which occurred in the MrCat sequence. They are 2 cAMP and cGMP

dependent protein kinase phosphorylation sites at 15-18 and 412415; 7 casein kinase II phosphorylation sites at 18-21, 121-124, 252255, 281-284, 353-356, 430-433 and 479-482; 6 N-myristoylation sites at 28-33, 113-118, 117-122, 200-205, 363-368 and 488-493; 1 amidation site at Ile99-gly100-Lys101-Lys102; 6 protein kinase C phosphorylation sites at 121-123, 163-165, 183-185, 197-199, 215217and 357-359; 5 N-glycosylation sites at 240-243, 355-358, 365368, 435-438 and 477-480 and 1 microbodies C-terminal targeting signal at Ala514-Lys515-Lue516. The sequence similarities between MrCat and other catalase proteins were analyzed using the ClustalW software (Fig. 2). The length of the amino acid sequences taken for multi sequence alignment ranged from 505 to 520, except, gazami crab Portunus trituberculatus (468 aa). There are plenty of identical, conserved and semi-conserved regions available both in the N terminal as well as C-terminal region. MrCat exhibited 93% similarity to the catalase protein from Pacific white shrimp Litopenaeus vannamei (Table 2). In overall performances of homologous comparisons, all the individuals taken for analysis showed not less than 80% similarity to MrCat. The phylogenetic analysis (Fig. 3) shows the relative position of MrCat in evolution with 27 representative species. Analysis results show that the MrCat is closely related to catalase from fleshy prawn Fenneropenaeus chinensis and L. vannamei and formed a sister group with catalase from mud crab Scylla paramamosain and P. trituberculatus and finally clustered with catalase from rotifer Brachionus plicatilis. Based on the similarities with other homologous catalase, the potential tertiary structure of MrCat was established using the Swiss-model prediction algorithm program. The Swiss-model 3D structure of MrCat was drawn based on the template ‘1f4jB’ from

Table 2 Amino acid sequence similarities (%) between M. rosenbergii catalase and other catalase from the closest organisms (gap ¼ 0%). Species Molluscs Pinctada fucata Cristaria plicata Chlamys farreri Anemonia viridis Crassostrea gigas Hyriopsis cumingii Haliotis discus discus Arthropods Fenneropenaeus chinensis Litopenaeus vannamei Scylla paramamosain Portunus trituberculatus Pediculus humanus corporis Brachionus plicatilis Aedes aegypti Daphnia magna Pisces Hypophthalmichthys molitrix Rachycentron canadum Ctenopharyngodon idella Takifugu obscurus Oplegnathus fasciatus Danio rerio Aves Melopsittacus undulatus Mammals Mus musculus Bos taurus Canis lupus familiaris Rattus norvegicus Cavia porcellus

GenBank accession no.

Amino acid length

Identity (%)

Similarity (%)

ADW08700 ADM64337 ABI64115 AAZ50618 ABS18267 ADL14588 ABF67505

495 495 504 497 506 460 488

73 73 70 71 69 74 71

85 86 84 84 81 87 85

ABW82155 AAR99908 ACX46120 ACI13850 EEB14972 BAH28837 EAT34333 ACU81116

520 501 517 449 484 505 504 495

83 84 82 84 75 71 68 73

92 93 90 90 84 86 82 83

ADJ67807 ACO07305 ACL99859 ABV24056 AAU44617 AAH51626

495 516 495 501 502 495

70 68 70 69 69 69

82 80 82 81 80 82

AAO72713

495

71

83

AAA37373 DAA21837 BAA36420 AAH81853 CAB57222

507 507 507 507 495

69 70 69 69 71

82 81 81 81 83

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

677

Fig. 3. A phylogenetic tree of MrCat with 27 other homologous catalase species was reconstructed by the Neighbor-Joining Method. The tree is based on an alignment corresponding to full-length amino acid sequences, using PHYLIP (3.69). The numbers shown at the branches denote the bootstrap majority consensus values of 1000 replicates. The GenBank accession number and gene details are given in Table 2.

