- Email: [email protected]
Molecular Cloning, Expression Pattern, and Chromosomal Localization of the Human Na–Cl Thiazide-Sensitive Cotransporter (SLC12A3)
GENOMICS
35, 486–493 (1996) 0388
ARTICLE NO.
Molecular Cloning, Expression Pattern, and Chromosomal Localization of the Human Na–Cl Thiazide-Sensitive Cotransporter (SLC12A3) NADIA MASTROIANNI,*,† MAURIZIO DE FUSCO,* MASSIMO ZOLLO,* GIULIA ARRIGO,‡ ORSETTA ZUFFARDI,‡,§ ALBERTO BETTINELLI,† ANDREA BALLABIO,*,Ø AND GIORGIO CASARI*,1 *Telethon Institute of Genetics and Medicine (Tigem), San Raffaele Biomedical Science Park, 20132 Milan, Italy; †Clinica Pediatrica II, University of Milan, 20122 Milan, Italy; ‡Laboratorio di Citogenetica, San Raffaele Hospital, Milan, Italy; §Istituto di Biologia Generale e Genetica Medica, Pavia, Italy; and ØDepartment of Molecular Biology, University of Siena, 53100 Siena, Italy Received February 5, 1996; accepted March 5, 1996
Electrolyte homeostasis is maintained by several ion transport systems. Na–(K)–Cl cotransporters promote the electrically silent movement of chloride across the membrane in absorptive and secretory epithelia. Two kidney-specific Na–(K)–Cl cotransporter isoforms are known, so far, according to their sensitivity to specific inhibitors. We have cloned the human cDNA coding for the renal Na–Cl cotransporter selectively inhibited by the thiazide class of diuretic agents. The predicted protein sequence of 1021 amino acids (112 kDa) shows a structure common to the other members of the Na– (K)–Cl cotransporter family: a central region harboring 12 transmembrane domains and the 2 intracellular hydrophilic amino and carboxyl termini. The expression pattern of the human Na–Cl thiazide-sensitive cotransporter (hTSC, HGMW-approved symbol SLC12A3) confirms the kidney specificity. hTSC has been mapped to human chromosome 16q13 by fluorescence in situ hybridization. The cloning and characterization of hTSC now render it possible to study the involvement of this cotransport system in the pathogenesis of tubulopathies such as Gitelman syndrome. q 1996 Academic Press, Inc.
INTRODUCTION
Polarized kidney cells transport solutes and water from one side of the tubule to the other. Several mechanisms of ion transport are known. Among them, cotransport (or symport) of sodium and chloride, accompanied or not, by potassium represents the specific target for several diuretic agents (Breyer and Jacobson, Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession Nos. X91220 and U17344. 1 To whom correspondence should be addressed at Telethon Institute of Genetics and Medicine (Tigem), San Raffaele Biomedical Science Park, Via Olgettina 58, 20132 Milan, Italy. Telephone: 39-221560201. Fax: 39-2-21560220. E-mail: [email protected].
0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
Genom 4080
/
6r1b$$$221
1990). A few electroneutral (i.e., neutral net charge of anions and cations) cotransporters from different species have been characterized by biochemical means (Ellison et al., 1993; Forbush and Palfrey, 1983) or more recently by cDNA cloning (Gamba et al., 1993, 1994; Payne et al., 1995; Delpire et al., 1994; Payne and Forbush, 1994; Xu et al., 1994). A subclassification of the cotransporter family is obtained according to the nature of the carried cation (Na/ –Cl0 or Na/ –K/ –2Cl cotransporter), the specificity of interaction with different classes of inhibitors (bumetanide-sensitive cotransporter, BSC, or thiazidesensitive cotransporter, TSC), and the polarized localization of the transporter molecules inside the cytoplasmic membrane. Secretory epithelia, like salivary glands, expose cotransporters on their basolateral side, while in salt-absorbent epithelia, such as the nephron, cotransporter systems are found only on the apical membrane. Bumetanide-sensitive Na/ –K/ –2Cl cotransporters are present in two different isoforms, BSC1 and BSC2; the former is kidney-specific and shows a higher affinity for loop diuretics (Forbush and Palfrey, 1983), while the latter is more widely expressed (Delpire et al., 1994). The coding sequences of the Na–Cl thiazide-sensitive cotransporter (TSC) have been isolated and sequenced previously from winter flounder by functional cloning (Gamba et al., 1993) and later from rat by screening a kidney cDNA library with the flounder probe (Gamba et al., 1994). Na–Cl thiazide-sensitive cotransporter expression is strictly kidney-specific, and so far, no additional isoforms are known. Recently, it has been shown in the rat that TSC mRNA is detectable almost exclusively in the cortical portion of the kidney (Gamba et al., 1994), which harbors the distal convolute tubules, the site of thiazide diuretic action (Breyer and Jacobson, 1990). In the present study, we report the cloning, sequencing, expression pattern, and chromosomal localization of the human Na/ –Cl0 thiazide-sensitive cotrans-
486
07-12-96 12:04:31
gnma
AP: Genomics
HUMAN Na–Cl THIAZIDE-SENSITIVE COTRANSPORTER (SLC12A3)
porter gene.2 The possible role of this gene in the pathogenesis of kidney diseases such as Gitelman syndrome is also discussed. MATERIALS AND METHODS RT-PCR. Forward and reverse oligonucleotide primers were designed according to the rat cDNA sequence (Gamba et al., 1994) to obtain PCR amplification products, which were used as heterologous probes on human cDNA libraries. Total RNA (5 mg) isolated from rat renal cortex was reverse-transcribed at 377C for 1 h using random hexamers and the Moloney murine leukemia virus reverse transcriptase (Pharmacia). After ethanol precipitation, first-strand cDNA was dissolved in 20 ml water, and 1 ml was used as a template in a 25-ml PCR containing 1.5 mM MgCl2 , 100 ng each primer, 200 mM DNTPs, 67 mM Tris–HCl, pH 8.8, 16 mM (NH4)2SO4 , 0.1% NP-40, 0.1% Tween 20, 5 mM b-mercaptoethanol, with 1 unit of Taq DNA polymerase. PCR conditions were 35 cycles of 50 s at 947C, 50 s at 547C, and 50 s at 727C, after an initial denaturation of 2 min at 947C. The following oligonucleotide primers were used: rTz3, ACTACTACCAGACCATGAGC (nucleotides 1331–1350); rTz4, ATCACATAGAGCAGGAGGAA (nucleotides 1817–1798); rTz5, ATCTACTGGCTGTTTGA (nucleotides 2452–2471); and rTz6, TGAGGAGAACGGGAGGACTG (nucleotides 2977–2958). The reaction products were analyzed on a 1% agarose gel, purified with the Gel extraction kit (QIAGEN, Genenco), and analyzed by direct sequencing using the fmol DNA sequencing system (Promega). cDNA library screening. An adult kidney cDNA library, oligo(dT) and random examers primed (Clontech HL1123n), was plated at a density of 9 1 104 PFU/150-mm plate and screened using the two rat TSC PCR fragments 32P-labeled by random priming (T7QuickPrime kit by Pharmacia). Filters were hybridized in 61 SSC, 51 Denhardt, 0.1% SDS, 100 mg/ml heat denatured salmon sperm DNA for 16 h at 657C, washed twice in 21 SSC, 0.2% SDS at 657C for 20 min, and then exposed to autoradiographic film for 12–24 h. Eight positive clones were identified by screening 2 1 106 original plaques. Inserts were excised in vivo by coinfecting the positive clones with RF408 helper phage into Escherichia coli XL1-Blue cells, according to the manufacturer’s recommendation. The size of each clone was determined by PCR using both the vector and the above-mentioned rat oligonucleotide primers, as well as by Southern blot. Genomic library screening. A 180-bp PCR product at the 5* end of our cDNA clones was obtained with the oligonucleotide primers hTz49, CTTTGTGCAGCGGGCGCT (nucleotides 66–85), and hTz180, TGCTGTTGGCATAGTGCTCA (nucleotides 245–226), and was used to screen a human fibroblast genomic library (Clontech, 946204). Three positive clones were isolated under the hybridization and washing conditions already described. DNA sequencing. Inserts from clones 23.1, 22.1, and 2.1, spanning most of the TSC transcript, were subcloned into pBluescript SK(0) and automatically sequenced using the dye terminator chemistry (ABI–Perkin–Elmer protocol 901497 rev.E). The protocol has been modified to obtain longer sequences as follows: 1st cycle, 967C for 2 min and 15 s, 507C for 4 s, 607C for 4 min; 2nd–25th cycle, 967C for 15 s, 507C for 4 s, 607C for 4 min. All the cDNA clones have been sequenced according to the ‘‘2 / 1 rule’’: each region has been covered by sequence data from both orientations and one more orientation (refer to Genome Sequencing and Analysis Conference VI, 1994, Hilton Head, SC). A dye primer walking strategy was chosen and a set of 15 oligonucleotide primers was selected and used for the different reactions that were run, collected, and analyzed with ABISoftware Version 2.0.1 (Applied Biosystems–Perkin–Elmer) on an automated ABI 373A Stretch. The data were trimmed of ambiguities using Factura Software (Version 1.2.b6) according to these settings: Identify ambiguities (1/20/10% and confidence range 1–500 bp) and then assemble and edit with ABI Prism(t) AutoAssembler (Version 2 The HGMW-approved symbol for the gene described in this paper is SLC12A3.
