Molecular cloning, expression analysis and subcellular localization of a Transparent Testa 12 ortholog in brown cotton (Gossypium hirsutum L.)

Gene 576 (2016) 763–769

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Molecular cloning, expression analysis and subcellular localization of a Transparent Testa 12 ortholog in brown cotton (Gossypium hirsutum L.) Jun-Shan Gao a, Nan Wu a, Zhi-Lin Shen a, Kai Lv b, Sen-He Qian a, Ning Guo a, Xu Sun a, Yong-Ping Cai a, Yi Lin a,⁎ a b

School of Life Sciences, Anhui Agricultural University, Hefei 230036, China Institute of Agricultural Economy and Information, Anhui Academy of Agricultural Sciences, Hefei 230031, China

a r t i c l e

i n f o

Article history: Received 19 November 2014 Received in revised form 16 October 2015 Accepted 2 November 2015 Available online 11 November 2015 Keywords: Brown cotton PAs GhTT12 Quantitative RT-PCR Subcellular localization

a b s t r a c t Transparent Testa 12 (TT12) is a kind of transmembrane transporter of proanthocyanidins (PAs), which belongs to a membrane-localized multidrug and toxin efflux (MATE) family, but the molecular basis of PAs transport is still poorly understood. Here, we cloned a full-length TT12 cDNA from the fiber of brown cotton (Gossypium hirsutum), named GhTT12 (GenBank accession No. KF240564), which comprised 1733 bp with an open reading frame (ORF) of 1503 bp and encoded a putative protein containing 500 amino acid residues with a typical MATE conserved domain. The GhTT12 gene had 96.8% similarity to AA genome in Gossypium arboretum. Quantitative RT-PCR analysis denoted that the relative expression of GhTT12 in brown cotton was 1–5 folds higher than that in white cotton. The mRNA level was the highest at 5 days post anthesis (DPA) and reduced gradually during the fiber development. Expressing GhTT12-fused green fluorescent protein (GFP) in Nicotiana tabacum showed that GhTT12-GFP was localized in the vacuole membrane. The content of PAs increased firstly and decreased afterwards, and reached the maximum at 15 DPA in brown cotton. But for white cotton, the content of PAs remained at a low level during the fiber development. We speculate that GhTT12 may participate in the transportation of PAs from the cytoplasmic matrix to the vacuole. Taken together, our data revealed that GhTT12 was functional as a PAs transmembrane transporter. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Cotton (Gossypium hirsutum L.) is an important commercial crop that is widely grown in the world and is used to produce both natural textile and cottonseed oil. Cotton production provides approximately $500 billion annually for cotton producers worldwide. The genus Gossypium includes two ploidy levels, diploid (2n = 2x = 26) and tetraploid (2n = 4x = 52) (Percival et al., 1999; Wendel and Cronn, 2003). This polyploidization event occurred approximately 1–2 million years ago and generated allopolyploid cotton that has been subsequently selected and domesticated as a modern cultivated cotton. The progenitors of allotetraploid cotton (2n = 4X = AADD) are most closely related to ‘AA’ and ‘DD’ extant diploid species. Upland cotton (G. hirsutum) originated from A-genome diploids and D-genome diploids. The AA genome progenitor species Abbreviations: TT12, Transparent Testa 12; PAs, proanthocyanidins; MATE, the multidrug and toxin efflux; EBGs, the early biosynthetic genes; LBGs, the late biosynthetic genes; ORF, open reading frame; UTR, untranslated region; qRT-PCR, quantitative real-time polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction; DPA, days post anthesis; GFP, green fluorescent protein; MOP, the multidrug/oligosaccharidyl-lipid/polysaccharide; RACE, rapid amplification of cDNA ends; UDP-glucose, uridine 5′-diphosphoglucose.. ⁎ Corresponding author. E-mail address: [email protected] (Y. Lin).

http://dx.doi.org/10.1016/j.gene.2015.11.002 0378-1119/© 2015 Elsevier B.V. All rights reserved.

(Gossypium arboreum or Gossypium herbaceum) native to Africa produce both long and short fibers. In contrast, the DD genome progenitor species (Gossypium raimondii) native to Mexico produce much fewer and shorter fibers than the fibers of the AA genome progenitor (Percival et al., 1999; Applequist et al., 2001; Paterson et al., 2012; Guan et al., 2014). Brown cotton is an important raw material for textile industry with a naturally colored fiber. Compared with white cotton, the colored cotton needs little or no dyeing during post processing, which could eliminate dyeing costs and chemical residues and decrease environmental pollutions (Xiao et al., 2014). Nevertheless, such problems as short fiber length, uneven coloring, low color fastness and saturation etc., restrict colored cotton application and development (Hua et al., 2008; Li et al., 2004). Since the emergence of colored cotton, the mechanism of pigment formation has been a hot research topic. The previous report has shown that the substances of pigment in brown cotton fiber may be flavonoids (Zhao and Wang, 2005). However, Zhan et al. (2007) consider that the pigment in brown cotton fiber is quinones, which are formed by the oxidation of tannic substances. Generally, it is agreed that the pigment of brown cotton fiber belongs to proanthocyanidins (PAs) (Li and Wang, 2000). PAs, also called condensed tannins, are a class of flavonoids with numerous functions in plant growth and development, including protecting against microbial infection, animal foraging and damaged

