- Email: [email protected]
Molecular cloning of a β-glucan pattern-recognition lipoprotein from the white shrimp Penaeus (Litopenaeus) vannamei: correlations between the deduced amino acid sequence and the native protein structure
Developmental and Comparative Immunology 28 (2004) 713–726 www.elsevier.com/locate/devcompimm
Molecular cloning of a b-glucan pattern-recognition lipoprotein from the white shrimp Penaeus (Litopenaeus) vannamei: correlations between the deduced amino acid sequence and the native protein structureq Marı´a Gabriela Romo-Figueroaa, Claudia Vargas-Requenaa, Rogerio R. Sotelo-Mundoa, Francisco Vargas-Alboresb, Inocencio Higuera-Ciaparac, Kenneth So¨derha¨lld, Gloria Yepiz-Plascenciaa,* a
Molecular Biology of Aquatic Organisms, DTAOA, Centro de Investigacio´n en Alimentacio´n y Desarrollo, A.C., P.O. Box 1735, Hermosillo, Sonora 83000, Me´xico b Marine Biotechnology, Centro de Investigacio´n en Alimentacio´n y Desarrollo, A.C.; P.O. Box 1735, Hermosillo, Sonora 83000, Me´xico c Unidad Guaymas, Centro de Investigacio´n en Alimentacio´n y Desarrollo, A.C.; P.O. Box 1735, Hermosillo, Sonora 83000, Me´xico d Department of Comparative Physiology, Evolutionary Biology Centre, Uppsala University, Sweden Received 11 May 2003; revised 13 November 2003; accepted 29 November 2003
Abstract The hemolymph pattern-recognition b-glucan binding protein from the white shrimp Penaeus (Litopenaeus) vannamei is also a high density lipoprotein (bGBP-HDL) involved in innate immunity. The bGBP-HDL full length cDNA sequence determined was 6.3 kb long, and contains a long 30 UTR region with a polyadenylation signal and a poly-Aþ tail. The open reading frame is 1454 amino acids long and the N-terminal residue of the mature protein is localized in position 198 of the ORF. Comparison of the bGBP-HDL amino acid sequence against GenBank detected only significant similarity to bGBP from the crayfish Pacifastacus leniusculus. bGBP-HDL is expressed in hepatopancreas, muscle, pleopods and gills, but not in hemocytes as determined by RT-PCR. We discuss the analysis of the deduced primary sequence in terms of the predicted secondary structure, glucanase-like and RGD motives relevant to its dual roles in defence and lipid transport. q 2003 Elsevier Ltd. All rights reserved. Keywords: Shrimp; Prawn; b-1,3-Glucan-binding protein; cDNA; RGD-motif; Glucanase-like; Glucan; Pattern-recognition; High density lipoprotein
Abbreviations: EST, expressed sequence tag; GBP, glucan binding protein; b-GBP, b-1,3-glucan-binding protein; HDL, high density lipoprotein; LGBP, lipopolysaccharide- and b-1,3-glucan-binding protein; MALDI-TOF, matrix assisted lasser desorption time of flight mass spectroscopy; PAGE, polyacrylamide gel electrophoresis; proPO, prophenoloxidase; VHDL, very high density lipoprotein. q The nucleotide sequence reported was submitted to GenBank and is available under accession number: AY249858. * Corresponding author. Tel.: þ 52-662-2892400x350; fax: þ52-662-2800421. E-mail address: [email protected] (G. Yepiz-Plascencia). 0145-305X/$ - see front matter q 2003 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2003.11.008
714
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