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
487
1.4.b3). The genomic clones were directly sequenced by the dideoxynucleotide termination method using the fmol DNA sequencing system (Promega). Sequence and homology analysis. Multiple sequence alignments and primary structure analysis were performed with the GCG Wisconsin Sequence Analysis Package, Version 8.1 (Genetics Computers Group, Inc.). All the calculations were performed on a multiprocessor SUN SPARC station 20 computer. Database searches were performed using locally maintained GenBank/EMBL, Swissprot, and PIR databases. Northern blot analysis. A Northern blot (Clontech) containing approximately 2 mg of poly(A)/ RNA per lane from different human tissues was purchased and hybridized to different cDNA clones corresponding to the coding region of hTSC. All hybridizations were performed at 657C in 31 SSC, 51 Denhardt, 0.1% SDS, 100 mg/ml heat denatured salmon sperm DNA. The membranes were washed once at room temperature and twice at 657C with 21 SSC, 0.1% SDS for 20 min and then exposed to X-ray film (Kodak, XAR5) at 0707C. Fluorescence in situ hybridization. Fluorescence in situ hybridization (FISH) was performed as described in Rossi et al. (1993) on metaphases of two normal XY males using pYEUra23.1 as a probe, a pYEUra3 derivative resulting from the excision of the l clone 23.1. The biotin-16–UTP-labeled probe was hybridized at 377C overnight. Posthybridization washes were performed at both 37 and 427C in 50% formamide/21 SSC (31 5 min) and in 21 SSC (31 10 min). Detection was performed by incubating the slides with fluorescein isothiocyanate–avidin (ONCOR detection kit) according to the supplier’s instructions with two amplification steps. Chromosomes were counterstained with propidium iodide (1 mg/ml), banded with diamidinophenylindole (DAPI), and mounted on slides in anti-fading solution (Vectashield mounting medium; VECTOR). Hybridization analysis was performed on metaphases with no more than 10 signals.
RESULTS
Molecular Cloning Two rat cDNA probes, corresponding to nucleotides 1331–1817 and 2452–2977 of the Na–Cl thiazide-sensitive cotransporter coding sequences (Gamba et al., 1994), were obtained by RT–PCR on renal cortex cDNA. These PCR products were used as probes for the screening of a human adult kidney cDNA library. Eight positive clones were subjected to further analysis. Following subcloning into BlueScript vector, the nucleotide sequence was determined at both ends. Partial sequencing data were compared to the rat TSC cDNA to select the clones covering the entire coding sequence. The inserts contained in clones 23.1, 22.1, and 2.1 (Fig. 1) appeared to span the entire cDNA sequence, except for the extreme 5* end. As none of the other clones contained the 5* missing sequence, a human probe containing nucleotides 66–185 was obtained by PCR with primers hTz49 and hTz180 and used to screen a human genomic library. One of the three positive clones, HG9.1, was sequenced and revealed the 5* end of the cDNA, consisting of the first 14 amino acids of the coding sequence. The translation initiation point was positioned at the unique ATG codon by considering the striking homology between the human and the rat protein, both starting with aa MAELP. Complete sequencing of the 4211-bp cDNA sequences (Fig. 2) was performed on both strands, showing a
gnma
AP: Genomics
488
MASTROIANNI ET AL.
FIG. 1. Map of the overlapping clones spanning the entire hTSC cDNA sequence. Translation start (ATG) and stop (TAA) codons are indicated. Thick lines under the coding sequence represent the probes used for library screening: the human 5* probe (black) and two the rat probes (shaded) are shown (see Materials and Methods).
3063-bp open reading frame and 1122 bp of 3* noncoding sequences. The coding region starts with a consensus sequence, ACAATGGG, well conserved in higher eukaryotes (Kozak, 1989), in which the purine at position 03 and the G at position /4, with respect to the translation start site, are retained. A polyadenylation signal, AATAAA, is present at position 4158, close to the extreme 3* end of the cDNA sequence, although a poly(A) tail was not found on clone 2.1. Primary Structure and Homologies The predicted protein product of the hTSC cDNA spans 1021 amino acids with a calculated molecular weight of 112 kDa. The overall identity with the rat and flounder TSC polypeptides is strikingly high, reaching 94 and 78%, respectively. At the DNA level, the identity in the coding sequences is still high (87% between human and rat, 72% between human and flounder), decreasing to 60% in the 3*-untranslated region. The Kyte–Doolittle algorithm (Kyte and Doolittle, 1982) predicts a hydrophobicity/hydrophilicity pattern common to other cotransporters (Gamba et al., 1994) and mainly organized in three regions, with a hydrophobic middle area between two hydrophilic extremities. The general structure among the TSC and BSC cotransporters that have been isolated so far, both apical and basolateral, is quite well conserved, although it substantially diverges in the intracellular amino-terminal end, which is longer in the BSC protein family than in the TSC (Fig. 3). Twelve transmembrane domains (Fig. 2, underlined amino acid sequences), which are highly homologous to the previously reported cDNA sequences from flounder and rat, can be predicted in this region of the protein. The central hydrophobic area maintains a high degree of homology, even with bumetanide-sensitive Na–K– Cl cotransporters from different species. The largest
extracellular loop is between transmembrane domains 7 and 8, and it harbors two putative N-glycosylation sites (Fig. 2): N416 and N426 are conserved in all nine considered cotransporters (rTSC and rBSC (Gamba et al., 1994); flTSC (Gamba et al., 1993); rbBSC (also named NKCC2; Payne and Forbush, 1994); hBSC2 (also named hNKCC1; Payne et al., 1995); mBSC2 (also named mNKCC1; Delpire et al., 1994); sBSC2 (also named sNKCC1; Xu et al., 1994); msBSC (predicted protein sequence homologous to BSC), unpublished, GenBank Accession No. U17344), with the exception of rat TSC, which lacks the corresponding N426. The hydrophilic amino and carboxyl termini show several putative phosphorylation sites for different protein kinases (Fig. 2), some of which are common to rat TSC (Ser17, Ser126, and Thr908), while the PK-C consensus on Ser953 is conserved in the nine cotransporter sequences considered in the analysis. It is worth noting that Ser804 is contained in a 17-amino-acid stretch (aa 790–807) present in the flounder TSC (aa 782–806), but absent in the rat TSC. The serine in position 857 is a potential phosphorylation site for the cAMP-dependent protein kinase (Glass et al., 1986) located in the endocellular C-terminal domain. A homologous site for cAMP-PK is present on the human basolateral Na–K–2Cl cotransporter (Payne et al., 1995). Six casein kinase phosphorylation sites are present in the long intracellular carboxyl domain and resemble those reported in the mouse Na–K–Cl cotransporter (Delpire et al., 1994). Expression Pattern The expression pattern of hTSC mRNA was analyzed by Northern blotting in the following human tissues: heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. Hybridization with a hTSC cDNA probe spanning nucleotides 66–1959 identified an
FIG. 2. cDNA sequence of the human Na–Cl electroneutral thiazide-sensitive cotransporter (submitted to GenBank/EMBL Data Libraries under Accession No. X91220) with the deduced amino acids sequence. The poly(A) signal and the 12 transmembrane domains are underlined. Boldface amino acids represent putative glycosylation (N) or PK-C phosphorylation sites (S or T). Single underlined Ss or Ts represent casein kinase phosphorylation sites; starred S, cAMP-dependent protein kinase site.