764

J.-S. Gao et al. / Gene 576 (2016) 763–769

by UV light. PAs are also beneficial in the human diet and livestock farming to prevent diseases of the cardiovascular system and to lower the risk of cancer, asthma and diabetes. Current knowledges of the flavonoid biosynthesis pathway and its regulation have mainly been obtained. In Arabidopsis thaliana, the structural genes leading to flavonoid biosynthesis including PA are usually divided into two groups, the early (EBGs) and late (LBGs) biosynthetic genes (Lepiniec et al., 2006; Tian et al., 2008; Ferraro et al., 2014). The EBGs include chalcone synthase (CHS), chalcone isomerase (CHI), flavonol 3-hydroxylase (F3H) and flavonol 3′-hydroxylase (F3′H), which are involved in precursor biosynthesis. The LBGs comprise dihydroflavonol-4-reductase (DFR), anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). In addition, other structural genes including TT10 (laccase), TT12 (MATE transporter), TT19 (glutathioneS-transferase) and AHA10 (H+-ATPase), have been shown to be involved in PA modification, transport and oxidation (Kitamura et al., 2004, 2010; Baxter et al., 2005; Debeaujon et al., 2001; DeBolt et al., 2009; Routaboul et al., 2012). Accordingly, some transcriptional regulators, such as the MYB transcription factors, basic helix–loop–helix (bHLH), and WDR factors, are also involved in the control of flavonoid biosynthesis (Li et al., 2013; Xu et al., 2014, 2015). According to reports, the AtTT12 encodes a secondary transporter that is localized to the tonoplast and belongs to the MATE transporter family, which is a part of the multidrug/oligosaccharidyl-lipid/polysaccharide (MOP) exporter superfamily (Debeaujon et al., 2001; Hvorup et al., 2003; Marinova et al., 2007). The AtTT12 protein functions to transport epicatechin 3′-O-glucoside as a precursor for PA biosynthesis in the PAsynthesizing cells of the seed coat (Debeaujon et al., 2001; Baxter et al., 2005; Marinova et al., 2007). TT12-like cDNAs, named MdMATE1 and MdMATE2, are cloned from apple (Malus x domestica), which are differentially expressed, and the functions of the encoded proteins are verified by complementation of the respective Arabidopsis mutants. In addition, MdMATE genes have a different gene structure compared to homologues from other species. Based on the report, MdMATE1 and MdMATE2 are proposed to be vacuolar flavonoid⁄H+-antiporters, and are actived in PA accumulating cells of apple fruit (Frank et al., 2011). Full-length or partial cDNA sequences encoding TT12 have been isolated from a number of species including Brassica napus, oleracea and rapa (Chai et al., 2009). The genes contain alternative transcriptional start and polyadenylation sites, which display high identities (N99%) to each other and resemble AtTT12 in such basic features as MatE/NorMCDs, subcellular localization, transmembrane helices and phosphorylation sites (Chai et al., 2009). Plant TT12 orthologs differ from other MATE proteins for expression. Like AtTT12, all Brassica TT12 genes are most highly expressed in developing seeds (Chai et al., 2009). To explore the molecular mechanism of PA synthesis, transport and accumulation in brown cotton fiber, we cloned a putative TT12 gene from brown cotton fiber using 3′-RACE and 5′-RACE techniques, and performed sequence analysis and expression analysis. From these results, our studies are designed to clear the molecular mechanisms of PAs synthesis in brown cotton fiber and provide a reference for genetic improvement of brown cotton. 2. Materials and methods 2.1. Plant materials and growth conditions Brown cottons (Zongcaixuan 1, medium brown, light brown) and white cotton cultivar Simian 3 as a control were cultivated in the farm of Anhui Agricultural University at every year. The cotton bolls were collected at 5, 10, 15, 20 and 25 DPA for use in this study. N. tabacum (tobacco) was used for transient expression of GhTT12. Tobacco seeds were sown on the nutritional soil and grown in a growth chamber at 25°C with 60% humidity and 16/8h day/night cycle. Sixweek-old plants were used for genetic transformation. After infiltration, the plants were trained for 2–3 days under the same condition.