1. Introduction In the innate immunity system of vertebrates and invertebrates, pattern-recognition proteins (PRP) recognize and bind molecules with structural features called molecular patterns [1]. These patterns are present in the surface of microorganisms but absent from animals. Although PRPs lack the binding specificity of antibodies, they recognize and bind carbohydrates such as b-1,3-glucans, lipopolysaccharides (LPS), lipoteichoic acid and peptidoglycans present on the surface of bacteria and fungi [1,2]. In shrimp, a plasma b-glucan binding protein (bGBP) was identified as a , 100-kDa PRP that upon binding b-glucans triggers the activation of the prophenoloxidase (proPO) system in hemocytes, a central component of the defence system [3,4]. The shrimp bGBP is also a high density lipoprotein (HDL) involved in the transport of lipids [5], as was originally shown for the crayfish Pacifastacus leniusculus [6]. bGBP-HDL is a lipoglycoprotein that contains high-mannose type oligosaccharides and approximately 50% lipids, with phospholipids as the pre-dominant lipid class [7]. Non-sex specific high density (HDL) [8]; and very-high density lipoproteins (VHDL) [9] have been found in shrimp and both are involved in the defence system as previously reported. The HDL is the same protein described as b-glucan binding protein (bGBP) and VHDL is the clotting protein (CP). This bifunctionality has been described in white shrimp P. vannamei [5], yellowleg shrimp Penaeus californiensis [10], freshwater crayfish P. leniusculus [6] and sand crayfish Ibacus ciliatus [11]. The shrimp bGBP-HDL differs from other PRPs that bind LPS and b1,3-glucans called LGBPs or b1,3-glucans (GBP or bGRPs). LGBP and GBP are also involved in proPO activation upon binding of their cognate ligand, although they are not lipoproteins, and do not have significant amino acid sequence similarity to crayfish bGBP. GBP’s and LBGP’s have been described from different invertebrates such as the hornworm Manduca sexta [12], the crayfish P. leniusculus [13], and the shrimps Penaeus stylirostris [14] and Penaeus monodon [15]. Secondary structure reflects protein folding and can be related to protein function. Recently, it was demonstrated by using circular dicroism spectroscopy that bGBP-HDL is composed mainly of b-sheets
(53%) similar to the secondary structure content of insect lipophorin HDLs (M. sexta, Locusta migratoria and Triatoma infestans) [16]. To further obtain insights about the basis of the bifunctionality of the shrimp bGBP-HDL, both as a PRP and as a lipoprotein, we have obtained the complete cDNA nucleotide sequence from the white shrimp P. vannamei, deduced its amino acid sequence and tried to correlate the predicted primary sequence with the native protein roles.
2. Materials and methods 2.1. Protein purification bGBP-HDL was obtained from juvenile white shrimps P. vannamei grown in an experimental tide pond (Center for Biological Research, Guaymas, Sonora) and maintained in an aquarium (salinity: 36 ppt) until used. Hemolymph was withdrawn from the pleopod base of the first abdominal segment using a 1.0 ml syringe with 27 gauge needle and containing two volumes of pre-cooled (10 8C) anticoagulant solution (450 mM NaCl, 10 mM KCl, 10 mM EDTA·Na2, 10 mM HEPES, pH 7.3, 850 mOsm/kg 10 mM EDTA·Na2) [17]. Hemocytes were removed by centrifugation at 800 £ g for 5 min and the cell-free plasma dialyzed against distilled water overnight. bGBP-HDL was purified using heparin affinity chromatography as previously described [16,18]. 2.2. Determination of internal partial amino acid sequences Purified bGBP-HDL was separated by SDS-PAGE and transferred to Immobilon P membrane (0.4 (M Millipore), stained with Coomassie Blue and the band cut from the membrane. Amino terminal amino acid sequences were previously obtained by Edman degradation [3,7]. Internal peptides sequences were obtained by digestion of the purified protein with trypsin and the resulting digest was subjected to MALDI-TOF MS performed on a Perseptive Biosystems Voyager-DE STR at Harvard Microchemistry Facility (Cambridge, MA).