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
gnma
AP: Genomics
AID
Genom 4080
/
6r1b$$4080
07-12-96 12:04:31
gnma
AP: Genomics
AID
Genom 4080
/
6r1b$$4080
07-12-96 12:04:31
gnma
AP: Genomics
HUMAN Na–Cl THIAZIDE-SENSITIVE COTRANSPORTER (SLC12A3)
FIG. 4. Northern blot of human tissues: h, heart; b, brain; pl, placenta; l, lung; li, liver; sk, skeletal muscle; k, kidney; p, pancreas. The molecular weight markers are shown to the left in kilobases. An abundant kidney-specific transcript of 4.4 kb is shown.
abundant transcript in the kidney, measuring approximately 4.4 kb (Fig. 4). The transcript size is consistent with that predicted from the cDNA contig. An additional weaker band, measuring 6.5 kb, can be detected in kidney RNA. At this time, we cannot establish whether this less abundant transcript derives from alternative splicing or from the usage of a different polyadenylation signal, resulting in a longer 3*-untranslated region. No signals were detected in the other tissues even after several days of exposure, thus confirming the kidney-specific expression pattern of hTSC. Chromosomal Localization In situ hybridization with probe 23.1 revealed a specific signal on the long arm of chromosome 16, at band 16q13. A total of 127 specific signals were detected on the 40 suitable metaphases analyzed after posthybridization washes at 427C, 56 of which were localized at 16q13 (Fig. 5). Ninety-five metaphases were analyzed at lower stringency (377C), resulting in a total of 209 specific signals, 84 of which were localized at 16q13. No other clusters of signals were found. DISCUSSION
Na–(K)–Cl electroneutral cotransporters promote the movement of chloride across the membrane of ab-
491
sorptive or secretory epithelial cells, contributing to the maintenance of electrolyte homeostasis. Several diuretic agents, such as loop diuretics and thiazide derivatives, increase salt excretion by specifically interacting and inhibiting cotransporter molecules. Loop diuretics bumetanide and furosemide exert their action in the thick ascending limb of the Henle’s loop by blocking the renal apical Na–K–2Cl cotransporter (BSC) with high affinity (Forbush and Palfrey, 1983). In nonabsorptive or secretory tissues, bumetanide inhibits the basolateral isoform of the Na–K–2Cl cotransporter (BSC2) with lower affinity than the renal isoform (Palfrey and O’Donnell, 1992). Here we report the cloning, expression pattern, and chromosomal location of the human Na–Cl thiazidesensitive cotransporter hTSC. Sequence analysis of hTSC cDNA revealed a deduced protein sequence of 1021 aa and 112 kDa, characterized by three major domains: two hydrophilic amino- and carboxyl-termini domains and a hydrophobic region in the middle part of the protein. Twelve transmembrane domains are predicted in this hydrophobic region, while the two intracellular hydrophilic extremities show several putative phosphorylation sites. hTSC shows extensive homologies with Na–(K)–Cl cotransporters cloned from very distantly related species such as mammals, fish, insects, and yeast. This family of proteins shares the primary structure divided in three major domains, with hydrophilic extremities and a hydrophobic middle portion. The multiple alignment of these protein sequences shows three main groups of closer homology structure: the thiazide-sensitive TSC isoforms; the renal apical bumetanide-sensitive BSC isoforms; and the ubiquitary basolateral bumetanide-sensitive BSC2 isoforms. Electroneutral cotransporters are a class of proteins highly conserved during evolution. The divergence of the primary structure of cotransporters, earlier between TSC and BSC and later between BSC1 and BSC2, seems to precede speciation, at least in vertebrates (Leid et al., 1992). The protein sequence divergence among the three groups is mainly localized in the amino-terminal portion and in the extracellular loops intercalated among the transmembrane domains in the middle region. Differences residing in the amino-terminal end could originate from the need for proper regulation of activity of the particular cotransporter; phosphorylation of the consensus site in this portion could regulate the cotransporter activity by intracellular mechanisms (Lytle and Forbush, 1992). The differences in the extracellular loops among the three cotransporter subgroups could be related to the affinity difference of cotransporters toward diuretic agents. In par-
FIG. 3. Multiple sequence alignment of Na–(K)–Cl cotransporter proteins: hTSC, rTSC, and flTSC denote human, rat, and flounder thiazide-sensitive cotransporter, respectively; rBSC and rbBSC (NKCC2) denote rat and rabbit apical bumetanide-sensitive cotransporter; hBSC2 (hNKCC1), mBSC2 (mNKCC1), and sBSC2 (sNKCC1) denote human, mouse, and spiny dogfish basolateral bumetanide-sensitive cotransporter; msBSC denotes manduca sexta bumetanide-sensitive cotransporter (predicted protein sequence homologous to BSC). Shaded boxes indicate amino acid identities.
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
gnma
AP: Genomics
492
MASTROIANNI ET AL.
FIG. 5. (a, c) FISH analysis using hTSC cDNA clone pYEUra23.1 to 46,XY metaphases. The results show specific hybridization signals at 16q13 (a, c), as identified by DAPI staining in the corresponding metaphases (b, d).
ticular, the first (aa 157–165), third (aa 307–339), and sixth (aa 582–584) extracellular loops are different in TSC and BSC, but maintain a complete conservation within each group. The expression pattern of the human TSC, like the rat homologue, confirms the complete kidney specificity of this ion transport system. Nonrenal TSC isoforms are not known. In the distal tubule, the site of action of thiazide diuretics, the main cotransporter system is the apical Na–Cl cotransporter (TSC), which is selectively blocked by thiazide diuretics (Breyer and Jacobson, 1990). The presence of a hereditary defect of the distal tubule accounts for the clinical features of Gitelman syndrome, an autosomal recessive disease (Gitelman et al., 1966; Bettinelli et al., 1992; Rodriguez-Soriano et al., 1987). Hypocalciuria, metabolic alkalosis, and hypomagnesemia and hypokalemia of renal tubular origin are the biochemical hallmarks, which provoke frequent tetanic episodes and muscular weakness. The distal tubule abnormalities in Gitelman syndrome resemble the effects of chronic administration of thiazide diuretics: the dissociation of renal calcium from magnesium transport, the moderate degree of sodium, chloride, and potassium wasting, and the exaggerated natriuresis and kaliuresis after furosemide administration (Bettinelli et al., 1992; Rodriguez-Soriano et al., 1987; Sutton et al., 1992). Furthermore, Gitelman syndrome patients do not respond to intravenous chlorothiazide, indicating that the Na–Cl cotransporter plays a major role in the pathogenesis of this kidney disease (Sutton et al., 1992).