2.2. Molecular cloning of GhTT12 full-length cDNA Total RNA was extracted from the fiber of Zongcaixuan 1 at 10 DPA using RNAprep Pure Plant Kit (Tiangen, Beijng) according to the manufacturer's protocol. The concentration of total RNA was 400 ng μL−1 and the numerical value of A260/A280 was 2.01. The first strand cDNA was synthesized from 2 μg RNA using FastQuant RT Kit (Tiangen, Beijng). Two pairs of degenerate primers, designed according to homologous sequences from A. thaliana, M. x domestica and so on, were used for nested PCR to amplify the fragment of GhTT12. The first round PCR was performed with the primers GhTT12-M-out-F and GhTT12-M-out-R (Table 1). The PCR product was used as a template for the second round PCR to amplify an internal cDNA fragment with the primers GhTT12-M-inner-F and GhTT12-M-inner-R (Table 1). The 3′ and 5′ distal cDNAs were obtained by rapid amplification of cDNA ends (RACE) method using 3′-Full RACE Kit and 5′-Full RACE Kit (Takara, Dalian) according to the instructions, respectively. 3′-RACE products were generated by two specific primers GhTT12-3-out-F and GhTT12-3-inner-F (Table 1). 5′-RACE products were generated by two specific primers GhTT12-5-out-R and GhTT12-5-inner-R (Table 1). These amplification reactions were carried out in PCR instrument (Biometra, Germany).The obtained PCR products were electrophoresed on a 1% agarose gel, and were recycled by SanPrep Column PCR Product Purification Kit (Sangon, Shanghai). The purified cDNAs were inserted into pMD18-T vector (Takara, Dalian). For sequence determination, at least 3–5 independent positive clones were selected and sequenced (Sangon, Shanghai). The overlapping sequences were assembled by DNAMAN software to obtain the full-length cDNA sequence of GhTT12. 2.3. Sequence analysis and homology comparison of GhTT12 The deduced amino acid sequences of GhTT12 were analyzed using SMART online analysis program (http://smart.embl-heidelberg.de) and BLAST software. Alignment of amino acid sequences of TT12 genes from diverse plants was done with ClustalW (http://www.ebi.ac.uk/ clustalw/) using the default parameters, and homologies were analyzed with DNAMAN software. The nonrooted neighbor-joining tree was generated by MEGA 4.1 program. All nodes are supported by at least 1000 bootstrap replicates. 2.4. Quantitative real-time PCR To detect the expression profile of GhTT12, qRT-PCR was performed. RNA was extracted from the fibers of 5, 10, 15, 20 and 25 DPA of Zongcaixuan 1, medium brown, light brown and Simian 3 by RNAprep Pure Plant Kit (Tiangen, Beijing). The first strand cDNAs were synthesized from 2 μg RNA with a PrimeScript™ RT reagent Kit (Takara, Dalian) according to the manufacturer's instruction. The primers GhTT12-RT-F and GhTT12-RT-R (Table 1) for qRT-PCR were Table 1 Primers used in this study. Name

Sequence (5′–3′)

GhTT12-M-out-F GhTT12-M-out-R GhTT12-M-inner-F GhTT12-M-inner-R GhTT12-3-out-F GhTT12-3-inner-F GhTT12-5-out-R GhTT12-5-inner-R GhTT12-F GhTT12-R GhTT12-RT-F GhTT12-RT-R GhUBQ7-F GhUBQ7-R

TGGGTTGTGCTGTTGAAACTCTntgyggncarg GCTTGCCAACCACAACCAayngcnacncc TTCGTTTATTGGATGATTCCTcarhtntwygc GCCTTAGGATGACCAGCAccnarytcrtt GCACATTCTTCTCACCTGGCTT CAGCCTCTCTTGGTGGTTTCTT GTGAAGGCTCTAAAGGATACGC ACAAGAAACCACCAAGAGAGGC CATGCCATGGGTTCAGCAGCTCCTGAGTATC GAAGATCTGTTTGCTCCTCATTTGCAGATTTC GTATTGGTTCTCTGGTGACG GTAAGAGCAGCACCAAGTAG GAAGGCATTCCACCTGACCAAC CTTGACCTTCTTCTTCTTGTGCTTG

J.-S. Gao et al. / Gene 576 (2016) 763–769

designed based on the sequence of GhTT12 cDNA. The Ubiquitin extension gene (UBQ7, GenBank accession No. DQ116441) was used as an internal control, which was amplified with the primers GhUBQ7-F and GhUBQ7-R (Tu et al., 2007) (Table 1). Every sample was carried out for three replications. The results were displayed in the form of relative value 2 − ΔΔCt , where ΔCt represents that Ct value of the gene subtracts that of the internal control gene (Bustin et al., 2009; Livak and Schmittgen, 2001).

765

(BIO-RAD, American). The transformed Agrobacteria were cultured in LB medium, supplemented with 50 mg L− 1 kanamycin and 50 mg L−1 rifampicin. The cultures were resuspended in infiltration media (1/2 MS, 5% sucrose, 0.02% Silwet L-77, 200 μM acetosyringone). Using the injection method, the suspensions were infiltrated into the leaves of N. tabacum. Excess Agrobacteria were subsequently removed and the plants were incubated in a culture room for three days. The GhTT12-GFP was observed by a Confocal Laser Scanning Microscopy (Olympus, Japan).

