- Email: [email protected]
Molecular cloning, characterization of Pomacea canaliculata HSP40 and its expression analysis under temperature change
Journal of Thermal Biology 81 (2019) 59–65
Contents lists available at ScienceDirect
Journal of Thermal Biology journal homepage: www.elsevier.com/locate/jtherbio
Molecular cloning, characterization of Pomacea canaliculata HSP40 and its expression analysis under temperature change
T
Yipeng Xu , Guowan Zheng, Guangfu Liu, Qianqian Yang, Xiaoping Yu ⁎
⁎
Zhejiang Provincial Key Laboratory of Biometrology and Inspection & Quarantine, College of Life Sciences, China Jiliang University, 258 Xueyuan Street, Xiasha, Hangzhou 310018, China
ARTICLE INFO
ABSTRACT
Keywords: Pomacea canaliculata Heat shock protein HSP40 HSP70
Heat shock proteins (HSPs) play important roles in the adaption of Pomacea canaliculata to unsuitable environments. In the present study, a cDNA encoding HSP40 in P. canaliculata (PocaHSP40) was cloned and characterized. The PocaHSP40 cDNA was 1466 bp, containing an ORF of 954 bp encoding 317 amino acids. Bioinformatics analysis showed that PocaHSP40 belonged to type II HSP40s and had four predicted phosphorylation sites. Phylogenetic analysis proved the conservation of HSP40s in mollusks. PocaHSP40 was widely expressed in the gill, digestive gland, kidney, and foot muscle of P. canaliculata. Challenged by different temperatures, the expression of PocaHSP40 was up-regulated under low temperatures but not high temperatures, which was contrary to the expression change of PocaHSP70 under low and high temperatures. These results implied that P. canaliculata evolved different strategies for survival under low temperature and high temperature through the regulation of HSPs.
1. Introduction
Hata, 2000b; Qiu et al., 2006). Type I HSP40s contain all above domains. Type II HSP40s lack the CRR domain. Type III HSP40s only possess the J domain. To date, thousands of HSP40s have been identified in prokaryotes and eukaryotes since the first discovery of HSP40 in bacteria (Yochem et al., 1978). However, only a few HSP40s have been studied in mollusks. So far, only three reports involve HSP40s from Gastropoda (Bouétard et al., 2013; Foster et al., 2015), and only the integrated protein sequences of HSP40s from Aplysia californica and Biomphalaria glabrata are available. Pomacea canaliculata, a member of Gastropoda, is one of the 100 worst invasive alien species in the black list of the World Conservation Union (Lowe et al., 2000). Temperature is an important environmental factor for the distribution of P. canaliculata (Lv et al., 2011; Seuffert et al., 2010), but it appears to have evolved a strong capability to endure temperature change. P. canaliculata has a greater tolerance to low temperatures than P. maculata (Matsukura et al., 2009, 2016; Yoshida et al., 2014), and to high temperatures than P. diffusa (Mu et al., 2015). It have been well verified that HSPs play important roles in protecting other animals from the injury of extreme temperature, thus it is meaningful to study the role of HSPs in the adaptation of P. canaliculata to temperature change. Recently, it has been proved that HSP60, HSP70 and HSP90 are involved in the thermal tolerance of P. canaliculata (Mu et al., 2015; Song et al., 2014; Xu et al., 2014; Zheng
Heat shock proteins (HSPs) are a group of highly conserved proteins that help organisms to maintain cellular viability under adversities, such as heat shock, microbial infection, starvation, and water deprivation (Hartl and Hayer-Hartl, 2002; Santoro, 2000). Based on their molecular weight and functions, HSPs can be classified into several families, including HSP100, HSP90, HSP70, HSP60, HSP40 and low molecular mass HSPs (Feder and Hofmann, 1999). Among them, the HSP40 family, also called DNAJ family, functions as co-chaperone with the well-studied HSP70 proteins (Fan et al., 2003). Cooperating with HSP70, the HSP40 family is involved in numerous cellular functions, including regulation of protein folding, translocation, and assembly (Cheetham and Caplan, 1998; Ohtsuka and Hata, 2000a). HSP40 proteins are characterized by the presence of the remarkably conserved J domain, through which HSP40s bind to HSP70s and regulate the ATPase activity of HSP70s (Li et al., 2009; Ohtsuka and Hata, 2000b; Qiu et al., 2006). Members of the HSP40 family have four distinct domains: J domain (JD), Gly/Phe-rich region (G/F domain), cysteine-rich region (CRR domain), and C-terminal domain (CTD) (Bork et al., 1992; Qiu et al., 2006). According to the organization of their domains, HSP40 proteins are divided into three categories (Cheetham and Caplan, 1998; Hennessy et al., 2000; Li et al., 2009; Ohtsuka and
Corresponding authors. E-mail addresses: [email protected] (Y. Xu), [email protected] (G. Zheng), [email protected] (G. Liu), [email protected] (Q. Yang), [email protected] (X. Yu). ⁎
https://doi.org/10.1016/j.jtherbio.2019.02.006 Received 16 August 2018; Received in revised form 13 January 2019; Accepted 1 February 2019 Available online 02 February 2019 0306-4565/ © 2019 Elsevier Ltd. All rights reserved.
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
2.4. Treatment of P. canaliculata
et al., 2012). In the present study, a full-length cDNA of P. canaliculata HSP40 was cloned, and its expression in response to temperature change was investigated aiming to explore the role of HPS40 in the adaptation of P. canaliculata to temperature changes.
Reported by most authors, the endurable temperature range of P. canaliculata is 4–35 °C (Seuffert et al., 2010), whereas the range in China is 8–38 °C, and the fatal temperature of P. canaliculata is lower than 0 °C and higher than 40 °C (Zhou et al., 2003). The water temperature for P. canaliculata breeding and activity is 10–30 °C, among which the optimum water temperature is near the ambient temperature (25 °C) (Liu et al., 2011; Seuffert et al., 2010). Therefore, in the present study, the ambient temperature (25 °C) was set as the control temperature, while 6 °C, 9 °C, 12 °C and 15 °C were set as the low test temperatures, and 30 °C, 33 °C, 36 °C and 39 °C were set as the high test temperatures. Considering the crucial role of female snails in the population reproduction of P. canalicauta, they were chosen to be experimental snails. The treatment of P. canaliculata was as described previously (Xu et al., 2014). For the experiment, the female snails of similar size (height: 3.1–3.5 cm; weight: 5.0–6.5 g) were isolated, and exposed to the different test temperatures for 2 h and then returned to 25 °C for 1 h to induce and accumulate HSPs expression before expression test (Cheng et al., 2007; Farcy et al., 2007; Nakano and Iwama, 2002; Zhang and Zhang, 2012). Each treatment was repeated three times. No snails died during experiments.
2. Materials and methods 2.1. Animals The experimental P. canaliculata snails were collected from the Zizania latifolia field in Yuyao City (121°09′E, 30°30′N), China. The annual average temperature, the highest and the lowest mean temperature of Yuyao is 16.2 °C, 28.3 °C (in July) and 4.1 °C (in January), respectively. When the snails were collected, the water temperature was 24.5 °C. After collection, these snails were reared with Chinese cabbage (Brassica rapa Pekinensis) in freshwater at ambient temperature (25 ± 1 °C). 2.2. cDNA cloning of PocaHSP40 cDNAs of all messenger RNA were obtained as previously described (Xu et al., 2014). Based on the alignment of all mollusk HSP40 sequences that are available, degenerate primers were designed for amplifying a conserved sequence of P. canaliculata HSP40 (PocaHSP40) (Table 1). The PCR product was cloned into pMD-18T cloning vector (Takara) and sequenced. Based on the sequenced conserved part of PocaHSP40, the specific primers were designed for 5′- and 3′-RACE (rapid amplification of cDNA ends) (Table 1). Using 5′-Full RACE Kit and 3′-Full RACE Kit (Takara), 5′- and 3′-RACE were carried out to define the putative 5′ and 3′ ends of PocaHSP40. The PCR products from 5′- and 3′-RACE were also cloned and sequenced. Finally, the full-length cDNA sequence of PocaHSP40 was obtained.
2.5. Quantitative PCR analysis of gene expression after treatment Total RNA was extracted from 100 mg tissues of treated P. canaliculata snails. After being treated with DNase I that was free of RNase, total RNA was used to synthesize the first-strand cDNA. With SYBR@ Premix Ex TaqTM (Takara), fluorescent quantitative PCR (qPCR) was used to investigate the transcript levels of target gene in gill, digestive gland, kidney, and foot muscle of P. canaliculata after various temperature treatments. Primers for qPCR analysis of different gene were designed (Table 1), and their specificity was checked by conventional PCR and melting curve analysis. The amplification efficiency value of qPCR primes, qPCRactin-F/qPCRactin-R, qPCR40-F/qPCR40-R and qPCR70-F/ qPCR70-R were 97.8%, 99.5%, and 100.7%, respectively. The relative transcript level of target gene from different sample was analyzed by 2−△△Ct (Ct=threshold cycle) method (Livak and Schmittgen, 2001), with β-actin as the internal reference gene (Farcy et al., 2007; Han et al., 2013). All data from qPCR were analyzed by PASW Statistics 18, and the significance test of gene expression difference was performed based on the Tukey HSD test analysis of means (n = 3).