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
FISH analysis assigned the hTSC gene to the long arm of human chromosome 16q13, a region harboring the metallothionein genes (West et al., 1990) and the Bardet–Bidle syndrome-associated gene (Kwitek-Black et al., 1993). This human chromosome region is syntenic to mouse chromosome 8 and rat chromosome 2. Linkage and mutation studies will clarify the role of the human TSC in the pathogenesis of distal tubulopathies such as Gitelman syndrome. Furthermore, important information on the interaction between the cotransporter and the diuretic agent could be obtained through the expression of hTSC protein in the eukaryotic system, properly mutagenized on the extracellular or regulatory domains, possibly leading to the design of new and more active drugs. ACKNOWLEDGMENTS We thank Dr. Monica Repetto and Massimo Littardi for technical assistance in sequencing reactions. N.M. is the recipient of a grant from Associazione per il Bambino Nefropatico, Milan. Note added in proof. During the reviewing process of this paper, Simon et al. reported data demonstrating that the Na–Cl cotransporter gene is responsible for Gitelman syndrome, and we found several mutations in the hTSC gene of Gitelman syndrome patients, including missense, point deletion, and insertion mutations, in either the homozygous state or the compound heterozygous state (data not shown).
REFERENCES Bettinelli, A., Bianchetti, M. G., Girardin, E., Caringella, A., Cecconi, M., Claris Appiani, A., Pavanello, L., Gastaldi, R., Isimbardi, C.,
gnma
AP: Genomics
HUMAN Na–Cl THIAZIDE-SENSITIVE COTRANSPORTER (SLC12A3) Lama, G., Marchesoni, C., Matteucci, C., Patriarca, C., Di Natale, B., Setzu, C., and Vitucci, P. (1992). Use of calcium excretion values to distinguish two forms of primary renal tubular hypocalemic alkalosis: Bartter and Gitelman syndromes. J. Pediatr. 120: 38– 43. Breyer, J., and Jacobson, H. R. (1990). Molecular mechanisms of diuretic agents. Annu. Rev. Med. 41: 265–275. Delpire, E., Rauchman, M. I., Beier, D. R., Hebert, S. C., and Gullans, S. R. (1994). Molecular cloning and chromosome localization of a putative basolateral Na–K–2Cl cotransporter from mouse inner medullary collecting duct (mIMCD-3) cells. J. Biol. Chem. 269: 25677–25683. Ellison, D. H., Biemesderfer, D., Morrisey, J., Lauring, J., and Desir, G. (1993). Immunocytochemical characterization of the high-affinity thiazide diuretic receptor in rabbit renal cortex. Am. J. Physiol. 264: F141–F148. Feng, D.-F., and Doolittle, R. F. (1987). Progressive sequence alignment as a prerequisite to correct phylogenetic trees. J. Mol. Evol. 25: 351–360. Forbush, B. I., and Palfrey, H. C. (1983). [3H]Bumetanide binding to membranes isolated from dog kidney outer medulla. Relationship to the Na,K,Cl co-transport system. J. Biol. Chem. 258: 11787– 1792. Gamba, G., Saltzberg, S. N., Lombardi, M., Miyanoshita, A., Lytton, J., Hediger, M. A., Brenner, B. M., and Hebert, S. C. (1993). Primary structure and functional expression of a cDNA encoding the thiazide-sensitive, electroneutral sodium-chloride cotransporter. Proc. Natl. Acad. Sci. USA 90: 2749–2753. Gamba, G., Miyanoshita, A., Lombardi, M., Lytton, J., Lee, W.-S., Hediger, M. A., and Hebert, S. C. (1994). Molecular cloning, primary structure and characterization of two members of the mammalian electroneutral sodium–(potassium)–chloride cotransporter family expressed in kidney. J. Biol. Chem. 269: 17713– 17722. Gitelman, H. J., Graham, J. B., and Melt, L. G. (1966). A new familial disorder characterized by hypokalemia and hypomagnesemia. Trans. Assoc. Am. Physicians 79: 221–235. Glass, D. B., El-Maghrabi, M. R., and Pilkis, S. J. (1986). Synthetic peptides corresponding to the site phoshorylated in 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase as substrates of cyclic nucleotide-dependent protein kinases. J. Biol. Chem. 261: 2987– 2993. Kozak, M. (1989). The scanning model for translation: An update. J. Cell Biol. 108: 229–241. Kwitek-Black, A. E., R., C., Duyk, G. M., et al. (1993). Genetic mapping of the gene for Bardet–Bidle syndrome to 16q21 in a large inbred pedigree. Am. J. Hum. Genet. 53: 139. Kyte, J. P., and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105–132. Leid, M., Kastner, P., and Chambon, P. (1992). Multiplicity generates
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
493
diversity in the retinoic acid signalling pathways. Trends Biochem. Sci. 17: 427–433. Lytle, C., and Forbush, B., III (1992). The Na–K–Cl cotransport protein of shark rectal gland. Regulation by direct phosphorylation. J. Biol. Chem. 267: 25438–25443. Palfrey, H. C., and O’Donnell, M. E. (1992). Cell. Physiol. Biochem. 2: 293–307. Payne, J. A., and Forbush, B. I. (1994). Alternatively spliced isoforms of the putative renal Na–K–Cl cotransporter are differentially distributed within the rabbit kidney. Proc. Natl. Acad. Sci. USA 91: 4544–4548. Payne, J. A., Xu, J.-C., Haas, M., Lytle, C. Y., Ward, D., and Forbush, B. I. (1995). Primary structure, functional expression, and chromosomal localization of the bumetanide-sensitive Na–K–Cl cotransporter in human colon. J. Biol. Chem. 270: 17977–17985. Rodriguez-Soriano, J., Vallo, A., and Garcia-Fuentes, M. (1987). Hypomagnesemia of hereditary renal origin. Pediatr. Nephrol. 1: 465– 472. Rossi, E., Zarrilli, R., and Zuffardi, O. (1993). Regional assignment of the gene coding for a human Graves’ disease autoantigen to 10q21.3–q22.1. Hum. Genet. 90: 653–654. Simon, D. B., Nelson-Williams, C., Johnson Bia, M., Ellison, D., Karet, F. E., Morey Molina, A., Vaara, I., Iwata, F., Cushner, H. M., Koolen, M., Gainza, F. J., Gitelman, H. J., and Lifton, R. P. (1996). Gitelman’s variant of Bartter’s syndrome, inherited hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive Na–Cl cotransporter. Nature Genet. 12: 24–30. Sutton, R. A. L. (1985). Diuretics and calcium metabolism. Am. J. Kidney Dis. 5: 4–9. Sutton, R. A. L., Mavichak, V., Halabe, A., and Wilkins, G. E. (1992). Bartter’s syndrome: Evidence suggesting a distal tubular defect in a hypocalciuric variant of the syndrome. Miner. Electrolyte Metab. 18: 43–51. West, A. K., Stallings, R., Hildebrand, C. E., Chiu, R., Karin, M., and Richards, R. I. (1990). Human metallothionein genes: Structure of a functional locus at 16q13. Genomics 8: 513–518. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., Burton, J., Connell, M., Copsey, T., Cooper, J., Coulson, A., Craxton, M., Dear, S., Du, Z., Durbin, R., Favello, A., Fraser, A., Fulton, L., Gardner, A., Green, P., Hawkins, T., Hillier, L., Jier, M., Johnston, L., Jones, M., Kershaw, J., Kirsten, J., Laisster, N., Latreille, P., Lightning, J., Lloyd, C., Mortimore, B., O’Callaghan, M., Parsons, J., Percy, C., Rifken, L., Roopra, A., Saunders, D., Shownkeen, R., Sims, M., Smaldon, N., Smith, A., Smith, M., Sonnahammer, E., Staden, R., Sulston, J., Thierry-Mieg, J., Thomas, K., Vaudin, M., Vaughan, K., Waterston, R., Watson, A., Weinstock, L., Wilkinson-Sproat, J., and Wohldman, P. (1994). 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368: 32–38. Xu, J., Lytle, C., Zhu, T. T., Payne, J. A., Benz, E., and Forbush, B. I. (1994). Molecular cloning and functional expression of the bumetanide-sensitive Na–K–Cl cotransporter. Proc. Natl. Sci. USA 91: 2201–2205.
gnma
AP: Genomics
35, 486–493 (1996) 0388
ARTICLE NO.