2.5. Determination of the PA contents PAs were extracted from the fibers of 5, 10, 15, 20 and 25 DPA in brown and white cottons according to the method described by Ikegami (Ikegami et al., 2009). Briefly, 100 mg of fresh fiber was ground into powder in 5 mL of 80% methanol and sonicated for 30 min. After centrifugation at 4500 × g for 10 min at 4 °C, the ‘soluble PAs’ in the supernatant was collected. The pellet was resuspended with 5 mL of 1% HCl in methanol and incubated at 60 °C for 1 h, and centrifugated at 4500 ×g for 10 min at 4 °C, then the ‘insoluble PAs’ in the supernatant were collected. The contents of PAs were determined according to DMACA color reaction methods (Li et al., 1996). The amount of PAs was calculated as equivalent to (+)-catechin. Experiments were replicated for three times. 2.6. Construction of the plasmid vector For transient expression assay, we constructed a transient expression vector with a GFP. A pair of primes GhTT12-F and GhTT12-R (Table 1) was used to amplify the target gene GhTT12. The PCR product was separated on 1% agarose gel and purified, then was inserted into the vector pMD18-T to generate pMD18-T-GhTT12. After the sequence was tested and verified, the plasmid DNA of pMD18-T-GhTT12 was extracted by plasmid extraction kit (Sangon, Shanghai). The extracted DNA and the empty expression vector pCambia1304 were digested with the restriction endonucleases Nco I and Bgl II, respectively. The products were separated on 1% agarose gel, and the target fragments were purified, respectively. Then the target fragment of GhTT12 was ligated with the Nco I and Bgl II fragment of pCambia1304 by T4 DNA Ligase (Takara, Dalian). The recombinants were transformed into Escherichia coli competent cells, and were tested and sequenced to obtain the plant expression vector pCambia1304-GhTT12 containing the GFP protein. 2.7. Agrobacterium tumefaciens-mediated transient expression and subcellular localization The constructed expression vector pCambia1304-GhTT12 was electroporated into A. tumefaciens EHA105 by Gene Pulser Xcell

3. Results 3.1. Cloning and characterization of GhTT12 A transmembrane transporter gene GhTT12, which belongs to a MATE family, was cloned from the fiber of Zongcaixuan 1. To obtain the full-length coding sequences of GhTT12, the 5′ and 3′ distal cDNAs were amplified by RACE technique. Nucleotide sequences indicated that the full-length cDNA of GhTT12 was 1733 bp (GenBank accession number KF240564). The cDNA contained a 76 bp 5′-untranslated region (5′-UTR), 154 bp 3′-UTR and 1503 bp open reading frame (ORF), which was located in the sixth chromosome of AA genome diploids (Fig. 1). The GhTT12 gene encoded 500 amino acid residues, which was more similar to AA genome from Gossypium arboretum than DD genome from G. raimondii (Fig. S1). Meanwhile, the GhTT12 gene was also cloned and sequenced in white cotton. The result indicated that the amino acid sequences of GhTT12 were identical in brown and white cottons (Fig. S1). The alignment of amino acid sequences of the GhTT12 protein and other TT12 proteins from diverse plants was showed in Fig. 2. The result showed that GhTT12 contained a conserved MATE domain, which was a member of MATE super-families. The amino acid sequences analyses indicated that the GhTT12 protein was highly homologous to other TT12 proteins. The GhTT12 protein had the highest identity (85.17%) to TcTT12 and had the lowest identity (74.8%) to AtTT12 (Table 2). The results revealed that TT12 is comparatively conservative in different plants. A phylogenetic tree was constructed based on the deduced amino acid sequences of the available TT12 genes from GenBank databases by the MEGA program in Fig. 3. The results indicated that GhTT12 was grouped into the same clade as TcTT12, which mean that the GhTT12 protein was closely related to TcTT12, and was not closely related to TT12 from A. thaliana, B. napus and Eutrema salsugineum. This analysis suggested that GhTT12 might play an important role similar to TcTT12.

Fig. 1. Structural diagram of the GhTT12 gene.

766

J.-S. Gao et al. / Gene 576 (2016) 763–769

Fig. 2. Multiple sequence alignments among the deduced amino acid sequences of GhTT12 and other homologous genes in plant. Amino acid identity of 100% is marked with a black background, amino acid identity of higher than 50% is marked with a dark grey background, and amino acid identity of more than 33% is marked with a light grey background. The MATE domains are marked with an overline. GenBank accession numbers in the figure are shown as followed: Gossypium hirsutum (GhTT12, AGW32085.1); Arabidopsis thaliana (AtTT12, NM_115765.3); Brassica napus (BnTT12, EU818786.1); Cicer arietinum (CaTT12, XM_004491216.1); Glycine max (GmTT12, XM_003545107.1); Medicago truncatula (MtTT12, FJ858726.1); Phaseolus vulgaris (PvTT12, XM_007141392.1); and Theobroma cacao (TcTT12, XM_007048834.1).

3.2. Expression of GhTT12 in different cotton fibers To determine the expression levels of GhTT12 at different development stages of fibers in brown and white cottons, we carried out qRT-PCR using specific primers for the respective mRNAs. The results showed that the

expressions of GhTT12 in brown cottons (Zongcaixuan 1, medium brown and light brown) were 1–5 folds higher than that in white cotton (Simian 3) relative to the reference gene UBQ7, especially at 5 and 10 DPA (Fig. 4). However, the expression of GhTT12 was the highest in Zongcaixuan 1 and the lowest in Simian 3, and the

J.-S. Gao et al. / Gene 576 (2016) 763–769

767

Table 2 The homology of TT12 from different plant species (%).

