- Email: [email protected]
Molecular cloning, characterization of one key molecule of teleost innate immunity from orange-spotted grouper (Epinephelus coioides): Serum amyloid A
Fish & Shellfish Immunology 34 (2013) 296e304
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Molecular cloning, characterization of one key molecule of teleost innate immunity from orange-spotted grouper (Epinephelus coioides): Serum amyloid A Jingguang Wei a, Minglan Guo a, Huasong Ji b, Qiwei Qin a, * a
Key Laboratory of Marine Bio-resources Sustainable Utilization, South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, PR China b State Key Laboratory Breeding Base for Sustainable Exploitation of Tropical Biotic Resources, College of Marine Science, Hainan University, Haikou 570228, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 August 2012 Received in revised form 19 October 2012 Accepted 3 November 2012 Available online 23 November 2012
The orange-spotted grouper (Epinephelus coioides), a favorite marine food fish, is widely cultured in China and Southeast Asian countries. However, little is known about its acute phase response (APR) caused by viral diseases. Serum amyloid A (SAA) is a major acute phase protein (APP). In this study, a new SAA homologous (EcSAA) gene was cloned from grouper, E. coioides, by rapid amplification of cDNA ends (RACE) PCR. The full-length cDNA sequence of SAA was 508 bp and contained a 363 bp open reading frame (ORF) coding for a protein of 121 aa. Similar to other fish known SAA genes, the EcSAA gene contained four exons and three introns. Quantitative real-time PCR analysis revealed that EcSAA mRNA is predominately expressed in liver and gill of grouper. Furthermore, the expression of EcSAA was differentially up-regulated in liver after infection with Staphyloccocus aureus, Vibrio vulnificus, Vibrio parahaemolyticus, Saccharomyces cerevisiae and Singapore grouper iridovirus (SGIV). Recombinant EcSAA (rEcSAA) was expressed in Escherichia BL21 (DE3) and purified for mouse anti-EcSAA serum preparation. The rEcSAA fusion protein was demonstrated to bind to all tested bacteria and yeast, and inhibit the replication of SGIV. Overexpression of EcSAA in grouper spleen (GS) cells could also inhibit the replication of SGIV. These results suggest that EcSAA may be an important molecule in the innate immunity of grouper. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Epinephelus coioides Singapore grouper iridovirus (SGIV) Serum amyloid A Molecular cloning Expression analysis
1. Introduction Innate immunity plays an important role in early defense mechanisms and serves to initiate the acquired immune response. The acute phase response (APR) is a complicated and systemic early defense system activated by tissue injury, infection, surgical trauma and inflammation [1,2], which results in a remarkable change in the concentrations of many plasma proteins, known as acute phase proteins (APPs) [3]. The great majority of APPs are synthesized in hepatocytes, also in extra-hepatic sites such as the brain and leukocytes [4]. It responses quickly and becomes a complicated but precise regulation network. APPs play an important role in a variety of the defense-related activities such as killing infectious microbes, repairing tissue damage and restoring healthy (homeostatic) state [5]. Serum amyloid A (SAA) is a major APP in mammals. The studies showed that the gene encoding SAA from trout acts as an effective gene of
* Corresponding author. Tel./fax: þ86 20 89023638. E-mail address: [email protected] (Q. Qin). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.11.014
innate immunity which is known to be regulated by the Toll-like receptor (TLR) signaling cascade. It has also been discussed that SAA may even constitute an endogenous TLR4 ligand [6]. SAA homologs have been identified in all vertebrates investigated and are highly conserved [2]. In recent years, SAA homologs have also been identified and characterized from some fish, such as arctic char (Salvelinus alpinus), common carp (Cyprinus carpio), Atlantic salmon (Salmo salar), zebrafish (Danio rerio) and rainbow trout (Oncorhynchus mykiss) [6e10]. The orange-spotted grouper，Epinephelus coioides, is widely cultured in China and Southeast Asian countries. As a favorite marine food fish, it is commercially important in live marine fish market. However, in recent years, with rapidly developing marine farming activities, outbreaks of viral diseases have affected grouper aquaculture industry causing heavy economic losses. Singapore grouper iridovirus (SGIV), a novel iridovirus in the genus Ranavirus, is one of the major pathogens that resulted in significant economic losses in grouper aquaculture [11,12]. In order to find immune-relevant factors responsible for virus infection, two suppression subtractive hybridization (SSH) libraries from the spleen of SGIV-infected grouper, E. coioides, have been described in our laboratory [13]. In our previous
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
studies, interleukin enhancer-binding factor 2, C-type lectin, bdefensin, leukocyte cell-derived chemotaxin-2 and hepcidin1/2 have been cloned from E. coioides, and results suggested that they may be important molecules involved in pattern recognition and pathogen elimination in the innate immunity of grouper [14e18]. In the present study, the molecular characteristics of grouper SAA, and the tissue distributions, expression patterns after challenging with bacterial and viral pathogens were investigated. The binding activity of the EcSAA and the inhibition of the replication of SGIV were also investigated. These present studies will help us to better understand its innate immune mechanisms in the antibacterial or anti-virus response of fishes. 2. Materials and methods 2.1. Fish Juvenile orange-spotted grouper, E. coioides (40e50 g) were purchased from a mari-culture farm at Daya bay, Huizhou City, Guangdong Province, China. After maintenance in aerated flowthrough seawater for 3 days, these fish were used for the challenge experiments. 2.2. Preparation of microbial cells and SGIV Vibrio vulnificus, Vibrio parahaemolyticus, Bacillus thuringiensis, Bacillus subtilis, Saccharomyces cerevisiae (American Type Culture Collection (ATCC) 9763), Staphylococcus aureus (ATCC 12598), Vibrio alginolyticus and Escherichia coli JM109 were obtained from our laboratory. V. parahaemolyticus was cultured with a TCBS agar plate at 26 C, while V. vulnificus was cultured at 26 C with aeration in LuriaeBertani (LB) medium prepared with fresh seawater. S. cerevisiae were cultured with 2 YPD medium with 3% glucose (4% bactotryptone, 2% bacto-yeast extract (pH 5.8)) at 30 C. Other bacterial strains were cultured at 37 C in LB prepared with the distilled water. All microbial strains were harvested by centrifugation at 3500 g for 10 min and suspended in the buffer for an appropriate concentration. Quantification was performed by plating various bacteria dilutions on agar plates. Cell lines of grouper spleen (GS) were propagated by the recommended methods with Leibovitz’s L15 culture medium with 10% fetal calf serum. Propagation of SGIV was performed as described previously [12]. The viral titer of SGIV was 105 TCID50/ml. 2.3. Immunization experiments In bacteria challenging experiment, each control and challenged sample was injected with 100 ml PBS and a live microbial PBS suspension (105 CFU/ml), respectively. Livers of six fish in each group were collected for quantitative real-time PCR (qRT-PCR) at 4, 8, 12, 24, 36 and 48 h for bacteria-challenged groups. In SGIV challenging experiment, each control and challenged sample was injected 50 ml PBS and SGIV at a concentration of 105 TCID50/ml, respectively. Livers of six fish in each group were collected for qRT-PCR at 4, 8,12, 24, 36, 48 and 72 h for SGIV-challenged groups. 2.4. RNA isolation and cDNA synthesis Total RNA was isolated from different tissues of grouper, E. coioides, using Trizol Reagent (Invitrogen) according to the manufacturer’s protocol. Each of the samples contained 6 independent individuals respectively to eliminate the individual differences. The RNA was treated with RQ1 RNase-Free DNase (Promega, USA) to remove contaminated DNA. The quality of total RNA was
297
assessed by electrophoresis on 1% agarose gel. Total RNA was reverse transcribed to synthesize the first-strand cDNA by ReverTra Ace kit (TOYOBO, Japan) according to the manufacturer’s instructions. 2.5. Cloning and sequence analysis of E. coioides serum amyloid A (EcSAA) cDNA and genomic DNA The first-strand cDNA was synthesized from the total liver RNA with the SMARTÔ RACE cDNA amplification kit (Clontech) for 30 RACE and 50 RACE. Two primers F1 (GAGAGGAGCAGGGGGCAGATGGG) and R1 (AGCCCATCTGCCCCCTGCTCCTC) were designed based on the identified EST sequence of SAA (GH612458). PCR was performed with 10 mM F1 or R1 and 500 nM of Nested Universal Primer A (NUP, Clontech). Denaturation was performed at 94 C for 5 min, followed by 35 cycles at 94 C for 30 s, 60 C for 30 s, and 72 C for 45 s. Genomic DNA was extracted from liver of orange-spotted grouper using the tissue Genomic DNA Purification System (Sino-American Biotechnology Co., China), according to the manufacturer’s instructions. The primers F2 (TCATAAGATTCTCTACGATCTATCA) and R2 (GTTGATGACTTTCATACTAATATT) were designed according to the 5-untranslated region (UTR) and 3-UTR of the full-length cDNA of EcSAA. 25 ng of genomic DNA was used for the genomic PCR with an LA Taq (TaKaRa) using F2 and R2. PCR was performed with an initial denaturation step of 5 min at 94 C, and then 35 cycles were run as follows: 94 C 45 s, 55 C 45 s, 72 C 1.5 min, and 72 C elongation for 5 min. 2.6. TA cloning, sequencing and database analysis PCR products were analyzed on 1% agarose gels, extracted with an AxyPrep DNA gel extraction kit (AxyGEN), and then ligated into pMD18-T vectors (TaKaRa) and transformed into competent E. coli DH5 cells. Positive colonies were screened by PCR and at least two recombinant plasmids were sequenced. Sequences were analyzed based on nucleotide and protein databases using the BLASTN and BLASTX program (http://www. ncbi.nlm.nih.gov/BLAST/). The protein and its topology prediction were performed using software at the ExPASy Molecular Biology Server (http://expasy.pku.edu.cn). Multiple sequence alignment of the EcSAA was performed with the Clustal X multiple-alignment software. MEGA 4.0 was also used to produce the phylogenetic tree. Neighbor-joining (NJ) method was used for the phylogenetic analysis. One thousand bootstraps were selected for the NJ trees to check its repeatability. 2.7. Analysis of EcSAA mRNA expression profiles qRT-PCR was employed to detect the EcSAA expression profiles using
b-actin as a reference gene. The qRT-PCR primers, F3 (ATTGCTCTGATTCTCATTGTGG)/R3 (CATCGTAGTTTCCTCTGG) and actin-F (TACGAGCTGCCTGACGGACA)/actin-R (GGCTGTGATCTCCTTTTGCA), were designed based on the full-length cDNA of EcSAA and b-actin. qRT-PCR was performed on Roche LightCycler 480 Real-time PCR system (Roche, Switzerland) using the 2 SYBR Green Real-time PCR Mix (TOYOBO, Japan). PCR amplification was performed in triplicate wells, using the cycling parameters: 94 C for 5 min, followed by 40 cycles of 5 s at 94 C, 10 s at 60 C and 15 s at 72 C. Relative gene expression was analyzed by OOC the comparative Ct method (2 T method). Target CT values were normalized to the endogenous gene b-actin. Results for each treated sample were expressed as N-fold changes in target gene expression relative to the same gene target in the calibrator sample, both normalized to the b-actin gene. All samples were analyzed in three duplications and all data were given in term of relative mRNA expression level as means SD, and then subjected to Student’s t-test. Differences were considered significant at p < 0.05 or p < 0.01.