Molecular Cloning, Expression Pattern, and Chromosomal Localization of the Human Na–Cl Thiazide-Sensitive Cotransporter (SLC12A3) NADIA MASTROIANNI,*,† MAURIZIO DE FUSCO,* MASSIMO ZOLLO,* GIULIA ARRIGO,‡ ORSETTA ZUFFARDI,‡,§ ALBERTO BETTINELLI,† ANDREA BALLABIO,*,Ø AND GIORGIO CASARI*,1 *Telethon Institute of Genetics and Medicine (Tigem), San Raffaele Biomedical Science Park, 20132 Milan, Italy; †Clinica Pediatrica II, University of Milan, 20122 Milan, Italy; ‡Laboratorio di Citogenetica, San Raffaele Hospital, Milan, Italy; §Istituto di Biologia Generale e Genetica Medica, Pavia, Italy; and ØDepartment of Molecular Biology, University of Siena, 53100 Siena, Italy Received February 5, 1996; accepted March 5, 1996
Electrolyte homeostasis is maintained by several ion transport systems. Na–(K)–Cl cotransporters promote the electrically silent movement of chloride across the membrane in absorptive and secretory epithelia. Two kidney-specific Na–(K)–Cl cotransporter isoforms are known, so far, according to their sensitivity to specific inhibitors. We have cloned the human cDNA coding for the renal Na–Cl cotransporter selectively inhibited by the thiazide class of diuretic agents. The predicted protein sequence of 1021 amino acids (112 kDa) shows a structure common to the other members of the Na– (K)–Cl cotransporter family: a central region harboring 12 transmembrane domains and the 2 intracellular hydrophilic amino and carboxyl termini. The expression pattern of the human Na–Cl thiazide-sensitive cotransporter (hTSC, HGMW-approved symbol SLC12A3) confirms the kidney specificity. hTSC has been mapped to human chromosome 16q13 by fluorescence in situ hybridization. The cloning and characterization of hTSC now render it possible to study the involvement of this cotransport system in the pathogenesis of tubulopathies such as Gitelman syndrome. q 1996 Academic Press, Inc.
INTRODUCTION
Polarized kidney cells transport solutes and water from one side of the tubule to the other. Several mechanisms of ion transport are known. Among them, cotransport (or symport) of sodium and chloride, accompanied or not, by potassium represents the specific target for several diuretic agents (Breyer and Jacobson, Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession Nos. X91220 and U17344. 1 To whom correspondence should be addressed at Telethon Institute of Genetics and Medicine (Tigem), San Raffaele Biomedical Science Park, Via Olgettina 58, 20132 Milan, Italy. Telephone: 39-221560201. Fax: 39-2-21560220. E-mail: [email protected].
0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
Genom 4080
/
6r1b$$$221
1990). A few electroneutral (i.e., neutral net charge of anions and cations) cotransporters from different species have been characterized by biochemical means (Ellison et al., 1993; Forbush and Palfrey, 1983) or more recently by cDNA cloning (Gamba et al., 1993, 1994; Payne et al., 1995; Delpire et al., 1994; Payne and Forbush, 1994; Xu et al., 1994). A subclassification of the cotransporter family is obtained according to the nature of the carried cation (Na/ –Cl0 or Na/ –K/ –2Cl cotransporter), the specificity of interaction with different classes of inhibitors (bumetanide-sensitive cotransporter, BSC, or thiazidesensitive cotransporter, TSC), and the polarized localization of the transporter molecules inside the cytoplasmic membrane. Secretory epithelia, like salivary glands, expose cotransporters on their basolateral side, while in salt-absorbent epithelia, such as the nephron, cotransporter systems are found only on the apical membrane. Bumetanide-sensitive Na/ –K/ –2Cl cotransporters are present in two different isoforms, BSC1 and BSC2; the former is kidney-specific and shows a higher affinity for loop diuretics (Forbush and Palfrey, 1983), while the latter is more widely expressed (Delpire et al., 1994). The coding sequences of the Na–Cl thiazide-sensitive cotransporter (TSC) have been isolated and sequenced previously from winter flounder by functional cloning (Gamba et al., 1993) and later from rat by screening a kidney cDNA library with the flounder probe (Gamba et al., 1994). Na–Cl thiazide-sensitive cotransporter expression is strictly kidney-specific, and so far, no additional isoforms are known. Recently, it has been shown in the rat that TSC mRNA is detectable almost exclusively in the cortical portion of the kidney (Gamba et al., 1994), which harbors the distal convolute tubules, the site of thiazide diuretic action (Breyer and Jacobson, 1990). In the present study, we report the cloning, sequencing, expression pattern, and chromosomal localization of the human Na/ –Cl0 thiazide-sensitive cotrans-
486
07-12-96 12:04:31
gnma
AP: Genomics
HUMAN Na–Cl THIAZIDE-SENSITIVE COTRANSPORTER (SLC12A3)
porter gene.2 The possible role of this gene in the pathogenesis of kidney diseases such as Gitelman syndrome is also discussed. MATERIALS AND METHODS RT-PCR. Forward and reverse oligonucleotide primers were designed according to the rat cDNA sequence (Gamba et al., 1994) to obtain PCR amplification products, which were used as heterologous probes on human cDNA libraries. Total RNA (5 mg) isolated from rat renal cortex was reverse-transcribed at 377C for 1 h using random hexamers and the Moloney murine leukemia virus reverse transcriptase (Pharmacia). After ethanol precipitation, first-strand cDNA was dissolved in 20 ml water, and 1 ml was used as a template in a 25-ml PCR containing 1.5 mM MgCl2 , 100 ng each primer, 200 mM DNTPs, 67 mM Tris–HCl, pH 8.8, 16 mM (NH4)2SO4 , 0.1% NP-40, 0.1% Tween 20, 5 mM b-mercaptoethanol, with 1 unit of Taq DNA polymerase. PCR conditions were 35 cycles of 50 s at 947C, 50 s at 547C, and 50 s at 727C, after an initial denaturation of 2 min at 947C. The following oligonucleotide primers were used: rTz3, ACTACTACCAGACCATGAGC (nucleotides 1331–1350); rTz4, ATCACATAGAGCAGGAGGAA (nucleotides 1817–1798); rTz5, ATCTACTGGCTGTTTGA (nucleotides 2452–2471); and rTz6, TGAGGAGAACGGGAGGACTG (nucleotides 2977–2958). The reaction products were analyzed on a 1% agarose gel, purified with the Gel extraction kit (QIAGEN, Genenco), and analyzed by direct sequencing using the fmol DNA sequencing system (Promega). cDNA library screening. An adult kidney cDNA library, oligo(dT) and random examers primed (Clontech HL1123n), was plated at a density of 9 1 104 PFU/150-mm plate and screened using the two rat TSC PCR fragments 32P-labeled by random priming (T7QuickPrime kit by Pharmacia). Filters were hybridized in 61 SSC, 51 Denhardt, 0.1% SDS, 100 mg/ml heat denatured salmon sperm DNA for 16 h at 657C, washed twice in 21 SSC, 0.2% SDS at 657C for 20 min, and then exposed to autoradiographic film for 12–24 h. Eight positive clones were identified by screening 2 1 106 original plaques. Inserts were excised in vivo by coinfecting the positive clones with RF408 helper phage into Escherichia coli XL1-Blue cells, according to the manufacturer’s recommendation. The size of each clone was determined by PCR using both the vector and the above-mentioned rat oligonucleotide primers, as well as by Southern blot. Genomic library screening. A 180-bp PCR product at the 5* end of our cDNA clones was obtained with the oligonucleotide primers hTz49, CTTTGTGCAGCGGGCGCT (nucleotides 66–85), and hTz180, TGCTGTTGGCATAGTGCTCA (nucleotides 245–226), and was used to screen a human fibroblast genomic library (Clontech, 946204). Three positive clones were isolated under the hybridization and washing conditions already described. DNA sequencing. Inserts from clones 23.1, 22.1, and 2.1, spanning most of the TSC transcript, were subcloned into pBluescript SK(0) and automatically sequenced using the dye terminator chemistry (ABI–Perkin–Elmer protocol 901497 rev.E). The protocol has been modified to obtain longer sequences as follows: 1st cycle, 967C for 2 min and 15 s, 507C for 4 s, 607C for 4 min; 2nd–25th cycle, 967C for 15 s, 507C for 4 s, 607C for 4 min. All the cDNA clones have been sequenced according to the ‘‘2 / 1 rule’’: each region has been covered by sequence data from both orientations and one more orientation (refer to Genome Sequencing and Analysis Conference VI, 1994, Hilton Head, SC). A dye primer walking strategy was chosen and a set of 15 oligonucleotide primers was selected and used for the different reactions that were run, collected, and analyzed with ABISoftware Version 2.0.1 (Applied Biosystems–Perkin–Elmer) on an automated ABI 373A Stretch. The data were trimmed of ambiguities using Factura Software (Version 1.2.b6) according to these settings: Identify ambiguities (1/20/10% and confidence range 1–500 bp) and then assemble and edit with ABI Prism(t) AutoAssembler (Version 2 The HGMW-approved symbol for the gene described in this paper is SLC12A3.