GhTT12 AtTT12 BnTT12 CaTT12 GmTT12 MtTT12 PvTT12 TcTT12

GhTT12

AtTT12

BnTT12

CaTT12

GmTT12

MtTT12

PvTT12

TcTT12

– 74.8 75.49 78.9 79.09 77.8 77.1 85.17

– 92.7 70.59 71.57 69.09 69.59 69.73

– 69.69 70.67 68.31 69.59 70.81

– 84.55 91.12 79.45 73.24

– 82.45 86.11 74.32

– 78.36 72.79

– 73.06

–

expression of GhTT12 decreased gradually as the fiber color became light at different fiber developmental stages (Fig. 4). These results showed that the expression levels of GhTT12 were different in cotton fibers, which mean that the change of cotton fiber color is positively related to the expression of GhTT12, and suggest that GhTT12 may be involved in the formation of fiber pigment. 3.3. Determination of PAs contents in different cotton fibers To clarify the difference of PAs accumulation between brown and white cotton fibers, the contents of PAs were determined and calculated as equivalent to (+)-catechin. Significant differences were detected among different cotton fibers from 5 to 25 DPA. For brown cottons (Zongcaixuan 1, medium brown and light brown), the contents of soluble PAs were increased firstly and decreased afterwards, and reached the maximum at 15 DPA (Fig. 5A). But for white cotton (Simian 3), the contents of PAs was low and had not significant differences at different fiber developmental stages (Fig. 5A). Likewise, the changing trends of the insoluble PAs contents were accordant with the soluble PAs contents among different cotton fibers (Fig. 5B). The results indicated that the expression of GhTT12 was the highest at 5 DPA and the contents of PAs were the largest at 15 DPA in brown cottons, which suggest that

Fig. 3. Phylogenetic tree constructed among GhTT12 and other plants TT12 proteins. Protein sequences were aligned with ClustalW, and the nonrooted neighbor-joining tree was generated by the MEGA 4.1 program. Numbers at branch points indicate bootstrap support. GenBank accession numbers in the figure are shown as followed: Arabidopsis thaliana (AtTT12, NM_115765.3); Brassica napus (BnTT12, EU818786.1); Cicer arietinum (CaTT12, XM_004491216.1); Citrus sinensis (CsTT12, KDO63439.1); Eutrema salsugineum (EsTT12, XP_006402730.1); Fragaria vesca subsp. Vesca (FvTT12, XP_004290839.1); Glycine max (GmTT12, XM_003545107.1); Gossypium hirsutum (GhTT12, AGW32085.1); Malus domestica (MdTT12, NP_001280841.1); Medicago truncatula (MtTT12, FJ858726.1); Morus notabilis (MnTT12, EXC08256.1); Phaseolus vulgaris (PvTT12, XM_007141392.1); Populus trichocarpa (PtTT12, XP_002307572.1); Prunus persica (PpTT12, XP_007215262.1); Theobroma cacao (TcTT12, XM_007048834.1); and Vitis vinifera (VvTT12, XP_002282932.1).

the GhTT12 gene may be involved in the accumulation or synthesis of PAs. 3.4. Subcellular localization of GhTT12 To examine the subcellular localization of GhTT12, the plant expression vector pCambia1304-GhTT12 was constructed and transformed into N. tabacum. A construct of free GFP was used for transient expression as a control. Our results showed that the GhTT12-GFP was detected not only around the plasma membrane of tobacco epidermal cells but also in the periphery of a small vesicule-like structure, which could be potentially prevacuolar (Fig. 6A–C). The result was quite different from the localization of free GFP with strong cytosolic and plasma membrane signal (Fig. 6D–F). According to the report that the TT12 gene in A. thaliana is localized in the vacuolar membrane (Marinova et al., 2007; Zhao and Dixon, 2009), we can speculate that GhTT12 encodes a vacuolar membrane protein. 4. Discussion Flavonoids are one of the largest groups of secondary metabolites and flavonoid biosynthesis is an enzymatic pathway studied thoroughly in plants. Existing research has demonstrated that the Arabidopsis MATE transporter TT12 acts as a flavonoid/H+-Antipater on the vacuolar membrane of PA-synthesizing cells of the seed coat (Marinova et al., 2007). It is clear that the molecular mechanism of pigment synthesis in the seed coat of the model plant A. thaliana. Because the cotton fiber cell is essentially a kind of specialized cells in the seed coat as same as that in Arabidopsis, it provides a great reference value for studying the synthesis, transport and accumulation of PAs. At present, many structural genes related to pigment synthesis in brown cotton fiber have been cloned, such as GhCHS, GhCHI, GhF3H, GhDFR, GhANS, GhANR and so on (Xiao et al., 2007; Yang et al., 2010). A detailed PAs biosynthesis pathway is wholly activated in brown cotton fiber. For the biosynthesis

Fig. 4. Expression patterns of GhTT12 in brown and white fibers at different development stages. qRT-PCR analyses for the expression level of GhTT12 relative to UBQ7 as a control in brown and white fibers. Data are the mean values and SE (standard error) is from three biological replicates.