2.3. Sequence and phylogenetic analysis PocaHSP40 sequence was analyzed by Lasergene software, and sequence comparison was performed through the BLAST program in NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The signal peptide of PocaHSP40 was predicted by the SignalIP program (http://www.cbs.dtu. dk/services/SignalP). The prediction of protein domain was carried out with SMART (http://smart.embl-heidelberg.de/). Glycosylation sites were predicted by the NetOGlyc and NetNGlyc services (http://www.cbs. dtu.dk/services/NetOGlyc/, http://www.cbs.dtu.dk/services/NetNGlyc/ ). Phosphorylation sites were predicted by the KinasePhos service (http://kinasephos.mbc.nctu.edu.tw/). 3-D structure was predicted by the Phyre2 service (http://www.sbg.bio.ic.ac.uk/phyre2/html/). Multiple sequence alignment of HSP40 was performed using the Clustal W program. The phylogenetic tree of HSP40 was constructed by MEGA 6.0 using the neighbor-joining analysis (bootstrap replicates=1000).
2.6. Western blotting Western blotting was performed as previously described (Zheng et al., 2012; Xu et al., 2014). Approximately 100 mg of tissue was homogenized in 400 µL Tris buffer (50 mM Trs-HCl, pH 7.6; 1 mM phenylmethylsulfonyl fluoride (PMSF); 2 mM EDTA) in a glass homogenizer. The supernatant of the homogenate was obtained after centrifugation at 15,000 g for 5 min at 4 °C, and the total protein
Table 1 Primers used in this study. Targets
Primers
Sequences (5′→3′)
Purpose
PocaHSP40 cDNA (GenBank accession No. KM405324)
HSP40F HSP40R 3′-HSP40-outer 3′-HSP40-inner 5′-HSP40-outer 5′-HSP40-inner qPCR40-F qPCR40-R qPCR70-F qPCR70-R qPCRactin-F qPCRactin-R
GCwGArGCbTAyGATGTnCT GGDAYGWTRTTKGGBCCCTGGT TTGGAGGAGGTTTATCATGGGTGC CGTAGGGTAATGAATGAGGATGG CAGGTCTCCAGCCTTTCTTGACG GGAAAGTATAGCCCTGAGTCCAAGC CGTAGGGTAATGAATGAGGATG TCCGCTGGTATGATGTTGG CCTCTTGCATCTTCAGAAACGT TGGCGATGATCTCTACCTG TCACCATTGGCAACGAGCGAT TCTCGTGAATACCAGCCGACT
Conventional PCR
PocaHSP70 cDNA (GenBank accession No. KM405321) β-actin cDNA (GenBank accession No. KM504520)
60
RACE
qPCR qPCR qPCR
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
Fig. 1. Nucleotide and deduced amino acid sequences of PocaHSP40 cDNA. The start code ATG and the termination code TAG are in bold. The J domain is underlined. The C-terminal domain is wavy underlined. The HPD motif is in a box. The phosphorylation sites are in gray. The typical polyadenylation signal sequence AATAAA is double underlined.
concentration in the supernatant was quantified with Bradford method. 10 µL each protein sample of 2 mg/mL with loading buffer was subjected to SDS-PAGE (10% gel). Then the gel was electroblotted to a nitrocellulose membrane (Millipore). Subsequently, the membrane was incubated with 3% skimmed milk, rabbit anti-PocaHSP40 (or rabbit anti-PocaHSP70) polyclonal antiserum diluted 1:5000–10,000 and goat anti-rabbit IgG-HRP (BOSTER) diluted 1:5000, step by step. Finally, the blots were stained with DAB substrate, and the bands in the nitrocellulose membrane were digitally captured by GS-800™ Calibrated Densitometer (Bio-rad). The rabbit anti-PocaHSP40 polyclonal antiserum and rabbit antiPocaHSP70 polyclonal antiserum were obtained by the way as previously described (Xu et al., 2014). The antigen of rabbit anti-PocaHSP70 polyclonal antiserum was the last 276 amino acid peptide of
PocaHSP70. The antigen of rabbit anti-PocaHSP40 polyclonal antiserum was the whole length peptide of PocaHSP40. 3. Results 3.1. Characterization of PocaHSP40 In this study, a 1466 bp full-length cDNA of PocaHSP40 was obtained, and the sequence was deposited in GenBank under accession no. KM405324. It contained a 50 bp 5’-untranslated region (UTR), an open reading frame (ORF) of 954 bp, a 462 bp 3′-UTR with a typical polyadenylation signal sequence AATAAA, and a poly (A) tail (Fig. 1). The ORF encoded a protein consisting of 317 amino acid residues with a calculated molecular mass of 35.89 kDa and a theoretical isoelectric 61
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
phosphorylated by PKA (protein kinase A), MAPK (mitogen-activated protein kinase), or CDK (cyclin-dependent kinase). As predicted, the secondary structure of PocaHSP40 had eight αhelixes and ten β-sheets. The J domain contained four helixes, and each CTD contained five sheets. Typically, the dimerization domain had an α-helix that should be critical for its dimerization (Fig. 2). Over all, the predicted 3-D structure of PocaHSP40 was highly similar to that of other HSP40s (Fig. 2). 3.2. Evolutionary relationship of PocaHSP40 Comparison of the amino acid sequences of HSP40s showed that PocaHSP40 was similar to other HSP40s, especially HSP40s from mollusks. The deduced amino acid sequence of PocaHSP40 had a closer identity to that of gastropods than other mollusks. PocaHSP40 was 83% identity to Aplysia california HSP40 (gi: 524885599), 82% to Lottia gigantean HSP40 (gi: 676487891), 82% to Biomphalaria glabrata HSP40 (gi: 908406922), 81% to Crassostrea gigas HSP40 (gi: 762143745), 78% to Mizuhopecten yessoensis HSP40 (gi: 1207947568), and 66% to Octopus bimaculoides HSP40 (gi: 961092812). These results were consistent to the phylogenetic tree of HSP40s, which was generated by the MEGA 6.0 (Fig. 3). The phylogenetic tree showed that PocaHSP40 was closer to its homologues of gastropods than that of bivalves. The phylogenetic tree also showed that HSP40s diverged among mollusks, insects, and vertebrates.
Fig. 2. Predicted 3-•D structure of PocaHSP40. JD, G/F domain, CTD1, CTD2 and DD represent J domain, Gly/Phe-rich region, C-terminal Domain 1, Cterminal Domain 2, and dimerization domain, respectively. N and F represent the N-terminal and C-terminal of PocaHSP40, respectively.
3.3. Expression of PocaHSPs
point (pI) of 8.739. Analyzed by SMART, deduced PocaHSP40 possessed the characteristic conserved J domain (JD), from D4 to D66, where a highly conserved HPD tripeptide was existed. PocaHSP40 also possessed two conserved C-terminal domains (CTD1 and CTD2), and a predicted dimerization domain (DD) (Mohler et al., 2004) (Fig. 1). Between the J domain and CTD1 of PocaHSP40, there was an irregular Gly/Phe-rich region (G/F domain). Therefore, PocaHSP40 belonged to Type II HSP40s (Cheetham and Caplan, 1998; Ohtsuka and Hata, 2000a). Similar to other HSP40s, PocaHSP40 was not a secreted protein, because no signal peptide was identified from the deduced amino acids of PocaHSP40. Analyzed by the NetOGlyc and NetNGlyc online services, there was a possible N-glycosylation site N10, but this site may not be glycosylated because PocaHSP40 without signal peptide is unlikely to be exposed to the N- or O-glycosylation machinery. Analyzed by the KinasePhos service, there were four serine/threonine phosphorylation sites, S28, S163, T139 and T304. S28 and S163 could be phosphorylated by PKG (protein kinase G). T139 and T304 could be
The expression pattern of PocaHSP40 in the gill, digestive gland, kidney and foot muscle of P. canaliculata was examined by qPCR and western blotting (Fig. 4A, Fig. 5A). The results showed that the expression of PocaHSP40 was highest in the digestive gland and lowest in the kidney when P. canaliculata was kept under ambient temperature (25 °C). Challenged by low temperatures (6 °C, 9 °C, 12 °C, 15 °C), the expression of PocaHSP40 in all four tested tissues was up-regulated. In the digestive gland, the expression level of PocaHSP40 under low temperatures was about two times more than that under 25 °C. In the foot muscle, when exposed to 6 °C, the expression of PocaHSP40 was significantly up-regulated, about six times more than that under 25 °C. However, challenged by high temperatures (30 °C, 33 °C, 36 °C, 39 °C), the expression of PocaHSP40 in all four tested tissues was slightly but insignificantly declined. Because HSP40s play their functions through interacting with HSP70s (Fan et al., 2003), the expression of PocaHSP70 was also
Fig. 3. The phylogenetic relation of HSP40. The neighbor-joining phylogenetic tree were constructed by MEGA 6.0 (bootstrap = 1000). Branch lengths were proportional to estimates of evolutionary change. The number associated with each internal branch represents the confidence of bootstrap probability. 62
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
Fig. 4. Transcript level of PocaHSP40 and PocaHSP70 in Pomacea canaliculata tissues under different temperatures. “*” between 25 °C and other temperatures represents the 0.05 significance of difference, based on the Tukey HSD test analysis of means (n= 3).
Fig. 5. Western blotting analysis of PocaHSP40 and PocaHSP70 in the different tissue of Pomacea canaliculata under different temperature.
examined at the same time (Fig. 4B, Fig. 5B). But the results showed that the expression change of PocaHSP70 under different test temperature was inconsistent with that of PocaHSP40. The expression of PocaHSP70 increased rapidly in all tested tissues from 25 °C to different high temperature (30 °C, 33 °C, 36 °C, 39 °C), as it was from tens of times to thousands of times more than that under 25 °C. However, the expression level of PocaHSP70 did not show significant difference under different low temperature (6 °C, 9 °C, 12 °C, 15 °C) compared with under 25 °C. Only in the foot muscle, the expression of PocaHSP70 gradually increased from 25 °C to 6 °C but it was not significant.