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
487
1.4.b3). The genomic clones were directly sequenced by the dideoxynucleotide termination method using the fmol DNA sequencing system (Promega). Sequence and homology analysis. Multiple sequence alignments and primary structure analysis were performed with the GCG Wisconsin Sequence Analysis Package, Version 8.1 (Genetics Computers Group, Inc.). All the calculations were performed on a multiprocessor SUN SPARC station 20 computer. Database searches were performed using locally maintained GenBank/EMBL, Swissprot, and PIR databases. Northern blot analysis. A Northern blot (Clontech) containing approximately 2 mg of poly(A)/ RNA per lane from different human tissues was purchased and hybridized to different cDNA clones corresponding to the coding region of hTSC. All hybridizations were performed at 657C in 31 SSC, 51 Denhardt, 0.1% SDS, 100 mg/ml heat denatured salmon sperm DNA. The membranes were washed once at room temperature and twice at 657C with 21 SSC, 0.1% SDS for 20 min and then exposed to X-ray film (Kodak, XAR5) at 0707C. Fluorescence in situ hybridization. Fluorescence in situ hybridization (FISH) was performed as described in Rossi et al. (1993) on metaphases of two normal XY males using pYEUra23.1 as a probe, a pYEUra3 derivative resulting from the excision of the l clone 23.1. The biotin-16–UTP-labeled probe was hybridized at 377C overnight. Posthybridization washes were performed at both 37 and 427C in 50% formamide/21 SSC (31 5 min) and in 21 SSC (31 10 min). Detection was performed by incubating the slides with fluorescein isothiocyanate–avidin (ONCOR detection kit) according to the supplier’s instructions with two amplification steps. Chromosomes were counterstained with propidium iodide (1 mg/ml), banded with diamidinophenylindole (DAPI), and mounted on slides in anti-fading solution (Vectashield mounting medium; VECTOR). Hybridization analysis was performed on metaphases with no more than 10 signals.
RESULTS
Molecular Cloning Two rat cDNA probes, corresponding to nucleotides 1331–1817 and 2452–2977 of the Na–Cl thiazide-sensitive cotransporter coding sequences (Gamba et al., 1994), were obtained by RT–PCR on renal cortex cDNA. These PCR products were used as probes for the screening of a human adult kidney cDNA library. Eight positive clones were subjected to further analysis. Following subcloning into BlueScript vector, the nucleotide sequence was determined at both ends. Partial sequencing data were compared to the rat TSC cDNA to select the clones covering the entire coding sequence. The inserts contained in clones 23.1, 22.1, and 2.1 (Fig. 1) appeared to span the entire cDNA sequence, except for the extreme 5* end. As none of the other clones contained the 5* missing sequence, a human probe containing nucleotides 66–185 was obtained by PCR with primers hTz49 and hTz180 and used to screen a human genomic library. One of the three positive clones, HG9.1, was sequenced and revealed the 5* end of the cDNA, consisting of the first 14 amino acids of the coding sequence. The translation initiation point was positioned at the unique ATG codon by considering the striking homology between the human and the rat protein, both starting with aa MAELP. Complete sequencing of the 4211-bp cDNA sequences (Fig. 2) was performed on both strands, showing a
gnma
AP: Genomics
488
MASTROIANNI ET AL.
FIG. 1. Map of the overlapping clones spanning the entire hTSC cDNA sequence. Translation start (ATG) and stop (TAA) codons are indicated. Thick lines under the coding sequence represent the probes used for library screening: the human 5* probe (black) and two the rat probes (shaded) are shown (see Materials and Methods).
3063-bp open reading frame and 1122 bp of 3* noncoding sequences. The coding region starts with a consensus sequence, ACAATGGG, well conserved in higher eukaryotes (Kozak, 1989), in which the purine at position 03 and the G at position /4, with respect to the translation start site, are retained. A polyadenylation signal, AATAAA, is present at position 4158, close to the extreme 3* end of the cDNA sequence, although a poly(A) tail was not found on clone 2.1. Primary Structure and Homologies The predicted protein product of the hTSC cDNA spans 1021 amino acids with a calculated molecular weight of 112 kDa. The overall identity with the rat and flounder TSC polypeptides is strikingly high, reaching 94 and 78%, respectively. At the DNA level, the identity in the coding sequences is still high (87% between human and rat, 72% between human and flounder), decreasing to 60% in the 3*-untranslated region. The Kyte–Doolittle algorithm (Kyte and Doolittle, 1982) predicts a hydrophobicity/hydrophilicity pattern common to other cotransporters (Gamba et al., 1994) and mainly organized in three regions, with a hydrophobic middle area between two hydrophilic extremities. The general structure among the TSC and BSC cotransporters that have been isolated so far, both apical and basolateral, is quite well conserved, although it substantially diverges in the intracellular amino-terminal end, which is longer in the BSC protein family than in the TSC (Fig. 3). Twelve transmembrane domains (Fig. 2, underlined amino acid sequences), which are highly homologous to the previously reported cDNA sequences from flounder and rat, can be predicted in this region of the protein. The central hydrophobic area maintains a high degree of homology, even with bumetanide-sensitive Na–K– Cl cotransporters from different species. The largest
extracellular loop is between transmembrane domains 7 and 8, and it harbors two putative N-glycosylation sites (Fig. 2): N416 and N426 are conserved in all nine considered cotransporters (rTSC and rBSC (Gamba et al., 1994); flTSC (Gamba et al., 1993); rbBSC (also named NKCC2; Payne and Forbush, 1994); hBSC2 (also named hNKCC1; Payne et al., 1995); mBSC2 (also named mNKCC1; Delpire et al., 1994); sBSC2 (also named sNKCC1; Xu et al., 1994); msBSC (predicted protein sequence homologous to BSC), unpublished, GenBank Accession No. U17344), with the exception of rat TSC, which lacks the corresponding N426. The hydrophilic amino and carboxyl termini show several putative phosphorylation sites for different protein kinases (Fig. 2), some of which are common to rat TSC (Ser17, Ser126, and Thr908), while the PK-C consensus on Ser953 is conserved in the nine cotransporter sequences considered in the analysis. It is worth noting that Ser804 is contained in a 17-amino-acid stretch (aa 790–807) present in the flounder TSC (aa 782–806), but absent in the rat TSC. The serine in position 857 is a potential phosphorylation site for the cAMP-dependent protein kinase (Glass et al., 1986) located in the endocellular C-terminal domain. A homologous site for cAMP-PK is present on the human basolateral Na–K–2Cl cotransporter (Payne et al., 1995). Six casein kinase phosphorylation sites are present in the long intracellular carboxyl domain and resemble those reported in the mouse Na–K–Cl cotransporter (Delpire et al., 1994). Expression Pattern The expression pattern of hTSC mRNA was analyzed by Northern blotting in the following human tissues: heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. Hybridization with a hTSC cDNA probe spanning nucleotides 66–1959 identified an
FIG. 2. cDNA sequence of the human Na–Cl electroneutral thiazide-sensitive cotransporter (submitted to GenBank/EMBL Data Libraries under Accession No. X91220) with the deduced amino acids sequence. The poly(A) signal and the 12 transmembrane domains are underlined. Boldface amino acids represent putative glycosylation (N) or PK-C phosphorylation sites (S or T). Single underlined Ss or Ts represent casein kinase phosphorylation sites; starred S, cAMP-dependent protein kinase site.