298
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
Fig. 1. Exon intron organisation of the grouper SAA gene. Start and stop codon are marked with triangles. Numbers indicate the DNA position relative to the transcriptional start.
2.8. Expression and purification of recombinant EcSAA and preparation of antiserum Specific primers F4 (CGGGATCCCAGTGGCACAACTTTCCTCGT) and R4 (GCCTCGAGCTAATATTTTTCTGGAAGTCC) were used to
amplify the DNA fragment encoding the mature peptide of EcSAA. The target PCR product was digested with BamH I and XhoI (Takara), and then subcloned into the BamH I/Xho I sites of expression vector pET-32a.The recombinant plasmid (pET-EcSAA) was transformed into E. coli BL21 (DE3) and subjected to nucleotide
Fig. 2. (A) Multiple alignment of the amino acid sequences of grouper SAA with other known SAAs. Black shaded sequence indicates positions that have a fully conserved residue, gray shaded sequence indicates conserved amino acid substitutions, light gray shaded sequence indicates semi-conserved amino acid substitutions, and dashes indicate gaps. Signal peptide is indicated upon the amino acid residues. N-terminal hydrophobic region is underlined. The predicted tertiary structure (a-helix and b-sheet) is boxed, based on the structure of human SAA [2]. GenBank accession numbers for these SAA protein sequences used are as follows: Lates calcarifer (ADE05545.1), Tetraodon nigroviridis (embjCAF99678.1), Oncorhynchus mykiss (CAA67766.1), Danio rerio (NP_001005599.1), Homo sapiens (AAB59539.1), Mesocricetus auratus (AAA37098.1), Macaca mulatta (XP_001086242.1), Pan troglodytes (XP_001173019.1), and Oryctolagus cuniculus (AAA31464.1). (B) Phylogenetic tree analysis of the aligned proteins with the Clustal X program. The relationships among the various components were analyzed by the Neighbor-joining (NJ) method. Numbers on the branches indicate percent bootstrap confidence values from 1000 replicates.
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
sequencing. Positive clone was incubated in 200 ml LB medium (containing 100 mg/ml ampicillin) at 37 C with shaking at 220 rpm. The parent vector without an insert fragment was used as negative control. When the culture medium reached OD600 of 0.5e0.7, the cells were incubated for 4 additional hours with the induction of IPTG at the final concentration of 0.6 mmol/l. The recombinant EcSAA fusion protein (designated as rEcSAA) was purified by affinity chromatography with Ni-nitrilotriacetic acidagarose (Qiagen, Germany) according to the manufacturer’s instruction. The resulting protein was analyzed by 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized with Coomassie brilliant blue R-250. The concentration of recombinant fusion protein was determined using Bradford’s method. The polyclonal antibody against rEcSAA produced by immunizing BALB/c mice according to the conventional method [19]. The titer of the antiserum was then determined by an enzyme-linked immunosorbent assay (ELISA), and the specificity of the antiserum was detected with western blot.
299
2.9. Microbial-binding assays Yeast (S. cerevisiae), Gram-positive bacteria (S. aureus, B. thuringiensis and B. subtilis) and Gram-negative bacteria (V. vulnificus, V. parahaemolyticus, V. alginolyticus and E. coli JM109) were used to test binding of recombinant EcSAA fusion protein to microorganisms according to the described method [14]. Briefly, bacteria or yeast were cultured in 9 ml LB medium or YPD medium for 6 h at 37 C. Bacterial or yeast cells were pelleted by centrifugation at 12,000 g for 2 min. Microbes were pelleted and washed several times with 1 ml of TBS buffer (50 mM TriseHCl, pH 7.5, 150 mM NaCl). Approximately 5 107 microbes were incubated with 5 mg of targeted proteins in TBS by gentle orbital rotation for about 1 h at room temperature. Microbes were pelleted and washed five times with 1 ml of binding buffer, and then subjected to elution with 4 M urea in 10 mM TriseHCl, pH 8.0 for 10e15 min with mild agitation in one-fifth of the original volume. As a control, bacterial cells were incubated with saline and subjected to the same treatments. Eluted proteins were then denatured by heating at 100 Cfor 15 min. Protein
Fig. 3. qRT-PCR analysis of the expression patterns of EcSAA. (A) The tissue expression patterns of grouper SAA mRNA. Date is expressed as a ratio to expression in Kidney. The endogenous control for qualification was b-actin. (B) The time course expression patterns of EcSAA mRNA in liver of grouper after challenge with S. cerevisiae. (C) The time course expression patterns of EcSAA mRNA in liver of grouper after challenge with S. aureus. (D) The time course expression patterns of EcSAA mRNA in liver of grouper after challenge with V. vulnificus. (E) The time course expression patterns of EcSAA mRNA in liver of grouper after challenge with SGIV. Date is expressed as a ratio to EcSAA mRNA expression of PBS group. Vertical bars represented the means SD (n ¼ 3), and significant differences of EcSAA expression between the challenged and unchallenged samples were indicated with an asterisk (*) at p < 0.05 or two asterisks (**) at p < 0.01. The endogenous control for qualification was b-actin.
300
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
binding was analyzed by western blot, as follows. Proteins were fractionated by electrophoresis through 12.5% SDS-PAGE and electrophoretic transferred onto a PVDF membrane (Millipore). Membranes were blocked with 5% nonfat milk and PBST at room temperature for 2 h and washed three times with PBST. Anti-EcSAA serum was diluted 1/1000 in 5% nonfat milk and incubated with the membranes overnight at 4 C. After washing three times with PBST, membranes were incubated for 1 h with HRP-labeled anti-mouse IgG Ab diluted 1/1000 in 5% nonfat milk. The membranes were washed three times with PBST and detected with DAB.
2.13. Statistical analysis
2.10. Protective effect of rEcSAA against SGIV infection
Based on the partial cDNA sequence of EcSAA, the gene-specific primers of F1 and R1 were designed for the rapid amplification of 30 and 50 cDNA (RACE), and the full-length cDNA of EcSAA was amplified. The full-length cDNA of EcSAA was 508 bp (Genbank accession no. JX131376) and contained a 366 bp open reading frame (ORF) coding for a protein of 121 amino acid (aa), and had a 72 bp of 50 -UTR and a 70 bp of 30 -UTR including a putative polydenylation consensus signal (AATAAA) and a poly (A) tail. After cloning and sequencing the cDNA of EcSAA, we next sought to obtain the gene sequence of EcSAA. Based on the fulllength cDNA sequence of EcSAA, two primers of F2 and R2 were designed. The PCR products were cloned, sequenced and assembled into a full-length gene of EcSAA. The EcSAA gene is segmented into
To determine the effect of EcSAA on SGIV infection, the rEcSAA fusion protein was mixed with SGIV and then used to infect GS cells at a MOI of about 0.1. After a 2 h incubation, the mixture of rEcSAA and SGIV was removed and the SGIV-infected cells were washed twice with PBS. At 3 days postinfection, the morphological changes were observed under a light microscope (Leica, Germany). 2.11. Selection of GS cells stably expressing EcSAA EcSAA expression vector pcDNA-EcSAA was constructed based on the vector pcDNA3.1 (þ) (Invitrogen, USA). Primers of pcDNA-EcSAAF (GCGGATCCATGAAGTTGCTTCTCGCAGGAAT) and pcDNA-EcSAA-R (CGGAATTCTCAGTGGTGGTGGTGGTGGTGATATTTTTCTGGAAGTC) were used to amplify the ORF sequence of EcSAA from grouper liver cDNA. The target PCR product was digested and subcloned into the BamHⅠ and XhoⅠsites of pcDNA3.1 (þ) vector. The recombinant plasmid was transformed into E. coli DH5a and subjected to nucleotide sequencing. Stable clones of GS cells expressing EcSAA were generated by transfection of pcDNA-EcSAA constructs into GS cells using Lipofectamine 2000 reagent according to the manufacturer’s instructions (Invitrogen). For control, GS cells were transfected with empty pcDNA3.1 vector. Transfected cells were clonally selected after at least 4 weeks using 2 mg/ml G418 and characterized by reverse transcription-polymerase chain reaction (RT-PCR). Total RNA was prepared from cells using TRIzol Teagent (Invitrogen), and was reverse-transcribed using Tra Ace (TOYOBO, USA) according to the manufacturer’s instructions. The resulting lines were named GS/ pcDNA3.1 and GS/EcSAA, respectively.