Song et al., 2014; Xu et al., 2014; Zheng et al., 2012). So far, HSP60, HSP70 and HSP90 of P. canaliculata have been characterized (Xu et al., 2014; Zheng et al., 2012), while other HSPs of P. canaliculata remain little-understood. In this study, HSP40 of P. canaliculata was characterized, and named PocaHSP40. PocaHSP40 belonged to type II HSP40s, because it had a J domain, a G/F domain and two C-terminal domains. PocaHSP40 was found similar to its homologues from other mollusks, especially gastropods. The phylogenic tree of HPS40 also underpins the conservation of HSP40s in mollusks, since PocaHSP40 is closely clustered with other mollusk HSPs. This implies that HSP40s has important conserved cellular functions in mollusks (Bishop et al., 2014). In mollusks, it has been shown that HSP40 is involved in mediating responses to pathogen infection, heavy metal exposure, temperature change, low salinity and chemical pollution challenges (Chen et al., 2014; Li et al., 2011; Li et al., 2016; Wang et al., 2018).
4. Discussion Heat shock proteins (HSPs) are important for the survival of P. canaliculata under unsuitable conditions (Giraud-Billoud et al., 2013; 63
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
Moreover, the phylogenic tree of HPS40 is like that of HSP60 but not HSP70 or HSP90 (Xu et al., 2014), in which mollusks is gathered with vertebrates, indicating that HSP40 and HSP60 may have same evolution path. Post-translational modifications are well-known key mechanisms to increase the diversity of proteome, as well as to modify the function of proteins. Phosphorylation is the most common post-translational mechanism for regulating the activity of enzymes (Khoury et al., 2011). In the present study, PocaHSP40 revealed four predicted serine/threonine phosphorylation sites, S28, T139, S163 and T304. According to 3-D structure of PocaHSP40, they were located in the J domain, near the Cterminal domain 1, in the C-terminal domain 1, and near C-terminal domain 2 (or dimerization domain), respectively. Some studies have indicated that HSP40 can be phosphorylated (Gotz et al., 2009; Kostenko et al., 2009, 2014; Patel et al., 2016). The ER-membrane-resident HSP40 ERj1 can be phosphorylated by protein kinase CK2 (Gotz et al., 2009). Human HSP40/DNAJB1 can be phosphorylated by mitogen-activated protein kinase-activated protein kinase 5 (MK5/PRAK) at 149 or/and 151 and 171 in the C-terminal domain, which stimulates the ATP hydrolyse activity of HSP40/HSP70 complex and enhances the repression of heat shock factor 1 (HSF1) driven transcription by HSP40 (Kostenko et al., 2014). At the structure level, phosphorylation can cause the conformation change of HSP40 and modulate its interaction with other proteins (Patel et al., 2016). In addition to HSP40, other HSPs, such as HSP27, HSP70, and HSP90, are also substrates of phosphorylases, with altered co-chaperone interactions (Kostenko et al., 2009; Muller et al., 2013; Truman et al., 2012). Therefore, the phosphorylation of PocaHSP40 and its effect on PocaHSP40 warrants attention. This study investigated the expression of PocaHSP40 in the response of P. canaliculata to 2 h temperature change followed by 1 h recovery. The results showed that the expression of PocaHSP40 can be up-regulated by low temperatures (6 °C, 9 °C, 12 °C, 15 °C) but not by high temperatures (30 °C, 33 °C, 36 °C, 39 °C). On the contrary, the expression of PocaHSP70 was up-regulated by high temperatures but not by low temperatures described above, which agrees with the results of our previous study (Xu et al., 2014). These results imply that P. canaliculata might maintain its survival by up-regulating HSP40 expression under low temperature but up-regulating HSP70 expression under high temperatures, suggesting that the mechanisms of P. canaliculata overcoming the injury derived from low and high temperatures are different. It has been proved that P. canaliculata uses glucose and glycerol to tolerate cold temperature, suggesting carbohydrate metabolic pathways are altered in P. canaliculata during its cold acclimation (Matsukura et al., 2009, 2016). On the other hand, molecular chaperones, oxidative stress related proteins, energy metabolism related proteins and immune responsive proteins are related to the heat tolerance of P. canaliculata (Mu et al., 2015). The function of HSP70 is regulated by HSP40 through the conserved J domain, but it does not mean they are co-expressed in the cell. In P. canaliculata, the expressions of HSP40 and HSP70 under heat temperature challenge and cold temperature challenge are not consistent. In the pearl oyster Pinctada martensii, 1 h thermal treatment (from 25 °C to 35 °C) can induce the expression of HSP40 and HSP70 in the hemocytes and the gill (Li et al., 2016). In the bay scallop Argopecten irradians, the expression of HSP40 and HSP70 can be significantly upregulated by both heat shock (from 20 °C to 30 °C) and cold shock (from 20 °C to 3 °C), while in sea scallops Placopecten magellanicus, the expressions of HSP40 and HSP70 do not change when animals were heatshocked (from 10 °C to 20 °C) for 3 h (Brun et al., 2008). It should be mentioned that the tolerable temperature range of P. canaliculata, A. irradians, P. magellanicus, and P. martensii is different, which are 8–38 °C (Zhou et al., 2003), 5–35 °C (Tettelbach and Rhodes, 1981; You et al., 2003), 5–15 °C (Brun et al., 2008; Pilditch and Grant, 1999) and 15–35 °C (Southgate and Lucas, 2008), respectively. In addition, P. canaliculata is a freshwater mollusk, others are marine mollusks.
Therefore, HSP expression elevated by heat or cold shock varies among mollusk species that differ in the tolerance of temperature changes and their habitat environment. This suggests a differential capacity of different mollusks using HSP40 and HSP70 to adapt to temperature change. Actually, different Pomacea species, P. canaliculata, P. maculata and P. diffusa, differ in the tolerance of temperature changes (Matsukura et al., 2009, 2016; Mu et al., 2015; Yoshida et al., 2014). Mu and co-workers showed that P. canaliculata HSP40 was not differentially expressed with HSP70 after acute and chronic heat shock, whereas P. diffusa HSP40 was (Mu et al., 2015). Thus, it will be interesting to compare the HSP's role in the tolerance of different Pomacea species to temperature changes. In the present study, PocaHSP40 belongs to type II HSP40 and PocaHSP70 belongs to type I HSP70, and there should be other HSP40s and HSP70s in P. canaliculata, thus another question to be answered is the difference of interactions between different types of HSP40s and HSP70s in P. canaliculata. In summary, P. canaliculata HSP40 was cloned, characterized, and its expression under different temperature was analyzed. In future studies, the role of PocaHSP40 in conditions other than temperature stress, such as parasitic infection or water deprivation, will be investigated, and the detail of the interaction between HSP40 and other HSPs of P. canaliculata will be clarified. In addition, as four phosphorylation sites were found in PocaHSP40, whether they will be phosphorylated by some phosphokinases and consequently affect the function of HSP40 in the adaptation of P. canaliculata to heat or cold shock will be examined. Acknowledgments This work was supported by the National High Technology Research and Development Program (“863” Program) of China (Grant no. 2012AA021601). References Bishop, O.T., Edkins, A.L., Blatch, G.L., 2014. Sequence and domain conservation of the coelacanth HSP40 and HSP90 chaperones suggests conservation of function. J. Exp. Zool. B. Mol. Dev. Evol. 322, 359–378. Bork, P., Sander, C., Valencia, A., Bukau, B., 1992. A module of the DnaJ heat shock proteins found in malaria parasites. Trends Biochem. Sci. 17, 129. Bouétard, A., Besnard, A.L., Vassaux, D., Lagadic, L., Coutellec, M.A., 2013. Impact of the redox-cycling herbicide diquat on transcript expression and antioxidant enzymatic activities of the freshwater snail Lymnaea stagnalis. Aquat. Toxicol. 126, 256–265. Brun, N.T., Bricelj, V.M., MacRae, T.H., Ross, N.W., 2008. Heat shock protein responses in thermally stressed bay scallops, Argopecten irradians, and sea scallops, Placopecten magellanicus. J. Exp. Mar. Biol. Ecol. 358, 151–162. Cheetham, M.E., Caplan, A.J., 1998. Structure, function and evolution of DnaJ: conservation and adaptation of chaperone function. Cell Stress Chaperon. 3, 28–36. Chen, H., Zha, J., Liang, X., Li, J., Wang, Z., 2014. Effects of the human antiepileptic drug carbamazepine on the behavior, biomarkers, and heat shock proteins in the asian clam Corbicula fluminea. Aquat. Toxicol. 155, 1–8. Cheng, P., Liu, X., Zhang, G., 2007. Cloning and expression analysis of a HSP70 gene from Pacific abalone, Haliotis discus hannai. Fish Shellfish Immun. 22, 77–87. Fan, C.Y., Lee, S., Cyr, D.M., 2003. Mechanisms for regulation of HSP70 function by HSP40. Cell Stress Chaperon. 8, 309–316. Farcy, E., Serpentini, A., Fiévet, B., Lebel, J.M., 2007. Identification of cdnas encoding HSP70 and HSP90 in the abalone Haliotis tuberculata: transcriptional induction in response to thermal stress in hemocyte primary culture. Comp. Biochem. Phys. B 146, 540–550. Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61, 243–282. Foster, N.L., Lukowiak, K., Henry, T.B., 2015. Time-related expression profiles for heat shock protein gene transcripts (HSP40, HSP70) in the central nervous system of Lymnaea stagnalis exposed to thermal stress. Commun. Integr. Biol. 8, e1040954. Giraud-Billoud, M., Vega, I.A., Tosi, M.E., Abud, M.A., Calderon, M.L., Castro-Vazquez, A., 2013. Antioxidant and molecular chaperone defences during estivation and arousal in the South American apple snail Pomacea canaliculata. J. Exp. Biol. 216, 614–622. Gotz, C., Muller, A., Montenarh, M., Zimmermann, R., Dudek, J., 2009. The ER-membrane-resident HSP40 ERj1 is a novel substrate for protein kinase CK2. Biochem. Biophys. Res. Commun. 388, 637–642. Han, G., Zhang, S., Marshall, D.J., Ke, C., Dong, Y., 2013. Metabolic energy sensors (AMPK and SIRT1), protein carbonylation, and cardiac failure as biomarkers of thermal stress in an intertidal limpet: linking energetic allocation with environmental