a tetragonal crystal of human Homo sapiens (homo tetrameric) erythrocyte catalase. The sequence similarity between the template and the target is 85.18% (Fig. 4). The root mean square deviation (rmsd) between MrCat and the template ‘1f4jB’ is 2.40 Å over 463 aligned residues. 3.3. qRT-PCR analysis of MrCat The MrCat mRNA tissue distribution in healthy M. rosenbergii and its induction pattern challenged by IHHNV were determined using quantitative real time PCR. In the healthy tissue, MrCat expression was significantly (P < 0.05) higher in digestive tract followed by hemocyte, gills, muscle, pleopods, brain, eye stalk, walking legs and hepatopancreas (Fig. 5A). Hence, digestive tract was selected to investigate the temporary expression of MrCat after IHHNV challenge.

To analyze the expression profile of M. rosenbergii MrCat during disease challenge, M. rosenbergii were challenged with IHHNV and the digestive tract was analyzed by quantitative real time PCR (Fig. 5B). The levels of MrCat mRNA transcripts significantly (P < 0.05) increased at 3 h post-injection (p.i.) and then a slight decrease of MrCat mRNA expression at 6 h, and again a slight increase at 12 h and at 24 h followed by a significant (P < 0.05) decrease in MrCat mRNA expression at 48 h. Significant differences (P < 0.05) in expression were found at 3, 6, 12, 24 and 48 h post-injection between the IHHNV challenged and the control group. 3.4. Protein expression and purification of MrCat The putative mature MrCat molecule was expressed in E. coli cells after cloning the cDNA into the EcoRI and PstI restriction sites

678

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

Fig. 4. The Swiss-Model 3D structure of M. rosenbergii catalase drawn based on the template ‘1f4jB’ (2.40 Å) from the tetragonal crystals of human Homo sapiens (homo tetrameric) erythrocyte catalase.

of pMAL-c2x-MrCat expression vector, IPTG driven expression of MrCat was done in E. coli BL 21 (DE3) cells. The recombinant MrCat was purified from the supernatant of induced cells. Fig. 6 (lane FP) shows the result of SDS-PAGE of the recombinant MrCat along with fusion protein, the recombinant protein gave a major single band with molecular mass around 101.5 kDa (42.5 kDa for MBP and 59 kDa for MrCat). Further, the recombinant MrCat protein has been purified from the MBP fusion protein using DEAE-Sepharose ion exchange chromatography method, and finally the recombinant MrCat protein showed a single band with molecular weight about 59 kDa (Fig. 6). 3.5. Catalase enzyme activity and functional properties of MrCat To determine the enzymatic activity of recombinant MrCat protein, we conducted the enzyme activity assay at various temperatures and pH. The enzyme activity assay of the recombinant MrCat protein was measured at various temperatures given in Fig. 7. One hundred percentage relative activities was observed at 30
C and thereafter decreased linearly until 100
C. The thermal stability of recombinant MrCat protein at various temperatures is presented in Fig. 8. At 50
C, M. rosenbergii catalase enzyme inactivation was observed for over 30 min. And we also observed the enzyme inactivation above 50
C. Further, we determined the optimum pH of recombinant MrCat enzyme activity (Fig. 9). The optimum pH of the recombinant MrCat was determined to be in