768

J.-S. Gao et al. / Gene 576 (2016) 763–769

Fig. 5. The changes of PAs contents in brown and white fibers at different development stages. A: soluble PA; B: insoluble PA. Data are the average values with three replications.

of PAs, the initiating units (flavan-3-ols) are firstly synthesized from leucoanthocyanidins and anthocyanidins, then are catalyzed by LAR, ANS and ANR, respectively (Feng et al., 2013; Xiao et al., 2014). To further clarify the relationship of flavonoid structural genes and fiber pigment synthesis, we detected transcriptional levels of ANS and ANR in the developing fibers from brown cotton (Zongcaixuan 1). As shown in Fig. S2, expression analyses demonstrated that ANS and ANR were upregulated in brown fibers, implying that the expression profiles of upstream genes were consistent with that of GhTT12 in PAs synthesis pathway and were related to brown pigment deposition in cotton fibers. According to previous studies, in M. x domestica (Frank et al., 2011), A. thaliana (Debeaujon et al., 2001), M. truncatula (Zhao and Dixon, 2009; Zhao et al., 2011) and Brassica sp (Wei et al., 2007; Chai et al., 2009; Zhang et al., 2009; Yu, 2013), TT12 encodes a membrane protein of the MATE family, which suggests that TT12 is involved in the vacuolar accumulation of PA precursors. In this work, we knew that GhTT12 contained a typical MATE conserved domain and was highly similar to

other TT12 proteins reported in plants, and their similarities are above 74%. So we speculate that GhTT12 may participate in the accumulation of PAs precursors in brown fibers. From the results of subcellular localization of GhTT12, it can also be seen that GhTT12 encodes a protein localized in the vacuolar membrane, which is similar to Medicago MATE1. It is thought that GhTT12 may be the same function as MATE1, which can transport epicatechin 3′-O-glucoside as a precursor for PAs biosynthesis (Zhao and Dixon, 2009). In this study, the GhTT12 was also detected in white cotton. We found that the sequences of GhTT12 were completely coincident with those in brown cotton, but qRT-PCR denoted that the relative expression level of GhTT12 in brown cotton was much higher than that in white cotton at different fiber developmental stages. The results of PAs contents also showed that there were less PAs in white fiber than in brown fiber. Moreover, we find that the promoter sequences of GhTT12 are different in brown and white cottons. The characterization of the specific promoter of GhTT12 impacts on the promoter activity, which regulates the expression profile of GhTT12 at different fiber developmental stages. In addition, we are generating transgenic cotton lines harboring the specific promoter-reporter constructs to study the mechanisms of gene expression and regulation of GhTT12 in plant systems. Meanwhile, we are confirming the function of GhTT12 during the synthesis of pigment in brown cotton fiber through transforming GhTT12 into the Arabidopsis tt12 mutant by transgenic technology. Currently, we obtained T0 and T1 transgenic plants and will detect the function of GhTT12. The results can reveal the relationships between GhTT12 and PA synthesis, which can also further clarify metabolic pathways of the pigment in brown cotton and provide a reference for genetic improvement of brown cotton. 5. Conclusions We cloned a full-length GhTT12 cDNA in brown cotton fiber for the first time, analyzed the sequence structure. Moreover, we detected the relative expression levels of GhTT12 using quantitative RT-PCR, and measured the contents of PAs in brown cotton lines and white cotton cultivar. In addition, we identified that GhTT12 was localized in the vacuole membrane by expressing GhTT12-fused GFP protein in N. tabacum. The results suggest that GhTT12 may participate in the transportation of PAs from the cytoplasmic matrix to the vacuole. Taken together, our data revealed that GhTT12 was functional as a PAs transmembrane transporter.

Fig. 6. Subcellular localization of pCambia1304-GhTT12-GFP. A–C: Subcellular localization of GhTT12-GFP; D–F: Subcellular localization of 35S-GFP. Long arrow shows an underdeveloped vacuole or a prevacuole.