Statistical analysis was carried out using SPSS Version 13. Oneway ANOVA at a 95% confidence level (p < 0.05 and p < 0.01) was used to evaluate the significance of the differences between the gene expressions in each sample. 3. Results 3.1. Sequencing analysis of grouper SAA cDNA and genomic DNA
2.12. Viral replication kinetics assay To investigate the impact of EcSAA on SGIV infection in vitro, viral replication kinetics were evaluated based on SGIV propagation in GS/EcSAA and GS/pcDNA3.1 cells, respectively. In detail, the cell lines of GS/EcSAA and GS/pcDNA3.1 (1 105 per well) were separately seeded in 24-well plates, grown for 24 h and infected with SGIV at a MOI of about 0.1. The virus-infected cell lysates were collected at the indicated time points (24 and 48 h p.i.), and were used to infect GS cells cultured in 96-well plates after serially diluted, then the virus titers of the collected lysates were determined using 50% tissue culture infectious dose (TCID50) assay after 7 day of incubation p.i [20]. Each sample was measured in triplicate. Meanwhile, parallel cell samples were harvested for RNA extraction and cDNA synthesis, and then the expression profiles of major capsid protein (MCP) of SGIV was assessed by qRT-PCR using primers MCP-F (GCACGCTTCTCTCACCTTCA) and MCP-R (AACGGCAACGGGAGCACTA). b-actin was amplified as reference gene with specific primers actin-F and actin-R. The morphological changes were observed daily under a light microscope (Leica, Germany). Data were analyzed using Student’s t-test when comparing means between GS/EcSAA and GS/pcDNA3.1 cells at single time points.
Fig. 4. Bioassay of recombinant EcSAA fusion protein. (A) SDS-PAGE and western blot analysis of recombinant protein expression of pET-SAA. M: Protein molecular mass standards. 1: Supernatant from induced pET-32a after sonication. 2: Supernatant from induced pET-SAA after sonication. 3: Pellets from induced pET-SAA after sonication. 4: Purified rEcSAA fusion protein. The recombinant EcSAA is boxed. 5: Purified rEcSAA fusion protein incubated with anti-EcSAA serum (1:2500). 6: Purified rEcSAA was detected by negative control serum. (B) Binding of the microorganisms by rEcSAA fusion protein. Living microbial strains were incubated with rEcSAA fusion protein and the stirringly washed pellets were subjected to the SDS-PAGE and detected by western blot with anti-EcSAA serum. Lane 1: rEcSAA protein. Lane 2: S. cerevisiae. Lane 3: S. aureus.Lane. 4: B. subtilis. Lane. 5: B. thuringiensis. Lane 6: V. vulnificus. Lane 7: V. parahaemolyticus. Lane 8: V. alginolyticus. Lane 9: E. coli JM109.
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
four exons (Fig. 1; JX131377). Exon 1 encodes the majority of the 5UTR. Exon 2 encodes the N-terminal 29 aa residues of the SAA protein. Exon 3 encodes the residual 46 aa while exon 4 encodes the last residual 46aa. The deduced amino acid sequence of EcSAA protein is remarkably conserved. It shared significant homology with SAA from Lates calcarifer (ADE05545.1, 86% identity), Tetraodon nigroviridis (embjCAF99678.1, 70% identity), O. mykiss (CAA67766.1, 73% identity), and D. rerio (NP_001005599.1, 67% identity). Multiple sequence alignments were carried out using the Clustal X multiplealignment software (Fig. 2A). EcSAA protein has a potential signal peptide with 18 amino acid residues in N-terminal by prediction of SignalP software. The hydrophobic N-terminal portion of the molecule has been shown to be a major determinant for amyloid formation [21] and C-terminal portion is the proposed neutrophil and GAG binding region. Secondary structure predictions indicated that the grouper SAA molecule is likely to contain two regions of a-helix and two b-strands. Phylogenetic and molecular evolutionary analysis was conducted using Mega 4.0. The phylogenetic NJ-tree construction based on SAA amino acid sequences is shown in Fig. 2B. EcSAA was grouped with other fish SAAs. This grouping was well-supported by bootstrapping.
301
3.3. Time-course of EcSAA gene expression upon stimulation with bacterial or virus challenge To determine whether EcSAA expression was differentially regulated upon infection, qRT-PCR analysis was also used to examine the relative expression of EcSAA in groupers challenged with different microbes with b-actin as internal control. The expression level of EcSAA in the grouper liver was up-regulated after bacterial challenge. The infection time-course analysis revealed 49.86-fold induction of EcSAA expression after 24 h injection of S. cerevisiae compared with PBS, and then decreased to 3.417-fold at 48 h (Fig. 3B). The expression of EcSAA in the liver injected with S. aureus was increased at all the time, and up to 462.6-fold at 48 h (Fig. 3C). The expression level injected with V. vulnificus was increased up to 115.9-fold at 12 h post-injection, and then decreased to 6.237-fold at 48 h (Fig. 3D). The expression level of EcSAA transcript was up-regulated after SGIV challenge (Fig. 3E). The infection time-course analysis revealed 1.008-fold induction of EcSAA transcript after 4 h injection of SGIV compared with PBS, and the transcript increased up to 10.64-fold at 36 h post-injection then decreased to 1.855-fold at 72 h. 3.4. Expression, purification, and antibody preparation of recombinant EcSAA
3.2. Expression analysis of EcSAA gene To investigate the tissue expression profile of EcSAA in healthy orange-spotted grouper, qRT-PCR was used to analyze its expression levels in various tissues. The EcSAA expression was mainly detected in the tissues of liver, gill, muscle, skin, and head kidney (Fig. 3A).
The parent vector pET-32a and the plasmid pET-EcSAA were transformed into E. coli BL21 (DE3), respectively. After IPTG induction, cell lysates were obtained and boiled for 10 min, then subjected to SDS-PAGE analysis. As determined by SDS-PAGE, one band at 20 kDa (Trx-His-tag) (Fig. 4A lane 1) was visualized by
Fig. 5. The rEcSAA fusion protein inhibited the replication of SGIV in GS cells. Severe cytopathogenic effect (CPE) sites are indicated by white arrows.
302
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
Coomassie brilliant blue staining, while recombinant EcSAA (rEcSAA) has an apparent mass of 29.5 kDa, which matched to the expected molecular mass of EcSAA based on the predicted molecular mass and the deduced amino acid sequence (Fig. 4A lane 2e3). The concentration of the purified rEcSAA (Fig. 4A lane 4) was 2.27 mg/ml according to Bradford’s method. To identify the biological properties of EcSAA, the recombinant protein were used to immunize mouse to prepare the immune serum. The specificity of anti-SAA serum was examined by western blot. The rEcSAA fusion protein (5 mg) was specifically recognized by polyclonal antibody against EcSAA (Fig. 4A lane 5), while no bands were found detected by negative control serum (Fig. 4A lane 6), indicating that the anti-EcSAA antibody specifically recognized the purified EcSAA fusion protein. 3.5. Binding of EcSAA to microbes To test the ability of the rEcSAA binding to microbes, a direct binding assay was performed. The microbes were incubated with the rEcSAA fusion protein, and the microbial pellets were assessed by western blot using anti-EcSAA serum. As shown in Fig. 4B, rEcSAA was found to bind to all tested bacteria and yeast. This experiment was processed with the recombinant protein, composed of a Trx-His-tag part plus the normal rEcSAA protein. To determine whether the extra part could affect the microbialbinding activity of rEcSAA, we obtained the rTrx (Trx-His-tag) fusion protein and incubated them with all tested bacteria and yeast. rTrx could not bind to the tested bacteria and yeast, indicating that rEcSAA do have the microbial-binding activity. 3.6. Effects of EcSAA on the SGIV replication To test the protective effect of rEcSAA against viral infection, the rEcSAA fusion protein (5 mg/ml) was mixed with SGIV and then used to infect GS cells at a MOI of about 0.1. The results showed that the CPE caused by SGIV or rTrx fusion protein (5 mg/ml) and SGIV appeared earlier and more prominently in GS cells, compared to that in GS cells with rEcSAA fusion protein (5 mg/ml) and SGIV (Fig. 5). To further assess the effect of EcSAA on the replication of SGIV, the stably transfected GS/pcDNA3.1 cells and GS/EcSAA cells were infected with SGIV and the replication kinetics were compared in the course of infection. As shown in Fig. 6A, the SGIV replicated more slowly in GS/EcSAA cells and the viral titers yielded were about 3.98 and 8.22 times lower than those in the GS/pcDNA3.1 cells in 24 and 48 h p.i. To verify the results, the transcription kinetics of MCP as an indicator of SGIV transcription was investigated by qRTPCR. As shown in Fig. 6B, the MCP transcripts in GS/pcDNA3.1 were about 1.81 and 3.66 times higher than those in GS/EcSAA at 24 and 48 h p.i., indicating over-expressed EcSAA has an inhibitory impact on the gene transcription kinetics of SGIV. Meanwhile, the CPE caused by SGIV appeared earlier and more prominently in GS/ pcDNA3.1 cells, compared to that in GS/EcSAA (Fig. 7). 4. Discussion In the present work, we described for the first time the molecular characterization of SAA in marine fish grouper. Our results strongly support that this sequence obtained from grouper is a mammalian SAA homolog. Similar to other known SAAs, grouper SAA (EcSAA) contained a signal sequence of 18 amino acids. The neutrophil and GAG binding region were well conserved in EcSAA. The length of EcSAA protein (121 aa) is similar to those of trout, zebrafish and pufferfish Tetraodon (121 aa) [6]. Almost all of the results in this study suggest that the EcSAA may be a functionally conserved protein.
Fig. 6. Effect of EcSAA overexpression on SGIV replication in GS cells. (A) Cell-free viruses were collected from the lysates of two stably transfected GS cell lines infected by SGIV at different time points (24 and 48 h p.i., respectively) and the viral titer was measured using TCID50 method. (B) The expression level of MCP mRNA in two stably transfected GS cells during SGIV infection. Cell lysates were collected at the indicated time points (24 and 48 h p.i., respectively) and used for RNA extraction. Relative expression levels of MCP mRNA were assessed by qRT-qPCR, using b-actin as a reference gene. Vertical bars represented the means SD, and significant differences of viral titers or MCP transcripts levels between GS/pcDNA3.1 cells and GS/EcSAA cells were indicated with an asterisk (*) at p < 0.05.