a pH range of 3.0e10.5 by incubating the enzyme at 30
C for 30 min, and pH 7.0 was optimal. 4. Discussion Catalase is one of the main enzymes of the biological antioxidant system. It plays an important role in the antioxidant defense pathways [41,42,57e59]. The characterization of catalase and its role in immunomodulation has been reported widely [34,42,43,60]. The active site of catalase is hemoglobin, and it acts as the catalytic in the decomposition of H2O2 into water and molecular oxygen, and prevents lipid peroxidation, protecting the body from injury [61]. M. rosenbergii, which is of great economical importance and known as ‘freshwater giant prawn’ in the aquaculture industry of South East Asian countries, has been suffering serious problems in recent years due to the outbreak of diseases. Understanding the immunity of freshwater prawn is beneficial of managing diseases and developing sustainable prawn culture. So far, the antioxidant systems of M. rosenbergii were not been clearly understood. In this study, we reported an antioxidant enzyme, catalase from M. rosenbergii. Catalase is ubiquitous in prokaryotes and eukaryotes as a hemoprotein with four identical subunits, the size of subunit in the range of 460e590 amino acids, and the molecular weight approximately 50e60 kDa [21,32]. In fact, the molecular weight of MrCat was 59 kDa, which was very close to that of vertebrate and invertebrate. Moreover, several characteristic motifs or signature sequences of

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

679

Fig. 5. Gene expression patterns of MrCat by qRT-PCR. 5A: Tissue distribution of MrCat in different tissues of M. rosenbergii. Data are expressed as a ratio to MrCat mRNA expression in hepatopancreas. 5B: The time course of MrCat mRNA expression in digestive tract at 0, 3, 6, 12, 24, and 48 h post-injection with IHHNV. Data are expressed as a ratio to MrCat mRNA in sample from unchallenged control group.

the catalase gene family were also identified in MrCat such as catalase 1 (catalase proximal heme-ligand signature) at 350-358, catalase 2 (catalase proximal active site signature) at 60-76 and catalase 3 (catalase family profile) at 20-499. Nevertheless, several differences were found in the sequence of the deduced amino acid sequence of MrCat, it displayed highest sequence similarities to catalase of L. vannamei. For instance, the Asn61 (N) residue of catalytic site motif in other invertebrate such as peal oyster Pinctada fucata was replaced by Asp61 (D) residue in MrCat, this case was also found in Chinese shrimp F. chinensis [44]. Two glycosylation sites (N145 and N435) were found in MrCat just the same as F. chinensis [44], but only one (N145) was found in freshwater mussel Cristaria plicata [35]. The mature catalase proteins were targeted to the interior of peroxisomes by peroxysome targeting signal (PTS), three amino acids were usually at the C-terminus of the protein, which served as the PTS [62]. The prototypic sequence (with many variations) was ‘Ser-Lys-Leu’. This motif, and its variations, was known in the PTS1 [63]. The PTS were ‘Ala-Asn-Leu’ in human, mouse and rat catalase, ‘Ser-Lys-Met’ in zebrafish catalase [34], ‘Ala-Asn-Leu’ in saltwater bivalves catalase [64], ‘Ser-Lys-Thr’ in Penaeus vannamei catalase [65] and ‘Lys-SerLeu’ in C. plicata [35]. However, the C-terminus of MrCat was ‘Ala514-Lys515-Lue516’. Besides for this sequence, its amino acid composition was consistent with PTS1. This suggested that MrCat might be also a peroxisomal glycoprotein family. A phylogenetic tree was constructed using various catalases from mollusks, arthropods, fishes, bird and mammals to evaluate

the molecular evolutionary relationships of MrCat. It is closely related to F. chinensis and L. vannamei and formed a sister group with catalase from S. paramamosain and P. trituberculatus and finally clustered with catalase from B. plicatilis. Therefore, phylogenetic analysis provides evidence that the MrCat has been derived from a common ancestor, but remains further extending with the identification of new catalase genes. In order to further elucidate the function of MrCat, the presumed tertiary structure of the molecule was established based on the template ‘1f4jB’ from a tetragonal crystal of human Homo sapiens (homo tetrameric) erythrocyte catalase using the Swissmodel prediction algorithm, and the secondary structure elements were indicated by ‘a’ (a-helix) and ‘b’ (b-sheets). About 52% of MrCat was composed of regular secondary structural motifs, in which a-helix accounted for 30% and b-sheet for 22%. The content of a-helix and b-sheet in MrCat was very similar to that of human catalase (25% a-helix and 14% b-sheet) [30] and Chlamys farreri (25% a-helix and 18% b-sheet) [34]. As reported by Li et al. [34] the predicted tertiary structure of MrCat, His71 was to be neighboring b2, Asn145 was located on b4’, and Tyr357 was speculated to be in a10. These spatial locations of the catalytic residues were exactly consistent with that in catalase beef [66], human [30] and C. farreri [34] and catalase A from brewer’s yeast Saccharomyces cerevisiae [67], and infer that MrCat probably performed its function in the same mechanism as human catalase. The native expression and localization of MrCat in M. rosenbergii was investigated at the transcriptional level. Even though MrCat