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
gnma
AP: Genomics
AID
Genom 4080
/
6r1b$$4080
07-12-96 12:04:31
gnma
AP: Genomics
AID
Genom 4080
/
6r1b$$4080
07-12-96 12:04:31
gnma
AP: Genomics
HUMAN Na–Cl THIAZIDE-SENSITIVE COTRANSPORTER (SLC12A3)
FIG. 4. Northern blot of human tissues: h, heart; b, brain; pl, placenta; l, lung; li, liver; sk, skeletal muscle; k, kidney; p, pancreas. The molecular weight markers are shown to the left in kilobases. An abundant kidney-specific transcript of 4.4 kb is shown.
abundant transcript in the kidney, measuring approximately 4.4 kb (Fig. 4). The transcript size is consistent with that predicted from the cDNA contig. An additional weaker band, measuring 6.5 kb, can be detected in kidney RNA. At this time, we cannot establish whether this less abundant transcript derives from alternative splicing or from the usage of a different polyadenylation signal, resulting in a longer 3*-untranslated region. No signals were detected in the other tissues even after several days of exposure, thus confirming the kidney-specific expression pattern of hTSC. Chromosomal Localization In situ hybridization with probe 23.1 revealed a specific signal on the long arm of chromosome 16, at band 16q13. A total of 127 specific signals were detected on the 40 suitable metaphases analyzed after posthybridization washes at 427C, 56 of which were localized at 16q13 (Fig. 5). Ninety-five metaphases were analyzed at lower stringency (377C), resulting in a total of 209 specific signals, 84 of which were localized at 16q13. No other clusters of signals were found. DISCUSSION
Na–(K)–Cl electroneutral cotransporters promote the movement of chloride across the membrane of ab-
491
sorptive or secretory epithelial cells, contributing to the maintenance of electrolyte homeostasis. Several diuretic agents, such as loop diuretics and thiazide derivatives, increase salt excretion by specifically interacting and inhibiting cotransporter molecules. Loop diuretics bumetanide and furosemide exert their action in the thick ascending limb of the Henle’s loop by blocking the renal apical Na–K–2Cl cotransporter (BSC) with high affinity (Forbush and Palfrey, 1983). In nonabsorptive or secretory tissues, bumetanide inhibits the basolateral isoform of the Na–K–2Cl cotransporter (BSC2) with lower affinity than the renal isoform (Palfrey and O’Donnell, 1992). Here we report the cloning, expression pattern, and chromosomal location of the human Na–Cl thiazidesensitive cotransporter hTSC. Sequence analysis of hTSC cDNA revealed a deduced protein sequence of 1021 aa and 112 kDa, characterized by three major domains: two hydrophilic amino- and carboxyl-termini domains and a hydrophobic region in the middle part of the protein. Twelve transmembrane domains are predicted in this hydrophobic region, while the two intracellular hydrophilic extremities show several putative phosphorylation sites. hTSC shows extensive homologies with Na–(K)–Cl cotransporters cloned from very distantly related species such as mammals, fish, insects, and yeast. This family of proteins shares the primary structure divided in three major domains, with hydrophilic extremities and a hydrophobic middle portion. The multiple alignment of these protein sequences shows three main groups of closer homology structure: the thiazide-sensitive TSC isoforms; the renal apical bumetanide-sensitive BSC isoforms; and the ubiquitary basolateral bumetanide-sensitive BSC2 isoforms. Electroneutral cotransporters are a class of proteins highly conserved during evolution. The divergence of the primary structure of cotransporters, earlier between TSC and BSC and later between BSC1 and BSC2, seems to precede speciation, at least in vertebrates (Leid et al., 1992). The protein sequence divergence among the three groups is mainly localized in the amino-terminal portion and in the extracellular loops intercalated among the transmembrane domains in the middle region. Differences residing in the amino-terminal end could originate from the need for proper regulation of activity of the particular cotransporter; phosphorylation of the consensus site in this portion could regulate the cotransporter activity by intracellular mechanisms (Lytle and Forbush, 1992). The differences in the extracellular loops among the three cotransporter subgroups could be related to the affinity difference of cotransporters toward diuretic agents. In par-
FIG. 3. Multiple sequence alignment of Na–(K)–Cl cotransporter proteins: hTSC, rTSC, and flTSC denote human, rat, and flounder thiazide-sensitive cotransporter, respectively; rBSC and rbBSC (NKCC2) denote rat and rabbit apical bumetanide-sensitive cotransporter; hBSC2 (hNKCC1), mBSC2 (mNKCC1), and sBSC2 (sNKCC1) denote human, mouse, and spiny dogfish basolateral bumetanide-sensitive cotransporter; msBSC denotes manduca sexta bumetanide-sensitive cotransporter (predicted protein sequence homologous to BSC). Shaded boxes indicate amino acid identities.
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
gnma
AP: Genomics
492
MASTROIANNI ET AL.
FIG. 5. (a, c) FISH analysis using hTSC cDNA clone pYEUra23.1 to 46,XY metaphases. The results show specific hybridization signals at 16q13 (a, c), as identified by DAPI staining in the corresponding metaphases (b, d).
ticular, the first (aa 157–165), third (aa 307–339), and sixth (aa 582–584) extracellular loops are different in TSC and BSC, but maintain a complete conservation within each group. The expression pattern of the human TSC, like the rat homologue, confirms the complete kidney specificity of this ion transport system. Nonrenal TSC isoforms are not known. In the distal tubule, the site of action of thiazide diuretics, the main cotransporter system is the apical Na–Cl cotransporter (TSC), which is selectively blocked by thiazide diuretics (Breyer and Jacobson, 1990). The presence of a hereditary defect of the distal tubule accounts for the clinical features of Gitelman syndrome, an autosomal recessive disease (Gitelman et al., 1966; Bettinelli et al., 1992; Rodriguez-Soriano et al., 1987). Hypocalciuria, metabolic alkalosis, and hypomagnesemia and hypokalemia of renal tubular origin are the biochemical hallmarks, which provoke frequent tetanic episodes and muscular weakness. The distal tubule abnormalities in Gitelman syndrome resemble the effects of chronic administration of thiazide diuretics: the dissociation of renal calcium from magnesium transport, the moderate degree of sodium, chloride, and potassium wasting, and the exaggerated natriuresis and kaliuresis after furosemide administration (Bettinelli et al., 1992; Rodriguez-Soriano et al., 1987; Sutton et al., 1992). Furthermore, Gitelman syndrome patients do not respond to intravenous chlorothiazide, indicating that the Na–Cl cotransporter plays a major role in the pathogenesis of this kidney disease (Sutton et al., 1992).