It is generally accepted that APPs are inductors of a proinflammatory reaction and fever, their over-expression can lead to an anti-inflammatory response. Thus, APPs are used today as potential biological markers for monitoring animal welfare and health status [22e24]. SAA are considered as main APP in mammals. Major APPs are often observed to increase markedly with the first 48 h after the triggering event and have a rapid decline due to their short half-life [1]. The aim of this study was mainly to determine the immune changes (APR) caused by bacterial infection. As shown in Fig. 3, the EcSAA expression was mainly detected in the tissues of liver, gill, muscle, skin, and head kidney. After bacterial infection, a remarkable APR is evoked. Our studies revealed that SAA mRNA was significantly up-regulated in grouper liver after infection with V. vulnificus, S. aureus and S. Cerevisiae. This is agreement with that in carp liver (50-fold at 36 h) and skin (1600-fold at 36 h) infected by Ichthyophthirius multifiliis [25]. It cannot be excluded that the hepatic regulation of SAA was induced by the cytokine molecules produced in the inflammation site, which would be in accordance with Jorgensen [9] who showed that cytokine-like molecules induce expression of SAA in the hepatocytes from Atlantic salmon. Recent study demonstrated that human SAA binds to many Gram-negative bacteria including E. coli and Pseudomonas aeruginosa through outer membrane protein A (OmpA) family members.
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
303
Fig. 7. Overexpression of EcSAA delayed the appearance of SGIV-induced CPE in GS cells. Severe CPE sites are indicated by white arrows.
The binding was found to be high affinity and rapid. Importantly, this binding was not inhibited by high density lipoprotein with which SAA is normally complexed in serum. Binding was also observed when bacteria were offered serum containing SAA [26]. As a mammalian SAA homolog, to test the ability of the rEcSAA binding to microbes, a direct binding assay was performed. In the present study, rEcSAA was found to bind to all tested bacteria and yeast, which is different from human SAA. The immune system of mammalian is much more complex than the fish, and shows different immune mechanisms to different species of bacteria. The grouper belongs to the lower vertebrates, and the SAA may take up the identification of whole bacteria, while in mammals, the function of SAA may be weakened and some separation. Serum amyloid A (SAA) is an acute-phase protein induced by a variety of inflammatory stimuli, including bacterial and viral infections. SAA was recently found to inhibit hepatitis C virus (HCV) infection in cultured cells [27]. SAA reduced HCV infectivity in a dose-dependent manner when added during HCV infection but not after virus entry. SAA bound HCV virions and specifically blocked HCV entry but did not affect virus attachment. To our knowledge, no study has been reported on SAA for its antiviral activity from marine fish grouper. Singapore grouper iridovirus (SGIV), a novel iridovirus in the genus Ranavirus, is one of the major
pathogens that resulted in significant economic losses in grouper aquaculture [11,12]. After obtaining the rEcSAA fusion protein and the GS cells stably expressed EcSAA, viral replication kinetics of SGIV were evaluated. The studies showed that both the rEcSAA fusion protein and over-expressed EcSAA in GS cells had the ability to inhibit the replication of SGIV. Those results indicated that EcSAA might be participated in the host antiviral responses, and play an important role in innate immunity of grouper. In conclusion, the full-length cDNA encoding SAA was cloned from grouper, E. coioides. It was predominately expressed in liver and gill of grouper, and was differentially up-regulated in liver after bacterial and viral challenge. The rEcSAA fusion protein was demonstrated to bind to all tested bacteria and yeast, and inhibit the replication of SGIV. Overexpression of EcSAA in grouper spleen (GS) cells could also inhibit the replication of SGIV. These results suggest that EcSAA may be an important molecule in the innate immunity of grouper. Acknowledgments This work was supported by grants from National High Technology Development Program of China (863)(2012AA092201), National Basic Research Program of China (973 program) (2012CB114402), the Knowledge Innovation Program of the Chinese Academy of Sciences
304
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
(KZCX2-EW-Q213, KZCX2-YW-BR-08), the National Natural Science Foundation of China (30930070, 31001124, 30725027, 31202022), and the Guangdong Province Natural Science Foundation (S2011040000953). References [1] Cray C, Zaias J, Altman NH. Acute phase response in animals: a review. Comparative Medicine 2009;59:517e26. [2] Uhlar CM, Whitehead AS. Serum amyloid A, the major vertebrate acute-phase reactant. European Journal of Biochemistry 1999;265:501e23. [3] Gabay C, Kushner I. Mechanisms of disease: acute-phase proteins and other systemic responses to inflammation. New England Journal of Medicine 1999; 340:448e54. [4] Bayne CJ, Gerwick L. The acute phase response and innate immunity of fish. Developmental and Comparative Immunology 2001;25:725e43. [5] Murata H, Shimada N, Yoshioka M. Current research on acute phase proteins in veterinary diagnosis: an overview. The Veterinary Journal 2004;168:28e40. [6] Rebl A, Goldammer T, Fischer U, Köllner B, Seyfert H-M. Characterization of two key molecules of teleost innate immunity from rainbow trout (Oncorhynchus mykiss): MyD88 and SAA. Veterinary Immunology and Immunopathology 2009;131:122e6. [7] Jensen LE, Hiney MP, Shields DC, Uhlar CM, Lindsay AJ, Whitehead AS. Acute phase proteins in salmonids - evolutionary analyses and acute phase response. Journal of Immunology 1997;158:384e92. [8] Fujiki K, Shin D-H, Nakao M, Yano T. Molecular cloning and expression analysis of carp (Cyprinus carpio) interleukin-1[beta], high affinity immunoglobulin E Fc receptor [gamma] subunit and serum amyloid A. Fish & Shellfish Immunology 2000;10:229e42. [9] Jorgensen JB, Lunde H, Jensen L, Whitehead AS, Robertsen B. Serum amyloid A transcription in Atlantic salmon (Salmo salar L.) hepatocytes is enhanced by stimulation with macrophage factors, recombinant human IL-1 beta, IL-6 and TNF alpha or bacterial lipopolysaccharide. Developmental and Comparative Immunology 2000;24:553e63. [10] Lin B, Chen S, Cao Z, Lin Y, Mo D, Zhang H, et al. Acute phase response in zebrafish upon Aeromonas salmonicida and Staphylococcus aureus infection: striking similarities and obvious differences with mammals. Molecular Immunology 2007;44:295e301. [11] Chang SF, Ngoh-Lim GH, Kueh LFS, Qin QW, Seng EK, Sin YM. Initial investigations into two viruses isolated from marine food fish in Singapore. Veterinary Record 2002;150:15e6. [12] Qin QW, Chang SF, Ngoh-Lim GH, Gibson-Kueh S, Shi C, Lam TJ. Characterization of a novel ranavirus isolated from grouper Epinephelus tauvina. Diseases of Aquatic Organisms 2003;53:1e9.
[13] Xu D, Wei J, Cui H, Gong J, Yan Y, Lai R, et al. Differential profiles of gene expression in grouper Epinephelus coioides, infected with Singapore grouper iridovirus, revealed by suppression subtractive hybridization and DNA microarray. Journal of Fish Biology 2010;77:341e60. [14] Wei JG, Xu D, Zhou JG, Cui HC, Yan Y, Ouyang ZL, et al. Molecular cloning, characterization and expression analysis of a C-type lectin (Ec-CTL) in orange-spotted grouper, Epinephelus coioides. Fish & Shellfish Immunology 2010;28:178e86. [15] Cui HC, Yan Y, Wei JG, Hou ZW, Huang YH, Huang XH, et al. Cloning, characterization, and expression analysis of orange-spotted grouper (Epinephelus coioides) ILF2 gene (EcILF2). Fish & Shellfish Immunology 2011; 30:378e88. [16] Zhou JG, Wei JG, Xu D, Cui HC, Yan Y, Ou-Yang ZL, et al. Molecular cloning and characterization of two novel hepcidins from orange-spotted grouper, Epinephelus coioides. Fish & Shellfish Immunology 2011;30:559e68. [17] Wei J, Guo M, Cui H, Yan Y, Ouyang Z, Qin Q. A new leukocyte cell-derived chemotaxin-2 from marine fish grouper, Epinephelus coioides: molecular cloning and expression analysis. Fish & Shellfish Immunology 2011;31:600e5. [18] Guo M, Wei J, Huang X, Huang Y, Qin Q. Antiviral effects of beta-defensin derived from orange-spotted grouper (Epinephelus coioides). Fish & Shellfish Immunology 2012;32:828e38. [19] Deininger P [in 3 volumes]. In: Molecular cloning: a laboratory manual. Analytical biochemistry. 2nd ed., vol. 186. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. p. 182e3. 1990. [20] Reed LJ, Muench H. A simple method of estimating 50% endpoints. Journal of Hygiene 1938;27:493e7. [21] Westermark GT, Engstrom U, Westermark P. The N-terminal segment of protein AA determines its fibrillogenic property. Biochemical and Biophysical Research Communications 1992;182:27e33. [22] Ceciliani F, Giordano A, Spagnolo V. The systemic reaction during inflammation: the acute-phase proteins. Protein and Peptide Letters 2002;9: 211e23. [23] Petersen HH, Nielsen JP, Heegaard PMH. Application of acute phase protein measurements in veterinary clinical chemistry. Veterinary Research 2004;35: 163e87. [24] Pallares FJ, Martinez-Subiela S, Seva J, Ramis G, Fuentes P, Bernabe A, et al. Relationship between serum acute phase protein concentrations and lesions in finishing pigs. Veterinary Journal 2008;177:369e73. [25] Gonzalez SF, Buchmann K, Nielsen ME. Ichthyophthirius multifiliis infection induces massive up-regulation of serum amyloid A in carp (Cyprinus carpio). Veterinary Immunology and Immunopathology 2007;115:172e8. [26] Shah C, Hari-Dass R, Raynes JG. Serum amyloid A is an innate immune opsonin for Gram-negative bacteria. Blood 2006;108:1751e7. [27] Cai Z, Cai L, Jiang J, Chang K-S, van der Westhuyzen DR, Luo G. Human serum amyloid A protein inhibits hepatitis C virus entry into cells. Journal of Virology 2007;81:6128e33.