680

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

Fig. 6. Expression and purification of the recombinant M. rosenbergii catalase protein. Protein samples were separated by SDS-PAGE and stained with Coomassie brilliant blue. Un, before induction with IPTG; In, after IPTG induction; FP, purified fusion protein, M, protein marker and P, purified recombinant protein.

mRNA was found in many tissues, e.g., hepatopancreas, walking legs, gills, muscle, hemocyte, digestive tract, pleopods, brain and eye stalk, it was highly expressed in the digestive tract and hence its expression was analyzed in M. rosenbergii challenged with IHHNV virus. The results of mRNA expression in digestive tract were similar with the earlier findings of F. chinensis catalase [44]. These results suggest that homeostasis of redox controlled by immune regulated catalase is one of the most crucial factors affecting host survival during continuous hostemicrobe interaction in the gastrointestinal tract of flies as described by Zhang et al. [44]. Viral infection is indeed a stressful process [68,69]. Cellular responses to stressors are an evolutionary ancient, ubiquitous and essential mechanism for cell survival. Diseases caused by viruses are the greatest challenge to worldwide shrimp aquaculture [70]. Levine et al. [71] reported that microbial elicitors could trigger oxidative

burst, leading to rapid production of reactive oxygen species to combat and destroy invading microorganisms. Further Lambert et al. [72] and Liu et al. [73] reported that H2O2, the most stable reactive oxygen intermediate, is produced to directly contact and kill pathogenic microorganisms at the early stages of infection, or to induce cellular protection and defense through certain signal transduction pathways. During this stage, catalase must be restricted to a low level to avoid the degradation of H2O2, though H2O2 also has poisonous effects on M. rosenbergii. The results of mRNA expression of MrCat after IHHNV challenge indicate the adverse effect of H2O2 as reported by Li et al. [34]. And also, they suggested that catalase stringently regulated H2O2 and was involved in eliminating ROS. The results of the present study also indicated that MrCat was a constitutive and inducible protein involved in the host innate immune response through elimination of H2O2 in M. rosenbergii. This MrCat sequence was validated by the pMAL-c2x-MrCat expression vector and expressed in E. coli as fusion protein. Recombinant MrCat was purified to homogeneity using pMALÔ protein fusion and purification system. The molecular mass of protein was about 59 kDa on 12% SDS-PAGE gel, similar to the earlier reported catalase from C. plicata [35]. The purified recombinant MrCat protein exhibited catalase enzyme activity. The recombinant MrCat existed in high thermal stability and broad spectrum of pH, which showed over 95% enzyme activity between pH 5 and 10.5, and was stable from 40
C to 70
C, and exhibited 85e100% enzyme activity from 30
C to 40
C, similar to catalase from Listeria seeligeri and [74] and C. plicata [35]. The results of catalase enzyme activity assays indicated that the MrCat enzyme was stable. Murthy et al. [75] reported that the high thermal stability might be due to the long b-barrel domain containing a heme moiety in the catalytic site. Similarly, previous report [66] on beef liver catalase structure revealed that b-barrel domain with anti-parallel b-sheets supported maintenance of enzymatic activity at higher temperatures. In conclusion, we identified a full-length MrCat gene from the constructed M. rosenbergii transcriptome database. The mRNA encoding catalase was found in all the tissues tested. The expression of catalase in digestive tract changed rapidly and dynamically in response to IHHNV infection. The catalase mRNA expression after infection indicated that it was inducible and might be involved in the M. rosenbergii immune response. We successfully expressed the MrCat gene from M. rosenbergii through an E. coli expression vector and acquired a highly purified protein and showed antioxidant activity against H2O2. These data would be helpful to understand the significance of catalase in M. rosenbergii defense system.