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
FISH analysis assigned the hTSC gene to the long arm of human chromosome 16q13, a region harboring the metallothionein genes (West et al., 1990) and the Bardet–Bidle syndrome-associated gene (Kwitek-Black et al., 1993). This human chromosome region is syntenic to mouse chromosome 8 and rat chromosome 2. Linkage and mutation studies will clarify the role of the human TSC in the pathogenesis of distal tubulopathies such as Gitelman syndrome. Furthermore, important information on the interaction between the cotransporter and the diuretic agent could be obtained through the expression of hTSC protein in the eukaryotic system, properly mutagenized on the extracellular or regulatory domains, possibly leading to the design of new and more active drugs. ACKNOWLEDGMENTS We thank Dr. Monica Repetto and Massimo Littardi for technical assistance in sequencing reactions. N.M. is the recipient of a grant from Associazione per il Bambino Nefropatico, Milan. Note added in proof. During the reviewing process of this paper, Simon et al. reported data demonstrating that the Na–Cl cotransporter gene is responsible for Gitelman syndrome, and we found several mutations in the hTSC gene of Gitelman syndrome patients, including missense, point deletion, and insertion mutations, in either the homozygous state or the compound heterozygous state (data not shown).
REFERENCES Bettinelli, A., Bianchetti, M. G., Girardin, E., Caringella, A., Cecconi, M., Claris Appiani, A., Pavanello, L., Gastaldi, R., Isimbardi, C.,
gnma
AP: Genomics
HUMAN Na–Cl THIAZIDE-SENSITIVE COTRANSPORTER (SLC12A3) Lama, G., Marchesoni, C., Matteucci, C., Patriarca, C., Di Natale, B., Setzu, C., and Vitucci, P. (1992). Use of calcium excretion values to distinguish two forms of primary renal tubular hypocalemic alkalosis: Bartter and Gitelman syndromes. J. Pediatr. 120: 38– 43. Breyer, J., and Jacobson, H. R. (1990). Molecular mechanisms of diuretic agents. Annu. Rev. Med. 41: 265–275. Delpire, E., Rauchman, M. I., Beier, D. R., Hebert, S. C., and Gullans, S. R. (1994). Molecular cloning and chromosome localization of a putative basolateral Na–K–2Cl cotransporter from mouse inner medullary collecting duct (mIMCD-3) cells. J. Biol. Chem. 269: 25677–25683. Ellison, D. H., Biemesderfer, D., Morrisey, J., Lauring, J., and Desir, G. (1993). Immunocytochemical characterization of the high-affinity thiazide diuretic receptor in rabbit renal cortex. Am. J. Physiol. 264: F141–F148. Feng, D.-F., and Doolittle, R. F. (1987). Progressive sequence alignment as a prerequisite to correct phylogenetic trees. J. Mol. Evol. 25: 351–360. Forbush, B. I., and Palfrey, H. C. (1983). [3H]Bumetanide binding to membranes isolated from dog kidney outer medulla. Relationship to the Na,K,Cl co-transport system. J. Biol. Chem. 258: 11787– 1792. Gamba, G., Saltzberg, S. N., Lombardi, M., Miyanoshita, A., Lytton, J., Hediger, M. A., Brenner, B. M., and Hebert, S. C. (1993). Primary structure and functional expression of a cDNA encoding the thiazide-sensitive, electroneutral sodium-chloride cotransporter. Proc. Natl. Acad. Sci. USA 90: 2749–2753. Gamba, G., Miyanoshita, A., Lombardi, M., Lytton, J., Lee, W.-S., Hediger, M. A., and Hebert, S. C. (1994). Molecular cloning, primary structure and characterization of two members of the mammalian electroneutral sodium–(potassium)–chloride cotransporter family expressed in kidney. J. Biol. Chem. 269: 17713– 17722. Gitelman, H. J., Graham, J. B., and Melt, L. G. (1966). A new familial disorder characterized by hypokalemia and hypomagnesemia. Trans. Assoc. Am. Physicians 79: 221–235. Glass, D. B., El-Maghrabi, M. R., and Pilkis, S. J. (1986). Synthetic peptides corresponding to the site phoshorylated in 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase as substrates of cyclic nucleotide-dependent protein kinases. J. Biol. Chem. 261: 2987– 2993. Kozak, M. (1989). The scanning model for translation: An update. J. Cell Biol. 108: 229–241. Kwitek-Black, A. E., R., C., Duyk, G. M., et al. (1993). Genetic mapping of the gene for Bardet–Bidle syndrome to 16q21 in a large inbred pedigree. Am. J. Hum. Genet. 53: 139. Kyte, J. P., and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105–132. Leid, M., Kastner, P., and Chambon, P. (1992). Multiplicity generates
AID
Genom 4080
/
6r1b$$$221
07-12-96 12:04:31
493
diversity in the retinoic acid signalling pathways. Trends Biochem. Sci. 17: 427–433. Lytle, C., and Forbush, B., III (1992). The Na–K–Cl cotransport protein of shark rectal gland. Regulation by direct phosphorylation. J. Biol. Chem. 267: 25438–25443. Palfrey, H. C., and O’Donnell, M. E. (1992). Cell. Physiol. Biochem. 2: 293–307. Payne, J. A., and Forbush, B. I. (1994). Alternatively spliced isoforms of the putative renal Na–K–Cl cotransporter are differentially distributed within the rabbit kidney. Proc. Natl. Acad. Sci. USA 91: 4544–4548. Payne, J. A., Xu, J.-C., Haas, M., Lytle, C. Y., Ward, D., and Forbush, B. I. (1995). Primary structure, functional expression, and chromosomal localization of the bumetanide-sensitive Na–K–Cl cotransporter in human colon. J. Biol. Chem. 270: 17977–17985. Rodriguez-Soriano, J., Vallo, A., and Garcia-Fuentes, M. (1987). Hypomagnesemia of hereditary renal origin. Pediatr. Nephrol. 1: 465– 472. Rossi, E., Zarrilli, R., and Zuffardi, O. (1993). Regional assignment of the gene coding for a human Graves’ disease autoantigen to 10q21.3–q22.1. Hum. Genet. 90: 653–654. Simon, D. B., Nelson-Williams, C., Johnson Bia, M., Ellison, D., Karet, F. E., Morey Molina, A., Vaara, I., Iwata, F., Cushner, H. M., Koolen, M., Gainza, F. J., Gitelman, H. J., and Lifton, R. P. (1996). Gitelman’s variant of Bartter’s syndrome, inherited hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive Na–Cl cotransporter. Nature Genet. 12: 24–30. Sutton, R. A. L. (1985). Diuretics and calcium metabolism. Am. J. Kidney Dis. 5: 4–9. Sutton, R. A. L., Mavichak, V., Halabe, A., and Wilkins, G. E. (1992). Bartter’s syndrome: Evidence suggesting a distal tubular defect in a hypocalciuric variant of the syndrome. Miner. Electrolyte Metab. 18: 43–51. West, A. K., Stallings, R., Hildebrand, C. E., Chiu, R., Karin, M., and Richards, R. I. (1990). Human metallothionein genes: Structure of a functional locus at 16q13. Genomics 8: 513–518. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., Burton, J., Connell, M., Copsey, T., Cooper, J., Coulson, A., Craxton, M., Dear, S., Du, Z., Durbin, R., Favello, A., Fraser, A., Fulton, L., Gardner, A., Green, P., Hawkins, T., Hillier, L., Jier, M., Johnston, L., Jones, M., Kershaw, J., Kirsten, J., Laisster, N., Latreille, P., Lightning, J., Lloyd, C., Mortimore, B., O’Callaghan, M., Parsons, J., Percy, C., Rifken, L., Roopra, A., Saunders, D., Shownkeen, R., Sims, M., Smaldon, N., Smith, A., Smith, M., Sonnahammer, E., Staden, R., Sulston, J., Thierry-Mieg, J., Thomas, K., Vaudin, M., Vaughan, K., Waterston, R., Watson, A., Weinstock, L., Wilkinson-Sproat, J., and Wohldman, P. (1994). 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368: 32–38. Xu, J., Lytle, C., Zhu, T. T., Payne, J. A., Benz, E., and Forbush, B. I. (1994). Molecular cloning and functional expression of the bumetanide-sensitive Na–K–Cl cotransporter. Proc. Natl. Sci. USA 91: 2201–2205.
gnma
AP: Genomics