64
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
cDNAs and a proposal for their classification and nomenclature. Cell Stress Chaperon. 5, 98–112. Ohtsuka, K., Hata, M., 2000b. Molecular chaperone function of mammalian HSP70 and HSP40 – a review. Int. J. Hyperth. 16, 231–245. Patel, P., Prescott, G.R., Burgoyne, R.D., Lian, L.Y., Morgan, A., 2016. Phosphorylation of cysteine string protein triggers a major conformational switch. Structure 24, 1380–1386. Qiu, X.B., Shao, Y.M., Miao, S., Wang, L., 2006. The diversity of the DnaJ/HSP40 family, the crucial partners for HSP70 chaperones. Cell Mol. Life Sci. 63, 2560–2570. Pilditch, C.A., Grant, J., 1999. Effect of temperature fluctuations and food supply on the growth and metabolism of juvenile sea scallops (Placopecten magellanicus). Mar. Biol. 134, 235–248. Santoro, M.G., 2000. Heat shock factors and the control of the stress response. Biochem. Pharmacol. 59, 55–63. Seuffert, M.E., Burela, S., Martin, P.R., 2010. Influence of water temperature on the activity of the freshwater snail Pomacea canaliculata (Caenogastropoda: Ampullariidae) at its southernmost limit (Southern Pampas, Argentina). J. Therm. Biol. 35, 77–84. Song, H.M., Mu, X.D., Gu, D.E., Luo, D., Yang, Y.X., Xu, M., Luo, J.R., Zhang, J.E., Hu, Y.C., 2014. Molecular characteristics of the HSP70 gene and its differential expression in female and male golden apple snails (Pomacea canaliculata) under temperature stimulation. Cell Stress Chaperon. 19, 579–589. Southgate, P.C., Lucas, J.S., 2008. The pearl oyster. In: Lucas, J.S. (Ed.), Environmental Influences. Elsevier, Amsterdam, pp. 1–222. Tettelbach, S.T., Rhodes, E.W., 1981. Combined effects of temperature and salinity on embryos and larvae of the northern bay scallop Argopecten irradians irradians. Mar. Biol. 63, 249–256. Truman, A.W., Kristjansdottir, K., Wolfgeher, D., Hasin, N., Polier, S., Zhang, H., Perrett, S., Prodromou, C., Jones, G.W., Kron, S.J., 2012. CDK-dependent HSP70 phosphorylation controls G1 cyclin abundance and cell-cycle progression. Cell 151, 1308–1318. Wang, Q., Liu, Y., Zheng, Z., Deng, Y., Jiao, Y., Du, X., 2018. Adaptive response of pearl oyster Pinctada fucata martensii to low water temperature stress. Fish Shellfish Immun. 78, 310–315. Xu, Y., Zheng, G., Dong, S., Liu, G., Yu, X., 2014. Molecular cloning, characterization and expression analysis of HSP60, HSP70 and HSP90 in the golden apple snail, Pomacea canaliculata. Fish Shellfish Immun. 41, 643–653. Yochem, J., Uchida, H., Sunshine, M., Saito, H., Georgopoulos, C.P., Feiss, M., 1978. Genetic analysis of two genes, dnaJ and dnaK, necessary for Escherichia coli and bacteriophage lambda DNA replication. Mol. Gen. Genet. 164, 9–14. Yoshida, K., Matsukura, K., Cazzaniga, N.J., Wada, T., 2014. Tolerance to low temperature and desiccation in two invasive apple snails, Pomacea canaliculata and P. maculata (caenogastropoda: ampullariidae), collected in their original distribution area (northern and central Argentina). J. Mollus. Stud. 80, 62–66. You, Z.J., Lu, T., Ma, B., Chen, Q.J., 2003. The temperature on the growth and survival of Argopecten irradians concentricus larvae and juveniles. Fish. Sci. 22, 8–10. Zhang, Z., Zhang, Q., 2012. Molecular cloning, characterization and expression of heat shock protein 70 gene from the oyster Crassostrea hongkongensis responding to thermal stress and exposure of Cu2+ and malachite green. Gene 497, 172–180. Zheng, G., Dong, S., Hou, Y., Yang, K., Yu, X., 2012. Molecular characteristics of HSC70 gene and its expression in the golden apple snails, Pomacea canaliculata (Mollusca: Gastropoda). Aquaculture 358, 41–49. Zhou, W.C., Wu, Y.F., Yang, J.Q., 2003. Viability of the ampullaria snail in China. Fujian J. Agric. Sci. 18, 25–28.
temperature during aerial emersion. J. Exp. Biol. 216, 3273–3282. Hartl, F.U., Hayer-Hartl, M., 2002. Molecular chaperones in the cytosol: from nascent chain to folded protein. Science 295, 1852–1858. Hennessy, F., Cheetham, M.E., Dirr, H.W., Blatch, G.L., 2000. Analysis of the levels of conservation of the J domain among the various types of DnaJ-like proteins. Cell Stress Chaperon. 5, 347–358. Khoury, G.A., Baliban, R.C., Floudas, C.A., 2011. Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci. Rep. 1. Kostenko, S., Jensen, K.L., Moens, U., 2014. Phosphorylation of heat shock protein 40 (HSP40/DnaJB1) by mitogen-activated protein kinase-activated protein kinase 5 (MK5/PRAK). Int. J. Biochem. Cell Biol. 47, 29–37. Kostenko, S., Johannessen, M., Moens, U., 2009. PKA-induced F-actin rearrangement requires phosphorylation of HSP27 by the MAPKAP kinase MK5. Cell Signal. 21, 712–718. Li, C., Li, L., Liu, F., Ning, X., Chen, A., Zhang, L., Wu, H., Zhao, J., 2011. Alternation of Venerupis philippinarum, HSP40 gene expression in response to pathogen challenge and heavy metal exposure. Fish Shellfish Immun. 30, 447–450. Li, J., Qian, X., Sha, B., 2009. Heat shock protein 40: Structural studies and their functional implications. Protein Pept. Lett. 16, 606–612. Li, J., Zhang, Y., Liu, Y., Xiao, S., Yu, Z., 2016. Co-expression of heat shock protein (HSP) 40 and HSP70 in Pinctada martensii response to thermal, low salinity and bacterial challenges. Fish Shellfish Immun. 48, 239–243. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Liu, Y.B., Han, W., Xian, Z.H., 2011. Effect of different temperatures on growth, development and feeding of Pomacea canaliculata. J. South. Agric. 24, 901–905. Lv, S., Zhang, Y., Steinmann, P., Yang, G.J., Yang, K., Zhou, X.N., Utzinger, J., 2011. The emergence of angiostrongyliasis in the People's Republic of China: the interplay between invasive snails, climate change and transmission dynamics. Freshw. Biol. 56, 717–734. Matsukura, K., Tsumuki, H., Izumi, Y., Wada, T., 2009. Physiological response to low temperature in the freshwater apple snail, Pomacea canaliculata (Gastropoda: Ampullariidae). J. Exp. Biol. 212, 2558–2563. Matsukura, K., Izumi, Y., Yoshida, K., Wada, T., 2016. Cold tolerance of invasive freshwater snails, Pomacea canaliculata, P. maculata, and their hybrids helps explain their different distributions. Freshw. Biol. 61, 80–87. Mohler, P.J., Hoffman, J.A., Davis, J.Q., Abdi, K.M., Kim, C.R., Jones, S.K., Davis, L.H., Roberts, K.F., Bennett, V., 2004. Isoform specificity among ankyrins. An amphipathic alpha-helix in the divergent regulatory domain of ankyrin-b interacts with the molecular co-chaperone Hdj1/HSP40. J. Biol. Chem. 279, 25798–25804. Mu, H., Sun, J., Fang, L., Luan, T., Williams, G.A., Cheung, S.G., Wong, C.K.C., Qiu, J., 2015. Genetic basis of differential heat resistance between two species of congeneric freshwater Snails: Insights from quantitative proteomics and base substitution rate analysis. J. Proteom. Res. 14, 4296–4308. Muller, P., Ruckova, E., Halada, P., Coates, P.J., Hrstka, R., Lane, D.P., Vojtesek, B., 2013. C-terminal phosphorylation of HSP70 and HSP90 regulates alternate binding to cochaperones CHIP and HOP to determine cellular protein folding/degradation balances. Oncogene 32, 3101–3110. Nakano, K., Iwama, G., 2002. The 70-kda heat shock protein response in two intertidal sculpins, Oligocottus maculosus and O. snyderi: relationship of HSP70 and thermal tolerance. Comp. Biochem. Phys. A 133, 79–94. Ohtsuka, K., Hata, M., 2000a. Mammalian HSP40/DNAJ homologs: cloning of novel
65
Contents lists available at ScienceDirect
Journal of Thermal Biology journal homepage: www.elsevier.com/locate/jtherbio
Molecular cloning, characterization of Pomacea canaliculata HSP40 and its expression analysis under temperature change
T
Yipeng Xu , Guowan Zheng, Guangfu Liu, Qianqian Yang, Xiaoping Yu ⁎
⁎
Zhejiang Provincial Key Laboratory of Biometrology and Inspection & Quarantine, College of Life Sciences, China Jiliang University, 258 Xueyuan Street, Xiasha, Hangzhou 310018, China
ARTICLE INFO
ABSTRACT
Keywords: Pomacea canaliculata Heat shock protein HSP40 HSP70
Heat shock proteins (HSPs) play important roles in the adaption of Pomacea canaliculata to unsuitable environments. In the present study, a cDNA encoding HSP40 in P. canaliculata (PocaHSP40) was cloned and characterized. The PocaHSP40 cDNA was 1466 bp, containing an ORF of 954 bp encoding 317 amino acids. Bioinformatics analysis showed that PocaHSP40 belonged to type II HSP40s and had four predicted phosphorylation sites. Phylogenetic analysis proved the conservation of HSP40s in mollusks. PocaHSP40 was widely expressed in the gill, digestive gland, kidney, and foot muscle of P. canaliculata. Challenged by different temperatures, the expression of PocaHSP40 was up-regulated under low temperatures but not high temperatures, which was contrary to the expression change of PocaHSP70 under low and high temperatures. These results implied that P. canaliculata evolved different strategies for survival under low temperature and high temperature through the regulation of HSPs.