Fig. 7. Enzyme activity assay of the recombinant M. rosenbergii catalase was measured at various temperatures.

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

681

Fig. 8. Thermal stability of recombinant M. rosenbergii catalase at various temperatures.

Fig. 9. Percentage relative enzyme activity of recombinant M. rosenbergii catalase at different pH conditions.

Acknowledgments The authors would like to thank the funding agency ABI (53-0203-1030) for supporting this research. And also University of Malaya, Kuala Lumpur, Malaysia is gratefully acknowledged for providing the postdoctoral research fellowship grant to the first author J. Arockiaraj. References [1] Sun Y. Free radicals, antioxidant enzymes, and carcinogenesis. Free Radic Biol Med 1990;8:583e99. [2] Sohal RS, Orr WC. Relationship between antioxidants, proxidants, and the aging process. Ann NY Acad Sci 1992;663:74e84. [3] Gerhard GS, Kauffman EJ, Grundy MA. Molecular cloning and sequence analysis of the Danio rerio catalase gene. Comp Biochem Physiol Part B 2000;127:447e57. [4] Barnham KJ, Masters CL, Bush AI. Neurodegenerative diseases and oxidative stress. Nat Rev Drug Discov 2004;3:205e14. [5] Cantara S, Donnini S, Giachetti A, Thorpe PE, Ziche M. Exogenous BH4/Bcl-2 peptide reverts coronary endothelial cell apoptosis induced by oxidative stress. J Vasc Res 2004;41:202e7. [6] Droge W. Oxidative stress and aging. Adv Exp Med Biol 2003;543:191e200. [7] Hansberg W, Aguirre J. Hyperoxidant states cause microbial cell differentiation by cell isolation from dioxygen. J Theor Biol 1990;142:201e21. [8] Carter AB, Tephly LA, Venkataraman S, Oberley LW, Zhang Y, Buettner GR, et al. High levels of catalase and GPx activity dampen H2O2 signaling in human alveolar macrophages. Am J Respir Cell Mol Biol 2004;31:43e53. [9] Paris S, Wysong D, Debeaupuis JP, Shibuya K, Philippe B, Diamond RD, et al. Catalases of Aspergillus fumigatus. Infect Immun 2003;71:3551e62. [10] Fridovich I. Superoxide dismutases. Adv Enzymol Relat Areas Mol Biol 1986; 58:61e97. [11] Fridovich I. Superoxide radical and superoxide dismutase. Ann Rev Biochem 1995;64:97e112. [12] Bauer H, Kanzok SM, Schirmer RH. Thioredoxin-2 but not thioredoxin-1 is a substrate of thioredoxin peroxidase-1 from Drosophila melanogaster. J Biol Chem 2002;277:17457e63.