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Molecular cloning, characterization of one key molecule of teleost innate immunity from orange-spotted grouper (Epinephelus coioides): Serum amyloid A Jingguang Wei a, Minglan Guo a, Huasong Ji b, Qiwei Qin a, * a
Key Laboratory of Marine Bio-resources Sustainable Utilization, South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, PR China b State Key Laboratory Breeding Base for Sustainable Exploitation of Tropical Biotic Resources, College of Marine Science, Hainan University, Haikou 570228, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 August 2012 Received in revised form 19 October 2012 Accepted 3 November 2012 Available online 23 November 2012
The orange-spotted grouper (Epinephelus coioides), a favorite marine food fish, is widely cultured in China and Southeast Asian countries. However, little is known about its acute phase response (APR) caused by viral diseases. Serum amyloid A (SAA) is a major acute phase protein (APP). In this study, a new SAA homologous (EcSAA) gene was cloned from grouper, E. coioides, by rapid amplification of cDNA ends (RACE) PCR. The full-length cDNA sequence of SAA was 508 bp and contained a 363 bp open reading frame (ORF) coding for a protein of 121 aa. Similar to other fish known SAA genes, the EcSAA gene contained four exons and three introns. Quantitative real-time PCR analysis revealed that EcSAA mRNA is predominately expressed in liver and gill of grouper. Furthermore, the expression of EcSAA was differentially up-regulated in liver after infection with Staphyloccocus aureus, Vibrio vulnificus, Vibrio parahaemolyticus, Saccharomyces cerevisiae and Singapore grouper iridovirus (SGIV). Recombinant EcSAA (rEcSAA) was expressed in Escherichia BL21 (DE3) and purified for mouse anti-EcSAA serum preparation. The rEcSAA fusion protein was demonstrated to bind to all tested bacteria and yeast, and inhibit the replication of SGIV. Overexpression of EcSAA in grouper spleen (GS) cells could also inhibit the replication of SGIV. These results suggest that EcSAA may be an important molecule in the innate immunity of grouper. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Epinephelus coioides Singapore grouper iridovirus (SGIV) Serum amyloid A Molecular cloning Expression analysis
1. Introduction Innate immunity plays an important role in early defense mechanisms and serves to initiate the acquired immune response. The acute phase response (APR) is a complicated and systemic early defense system activated by tissue injury, infection, surgical trauma and inflammation [1,2], which results in a remarkable change in the concentrations of many plasma proteins, known as acute phase proteins (APPs) [3]. The great majority of APPs are synthesized in hepatocytes, also in extra-hepatic sites such as the brain and leukocytes [4]. It responses quickly and becomes a complicated but precise regulation network. APPs play an important role in a variety of the defense-related activities such as killing infectious microbes, repairing tissue damage and restoring healthy (homeostatic) state [5]. Serum amyloid A (SAA) is a major APP in mammals. The studies showed that the gene encoding SAA from trout acts as an effective gene of
* Corresponding author. Tel./fax: þ86 20 89023638. E-mail address: [email protected] (Q. Qin). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.11.014
innate immunity which is known to be regulated by the Toll-like receptor (TLR) signaling cascade. It has also been discussed that SAA may even constitute an endogenous TLR4 ligand [6]. SAA homologs have been identified in all vertebrates investigated and are highly conserved [2]. In recent years, SAA homologs have also been identified and characterized from some fish, such as arctic char (Salvelinus alpinus), common carp (Cyprinus carpio), Atlantic salmon (Salmo salar), zebrafish (Danio rerio) and rainbow trout (Oncorhynchus mykiss) [6e10]. The orange-spotted grouper，Epinephelus coioides, is widely cultured in China and Southeast Asian countries. As a favorite marine food fish, it is commercially important in live marine fish market. However, in recent years, with rapidly developing marine farming activities, outbreaks of viral diseases have affected grouper aquaculture industry causing heavy economic losses. Singapore grouper iridovirus (SGIV), a novel iridovirus in the genus Ranavirus, is one of the major pathogens that resulted in significant economic losses in grouper aquaculture [11,12]. In order to find immune-relevant factors responsible for virus infection, two suppression subtractive hybridization (SSH) libraries from the spleen of SGIV-infected grouper, E. coioides, have been described in our laboratory [13]. In our previous
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
studies, interleukin enhancer-binding factor 2, C-type lectin, bdefensin, leukocyte cell-derived chemotaxin-2 and hepcidin1/2 have been cloned from E. coioides, and results suggested that they may be important molecules involved in pattern recognition and pathogen elimination in the innate immunity of grouper [14e18]. In the present study, the molecular characteristics of grouper SAA, and the tissue distributions, expression patterns after challenging with bacterial and viral pathogens were investigated. The binding activity of the EcSAA and the inhibition of the replication of SGIV were also investigated. These present studies will help us to better understand its innate immune mechanisms in the antibacterial or anti-virus response of fishes. 2. Materials and methods 2.1. Fish Juvenile orange-spotted grouper, E. coioides (40e50 g) were purchased from a mari-culture farm at Daya bay, Huizhou City, Guangdong Province, China. After maintenance in aerated flowthrough seawater for 3 days, these fish were used for the challenge experiments. 2.2. Preparation of microbial cells and SGIV Vibrio vulnificus, Vibrio parahaemolyticus, Bacillus thuringiensis, Bacillus subtilis, Saccharomyces cerevisiae (American Type Culture Collection (ATCC) 9763), Staphylococcus aureus (ATCC 12598), Vibrio alginolyticus and Escherichia coli JM109 were obtained from our laboratory. V. parahaemolyticus was cultured with a TCBS agar plate at 26 C, while V. vulnificus was cultured at 26 C with aeration in LuriaeBertani (LB) medium prepared with fresh seawater. S. cerevisiae were cultured with 2 YPD medium with 3% glucose (4% bactotryptone, 2% bacto-yeast extract (pH 5.8)) at 30 C. Other bacterial strains were cultured at 37 C in LB prepared with the distilled water. All microbial strains were harvested by centrifugation at 3500 g for 10 min and suspended in the buffer for an appropriate concentration. Quantification was performed by plating various bacteria dilutions on agar plates. Cell lines of grouper spleen (GS) were propagated by the recommended methods with Leibovitz’s L15 culture medium with 10% fetal calf serum. Propagation of SGIV was performed as described previously [12]. The viral titer of SGIV was 105 TCID50/ml. 2.3. Immunization experiments In bacteria challenging experiment, each control and challenged sample was injected with 100 ml PBS and a live microbial PBS suspension (105 CFU/ml), respectively. Livers of six fish in each group were collected for quantitative real-time PCR (qRT-PCR) at 4, 8, 12, 24, 36 and 48 h for bacteria-challenged groups. In SGIV challenging experiment, each control and challenged sample was injected 50 ml PBS and SGIV at a concentration of 105 TCID50/ml, respectively. Livers of six fish in each group were collected for qRT-PCR at 4, 8,12, 24, 36, 48 and 72 h for SGIV-challenged groups. 2.4. RNA isolation and cDNA synthesis Total RNA was isolated from different tissues of grouper, E. coioides, using Trizol Reagent (Invitrogen) according to the manufacturer’s protocol. Each of the samples contained 6 independent individuals respectively to eliminate the individual differences. The RNA was treated with RQ1 RNase-Free DNase (Promega, USA) to remove contaminated DNA. The quality of total RNA was
297
assessed by electrophoresis on 1% agarose gel. Total RNA was reverse transcribed to synthesize the first-strand cDNA by ReverTra Ace kit (TOYOBO, Japan) according to the manufacturer’s instructions. 2.5. Cloning and sequence analysis of E. coioides serum amyloid A (EcSAA) cDNA and genomic DNA The first-strand cDNA was synthesized from the total liver RNA with the SMARTÔ RACE cDNA amplification kit (Clontech) for 30 RACE and 50 RACE. Two primers F1 (GAGAGGAGCAGGGGGCAGATGGG) and R1 (AGCCCATCTGCCCCCTGCTCCTC) were designed based on the identified EST sequence of SAA (GH612458). PCR was performed with 10 mM F1 or R1 and 500 nM of Nested Universal Primer A (NUP, Clontech). Denaturation was performed at 94 C for 5 min, followed by 35 cycles at 94 C for 30 s, 60 C for 30 s, and 72 C for 45 s. Genomic DNA was extracted from liver of orange-spotted grouper using the tissue Genomic DNA Purification System (Sino-American Biotechnology Co., China), according to the manufacturer’s instructions. The primers F2 (TCATAAGATTCTCTACGATCTATCA) and R2 (GTTGATGACTTTCATACTAATATT) were designed according to the 5-untranslated region (UTR) and 3-UTR of the full-length cDNA of EcSAA. 25 ng of genomic DNA was used for the genomic PCR with an LA Taq (TaKaRa) using F2 and R2. PCR was performed with an initial denaturation step of 5 min at 94 C, and then 35 cycles were run as follows: 94 C 45 s, 55 C 45 s, 72 C 1.5 min, and 72 C elongation for 5 min. 2.6. TA cloning, sequencing and database analysis PCR products were analyzed on 1% agarose gels, extracted with an AxyPrep DNA gel extraction kit (AxyGEN), and then ligated into pMD18-T vectors (TaKaRa) and transformed into competent E. coli DH5 cells. Positive colonies were screened by PCR and at least two recombinant plasmids were sequenced. Sequences were analyzed based on nucleotide and protein databases using the BLASTN and BLASTX program (http://www. ncbi.nlm.nih.gov/BLAST/). The protein and its topology prediction were performed using software at the ExPASy Molecular Biology Server (http://expasy.pku.edu.cn). Multiple sequence alignment of the EcSAA was performed with the Clustal X multiple-alignment software. MEGA 4.0 was also used to produce the phylogenetic tree. Neighbor-joining (NJ) method was used for the phylogenetic analysis. One thousand bootstraps were selected for the NJ trees to check its repeatability. 2.7. Analysis of EcSAA mRNA expression profiles qRT-PCR was employed to detect the EcSAA expression profiles using
b-actin as a reference gene. The qRT-PCR primers, F3 (ATTGCTCTGATTCTCATTGTGG)/R3 (CATCGTAGTTTCCTCTGG) and actin-F (TACGAGCTGCCTGACGGACA)/actin-R (GGCTGTGATCTCCTTTTGCA), were designed based on the full-length cDNA of EcSAA and b-actin. qRT-PCR was performed on Roche LightCycler 480 Real-time PCR system (Roche, Switzerland) using the 2 SYBR Green Real-time PCR Mix (TOYOBO, Japan). PCR amplification was performed in triplicate wells, using the cycling parameters: 94 C for 5 min, followed by 40 cycles of 5 s at 94 C, 10 s at 60 C and 15 s at 72 C. Relative gene expression was analyzed by OOC the comparative Ct method (2 T method). Target CT values were normalized to the endogenous gene b-actin. Results for each treated sample were expressed as N-fold changes in target gene expression relative to the same gene target in the calibrator sample, both normalized to the b-actin gene. All samples were analyzed in three duplications and all data were given in term of relative mRNA expression level as means SD, and then subjected to Student’s t-test. Differences were considered significant at p < 0.05 or p < 0.01.