1. Introduction
Hata, 2000b; Qiu et al., 2006). Type I HSP40s contain all above domains. Type II HSP40s lack the CRR domain. Type III HSP40s only possess the J domain. To date, thousands of HSP40s have been identified in prokaryotes and eukaryotes since the first discovery of HSP40 in bacteria (Yochem et al., 1978). However, only a few HSP40s have been studied in mollusks. So far, only three reports involve HSP40s from Gastropoda (Bouétard et al., 2013; Foster et al., 2015), and only the integrated protein sequences of HSP40s from Aplysia californica and Biomphalaria glabrata are available. Pomacea canaliculata, a member of Gastropoda, is one of the 100 worst invasive alien species in the black list of the World Conservation Union (Lowe et al., 2000). Temperature is an important environmental factor for the distribution of P. canaliculata (Lv et al., 2011; Seuffert et al., 2010), but it appears to have evolved a strong capability to endure temperature change. P. canaliculata has a greater tolerance to low temperatures than P. maculata (Matsukura et al., 2009, 2016; Yoshida et al., 2014), and to high temperatures than P. diffusa (Mu et al., 2015). It have been well verified that HSPs play important roles in protecting other animals from the injury of extreme temperature, thus it is meaningful to study the role of HSPs in the adaptation of P. canaliculata to temperature change. Recently, it has been proved that HSP60, HSP70 and HSP90 are involved in the thermal tolerance of P. canaliculata (Mu et al., 2015; Song et al., 2014; Xu et al., 2014; Zheng
Heat shock proteins (HSPs) are a group of highly conserved proteins that help organisms to maintain cellular viability under adversities, such as heat shock, microbial infection, starvation, and water deprivation (Hartl and Hayer-Hartl, 2002; Santoro, 2000). Based on their molecular weight and functions, HSPs can be classified into several families, including HSP100, HSP90, HSP70, HSP60, HSP40 and low molecular mass HSPs (Feder and Hofmann, 1999). Among them, the HSP40 family, also called DNAJ family, functions as co-chaperone with the well-studied HSP70 proteins (Fan et al., 2003). Cooperating with HSP70, the HSP40 family is involved in numerous cellular functions, including regulation of protein folding, translocation, and assembly (Cheetham and Caplan, 1998; Ohtsuka and Hata, 2000a). HSP40 proteins are characterized by the presence of the remarkably conserved J domain, through which HSP40s bind to HSP70s and regulate the ATPase activity of HSP70s (Li et al., 2009; Ohtsuka and Hata, 2000b; Qiu et al., 2006). Members of the HSP40 family have four distinct domains: J domain (JD), Gly/Phe-rich region (G/F domain), cysteine-rich region (CRR domain), and C-terminal domain (CTD) (Bork et al., 1992; Qiu et al., 2006). According to the organization of their domains, HSP40 proteins are divided into three categories (Cheetham and Caplan, 1998; Hennessy et al., 2000; Li et al., 2009; Ohtsuka and
Corresponding authors. E-mail addresses: [email protected] (Y. Xu), [email protected] (G. Zheng), [email protected] (G. Liu), [email protected] (Q. Yang), [email protected] (X. Yu). ⁎
https://doi.org/10.1016/j.jtherbio.2019.02.006 Received 16 August 2018; Received in revised form 13 January 2019; Accepted 1 February 2019 Available online 02 February 2019 0306-4565/ © 2019 Elsevier Ltd. All rights reserved.
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
2.4. Treatment of P. canaliculata
et al., 2012). In the present study, a full-length cDNA of P. canaliculata HSP40 was cloned, and its expression in response to temperature change was investigated aiming to explore the role of HPS40 in the adaptation of P. canaliculata to temperature changes.
Reported by most authors, the endurable temperature range of P. canaliculata is 4–35 °C (Seuffert et al., 2010), whereas the range in China is 8–38 °C, and the fatal temperature of P. canaliculata is lower than 0 °C and higher than 40 °C (Zhou et al., 2003). The water temperature for P. canaliculata breeding and activity is 10–30 °C, among which the optimum water temperature is near the ambient temperature (25 °C) (Liu et al., 2011; Seuffert et al., 2010). Therefore, in the present study, the ambient temperature (25 °C) was set as the control temperature, while 6 °C, 9 °C, 12 °C and 15 °C were set as the low test temperatures, and 30 °C, 33 °C, 36 °C and 39 °C were set as the high test temperatures. Considering the crucial role of female snails in the population reproduction of P. canalicauta, they were chosen to be experimental snails. The treatment of P. canaliculata was as described previously (Xu et al., 2014). For the experiment, the female snails of similar size (height: 3.1–3.5 cm; weight: 5.0–6.5 g) were isolated, and exposed to the different test temperatures for 2 h and then returned to 25 °C for 1 h to induce and accumulate HSPs expression before expression test (Cheng et al., 2007; Farcy et al., 2007; Nakano and Iwama, 2002; Zhang and Zhang, 2012). Each treatment was repeated three times. No snails died during experiments.
2. Materials and methods 2.1. Animals The experimental P. canaliculata snails were collected from the Zizania latifolia field in Yuyao City (121°09′E, 30°30′N), China. The annual average temperature, the highest and the lowest mean temperature of Yuyao is 16.2 °C, 28.3 °C (in July) and 4.1 °C (in January), respectively. When the snails were collected, the water temperature was 24.5 °C. After collection, these snails were reared with Chinese cabbage (Brassica rapa Pekinensis) in freshwater at ambient temperature (25 ± 1 °C). 2.2. cDNA cloning of PocaHSP40 cDNAs of all messenger RNA were obtained as previously described (Xu et al., 2014). Based on the alignment of all mollusk HSP40 sequences that are available, degenerate primers were designed for amplifying a conserved sequence of P. canaliculata HSP40 (PocaHSP40) (Table 1). The PCR product was cloned into pMD-18T cloning vector (Takara) and sequenced. Based on the sequenced conserved part of PocaHSP40, the specific primers were designed for 5′- and 3′-RACE (rapid amplification of cDNA ends) (Table 1). Using 5′-Full RACE Kit and 3′-Full RACE Kit (Takara), 5′- and 3′-RACE were carried out to define the putative 5′ and 3′ ends of PocaHSP40. The PCR products from 5′- and 3′-RACE were also cloned and sequenced. Finally, the full-length cDNA sequence of PocaHSP40 was obtained.
2.5. Quantitative PCR analysis of gene expression after treatment Total RNA was extracted from 100 mg tissues of treated P. canaliculata snails. After being treated with DNase I that was free of RNase, total RNA was used to synthesize the first-strand cDNA. With SYBR@ Premix Ex TaqTM (Takara), fluorescent quantitative PCR (qPCR) was used to investigate the transcript levels of target gene in gill, digestive gland, kidney, and foot muscle of P. canaliculata after various temperature treatments. Primers for qPCR analysis of different gene were designed (Table 1), and their specificity was checked by conventional PCR and melting curve analysis. The amplification efficiency value of qPCR primes, qPCRactin-F/qPCRactin-R, qPCR40-F/qPCR40-R and qPCR70-F/ qPCR70-R were 97.8%, 99.5%, and 100.7%, respectively. The relative transcript level of target gene from different sample was analyzed by 2−△△Ct (Ct=threshold cycle) method (Livak and Schmittgen, 2001), with β-actin as the internal reference gene (Farcy et al., 2007; Han et al., 2013). All data from qPCR were analyzed by PASW Statistics 18, and the significance test of gene expression difference was performed based on the Tukey HSD test analysis of means (n = 3).