[13] Switala J, Loewen PC. Diversity of properties among catalases. Arch Biochem Biophys 2002;401:145e54. [14] Chance B, Sies H, Boveris A. Hydrogen peroxide metabolism in mammalian organs. Physiol Rev 1979;59:527e605. [15] Kim BY, Kim HJ, Lee KS, Seo SJ, Jin BR. Catalase from the white-spotted flower chafer, Protaetia brevitarsis: cDNA sequence, expression, and functional characterization. Comp Biochem Physiol Part B 2008;149:183e90. [16] Chelikani P, Fita I, Loewen PC. Diversity of structures and properties among catalases. Cell Mol Life Sci 2004;61:192e208. [17] Ho YS, Xiong Y, Ma W, Spector A, Ho D. Mice lacking catalase develop normally but show differential sensitivity to oxidant tissue injury. J Biol Chem 2004;279:32804e12. [18] Muradian KK, Utko NA, Fraifeld V, Mozzhukhina TG, Pishel IN, Litoshenko AY. Superoxide dismutase, catalase and glutathione peroxidase activities in the liver of young and old mice: linear regression and correlation. Arch Gerontol Geriatr 2002;35:205e14. [19] Igarashi T, Kono Y, Tanaka K. Molecular cloning of manganese catalase from Lactobacillus plantarum. J Biol Chem 1996;271:29521e4. [20] Fowler T, Rey MW, Vaha-Vahe P, Power SD, Berka RM. The catR gene encoding a catalase from Aspergillus niger: primary structure and elevated expression through increased gene copy number and use of a strong promoter. Mol Microbiol 1993;9:989e98. [21] Klotz MG, Klassen GR, Loewen PC. Phylogenetic relationships among prokaryotic and eukaryotic catalases. Mol Biol Evol 1997;14:951e8. [22] Kawasaki L, Aguirre J. Multiple catalase genes are differentially regulated in Aspergillus nidulans. J Bacteriol 2001;183:1434e40. [23] Diaz A, Rangel P, Montes de Oca Y, Lledias F, Hansberg W. Molecular and kinetic study of catalase-1, a durable large catalase of Neurospora crassa. Free Radic Biol Med 2001;31:1323e33. [24] Scherer M, Wei H, Liese R, Fischer R. Aspergillus nidulans catalase-peroxidase gene (cpeA) is transcriptionally induced during sexual development through the transcription factor StuA. Eukaryot Cell 2002;1:725e35. [25] Michan S, Lledias F, Baldwin JD, Natvig DO, Hansberg W. Regulation and oxidation of two large monofunctional catalases. Free Radic Biol Med 2002;33:521e32. [26] Varnado CL, Hertwig KM, Thomas R, Roberts JK, Goodwin DC. Properties of a novel periplasmic catalase-peroxidase from Escherichia coli O157:H7. Arch Biochem Biophys 2004;421:166e74. [27] Hisada H, Hata Y, Kawato A, Abe Y, Akita O. Cloning and expression analysis of two catalase genes from Aspergillus oryzae. J Biosci Bioeng 2005;99:562e8.