298
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
Fig. 1. Exon intron organisation of the grouper SAA gene. Start and stop codon are marked with triangles. Numbers indicate the DNA position relative to the transcriptional start.
2.8. Expression and purification of recombinant EcSAA and preparation of antiserum Specific primers F4 (CGGGATCCCAGTGGCACAACTTTCCTCGT) and R4 (GCCTCGAGCTAATATTTTTCTGGAAGTCC) were used to
amplify the DNA fragment encoding the mature peptide of EcSAA. The target PCR product was digested with BamH I and XhoI (Takara), and then subcloned into the BamH I/Xho I sites of expression vector pET-32a.The recombinant plasmid (pET-EcSAA) was transformed into E. coli BL21 (DE3) and subjected to nucleotide
Fig. 2. (A) Multiple alignment of the amino acid sequences of grouper SAA with other known SAAs. Black shaded sequence indicates positions that have a fully conserved residue, gray shaded sequence indicates conserved amino acid substitutions, light gray shaded sequence indicates semi-conserved amino acid substitutions, and dashes indicate gaps. Signal peptide is indicated upon the amino acid residues. N-terminal hydrophobic region is underlined. The predicted tertiary structure (a-helix and b-sheet) is boxed, based on the structure of human SAA [2]. GenBank accession numbers for these SAA protein sequences used are as follows: Lates calcarifer (ADE05545.1), Tetraodon nigroviridis (embjCAF99678.1), Oncorhynchus mykiss (CAA67766.1), Danio rerio (NP_001005599.1), Homo sapiens (AAB59539.1), Mesocricetus auratus (AAA37098.1), Macaca mulatta (XP_001086242.1), Pan troglodytes (XP_001173019.1), and Oryctolagus cuniculus (AAA31464.1). (B) Phylogenetic tree analysis of the aligned proteins with the Clustal X program. The relationships among the various components were analyzed by the Neighbor-joining (NJ) method. Numbers on the branches indicate percent bootstrap confidence values from 1000 replicates.
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
sequencing. Positive clone was incubated in 200 ml LB medium (containing 100 mg/ml ampicillin) at 37 C with shaking at 220 rpm. The parent vector without an insert fragment was used as negative control. When the culture medium reached OD600 of 0.5e0.7, the cells were incubated for 4 additional hours with the induction of IPTG at the final concentration of 0.6 mmol/l. The recombinant EcSAA fusion protein (designated as rEcSAA) was purified by affinity chromatography with Ni-nitrilotriacetic acidagarose (Qiagen, Germany) according to the manufacturer’s instruction. The resulting protein was analyzed by 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized with Coomassie brilliant blue R-250. The concentration of recombinant fusion protein was determined using Bradford’s method. The polyclonal antibody against rEcSAA produced by immunizing BALB/c mice according to the conventional method [19]. The titer of the antiserum was then determined by an enzyme-linked immunosorbent assay (ELISA), and the specificity of the antiserum was detected with western blot.
299
2.9. Microbial-binding assays Yeast (S. cerevisiae), Gram-positive bacteria (S. aureus, B. thuringiensis and B. subtilis) and Gram-negative bacteria (V. vulnificus, V. parahaemolyticus, V. alginolyticus and E. coli JM109) were used to test binding of recombinant EcSAA fusion protein to microorganisms according to the described method [14]. Briefly, bacteria or yeast were cultured in 9 ml LB medium or YPD medium for 6 h at 37 C. Bacterial or yeast cells were pelleted by centrifugation at 12,000 g for 2 min. Microbes were pelleted and washed several times with 1 ml of TBS buffer (50 mM TriseHCl, pH 7.5, 150 mM NaCl). Approximately 5 107 microbes were incubated with 5 mg of targeted proteins in TBS by gentle orbital rotation for about 1 h at room temperature. Microbes were pelleted and washed five times with 1 ml of binding buffer, and then subjected to elution with 4 M urea in 10 mM TriseHCl, pH 8.0 for 10e15 min with mild agitation in one-fifth of the original volume. As a control, bacterial cells were incubated with saline and subjected to the same treatments. Eluted proteins were then denatured by heating at 100 Cfor 15 min. Protein
Fig. 3. qRT-PCR analysis of the expression patterns of EcSAA. (A) The tissue expression patterns of grouper SAA mRNA. Date is expressed as a ratio to expression in Kidney. The endogenous control for qualification was b-actin. (B) The time course expression patterns of EcSAA mRNA in liver of grouper after challenge with S. cerevisiae. (C) The time course expression patterns of EcSAA mRNA in liver of grouper after challenge with S. aureus. (D) The time course expression patterns of EcSAA mRNA in liver of grouper after challenge with V. vulnificus. (E) The time course expression patterns of EcSAA mRNA in liver of grouper after challenge with SGIV. Date is expressed as a ratio to EcSAA mRNA expression of PBS group. Vertical bars represented the means SD (n ¼ 3), and significant differences of EcSAA expression between the challenged and unchallenged samples were indicated with an asterisk (*) at p < 0.05 or two asterisks (**) at p < 0.01. The endogenous control for qualification was b-actin.
300
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
binding was analyzed by western blot, as follows. Proteins were fractionated by electrophoresis through 12.5% SDS-PAGE and electrophoretic transferred onto a PVDF membrane (Millipore). Membranes were blocked with 5% nonfat milk and PBST at room temperature for 2 h and washed three times with PBST. Anti-EcSAA serum was diluted 1/1000 in 5% nonfat milk and incubated with the membranes overnight at 4 C. After washing three times with PBST, membranes were incubated for 1 h with HRP-labeled anti-mouse IgG Ab diluted 1/1000 in 5% nonfat milk. The membranes were washed three times with PBST and detected with DAB.
2.13. Statistical analysis
2.10. Protective effect of rEcSAA against SGIV infection
Based on the partial cDNA sequence of EcSAA, the gene-specific primers of F1 and R1 were designed for the rapid amplification of 30 and 50 cDNA (RACE), and the full-length cDNA of EcSAA was amplified. The full-length cDNA of EcSAA was 508 bp (Genbank accession no. JX131376) and contained a 366 bp open reading frame (ORF) coding for a protein of 121 amino acid (aa), and had a 72 bp of 50 -UTR and a 70 bp of 30 -UTR including a putative polydenylation consensus signal (AATAAA) and a poly (A) tail. After cloning and sequencing the cDNA of EcSAA, we next sought to obtain the gene sequence of EcSAA. Based on the fulllength cDNA sequence of EcSAA, two primers of F2 and R2 were designed. The PCR products were cloned, sequenced and assembled into a full-length gene of EcSAA. The EcSAA gene is segmented into
To determine the effect of EcSAA on SGIV infection, the rEcSAA fusion protein was mixed with SGIV and then used to infect GS cells at a MOI of about 0.1. After a 2 h incubation, the mixture of rEcSAA and SGIV was removed and the SGIV-infected cells were washed twice with PBS. At 3 days postinfection, the morphological changes were observed under a light microscope (Leica, Germany). 2.11. Selection of GS cells stably expressing EcSAA EcSAA expression vector pcDNA-EcSAA was constructed based on the vector pcDNA3.1 (þ) (Invitrogen, USA). Primers of pcDNA-EcSAAF (GCGGATCCATGAAGTTGCTTCTCGCAGGAAT) and pcDNA-EcSAA-R (CGGAATTCTCAGTGGTGGTGGTGGTGGTGATATTTTTCTGGAAGTC) were used to amplify the ORF sequence of EcSAA from grouper liver cDNA. The target PCR product was digested and subcloned into the BamHⅠ and XhoⅠsites of pcDNA3.1 (þ) vector. The recombinant plasmid was transformed into E. coli DH5a and subjected to nucleotide sequencing. Stable clones of GS cells expressing EcSAA were generated by transfection of pcDNA-EcSAA constructs into GS cells using Lipofectamine 2000 reagent according to the manufacturer’s instructions (Invitrogen). For control, GS cells were transfected with empty pcDNA3.1 vector. Transfected cells were clonally selected after at least 4 weeks using 2 mg/ml G418 and characterized by reverse transcription-polymerase chain reaction (RT-PCR). Total RNA was prepared from cells using TRIzol Teagent (Invitrogen), and was reverse-transcribed using Tra Ace (TOYOBO, USA) according to the manufacturer’s instructions. The resulting lines were named GS/ pcDNA3.1 and GS/EcSAA, respectively.