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
2.3. cDNA cloning and sequencing A white shrimp unidirectional cDNA library was constructed from juvenile intermolt shrimps as follows. Hepatopancreas were dissected, rinsed with RNase-free shrimp anticoagulant solution, immediately homogenized in a guanidinium isothiocyanate solution using a Polytron and total RNA was isolated using the RNaid Matrix (BIO 101, La Jolla, CA). PolyAþ RNA was purified using Dynabeads (Dynal, Oslo, Norway) following the manufacturer’s instructions. A cDNA library was constructed using the ZAP Expressw cDNA Synthesis Kit, following the manufacturer recommendations (Stratagene, La Jolla, CA). Primers for PCR amplification of a cDNA fragment encoding bGBP-HDL were designed based on amino acid sequences of the amino terminus and two internal fragments (Table 1). PCR was carried out in a 50 ml reaction containing 50 mM KCl, 10 mM Tris –HCl, (pH 8.3), 250 m dNTPs (each), 1.5 mM MgCl2, 0.5 mM each primers and 4 ml of the hepatopancreas cDNA library under the following conditions: 3 min, 94 8C, (one cycle); 1 min, 55 8C, 3 min,72 8C (1 cycle); 3 min, 94 8C; 1 min, 42 8C; 3 min, 72 8C (1 cycle); 3 min, 94 8C; 1 min, 52 8C; 3 min, 72 8C (33 cycles); and 10 min at 72 8C (1 cycle). PCR products were cloned into a pCR 2.1-TOPO TA cloning vector (Invitrogen, Carlsbad, CA) following
715
the manufacturer instructions. The recombinant products were designated as pPvBLp1 (primer pairs 1Fw and 5Rv) and pPvBLp2 (primer pairs 1Fw and 6Rv). Primers were also designed based on an expressed sequence tag (EST; dbEST Id: 6347782, GenBank BF024091), to amplify the 50 UTR (Table 1). 2.4. Probes and screening A probe was prepared using the bGBP-HDL fragment (, 2 kb) contained in pPvBLp2, labeled with digoxigenin (DIG) by random-priming labeling (Boehringer – Mannheim – Roche, Indianapolis, IN). For screening of the hepatopancreas cDNA library, approximately 250 000 plaques were blotted onto Nylon (Hybond þ , Amersham, Pharmacia Biotech) membranes and hybridizations carried out overnight (16 h) at 65 8C in 5 £ SSC, 0.1% N-laurylsarcosine, 0.02% SDS and 1% blocking reagent. The filters were washed twice with 2 £ SSC, 0.1% SDS at room temperature for 5 min, and twice with 0.1 £ SSC, 0.1% SDS at 68 8C for 15 min under constant agitation. The filters were rinsed briefly with washing buffer (maleic acid buffer (0.1 M maleic acid, 0.15 M NaCl; pH 7.5), 0.3% Tween 20 (v/v)) and incubated with 1 £ blocking solution (Boehringer – Mannheim) for 30 min, then incubated with anti-DIG-AP conjugate (150 mU/ml) in blocking solution and washed
Table 1 Partial amino acid sequences of bGBP-HDL and nucleotide sequences of primers Primer name
DNA sequence
Position
Amino acid sequences
1Fwa 5Rvb 6Rvb 5UTRa3 5UTRb3 5MR 1F 4R 6F 13R
GGGNCARGCIWSIYTIGCNGGNAAYTTYAA GAGGGTTTIATRTCNGCIATRTTIATRTC GCYTCIATRTTNCCYTCNARIGTYTC TATGGAAACAGATCTGGAAGAG GACATTGATAACAGAGAGGAGC CCAGTAAGAGCCAAGATCTC CCTTGGTCAGAATGAAATCAC TCGATCCTCTCGAAGTCTTCG TCAATATGGAAATGAGCACG GGAAGCTGTAATCCAGATC
646–674 2332–2357 2539–2564 NI 277–298 865–884 1269–1289 5817–5837 3005–3024 3754–3772
GQASLAGNFN DINIADINP ETLEGNIEA NI DIDNTEE EILALTG LGQNEIT 30 UTR NMEMST DVDYSF
3 a b
UTR, designed based on EST (dbEST Id: 6347782, GenBank BF024091); NI, not included. Degenerate primer designed based on the N-terminal sequence. Degenerate primers designed based on internal peptide sequences.