2.3. Sequence and phylogenetic analysis PocaHSP40 sequence was analyzed by Lasergene software, and sequence comparison was performed through the BLAST program in NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The signal peptide of PocaHSP40 was predicted by the SignalIP program (http://www.cbs.dtu. dk/services/SignalP). The prediction of protein domain was carried out with SMART (http://smart.embl-heidelberg.de/). Glycosylation sites were predicted by the NetOGlyc and NetNGlyc services (http://www.cbs. dtu.dk/services/NetOGlyc/, http://www.cbs.dtu.dk/services/NetNGlyc/ ). Phosphorylation sites were predicted by the KinasePhos service (http://kinasephos.mbc.nctu.edu.tw/). 3-D structure was predicted by the Phyre2 service (http://www.sbg.bio.ic.ac.uk/phyre2/html/). Multiple sequence alignment of HSP40 was performed using the Clustal W program. The phylogenetic tree of HSP40 was constructed by MEGA 6.0 using the neighbor-joining analysis (bootstrap replicates=1000).
2.6. Western blotting Western blotting was performed as previously described (Zheng et al., 2012; Xu et al., 2014). Approximately 100 mg of tissue was homogenized in 400 µL Tris buffer (50 mM Trs-HCl, pH 7.6; 1 mM phenylmethylsulfonyl fluoride (PMSF); 2 mM EDTA) in a glass homogenizer. The supernatant of the homogenate was obtained after centrifugation at 15,000 g for 5 min at 4 °C, and the total protein
Table 1 Primers used in this study. Targets
Primers
Sequences (5′→3′)
Purpose
PocaHSP40 cDNA (GenBank accession No. KM405324)
HSP40F HSP40R 3′-HSP40-outer 3′-HSP40-inner 5′-HSP40-outer 5′-HSP40-inner qPCR40-F qPCR40-R qPCR70-F qPCR70-R qPCRactin-F qPCRactin-R
GCwGArGCbTAyGATGTnCT GGDAYGWTRTTKGGBCCCTGGT TTGGAGGAGGTTTATCATGGGTGC CGTAGGGTAATGAATGAGGATGG CAGGTCTCCAGCCTTTCTTGACG GGAAAGTATAGCCCTGAGTCCAAGC CGTAGGGTAATGAATGAGGATG TCCGCTGGTATGATGTTGG CCTCTTGCATCTTCAGAAACGT TGGCGATGATCTCTACCTG TCACCATTGGCAACGAGCGAT TCTCGTGAATACCAGCCGACT
Conventional PCR
PocaHSP70 cDNA (GenBank accession No. KM405321) β-actin cDNA (GenBank accession No. KM504520)
60
RACE
qPCR qPCR qPCR
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
Fig. 1. Nucleotide and deduced amino acid sequences of PocaHSP40 cDNA. The start code ATG and the termination code TAG are in bold. The J domain is underlined. The C-terminal domain is wavy underlined. The HPD motif is in a box. The phosphorylation sites are in gray. The typical polyadenylation signal sequence AATAAA is double underlined.
concentration in the supernatant was quantified with Bradford method. 10 µL each protein sample of 2 mg/mL with loading buffer was subjected to SDS-PAGE (10% gel). Then the gel was electroblotted to a nitrocellulose membrane (Millipore). Subsequently, the membrane was incubated with 3% skimmed milk, rabbit anti-PocaHSP40 (or rabbit anti-PocaHSP70) polyclonal antiserum diluted 1:5000–10,000 and goat anti-rabbit IgG-HRP (BOSTER) diluted 1:5000, step by step. Finally, the blots were stained with DAB substrate, and the bands in the nitrocellulose membrane were digitally captured by GS-800™ Calibrated Densitometer (Bio-rad). The rabbit anti-PocaHSP40 polyclonal antiserum and rabbit antiPocaHSP70 polyclonal antiserum were obtained by the way as previously described (Xu et al., 2014). The antigen of rabbit anti-PocaHSP70 polyclonal antiserum was the last 276 amino acid peptide of
PocaHSP70. The antigen of rabbit anti-PocaHSP40 polyclonal antiserum was the whole length peptide of PocaHSP40. 3. Results 3.1. Characterization of PocaHSP40 In this study, a 1466 bp full-length cDNA of PocaHSP40 was obtained, and the sequence was deposited in GenBank under accession no. KM405324. It contained a 50 bp 5’-untranslated region (UTR), an open reading frame (ORF) of 954 bp, a 462 bp 3′-UTR with a typical polyadenylation signal sequence AATAAA, and a poly (A) tail (Fig. 1). The ORF encoded a protein consisting of 317 amino acid residues with a calculated molecular mass of 35.89 kDa and a theoretical isoelectric 61
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
phosphorylated by PKA (protein kinase A), MAPK (mitogen-activated protein kinase), or CDK (cyclin-dependent kinase). As predicted, the secondary structure of PocaHSP40 had eight αhelixes and ten β-sheets. The J domain contained four helixes, and each CTD contained five sheets. Typically, the dimerization domain had an α-helix that should be critical for its dimerization (Fig. 2). Over all, the predicted 3-D structure of PocaHSP40 was highly similar to that of other HSP40s (Fig. 2). 3.2. Evolutionary relationship of PocaHSP40 Comparison of the amino acid sequences of HSP40s showed that PocaHSP40 was similar to other HSP40s, especially HSP40s from mollusks. The deduced amino acid sequence of PocaHSP40 had a closer identity to that of gastropods than other mollusks. PocaHSP40 was 83% identity to Aplysia california HSP40 (gi: 524885599), 82% to Lottia gigantean HSP40 (gi: 676487891), 82% to Biomphalaria glabrata HSP40 (gi: 908406922), 81% to Crassostrea gigas HSP40 (gi: 762143745), 78% to Mizuhopecten yessoensis HSP40 (gi: 1207947568), and 66% to Octopus bimaculoides HSP40 (gi: 961092812). These results were consistent to the phylogenetic tree of HSP40s, which was generated by the MEGA 6.0 (Fig. 3). The phylogenetic tree showed that PocaHSP40 was closer to its homologues of gastropods than that of bivalves. The phylogenetic tree also showed that HSP40s diverged among mollusks, insects, and vertebrates.
Fig. 2. Predicted 3-•D structure of PocaHSP40. JD, G/F domain, CTD1, CTD2 and DD represent J domain, Gly/Phe-rich region, C-terminal Domain 1, Cterminal Domain 2, and dimerization domain, respectively. N and F represent the N-terminal and C-terminal of PocaHSP40, respectively.
3.3. Expression of PocaHSPs
point (pI) of 8.739. Analyzed by SMART, deduced PocaHSP40 possessed the characteristic conserved J domain (JD), from D4 to D66, where a highly conserved HPD tripeptide was existed. PocaHSP40 also possessed two conserved C-terminal domains (CTD1 and CTD2), and a predicted dimerization domain (DD) (Mohler et al., 2004) (Fig. 1). Between the J domain and CTD1 of PocaHSP40, there was an irregular Gly/Phe-rich region (G/F domain). Therefore, PocaHSP40 belonged to Type II HSP40s (Cheetham and Caplan, 1998; Ohtsuka and Hata, 2000a). Similar to other HSP40s, PocaHSP40 was not a secreted protein, because no signal peptide was identified from the deduced amino acids of PocaHSP40. Analyzed by the NetOGlyc and NetNGlyc online services, there was a possible N-glycosylation site N10, but this site may not be glycosylated because PocaHSP40 without signal peptide is unlikely to be exposed to the N- or O-glycosylation machinery. Analyzed by the KinasePhos service, there were four serine/threonine phosphorylation sites, S28, S163, T139 and T304. S28 and S163 could be phosphorylated by PKG (protein kinase G). T139 and T304 could be
The expression pattern of PocaHSP40 in the gill, digestive gland, kidney and foot muscle of P. canaliculata was examined by qPCR and western blotting (Fig. 4A, Fig. 5A). The results showed that the expression of PocaHSP40 was highest in the digestive gland and lowest in the kidney when P. canaliculata was kept under ambient temperature (25 °C). Challenged by low temperatures (6 °C, 9 °C, 12 °C, 15 °C), the expression of PocaHSP40 in all four tested tissues was up-regulated. In the digestive gland, the expression level of PocaHSP40 under low temperatures was about two times more than that under 25 °C. In the foot muscle, when exposed to 6 °C, the expression of PocaHSP40 was significantly up-regulated, about six times more than that under 25 °C. However, challenged by high temperatures (30 °C, 33 °C, 36 °C, 39 °C), the expression of PocaHSP40 in all four tested tissues was slightly but insignificantly declined. Because HSP40s play their functions through interacting with HSP70s (Fan et al., 2003), the expression of PocaHSP70 was also
Fig. 3. The phylogenetic relation of HSP40. The neighbor-joining phylogenetic tree were constructed by MEGA 6.0 (bootstrap = 1000). Branch lengths were proportional to estimates of evolutionary change. The number associated with each internal branch represents the confidence of bootstrap probability. 62
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
Fig. 4. Transcript level of PocaHSP40 and PocaHSP70 in Pomacea canaliculata tissues under different temperatures. “*” between 25 °C and other temperatures represents the 0.05 significance of difference, based on the Tukey HSD test analysis of means (n= 3).
Fig. 5. Western blotting analysis of PocaHSP40 and PocaHSP70 in the different tissue of Pomacea canaliculata under different temperature.
examined at the same time (Fig. 4B, Fig. 5B). But the results showed that the expression change of PocaHSP70 under different test temperature was inconsistent with that of PocaHSP40. The expression of PocaHSP70 increased rapidly in all tested tissues from 25 °C to different high temperature (30 °C, 33 °C, 36 °C, 39 °C), as it was from tens of times to thousands of times more than that under 25 °C. However, the expression level of PocaHSP70 did not show significant difference under different low temperature (6 °C, 9 °C, 12 °C, 15 °C) compared with under 25 °C. Only in the foot muscle, the expression of PocaHSP70 gradually increased from 25 °C to 6 °C but it was not significant.