Statistical analysis was carried out using SPSS Version 13. Oneway ANOVA at a 95% confidence level (p < 0.05 and p < 0.01) was used to evaluate the significance of the differences between the gene expressions in each sample. 3. Results 3.1. Sequencing analysis of grouper SAA cDNA and genomic DNA
2.12. Viral replication kinetics assay To investigate the impact of EcSAA on SGIV infection in vitro, viral replication kinetics were evaluated based on SGIV propagation in GS/EcSAA and GS/pcDNA3.1 cells, respectively. In detail, the cell lines of GS/EcSAA and GS/pcDNA3.1 (1 105 per well) were separately seeded in 24-well plates, grown for 24 h and infected with SGIV at a MOI of about 0.1. The virus-infected cell lysates were collected at the indicated time points (24 and 48 h p.i.), and were used to infect GS cells cultured in 96-well plates after serially diluted, then the virus titers of the collected lysates were determined using 50% tissue culture infectious dose (TCID50) assay after 7 day of incubation p.i [20]. Each sample was measured in triplicate. Meanwhile, parallel cell samples were harvested for RNA extraction and cDNA synthesis, and then the expression profiles of major capsid protein (MCP) of SGIV was assessed by qRT-PCR using primers MCP-F (GCACGCTTCTCTCACCTTCA) and MCP-R (AACGGCAACGGGAGCACTA). b-actin was amplified as reference gene with specific primers actin-F and actin-R. The morphological changes were observed daily under a light microscope (Leica, Germany). Data were analyzed using Student’s t-test when comparing means between GS/EcSAA and GS/pcDNA3.1 cells at single time points.
Fig. 4. Bioassay of recombinant EcSAA fusion protein. (A) SDS-PAGE and western blot analysis of recombinant protein expression of pET-SAA. M: Protein molecular mass standards. 1: Supernatant from induced pET-32a after sonication. 2: Supernatant from induced pET-SAA after sonication. 3: Pellets from induced pET-SAA after sonication. 4: Purified rEcSAA fusion protein. The recombinant EcSAA is boxed. 5: Purified rEcSAA fusion protein incubated with anti-EcSAA serum (1:2500). 6: Purified rEcSAA was detected by negative control serum. (B) Binding of the microorganisms by rEcSAA fusion protein. Living microbial strains were incubated with rEcSAA fusion protein and the stirringly washed pellets were subjected to the SDS-PAGE and detected by western blot with anti-EcSAA serum. Lane 1: rEcSAA protein. Lane 2: S. cerevisiae. Lane 3: S. aureus.Lane. 4: B. subtilis. Lane. 5: B. thuringiensis. Lane 6: V. vulnificus. Lane 7: V. parahaemolyticus. Lane 8: V. alginolyticus. Lane 9: E. coli JM109.
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
four exons (Fig. 1; JX131377). Exon 1 encodes the majority of the 5UTR. Exon 2 encodes the N-terminal 29 aa residues of the SAA protein. Exon 3 encodes the residual 46 aa while exon 4 encodes the last residual 46aa. The deduced amino acid sequence of EcSAA protein is remarkably conserved. It shared significant homology with SAA from Lates calcarifer (ADE05545.1, 86% identity), Tetraodon nigroviridis (embjCAF99678.1, 70% identity), O. mykiss (CAA67766.1, 73% identity), and D. rerio (NP_001005599.1, 67% identity). Multiple sequence alignments were carried out using the Clustal X multiplealignment software (Fig. 2A). EcSAA protein has a potential signal peptide with 18 amino acid residues in N-terminal by prediction of SignalP software. The hydrophobic N-terminal portion of the molecule has been shown to be a major determinant for amyloid formation [21] and C-terminal portion is the proposed neutrophil and GAG binding region. Secondary structure predictions indicated that the grouper SAA molecule is likely to contain two regions of a-helix and two b-strands. Phylogenetic and molecular evolutionary analysis was conducted using Mega 4.0. The phylogenetic NJ-tree construction based on SAA amino acid sequences is shown in Fig. 2B. EcSAA was grouped with other fish SAAs. This grouping was well-supported by bootstrapping.
301
3.3. Time-course of EcSAA gene expression upon stimulation with bacterial or virus challenge To determine whether EcSAA expression was differentially regulated upon infection, qRT-PCR analysis was also used to examine the relative expression of EcSAA in groupers challenged with different microbes with b-actin as internal control. The expression level of EcSAA in the grouper liver was up-regulated after bacterial challenge. The infection time-course analysis revealed 49.86-fold induction of EcSAA expression after 24 h injection of S. cerevisiae compared with PBS, and then decreased to 3.417-fold at 48 h (Fig. 3B). The expression of EcSAA in the liver injected with S. aureus was increased at all the time, and up to 462.6-fold at 48 h (Fig. 3C). The expression level injected with V. vulnificus was increased up to 115.9-fold at 12 h post-injection, and then decreased to 6.237-fold at 48 h (Fig. 3D). The expression level of EcSAA transcript was up-regulated after SGIV challenge (Fig. 3E). The infection time-course analysis revealed 1.008-fold induction of EcSAA transcript after 4 h injection of SGIV compared with PBS, and the transcript increased up to 10.64-fold at 36 h post-injection then decreased to 1.855-fold at 72 h. 3.4. Expression, purification, and antibody preparation of recombinant EcSAA
3.2. Expression analysis of EcSAA gene To investigate the tissue expression profile of EcSAA in healthy orange-spotted grouper, qRT-PCR was used to analyze its expression levels in various tissues. The EcSAA expression was mainly detected in the tissues of liver, gill, muscle, skin, and head kidney (Fig. 3A).
The parent vector pET-32a and the plasmid pET-EcSAA were transformed into E. coli BL21 (DE3), respectively. After IPTG induction, cell lysates were obtained and boiled for 10 min, then subjected to SDS-PAGE analysis. As determined by SDS-PAGE, one band at 20 kDa (Trx-His-tag) (Fig. 4A lane 1) was visualized by
Fig. 5. The rEcSAA fusion protein inhibited the replication of SGIV in GS cells. Severe cytopathogenic effect (CPE) sites are indicated by white arrows.
302
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
Coomassie brilliant blue staining, while recombinant EcSAA (rEcSAA) has an apparent mass of 29.5 kDa, which matched to the expected molecular mass of EcSAA based on the predicted molecular mass and the deduced amino acid sequence (Fig. 4A lane 2e3). The concentration of the purified rEcSAA (Fig. 4A lane 4) was 2.27 mg/ml according to Bradford’s method. To identify the biological properties of EcSAA, the recombinant protein were used to immunize mouse to prepare the immune serum. The specificity of anti-SAA serum was examined by western blot. The rEcSAA fusion protein (5 mg) was specifically recognized by polyclonal antibody against EcSAA (Fig. 4A lane 5), while no bands were found detected by negative control serum (Fig. 4A lane 6), indicating that the anti-EcSAA antibody specifically recognized the purified EcSAA fusion protein. 3.5. Binding of EcSAA to microbes To test the ability of the rEcSAA binding to microbes, a direct binding assay was performed. The microbes were incubated with the rEcSAA fusion protein, and the microbial pellets were assessed by western blot using anti-EcSAA serum. As shown in Fig. 4B, rEcSAA was found to bind to all tested bacteria and yeast. This experiment was processed with the recombinant protein, composed of a Trx-His-tag part plus the normal rEcSAA protein. To determine whether the extra part could affect the microbialbinding activity of rEcSAA, we obtained the rTrx (Trx-His-tag) fusion protein and incubated them with all tested bacteria and yeast. rTrx could not bind to the tested bacteria and yeast, indicating that rEcSAA do have the microbial-binding activity. 3.6. Effects of EcSAA on the SGIV replication To test the protective effect of rEcSAA against viral infection, the rEcSAA fusion protein (5 mg/ml) was mixed with SGIV and then used to infect GS cells at a MOI of about 0.1. The results showed that the CPE caused by SGIV or rTrx fusion protein (5 mg/ml) and SGIV appeared earlier and more prominently in GS cells, compared to that in GS cells with rEcSAA fusion protein (5 mg/ml) and SGIV (Fig. 5). To further assess the effect of EcSAA on the replication of SGIV, the stably transfected GS/pcDNA3.1 cells and GS/EcSAA cells were infected with SGIV and the replication kinetics were compared in the course of infection. As shown in Fig. 6A, the SGIV replicated more slowly in GS/EcSAA cells and the viral titers yielded were about 3.98 and 8.22 times lower than those in the GS/pcDNA3.1 cells in 24 and 48 h p.i. To verify the results, the transcription kinetics of MCP as an indicator of SGIV transcription was investigated by qRTPCR. As shown in Fig. 6B, the MCP transcripts in GS/pcDNA3.1 were about 1.81 and 3.66 times higher than those in GS/EcSAA at 24 and 48 h p.i., indicating over-expressed EcSAA has an inhibitory impact on the gene transcription kinetics of SGIV. Meanwhile, the CPE caused by SGIV appeared earlier and more prominently in GS/ pcDNA3.1 cells, compared to that in GS/EcSAA (Fig. 7). 4. Discussion In the present work, we described for the first time the molecular characterization of SAA in marine fish grouper. Our results strongly support that this sequence obtained from grouper is a mammalian SAA homolog. Similar to other known SAAs, grouper SAA (EcSAA) contained a signal sequence of 18 amino acids. The neutrophil and GAG binding region were well conserved in EcSAA. The length of EcSAA protein (121 aa) is similar to those of trout, zebrafish and pufferfish Tetraodon (121 aa) [6]. Almost all of the results in this study suggest that the EcSAA may be a functionally conserved protein.
Fig. 6. Effect of EcSAA overexpression on SGIV replication in GS cells. (A) Cell-free viruses were collected from the lysates of two stably transfected GS cell lines infected by SGIV at different time points (24 and 48 h p.i., respectively) and the viral titer was measured using TCID50 method. (B) The expression level of MCP mRNA in two stably transfected GS cells during SGIV infection. Cell lysates were collected at the indicated time points (24 and 48 h p.i., respectively) and used for RNA extraction. Relative expression levels of MCP mRNA were assessed by qRT-qPCR, using b-actin as a reference gene. Vertical bars represented the means SD, and significant differences of viral titers or MCP transcripts levels between GS/pcDNA3.1 cells and GS/EcSAA cells were indicated with an asterisk (*) at p < 0.05.