J.-S. Gao et al. / Gene 576 (2016) 763–769

Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2015.11.002. Acknowledgements This work was supported by the Specialized Research Fund for the Doctoral Program of Higher Education of China (no. 20123418120001). It was also supported by the Natural Science Foundation of the Higher Education Institutions of Anhui Province, China (nos. KJ2013A117 and KJ2014A078) and the Biology Key Subject Construction of Anhui (2014SWQJ009). References Applequist, W.L., Cronn, R., Wendel, J.F., 2001. Comparative development of fiber in wild and cultivated cotton. Evol. Dev. 3, 3–17. Baxter, I.R., Young, J.C., Armstrong, G., Foster, N., Bogenschutz, N., Cordova, T., Peer, W.A., Hazen, S.P., Murphy, A.S., Harper, J.F., 2005. A plasma membrane H+-ATPase is required for the formation of proanthocyanidins in the seed coat endothelium of Arabidopsis thaliana. Proc. Natl. Acad. Sci. 102, 2649–2654. Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The MIQE Guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55, 611–622. Chai, Y.R., Lei, B., Huang, H.L., Li, J.N., Yin, J.M., Tang, Z.L., Wang, R., Chen, L., 2009. TRANSPARENT TESTA 12 genes from Brassica napus and parental species: cloning, evolution, and differential involvement in yellow seed trait. Mol. Gen. Genomics. 281, 109–123. Debeaujon, I., Peeters, A.J., Léon-Kloosterziel, K.M., Koornneef, M., 2001. The TRANSPARENT TESTA12 gene of Arabidopsis encodes a multidrug secondary transporter-like protein required for flavonoid sequestration in vacuoles of the seed coat endothelium. Plant Cell 13, 853–871. DeBolt, S., Scheible, W., Schrick, K., Auer, M., Beisson, F., Bischoff, V., Bouvier-Navé, P., Carroll, A., Hematy, K., Li, Y., Milne, J., Nair, M., Schaller, H., Zemla, M., Somerville, C., 2009. Mutations in UDP-glucose: sterol glucosyltransferase in Arabidopsis cause transparent testa phenotype and suberization defect in seeds. Plant Physiol. 151, 78–87. Feng, H., Tian, X., Liu, Y., Li, Y., Zhang, X., Jones, B.J., Sun, Y., Sun, J., 2013. Analysis of flavonoids and the flavonoid structural genes in brown fiber of upland cotton. PLoS One 8, e58820. Ferraro, K., Jin, A.L., Nguyen, T.D., Reinecke, D.M., Ozga, J.A., Ro, D.K., 2014. Characterization of proanthocyanidin metabolism in pea (Pisum sativum) seeds. BMC Plant Biol. 14, 238. Frank, S., Keck, M., Sagasser, M., Niehaus, K., Weisshaar, B., Stracke, R., 2011. Two differentially expressed MATE factor genes from apple complement the Arabidopsis transparent testa 12 mutant. Plant Biol. 13, 42–50. Guan, X.Y., Song, Q.X., Chen, Z.J., 2014. Polyploidy and small RNA regulation of cotton fiber development. Trends Plant Sci. 19, 516–528. Hua, S.J., Wang, X.D., Zhao, X.Q., Ni, M., Yuan, H.N., Jiang, L.X., 2008. Dynamics of carbohydrate and pigment content during fiber development in brown-colored cotton. Cotton Science 20, 239–241. Hvorup, R.N., Winnen, B., Chang, A.B., 2003. The multidrug/oligosaccharidyl-lipid/ polysac-charide (MOP) exporter superfamily. Eur. J. Biochem. 270, 799–813. Ikegami, A., Akagi, T., Potter, D., Yamada, M., Sato, A., Yonemori, K., Kitajima, A., Inoue, K., 2009. Molecular identification of 1-cys peroxiredoxin and anthocyanidin/flavonol 3-O-galactosyltrans-ferase from proanthocyanidin-rich young fruits of persimmon (Diospyros kaki Thunb.). Planta 230, 841–855. Kitamura, S., Shikazono, N., Tanaka, A., 2004. TRANSPARENT TESTA 19 is involved in the accumulation of both anthocyanins and proanthocyanidins in Arabidopsis. Plant J. 37, 104–114. Kitamura, S., Matsuda, F., Tohge, T., Yonekura-Sakakibara, K., Yamazaki, M., Saito, K., Narumi, I., 2010. Metabolic profiling and cytological analysis of proanthocyanidins in immature seeds of Arabidopsis thaliana flavonoid accumulation mutants. Plant J. 62, 549–559. Lepiniec, L., Debeaujon, I., Routaboul, J., Baudry, A., Pourcel, L., Nesi, N., Caboche, M., 2006. Genetics and biochemistry of seed flavonoids. Annu. Rev. Plant Biol. 57, 405–430.