682

J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682

[28] David M, Munaswamy V, Halappa R, Marigoudar SR. Impact of sodium cyanide on catalase activity in the freshwater exotic carp, Cyprinus carpio (Linnaeus). Pestic Biochem Physiol 2008;92:15e8. [29] Kim J, Kim S, An KW, Choi CY, Lee S, Choi K. Molecular cloning of Daphnia magna catalase and its biomarker potential against oxidative stresses. Comp Biochem Physiol Part C 2010;152:263e9. [30] Putnam CD, Arvai AS, Bourne Y, Tainer JA. Active and inhibited human catalase structures: ligand and NADPH binding and catalytic mechanism. J Mol Biol 2000;296:295e309. [31] Smith V, Brown J, Hauton C. Immunostimulation in crustaceans: does it really protect against infection? Fish Shellfish Immunol 2003;15:71e90. [32] Kashiwagi A, Kashiwagi K, Takase M, Hanada H, Nakamura M. Comparison of catalase in diploid and haploid Rana rugosa using heat and chemical inactivation techniques. Comp Biochem Physiol Part B 1997;118:499e503. [33] Manduzio H, Monsinjon T, Galap C, Leboulenger F, Rocher B. Seasonal variations in antioxidant defences in blue mussels Mytilus edulis collected from a polluted area: major contributions in gills of an inducible isoform of Cu/Znsuperoxide dismutase and of glutathione S-transferase. Aqua Toxicol 2004;7: 83e93. [34] Li C, Ni D, Song L, Zhao J, Zhang H, Li L. Molecular cloning and characterization of a catalase gene from Zhikong scallop Chlamys farreri. Fish Shellfish Immunol 2008;24:26e34. [35] Xilan Y, Gang L, Chungen W, Baoqing H, Lirong D, Pengzu P, et al. A catalase from the freshwater mussel Cristaria plicata with cloning, identification and protein characterization. Fish Shellfish Immunol 2011;31:389e99. [36] Mackay M, Bewley GC. The genetics of catalase in Drosophila melanogaster: isolation and characterization of acatalasemic mutants. Genetics 1989;22: 643e52. [37] Bryant DD, Wilson GN. Differential evolution and expression of murine peroxisomal membrane protein genes. Biochem Mol Med 1995;55:22e30. [38] McClung CR. Regulation of catalases in Arabidopsis. Free Radic Biol Med 1997; 23:489e96. [39] Storz G, Tartaglia LA. OxyR: a regulator of antioxidant genes. J Nutr 1992;122: 627e30. [40] Campa-Córdova AI, Hernández-Saaverdra NY, De Philippis R, Ascencio F. Generation of superoxide anion and SOD activity in hemocytes and muscle of American white shrimp (Litopenaeus vannameii) as a response to b-glucan and sulphated polysaccharide. Fish Shellfish Immunol 2002;12:353e66. [41] Mohankumar K, Ramasamy P. White spot syndrome virus infection decreases the activity of antioxidant enzymes in Fenneropenaeus indicus. Virus Res 2006; 115:69e75. [42] Mathew S, Kumar AK, Anandan R, Nair VPG, Devadasan K. Changes in tissue defence system in white spot syndrome virus (WSSV) infected Penaeus monodon. Comp Biochem Physiol Part C 2007;145:315e20. [43] Chongsatja PO, Bourchookarn A, Lo CF, Thongboonkerd V, Krittanai C. Proteomic analysis of differentially expressed proteins in Penaeus vannamei hemocytes upon Taura syndrome virus infection. Proteomics 2007;7: 3592e601. [44] Zhang Q, Li F, Zhang X, Dong B, Zhang J, Xie Y, et al. cDNA cloning, characterization and expression analysis of the antioxidant enzyme gene, catalase, of Chinese shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol 2008;24: 584e91. [45] Arockiaraj J, Vanaraja P, Easwvaran S, Singh A, Alinejaid T, Othman RY, et al. Gene profiling and characterization of arginine kinase-1 (MrAK-1) from freshwater giant prawn (Macrobrachium rosenbergii). Fish Shellfish Immunol 2011;31:81e9. [46] Arockiaraj J, Easwvaran S, Vanaraja P, Singh A, Othman RY, Bhassu S. Prophenoloxidase activating enzyme-III from giant freshwater prawn Macrobrachium rosenbergii: characterization, expression and specific enzyme activity. Mol Biol Rep 2012;39:1377e86. [47] Bairoch A, Bucher P, Hofmann K. The PROSITE data base, its status in 1997. Nucleic Acid Res 1997;25:217e21. [48] Pearson WR. Rapid and sensitive sequence comparison with FASTP and FASTA. Meth Enzymol 1990;183:63e98. [49] Thompson JD, Higgins DG, Gibson TJ. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acid Res 1994;22:4673e80. [50] Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a webbased environment for protein structure homology modelling. Bioinformatics 2006;22:195e201.