716
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
twice with washing buffer and finally equilibrated with detection buffer (0.1 M Tris– HCl, 0.1 M NaCl, 50 mM MgCl2, pH 9.5). Positive plaques were detected with NBT/BCIP. Putative positive plaques were subjected to secondary and tertiary screening until pure. Plasmids were obtained from phagemids by in vivo excision using ExAssist Helper phage with E. coli XLOLR (Stratagene) and used for sequencing. Subcloning and primer walking was used to obtain the complete nucleotide sequence of both strands (100%) of the cDNA. Specific primers were designed based on the previously obtained sequence. 2.5. DNA sequencing and sequence analysis All clones were thoroughly sequenced by the dideoxy chain-termination method at the LMSE facility (Laboratory of Molecular and Systematic Evolution) at the University of Arizona. The cDNA sequence was analysed with the DNASIS v 2.5 (Hitachi Software Engineering America, Ltd). The nucleotide and deduced protein sequence was compared to non-redundant nucleotide, EST, and protein databases using the BLAST algorithm [19] at the National Center for Biotechnology Information, Bethesda, MD (http://www.ncbi.nlm.nih. gov/BLAST/) and ProtParam was used to analyze the deduced protein characteristics (http://ca.expasy. org/tools/protparam.html). bGBP-HDL predicted polypeptide sequence was also analysed by hydrophobicity using the hydrophobic cluster analysis (HCA) method [20 – 22] and the secondary structure was predicted using the PSIPRED algorithm [23,24] as implemented in the web accessible server available at http://bioinf.cs.ucl.ac.uk/psipred/ psiform.html. 2.6. Northern and RNA dot blot analysis Total RNA from P. vannamei hepatopancreas was isolated using TRIzol (Gibco, BRL), 20 mg were denatured in formamide and separated in denaturing agarose-gel (1% agarose/1 M formaldehyde) [25], vacuum blotted to nylon membranes and crosslinked by UV treatment. A PCR fragment of 4568 bp was generated using internal primers (1F and 4R corresponding to positions 1269 – 5837 of the complete cDNA sequence and 25 ng of DNA were
labeled with a-32P dCTP by random primer labeling and used for Northern hybridization. Alongside, an RNA dot blot was done containing 4 mg of total RNA from hepatopancreas, muscle, pleopods and gills. Membranes were pre-hybridized for 1 h at 65 8C in 5 £ SSC (20 £ SSC 3 M NaCl, 0.3 M sodium citrate, pH 7.0), 5 £ Denhardt’s solution (100 £ Denhardt’s solution: 2% (w/v) bovine serum albumin, 2% (w/v) Ficoll and 2% polyvinylpyrrolidone), 0.1% SDS and 100 mg/ml herring sperm DNA [26], the probe added and hybridization done for 24 h at 65 8C. The membranes were washed with 2 £ SSC, 0.1% SDS 15 min at room temperature, 2 £ SSC, 0.5% SDS 15 min at 60 8C, 0.2 £ SSC, 0.1% SDS 30 min at 60 8C and 0.1 £ SSC, 0.1% SDS 1 h at 68 8C, and subjected to autoradiography at 2 80 8C with BIOMAX films (Kodak) using intensifying screens. 2.7. Reverse transcriptase-PCR analysis (RT-PCR) Hepatopancreas, hemocytes, muscle, pleopods and gills total RNA were pre-treated with DNAse I (1 U/mg of total RNA) and 1.2 mg were reverse transcribed using oligo dT and SuperScript II reverse transcriptase (Gibco, BRL). The cDNA from the different tissues was amplified by PCR using the internal primers 6Fw and 13R that produce a fragment of 767 bp. Two primers were designed to amplify the b-Actin transcript (GenBank AF300705) from the same RNA for comparisons and designated as Act-Fw (positions 652-671) and Act-Rv (1197-1216). PCR products were separated by electrophoresis on a 1.0% agarose gel and visualised by ethidium bromide staining. Transcripts abundance respect to actin was estimated by band intensity densitometry using Kodak Digital Science ID Image Analysis Software v 3.0 (New Haven, CT).
3. Results and discussion By using degenerate primers designed from the amino acid sequence of the mature N-terminus and two internal peptides, a , 1.8 and 2.0 kb fragments were obtained by PCR from the hepatopancreas cDNA library (Fig 1). The deduced amino acid sequence of these fragments was similar to bGBP
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 1. Restriction map and overlapping clones of the bGBP-HDL from P. vannamei. The complete sequence is 6379 bp long with overlapping clones: pPvBLpUTR, pPvBLp1 and pPvBLp2 obtained using a PCR strategy and pPvBLp3, isolated from the cDNA library using pPvBLp2 as a probe. Restriction sites S: Sal I, E: Eco RI, X: Xho I. The corresponding positions of the clones with respect to the complete sequence are: pPvBLpUTR, nucleotide positions 1-884; pPvBLp1, 646-2357; pPvBLp2, 646-2564 and pPvBLp3, 805-6379.