Song et al., 2014; Xu et al., 2014; Zheng et al., 2012). So far, HSP60, HSP70 and HSP90 of P. canaliculata have been characterized (Xu et al., 2014; Zheng et al., 2012), while other HSPs of P. canaliculata remain little-understood. In this study, HSP40 of P. canaliculata was characterized, and named PocaHSP40. PocaHSP40 belonged to type II HSP40s, because it had a J domain, a G/F domain and two C-terminal domains. PocaHSP40 was found similar to its homologues from other mollusks, especially gastropods. The phylogenic tree of HPS40 also underpins the conservation of HSP40s in mollusks, since PocaHSP40 is closely clustered with other mollusk HSPs. This implies that HSP40s has important conserved cellular functions in mollusks (Bishop et al., 2014). In mollusks, it has been shown that HSP40 is involved in mediating responses to pathogen infection, heavy metal exposure, temperature change, low salinity and chemical pollution challenges (Chen et al., 2014; Li et al., 2011; Li et al., 2016; Wang et al., 2018).
4. Discussion Heat shock proteins (HSPs) are important for the survival of P. canaliculata under unsuitable conditions (Giraud-Billoud et al., 2013; 63
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
Moreover, the phylogenic tree of HPS40 is like that of HSP60 but not HSP70 or HSP90 (Xu et al., 2014), in which mollusks is gathered with vertebrates, indicating that HSP40 and HSP60 may have same evolution path. Post-translational modifications are well-known key mechanisms to increase the diversity of proteome, as well as to modify the function of proteins. Phosphorylation is the most common post-translational mechanism for regulating the activity of enzymes (Khoury et al., 2011). In the present study, PocaHSP40 revealed four predicted serine/threonine phosphorylation sites, S28, T139, S163 and T304. According to 3-D structure of PocaHSP40, they were located in the J domain, near the Cterminal domain 1, in the C-terminal domain 1, and near C-terminal domain 2 (or dimerization domain), respectively. Some studies have indicated that HSP40 can be phosphorylated (Gotz et al., 2009; Kostenko et al., 2009, 2014; Patel et al., 2016). The ER-membrane-resident HSP40 ERj1 can be phosphorylated by protein kinase CK2 (Gotz et al., 2009). Human HSP40/DNAJB1 can be phosphorylated by mitogen-activated protein kinase-activated protein kinase 5 (MK5/PRAK) at 149 or/and 151 and 171 in the C-terminal domain, which stimulates the ATP hydrolyse activity of HSP40/HSP70 complex and enhances the repression of heat shock factor 1 (HSF1) driven transcription by HSP40 (Kostenko et al., 2014). At the structure level, phosphorylation can cause the conformation change of HSP40 and modulate its interaction with other proteins (Patel et al., 2016). In addition to HSP40, other HSPs, such as HSP27, HSP70, and HSP90, are also substrates of phosphorylases, with altered co-chaperone interactions (Kostenko et al., 2009; Muller et al., 2013; Truman et al., 2012). Therefore, the phosphorylation of PocaHSP40 and its effect on PocaHSP40 warrants attention. This study investigated the expression of PocaHSP40 in the response of P. canaliculata to 2 h temperature change followed by 1 h recovery. The results showed that the expression of PocaHSP40 can be up-regulated by low temperatures (6 °C, 9 °C, 12 °C, 15 °C) but not by high temperatures (30 °C, 33 °C, 36 °C, 39 °C). On the contrary, the expression of PocaHSP70 was up-regulated by high temperatures but not by low temperatures described above, which agrees with the results of our previous study (Xu et al., 2014). These results imply that P. canaliculata might maintain its survival by up-regulating HSP40 expression under low temperature but up-regulating HSP70 expression under high temperatures, suggesting that the mechanisms of P. canaliculata overcoming the injury derived from low and high temperatures are different. It has been proved that P. canaliculata uses glucose and glycerol to tolerate cold temperature, suggesting carbohydrate metabolic pathways are altered in P. canaliculata during its cold acclimation (Matsukura et al., 2009, 2016). On the other hand, molecular chaperones, oxidative stress related proteins, energy metabolism related proteins and immune responsive proteins are related to the heat tolerance of P. canaliculata (Mu et al., 2015). The function of HSP70 is regulated by HSP40 through the conserved J domain, but it does not mean they are co-expressed in the cell. In P. canaliculata, the expressions of HSP40 and HSP70 under heat temperature challenge and cold temperature challenge are not consistent. In the pearl oyster Pinctada martensii, 1 h thermal treatment (from 25 °C to 35 °C) can induce the expression of HSP40 and HSP70 in the hemocytes and the gill (Li et al., 2016). In the bay scallop Argopecten irradians, the expression of HSP40 and HSP70 can be significantly upregulated by both heat shock (from 20 °C to 30 °C) and cold shock (from 20 °C to 3 °C), while in sea scallops Placopecten magellanicus, the expressions of HSP40 and HSP70 do not change when animals were heatshocked (from 10 °C to 20 °C) for 3 h (Brun et al., 2008). It should be mentioned that the tolerable temperature range of P. canaliculata, A. irradians, P. magellanicus, and P. martensii is different, which are 8–38 °C (Zhou et al., 2003), 5–35 °C (Tettelbach and Rhodes, 1981; You et al., 2003), 5–15 °C (Brun et al., 2008; Pilditch and Grant, 1999) and 15–35 °C (Southgate and Lucas, 2008), respectively. In addition, P. canaliculata is a freshwater mollusk, others are marine mollusks.
Therefore, HSP expression elevated by heat or cold shock varies among mollusk species that differ in the tolerance of temperature changes and their habitat environment. This suggests a differential capacity of different mollusks using HSP40 and HSP70 to adapt to temperature change. Actually, different Pomacea species, P. canaliculata, P. maculata and P. diffusa, differ in the tolerance of temperature changes (Matsukura et al., 2009, 2016; Mu et al., 2015; Yoshida et al., 2014). Mu and co-workers showed that P. canaliculata HSP40 was not differentially expressed with HSP70 after acute and chronic heat shock, whereas P. diffusa HSP40 was (Mu et al., 2015). Thus, it will be interesting to compare the HSP's role in the tolerance of different Pomacea species to temperature changes. In the present study, PocaHSP40 belongs to type II HSP40 and PocaHSP70 belongs to type I HSP70, and there should be other HSP40s and HSP70s in P. canaliculata, thus another question to be answered is the difference of interactions between different types of HSP40s and HSP70s in P. canaliculata. In summary, P. canaliculata HSP40 was cloned, characterized, and its expression under different temperature was analyzed. In future studies, the role of PocaHSP40 in conditions other than temperature stress, such as parasitic infection or water deprivation, will be investigated, and the detail of the interaction between HSP40 and other HSPs of P. canaliculata will be clarified. In addition, as four phosphorylation sites were found in PocaHSP40, whether they will be phosphorylated by some phosphokinases and consequently affect the function of HSP40 in the adaptation of P. canaliculata to heat or cold shock will be examined. Acknowledgments This work was supported by the National High Technology Research and Development Program (“863” Program) of China (Grant no. 2012AA021601). References Bishop, O.T., Edkins, A.L., Blatch, G.L., 2014. Sequence and domain conservation of the coelacanth HSP40 and HSP90 chaperones suggests conservation of function. J. Exp. Zool. B. Mol. Dev. Evol. 322, 359–378. Bork, P., Sander, C., Valencia, A., Bukau, B., 1992. A module of the DnaJ heat shock proteins found in malaria parasites. Trends Biochem. Sci. 17, 129. Bouétard, A., Besnard, A.L., Vassaux, D., Lagadic, L., Coutellec, M.A., 2013. Impact of the redox-cycling herbicide diquat on transcript expression and antioxidant enzymatic activities of the freshwater snail Lymnaea stagnalis. Aquat. Toxicol. 126, 256–265. Brun, N.T., Bricelj, V.M., MacRae, T.H., Ross, N.W., 2008. Heat shock protein responses in thermally stressed bay scallops, Argopecten irradians, and sea scallops, Placopecten magellanicus. J. Exp. Mar. Biol. Ecol. 358, 151–162. Cheetham, M.E., Caplan, A.J., 1998. Structure, function and evolution of DnaJ: conservation and adaptation of chaperone function. Cell Stress Chaperon. 3, 28–36. Chen, H., Zha, J., Liang, X., Li, J., Wang, Z., 2014. Effects of the human antiepileptic drug carbamazepine on the behavior, biomarkers, and heat shock proteins in the asian clam Corbicula fluminea. Aquat. Toxicol. 155, 1–8. Cheng, P., Liu, X., Zhang, G., 2007. Cloning and expression analysis of a HSP70 gene from Pacific abalone, Haliotis discus hannai. Fish Shellfish Immun. 22, 77–87. Fan, C.Y., Lee, S., Cyr, D.M., 2003. Mechanisms for regulation of HSP70 function by HSP40. Cell Stress Chaperon. 8, 309–316. Farcy, E., Serpentini, A., Fiévet, B., Lebel, J.M., 2007. Identification of cdnas encoding HSP70 and HSP90 in the abalone Haliotis tuberculata: transcriptional induction in response to thermal stress in hemocyte primary culture. Comp. Biochem. Phys. B 146, 540–550. Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61, 243–282. Foster, N.L., Lukowiak, K., Henry, T.B., 2015. Time-related expression profiles for heat shock protein gene transcripts (HSP40, HSP70) in the central nervous system of Lymnaea stagnalis exposed to thermal stress. Commun. Integr. Biol. 8, e1040954. Giraud-Billoud, M., Vega, I.A., Tosi, M.E., Abud, M.A., Calderon, M.L., Castro-Vazquez, A., 2013. Antioxidant and molecular chaperone defences during estivation and arousal in the South American apple snail Pomacea canaliculata. J. Exp. Biol. 216, 614–622. Gotz, C., Muller, A., Montenarh, M., Zimmermann, R., Dudek, J., 2009. The ER-membrane-resident HSP40 ERj1 is a novel substrate for protein kinase CK2. Biochem. Biophys. Res. Commun. 388, 637–642. Han, G., Zhang, S., Marshall, D.J., Ke, C., Dong, Y., 2013. Metabolic energy sensors (AMPK and SIRT1), protein carbonylation, and cardiac failure as biomarkers of thermal stress in an intertidal limpet: linking energetic allocation with environmental