769

Li, C.K., Wang, J.H., 2000. Research and utilization status of naturally coloured cotton. Shandong Agri. Sci. 4, 52–53. Li, Y.G., Tanner, G., Larkin, P., 1996. The DMACA-HCl protocol and the threshold proanthocyanidin content for bloat safety in forage legumes. J. Sci. Food Agric. 70, 89–101. Li, D.G., Nie, Y.C., Zhang, X.L., 2004. Genetic analysis of fiber color on brown upland cotton. J. Huazhong Agric. Univ. 23, 606–609. Li, X.W., Li, J.W., Zhai, Y., Zhao, Y., Zhao, X., Zhang, H.J., Su, L.T., Wang, Y., Wang, Q.Y., 2013. AR2R3-MYB transcription factor, GmMYB12B2, affects the expression levels of flavonoid biosynthesis genes encoding key enzymes in transgenic Arabidopsis plants. Gene 532, 72–79. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(− Delta Delta C(T)) method. Methods 25, 402–408. Marinova, K.I., Pourcel, L., Weder, B., Schwarz, M., Barron, D., Routaboul, J.M., Debeaujon, I., Klein, M., 2007. The Arabidopsis MATE transporter TT12 acts as a vacuolar flavonoid/H+-antiporter active in proanthocyanidin-accumulating cells of the seed coat. Plant Cell 19, 2023–2038. Paterson, A.H., Wendel, J.F., Gundlach, H., Guo, H., Jenkins, J., Jin, D., Llewellyn, D., Showmaker, K.C., Shu, S., Udall, J., Yoo, M.J., Byers, R., Chen, W., et al., 2012. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres. Nature 492, 423–427. Percival, A.E., Wendel, J.F., Stewart, J.M., 1999. Taxonomy and germplasm resources. In: Smith, C.W., Cothren, J.T. (Eds.), Cotton: Origin, History, Technology, and Production. NewYork, NY, JohnWiley & Sons, pp. 33–63. Routaboul, J.M., Dubos, C., Beck, G., Marquis, C., Bidzinski, P., Loudet, O., Lepiniec, L., 2012. Metabolite profiling and quantitative genetics of natural variation for flavonoids in Arabidopsis. J. Exp. Bot. 63, 3749–3764. Tian, L., Pang, Y.Z., Dixon, R.A., 2008. Biosynthesis and genetic engineering of proanthocyanidins and (iso) flavonoids. Phytochem. Rev. 7, 445–465. Tu, L.L., Zhang, X.L., Liu, D.Q., Jin, S.X., Cao, J.L., Zhu, L.F., Deng, F.L., Tan, J.F., Zhang, C.B., 2007. Suitable internal control genes for qRT-PCR normalization in cotton fiber development and somatic embryogenesis. Chin. Sci. Bull. 52, 3110–3117. Wei, Y.L., Li, J.N., Lu, J., Tang, Z.L., Pu, D.C., Chai, Y.P., 2007. Molecular cloning of Brassica napus TRANSPARENT TESTA 2 gene family encoding potential MYB regulatory proteins of proanthocyanidin biosynthesis. Mol. Biol. Rep. 34, 105–120. Wendel, J.F., Cronn, R.C., 2003. Polyploidy and the evolutionary history of cotton. Adv. Agron. 78, 139–186. Xiao, Y.H., Zhang, Z.S., Yin, M.H., Luo, M., Li, X.B., Hou, L., Pei, Y., 2007. Cotton flavonoid structural genes related to the pigmentation in brown fibers. Biochem. Biophys. Res. Commun. 358, 73–78. Xiao, Y.H., Yan, Q., Ding, H., Luo, M., Hou, L., Zhang, M., Yao, D., Liu, H.S., Li, X., Zhao, J., Pei, Y., 2014. Transcriptome and biochemical analyses revealed a detailed proanthocyanidin biosynthesis pathway in brown cotton fiber. PLoS One 9, e86344. Xu, W., Grain, D., Bobet, S., Gourrierec, J., Thevenin, J., Kelemen, Z., Lepiniec, L., Dubos, C., 2014. Complexity and robustness of the flavonoid transcriptional regulatory network revealed by comprehensive analyses of MYB–bHLH–WDR complexes and their targets in Arabidopsis Seed. New Phytol. 202, 132–144. Xu, W., Dubos, C., Lepiniec, L., 2015. Transcriptional control of flavonoid biosynthesis by MYB–bHLH–WDR complexes. Trends Plant Sci. 20, 176–185. Yang, H.N., Tian, X.H., Li, Y.J., Li, M.Y., Feng, H.J., Sun, J., 2010. Cloning and quantitative analysis by real-time RT-PCR of a chalcones synthase gene (GhCHS1) in the natural brown cotton fibers. Cotton Science 22, 42–48. Yu, C.Y., 2013. Molecular mechanism of manipulating seed coat coloration in oilseed Brassica species. J. Appl. Genet. 54, 135–145. Zhan, S.H., Lin, Y., Cai, Y.P., Li, Z.P., 2007. Preliminary deductions of the chemical structure of the pigment brown in cotton fiber. Chin. Bull. Bot. 24, 99–104. Zhang, J., Lu, Y., Yuan, Y., Zhang, X., Geng, J., Chen, Y., Cloutier, S., McVetty, P.B., Li, G., 2009. Map-based cloning and characterization of a gene controlling hairiness and seed coat color traits in Brassica rapa. Plant Mol. Biol. 69, 553–563. Zhao, J., Dixon, R.A., 2009. MATE transporters facilitate vacuolar uptake of epicatechin 3′-O-glucoside for proanthocyanidin biosynthesis in Medicago truncatula and Arabidopsis. Plant Cell 21, 2323–2340. Zhao, X.Q., Wang, X.D., 2005. Composition analysis of pigment in colored cotton fiber. Acta Agron. Sin. 31, 456–462. Zhao, J., Huhman, D., Shadle, G., He, X.Z., Sumner, L.W., Tang, Y., Dixon, R.A., 2011. MATE2 mediates vacuolar sequestration of flavonoid glycosides and glycoside malonates in Medicago truncatula. Plant Cell 23, 1536–1555.