[51] Dhar AK, Bowers RM, Licon KS, Veazey G, Read B. Validation of reference genes for quantitative measurement of immune gene expression in shrimp. Mol Immunol 2009;46:1688e95. [52] Livak KJ, Schmittgenm TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) method. Methods 2001;25:402e8. [53] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press; 1989. [54] Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of proteinedye binding. Anal Biochem 1976;72:248e54. [55] Aebi H. Catalase in vitro. Meths Enzymol 1984;105:121e6. [56] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the folin phenol reagent. J Biol Chem 1951;193:265e75. [57] Bai J, Rodriguez AM, Melendez JA, Cederbaum AI. Overexpression of catalase in cytosolic or mitochondrial compartment protects HepG2 cells against oxidative injury. J Biol Chem 1999;274:26217e24. [58] Garcia MX, Foote C, van Es S, Devreotes PN, Alexander S, Alexander H. Differential development expression and cell type specificity of Dictyostelium catalases and their response to oxidative stress and UV-light. Biochim Biophys Acta 2000;1492:295e310. [59] Mousa HM, Omer OH, Ali BH, Al-Wabel N, Ahmed SM. Antioxidant levels in tissues of young and adult camels (Camelus dromedarius). J Physiol Biochem 2006;62:213e8. [60] Ha EM, Oh CT, Ryu JH, Bae YS, Kang SW, Jang IH, et al. An antioxidant system required for host protection against gut infection in Drosophila. Dev Cell 2005; 8:125e32. [61] Nordberg J, Arnér ESJ. Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Radic Biol Med 2001;31:1287e312. [62] Keller GA, Krisans S, Gould SJ, Sommer JM, Wang CC, Schliebs W, et al. Evolutionary conservation of a microbody targeting signal that targets proteins to peroxisomes, glyoxysomes and glycosomes. J Cell Biol 1991;114:893e904. [63] Gould GW, Mcwhirter JM, East JM, Lee AG. A model for the uptake and release of Ca2þ by sarcoplasmic-reticulum. Biochem J 1987;245:739e49. [64] Ken CF, Lin CT, Wu JL, Shaw JF. Cloning and Expression of a cDNA coding for catalase from zebrafish (Danio rerio). J Agri Food Chem 2000;48:2092e6. [65] Tavares-Sánchez OL, Gómez-Anduro GA, Felipe-Ortega X, Islas-Osuna MA, Sotelo-Mundo RR, Barillas-Mury C, et al. Catalase from the white shrimp Penaeus (Litopenaeus) vannamei: molecular cloning and protein detection. Comp Biochem Physiol Part B 2004;138:331e7. [66] Fita I, Silva AM, Murthy MRN, Rossmann MG. The refined structure of beef liver catalase at 2.5 Å resolution. Acta Cryst 1986;B42:497e515. [67] Berthet S, Nykyri LM, Bravo J, Mate MJ, Berthet-colominas C, Alzari PM, et al. Crystallization and preliminary structural analysis of catalase A from Saccharomyces cerevisiae. Protein Sci 1997;6:481e3. [68] Prohaszka Z, Fust G. Immunological aspects of heat-shock proteins-the optimum stress of life. Mol Immunol 2004;41:29e44. [69] Dong CW, Zhang YB, Zhang QY, Gui JF. Differential expression of three Paralichthys olivaceus Hsp40 genes in responses to virus infection and heat shock. Fish Shellfish Immunol 2006;21:146e58. [70] Huang PY, Kang ST, Chen WY, Hsu TC, Lo CF, Liu KF, et al. Identification of the small heat shock protein, HSP21, of shrimp Penaeus monodon and the gene expression of HSP21 is inactivated after white spot syndrome virus (WSSV) infection. Fish Shellfish Immunol 2008;25:250e7. [71] Levine A, Tenhaken R, Dixon R, Lamb C. H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 1994; 79:583e93. [72] Lambert C, Soudant P, Choquet G, Paillard C. Measurement of Crassostrea gigas hemocyte oxidative metabolism by flow cytometry and the inhibiting capacity of pathogenic vibrios. Fish Shellfish Immunol 2003;15:225e40. [73] Liu C, Tseng M, Cheng W. Identification and cloning of the antioxidant enzyme, glutathione peroxidase, of white shrimp, Litopenaeus vannamei, and its expression following Vibrio alginolyticus infection. Fish Shellfish Immunol 2007;23:34e45. [74] Hass A, Brehum K, Kreft J, Goeble W. Cloning, characterization and expression of Escherichia coli of a gene encoding Listeria seeligeri catalase, a bacterial enzyme highly homologous to mammalian catalases. J Bacteriol 1991;173: 5159e67. [75] Murthy MRN, Reid TJ, Sicignano A, Tanaka N, Rossmann MG. Structure of beef liver catalase. J Mol Biol 1981;152:465e99.