64
Journal of Thermal Biology 81 (2019) 59–65
Y. Xu, et al.
cDNAs and a proposal for their classification and nomenclature. Cell Stress Chaperon. 5, 98–112. Ohtsuka, K., Hata, M., 2000b. Molecular chaperone function of mammalian HSP70 and HSP40 – a review. Int. J. Hyperth. 16, 231–245. Patel, P., Prescott, G.R., Burgoyne, R.D., Lian, L.Y., Morgan, A., 2016. Phosphorylation of cysteine string protein triggers a major conformational switch. Structure 24, 1380–1386. Qiu, X.B., Shao, Y.M., Miao, S., Wang, L., 2006. The diversity of the DnaJ/HSP40 family, the crucial partners for HSP70 chaperones. Cell Mol. Life Sci. 63, 2560–2570. Pilditch, C.A., Grant, J., 1999. Effect of temperature fluctuations and food supply on the growth and metabolism of juvenile sea scallops (Placopecten magellanicus). Mar. Biol. 134, 235–248. Santoro, M.G., 2000. Heat shock factors and the control of the stress response. Biochem. Pharmacol. 59, 55–63. Seuffert, M.E., Burela, S., Martin, P.R., 2010. Influence of water temperature on the activity of the freshwater snail Pomacea canaliculata (Caenogastropoda: Ampullariidae) at its southernmost limit (Southern Pampas, Argentina). J. Therm. Biol. 35, 77–84. Song, H.M., Mu, X.D., Gu, D.E., Luo, D., Yang, Y.X., Xu, M., Luo, J.R., Zhang, J.E., Hu, Y.C., 2014. Molecular characteristics of the HSP70 gene and its differential expression in female and male golden apple snails (Pomacea canaliculata) under temperature stimulation. Cell Stress Chaperon. 19, 579–589. Southgate, P.C., Lucas, J.S., 2008. The pearl oyster. In: Lucas, J.S. (Ed.), Environmental Influences. Elsevier, Amsterdam, pp. 1–222. Tettelbach, S.T., Rhodes, E.W., 1981. Combined effects of temperature and salinity on embryos and larvae of the northern bay scallop Argopecten irradians irradians. Mar. Biol. 63, 249–256. Truman, A.W., Kristjansdottir, K., Wolfgeher, D., Hasin, N., Polier, S., Zhang, H., Perrett, S., Prodromou, C., Jones, G.W., Kron, S.J., 2012. CDK-dependent HSP70 phosphorylation controls G1 cyclin abundance and cell-cycle progression. Cell 151, 1308–1318. Wang, Q., Liu, Y., Zheng, Z., Deng, Y., Jiao, Y., Du, X., 2018. Adaptive response of pearl oyster Pinctada fucata martensii to low water temperature stress. Fish Shellfish Immun. 78, 310–315. Xu, Y., Zheng, G., Dong, S., Liu, G., Yu, X., 2014. Molecular cloning, characterization and expression analysis of HSP60, HSP70 and HSP90 in the golden apple snail, Pomacea canaliculata. Fish Shellfish Immun. 41, 643–653. Yochem, J., Uchida, H., Sunshine, M., Saito, H., Georgopoulos, C.P., Feiss, M., 1978. Genetic analysis of two genes, dnaJ and dnaK, necessary for Escherichia coli and bacteriophage lambda DNA replication. Mol. Gen. Genet. 164, 9–14. Yoshida, K., Matsukura, K., Cazzaniga, N.J., Wada, T., 2014. Tolerance to low temperature and desiccation in two invasive apple snails, Pomacea canaliculata and P. maculata (caenogastropoda: ampullariidae), collected in their original distribution area (northern and central Argentina). J. Mollus. Stud. 80, 62–66. You, Z.J., Lu, T., Ma, B., Chen, Q.J., 2003. The temperature on the growth and survival of Argopecten irradians concentricus larvae and juveniles. Fish. Sci. 22, 8–10. Zhang, Z., Zhang, Q., 2012. Molecular cloning, characterization and expression of heat shock protein 70 gene from the oyster Crassostrea hongkongensis responding to thermal stress and exposure of Cu2+ and malachite green. Gene 497, 172–180. Zheng, G., Dong, S., Hou, Y., Yang, K., Yu, X., 2012. Molecular characteristics of HSC70 gene and its expression in the golden apple snails, Pomacea canaliculata (Mollusca: Gastropoda). Aquaculture 358, 41–49. Zhou, W.C., Wu, Y.F., Yang, J.Q., 2003. Viability of the ampullaria snail in China. Fujian J. Agric. Sci. 18, 25–28.
temperature during aerial emersion. J. Exp. Biol. 216, 3273–3282. Hartl, F.U., Hayer-Hartl, M., 2002. Molecular chaperones in the cytosol: from nascent chain to folded protein. Science 295, 1852–1858. Hennessy, F., Cheetham, M.E., Dirr, H.W., Blatch, G.L., 2000. Analysis of the levels of conservation of the J domain among the various types of DnaJ-like proteins. Cell Stress Chaperon. 5, 347–358. Khoury, G.A., Baliban, R.C., Floudas, C.A., 2011. Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci. Rep. 1. Kostenko, S., Jensen, K.L., Moens, U., 2014. Phosphorylation of heat shock protein 40 (HSP40/DnaJB1) by mitogen-activated protein kinase-activated protein kinase 5 (MK5/PRAK). Int. J. Biochem. Cell Biol. 47, 29–37. Kostenko, S., Johannessen, M., Moens, U., 2009. PKA-induced F-actin rearrangement requires phosphorylation of HSP27 by the MAPKAP kinase MK5. Cell Signal. 21, 712–718. Li, C., Li, L., Liu, F., Ning, X., Chen, A., Zhang, L., Wu, H., Zhao, J., 2011. Alternation of Venerupis philippinarum, HSP40 gene expression in response to pathogen challenge and heavy metal exposure. Fish Shellfish Immun. 30, 447–450. Li, J., Qian, X., Sha, B., 2009. Heat shock protein 40: Structural studies and their functional implications. Protein Pept. Lett. 16, 606–612. Li, J., Zhang, Y., Liu, Y., Xiao, S., Yu, Z., 2016. Co-expression of heat shock protein (HSP) 40 and HSP70 in Pinctada martensii response to thermal, low salinity and bacterial challenges. Fish Shellfish Immun. 48, 239–243. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Liu, Y.B., Han, W., Xian, Z.H., 2011. Effect of different temperatures on growth, development and feeding of Pomacea canaliculata. J. South. Agric. 24, 901–905. Lv, S., Zhang, Y., Steinmann, P., Yang, G.J., Yang, K., Zhou, X.N., Utzinger, J., 2011. The emergence of angiostrongyliasis in the People's Republic of China: the interplay between invasive snails, climate change and transmission dynamics. Freshw. Biol. 56, 717–734. Matsukura, K., Tsumuki, H., Izumi, Y., Wada, T., 2009. Physiological response to low temperature in the freshwater apple snail, Pomacea canaliculata (Gastropoda: Ampullariidae). J. Exp. Biol. 212, 2558–2563. Matsukura, K., Izumi, Y., Yoshida, K., Wada, T., 2016. Cold tolerance of invasive freshwater snails, Pomacea canaliculata, P. maculata, and their hybrids helps explain their different distributions. Freshw. Biol. 61, 80–87. Mohler, P.J., Hoffman, J.A., Davis, J.Q., Abdi, K.M., Kim, C.R., Jones, S.K., Davis, L.H., Roberts, K.F., Bennett, V., 2004. Isoform specificity among ankyrins. An amphipathic alpha-helix in the divergent regulatory domain of ankyrin-b interacts with the molecular co-chaperone Hdj1/HSP40. J. Biol. Chem. 279, 25798–25804. Mu, H., Sun, J., Fang, L., Luan, T., Williams, G.A., Cheung, S.G., Wong, C.K.C., Qiu, J., 2015. Genetic basis of differential heat resistance between two species of congeneric freshwater Snails: Insights from quantitative proteomics and base substitution rate analysis. J. Proteom. Res. 14, 4296–4308. Muller, P., Ruckova, E., Halada, P., Coates, P.J., Hrstka, R., Lane, D.P., Vojtesek, B., 2013. C-terminal phosphorylation of HSP70 and HSP90 regulates alternate binding to cochaperones CHIP and HOP to determine cellular protein folding/degradation balances. Oncogene 32, 3101–3110. Nakano, K., Iwama, G., 2002. The 70-kda heat shock protein response in two intertidal sculpins, Oligocottus maculosus and O. snyderi: relationship of HSP70 and thermal tolerance. Comp. Biochem. Phys. A 133, 79–94. Ohtsuka, K., Hata, M., 2000a. Mammalian HSP40/DNAJ homologs: cloning of novel
65