It is generally accepted that APPs are inductors of a proinflammatory reaction and fever, their over-expression can lead to an anti-inflammatory response. Thus, APPs are used today as potential biological markers for monitoring animal welfare and health status [22e24]. SAA are considered as main APP in mammals. Major APPs are often observed to increase markedly with the first 48 h after the triggering event and have a rapid decline due to their short half-life [1]. The aim of this study was mainly to determine the immune changes (APR) caused by bacterial infection. As shown in Fig. 3, the EcSAA expression was mainly detected in the tissues of liver, gill, muscle, skin, and head kidney. After bacterial infection, a remarkable APR is evoked. Our studies revealed that SAA mRNA was significantly up-regulated in grouper liver after infection with V. vulnificus, S. aureus and S. Cerevisiae. This is agreement with that in carp liver (50-fold at 36 h) and skin (1600-fold at 36 h) infected by Ichthyophthirius multifiliis [25]. It cannot be excluded that the hepatic regulation of SAA was induced by the cytokine molecules produced in the inflammation site, which would be in accordance with Jorgensen [9] who showed that cytokine-like molecules induce expression of SAA in the hepatocytes from Atlantic salmon. Recent study demonstrated that human SAA binds to many Gram-negative bacteria including E. coli and Pseudomonas aeruginosa through outer membrane protein A (OmpA) family members.
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
303
Fig. 7. Overexpression of EcSAA delayed the appearance of SGIV-induced CPE in GS cells. Severe CPE sites are indicated by white arrows.
The binding was found to be high affinity and rapid. Importantly, this binding was not inhibited by high density lipoprotein with which SAA is normally complexed in serum. Binding was also observed when bacteria were offered serum containing SAA [26]. As a mammalian SAA homolog, to test the ability of the rEcSAA binding to microbes, a direct binding assay was performed. In the present study, rEcSAA was found to bind to all tested bacteria and yeast, which is different from human SAA. The immune system of mammalian is much more complex than the fish, and shows different immune mechanisms to different species of bacteria. The grouper belongs to the lower vertebrates, and the SAA may take up the identification of whole bacteria, while in mammals, the function of SAA may be weakened and some separation. Serum amyloid A (SAA) is an acute-phase protein induced by a variety of inflammatory stimuli, including bacterial and viral infections. SAA was recently found to inhibit hepatitis C virus (HCV) infection in cultured cells [27]. SAA reduced HCV infectivity in a dose-dependent manner when added during HCV infection but not after virus entry. SAA bound HCV virions and specifically blocked HCV entry but did not affect virus attachment. To our knowledge, no study has been reported on SAA for its antiviral activity from marine fish grouper. Singapore grouper iridovirus (SGIV), a novel iridovirus in the genus Ranavirus, is one of the major
pathogens that resulted in significant economic losses in grouper aquaculture [11,12]. After obtaining the rEcSAA fusion protein and the GS cells stably expressed EcSAA, viral replication kinetics of SGIV were evaluated. The studies showed that both the rEcSAA fusion protein and over-expressed EcSAA in GS cells had the ability to inhibit the replication of SGIV. Those results indicated that EcSAA might be participated in the host antiviral responses, and play an important role in innate immunity of grouper. In conclusion, the full-length cDNA encoding SAA was cloned from grouper, E. coioides. It was predominately expressed in liver and gill of grouper, and was differentially up-regulated in liver after bacterial and viral challenge. The rEcSAA fusion protein was demonstrated to bind to all tested bacteria and yeast, and inhibit the replication of SGIV. Overexpression of EcSAA in grouper spleen (GS) cells could also inhibit the replication of SGIV. These results suggest that EcSAA may be an important molecule in the innate immunity of grouper. Acknowledgments This work was supported by grants from National High Technology Development Program of China (863)(2012AA092201), National Basic Research Program of China (973 program) (2012CB114402), the Knowledge Innovation Program of the Chinese Academy of Sciences
304
J. Wei et al. / Fish & Shellfish Immunology 34 (2013) 296e304
(KZCX2-EW-Q213, KZCX2-YW-BR-08), the National Natural Science Foundation of China (30930070, 31001124, 30725027, 31202022), and the Guangdong Province Natural Science Foundation (S2011040000953). References [1] Cray C, Zaias J, Altman NH. Acute phase response in animals: a review. Comparative Medicine 2009;59:517e26. [2] Uhlar CM, Whitehead AS. Serum amyloid A, the major vertebrate acute-phase reactant. European Journal of Biochemistry 1999;265:501e23. [3] Gabay C, Kushner I. Mechanisms of disease: acute-phase proteins and other systemic responses to inflammation. New England Journal of Medicine 1999; 340:448e54. [4] Bayne CJ, Gerwick L. The acute phase response and innate immunity of fish. Developmental and Comparative Immunology 2001;25:725e43. [5] Murata H, Shimada N, Yoshioka M. Current research on acute phase proteins in veterinary diagnosis: an overview. The Veterinary Journal 2004;168:28e40. [6] Rebl A, Goldammer T, Fischer U, Köllner B, Seyfert H-M. Characterization of two key molecules of teleost innate immunity from rainbow trout (Oncorhynchus mykiss): MyD88 and SAA. Veterinary Immunology and Immunopathology 2009;131:122e6. [7] Jensen LE, Hiney MP, Shields DC, Uhlar CM, Lindsay AJ, Whitehead AS. Acute phase proteins in salmonids - evolutionary analyses and acute phase response. Journal of Immunology 1997;158:384e92. [8] Fujiki K, Shin D-H, Nakao M, Yano T. Molecular cloning and expression analysis of carp (Cyprinus carpio) interleukin-1[beta], high affinity immunoglobulin E Fc receptor [gamma] subunit and serum amyloid A. Fish & Shellfish Immunology 2000;10:229e42. [9] Jorgensen JB, Lunde H, Jensen L, Whitehead AS, Robertsen B. Serum amyloid A transcription in Atlantic salmon (Salmo salar L.) hepatocytes is enhanced by stimulation with macrophage factors, recombinant human IL-1 beta, IL-6 and TNF alpha or bacterial lipopolysaccharide. Developmental and Comparative Immunology 2000;24:553e63. [10] Lin B, Chen S, Cao Z, Lin Y, Mo D, Zhang H, et al. Acute phase response in zebrafish upon Aeromonas salmonicida and Staphylococcus aureus infection: striking similarities and obvious differences with mammals. Molecular Immunology 2007;44:295e301. [11] Chang SF, Ngoh-Lim GH, Kueh LFS, Qin QW, Seng EK, Sin YM. Initial investigations into two viruses isolated from marine food fish in Singapore. Veterinary Record 2002;150:15e6. [12] Qin QW, Chang SF, Ngoh-Lim GH, Gibson-Kueh S, Shi C, Lam TJ. Characterization of a novel ranavirus isolated from grouper Epinephelus tauvina. Diseases of Aquatic Organisms 2003;53:1e9.
[13] Xu D, Wei J, Cui H, Gong J, Yan Y, Lai R, et al. Differential profiles of gene expression in grouper Epinephelus coioides, infected with Singapore grouper iridovirus, revealed by suppression subtractive hybridization and DNA microarray. Journal of Fish Biology 2010;77:341e60. [14] Wei JG, Xu D, Zhou JG, Cui HC, Yan Y, Ouyang ZL, et al. Molecular cloning, characterization and expression analysis of a C-type lectin (Ec-CTL) in orange-spotted grouper, Epinephelus coioides. Fish & Shellfish Immunology 2010;28:178e86. [15] Cui HC, Yan Y, Wei JG, Hou ZW, Huang YH, Huang XH, et al. Cloning, characterization, and expression analysis of orange-spotted grouper (Epinephelus coioides) ILF2 gene (EcILF2). Fish & Shellfish Immunology 2011; 30:378e88. [16] Zhou JG, Wei JG, Xu D, Cui HC, Yan Y, Ou-Yang ZL, et al. Molecular cloning and characterization of two novel hepcidins from orange-spotted grouper, Epinephelus coioides. Fish & Shellfish Immunology 2011;30:559e68. [17] Wei J, Guo M, Cui H, Yan Y, Ouyang Z, Qin Q. A new leukocyte cell-derived chemotaxin-2 from marine fish grouper, Epinephelus coioides: molecular cloning and expression analysis. Fish & Shellfish Immunology 2011;31:600e5. [18] Guo M, Wei J, Huang X, Huang Y, Qin Q. Antiviral effects of beta-defensin derived from orange-spotted grouper (Epinephelus coioides). Fish & Shellfish Immunology 2012;32:828e38. [19] Deininger P [in 3 volumes]. In: Molecular cloning: a laboratory manual. Analytical biochemistry. 2nd ed., vol. 186. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. p. 182e3. 1990. [20] Reed LJ, Muench H. A simple method of estimating 50% endpoints. Journal of Hygiene 1938;27:493e7. [21] Westermark GT, Engstrom U, Westermark P. The N-terminal segment of protein AA determines its fibrillogenic property. Biochemical and Biophysical Research Communications 1992;182:27e33. [22] Ceciliani F, Giordano A, Spagnolo V. The systemic reaction during inflammation: the acute-phase proteins. Protein and Peptide Letters 2002;9: 211e23. [23] Petersen HH, Nielsen JP, Heegaard PMH. Application of acute phase protein measurements in veterinary clinical chemistry. Veterinary Research 2004;35: 163e87. [24] Pallares FJ, Martinez-Subiela S, Seva J, Ramis G, Fuentes P, Bernabe A, et al. Relationship between serum acute phase protein concentrations and lesions in finishing pigs. Veterinary Journal 2008;177:369e73. [25] Gonzalez SF, Buchmann K, Nielsen ME. Ichthyophthirius multifiliis infection induces massive up-regulation of serum amyloid A in carp (Cyprinus carpio). Veterinary Immunology and Immunopathology 2007;115:172e8. [26] Shah C, Hari-Dass R, Raynes JG. Serum amyloid A is an innate immune opsonin for Gram-negative bacteria. Blood 2006;108:1751e7. [27] Cai Z, Cai L, Jiang J, Chang K-S, van der Westhuyzen DR, Luo G. Human serum amyloid A protein inhibits hepatitis C virus entry into cells. Journal of Virology 2007;81:6128e33.