from the freshwater crayfish, P. leniusculus [27]. Using the 2.0 kb clone as a probe, 250 000 plaques from the hepatopancreas cDNA library were screened and 27 putative clones obtained in the first screening. After tertiary screening, five different clones with inserts of approximately 4.5 kb were obtained; all the clones differed in their 50 -ends and did not contain the sequence corresponding to the N-terminus of the bGBP-HDL. To obtain the 50 region of the bGBP-HDL cDNA, we used an EST from GenBank named PvP 352 (dbEST Id: 6347782, GenBank BF024091) reported by other authors [28]. This EST is 906 bp long, contains several ambiguities and overlapped by approximately 200 bp with the sequence that we had obtained from the clones using degenerate primers and corresponding to N-terminus of the mature protein (pPvBLp1 and pPvBLp2, Fig. 1). Based on this EST, we designed two forward primers: 5UTRa and 5UTRb. PCR was carried out using every one of these primers in combination with 5MR and cDNA as template. The PCR products sequences were overlapped and aligned to obtain the full length cDNA sequence of the bGBP-HDL (Figs. 1 and 2). The complete cDNA (6379 bp) encodes a deduced 1454 amino acid residue protein. The Nterminal amino acid of the mature bGBP-HDL
717
(DAGQASLAGNFNSLRFNMKTPFERA) [5] is found 197 residues after the first methionine (Fig. 2). The cDNA sequence contained a polyadenylation signal AATAAA twelve nucleotides upstream the polyAþ tail. A long 30 -untranslated sequence of 1966 nucleotides was present between the termination codon and the polyAþ. This region contains two ATTTA (positions 6142 and 6153) destabilization mRNA motifs that are involved in mRNA decay [29] and has 96% nucleotide identity with a 618 nt EST (PsP 471 L99-05 Litopenaeus setiferus cDNA, GenBank accession BF024578.1) with as yet, unassigned identification. The bGBP-HDL cDNA sequence contains an open reading frame of 1454 amino acids that contains the previously determined amino terminal sequence [5] and three internal amino acid sequences obtained by tryptic digestion (Fig. 2). The first Met residue is present 197 residues upstream the mature N-terminus and there is no consensus secretion signal peptide. Although this is a long fragment that is removed to generate the mature N-terminus of the protein, a segment of 109 residues occurs also in the crayfish bGBP [27] and these regions are also homologous between these two proteins (Fig. 3). Potential processing sites for the precursor protein are found near the mature N- and C-termini in both, shrimp and crayfish. The sequence RSKR conforming to the (R(K)/XX/R(K) paired-basic motif is found in positions 2 12 to 2 15 and a second site is located in positions 1091– 1094 with residues RVRR; thus it is possible that the bGBP-HDL precursor polypeptide is proteolytically processed at both extremes to produce the mature protein. This paired-basic motif is a processing site that is recognized by subtilisin-like proprotein convertase [30] and it is involved in the proteolytic processing of proteins such as vitellin from Macrobrachium rosenbergii [31] and in mosquito Aedes aegypti pro-vitellogenin, inducible during vitellogenesis [32]. Since we detected previously a , 140 kDa protein in western blots of crude protein extracts and in in vitro translated mRNA from hepatopancreas [33], it appears that this is the true precursor protein. Perhaps, this unusual N-terminal region of the precursor protein plays a role in the correct folding, lipid loading mechanism and/or secretion of the protein and compensates for the lack
718
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 2. Nucleotide sequence and deduced amino acid sequence of bGBP-HDL cDNA. The deduced amino acid sequence is shown above the cDNA nucleotide sequence. The amino acid sequence of the N-terminal of the mature protein is shown in bold and the internal peptides are bold and italics. The RGD sequence is in bold and parenthesis. The putative glucanase regions are double underlined. The(R(K)/X/X/R(K)) sites are underlined. The polyadenylation signal are marked with (00 ) and underlined. The stop codon is marked with an asterisk (*). The mRNA destabilization elements are shown in bold and dot underlined.
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 2 (continued )
719
720
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 2 (continued )
of a typical secretion signal peptide, but this remains still unknown. The N-terminal sequence of the bGBP-HDL is a highly conserved region between two Penaeid shrimps [5,10] and the freshwater crayfish [27]. Four O-glycosylation (187-T, 980-T, 415-S, and 1191-S) and five N-glycosylation (374-N, 395-N, 628-N, 685N and 956-N) potential sites were also found in the deduced primary sequence (Fig. 2). The presence of carbohydrates in this protein was reported [3,8]; however, attempts to detect changes in migration of the purified protein after deglycosylation were unsuccessful, perhaps related to the amount of carbohydrates present or to an interference by the lipids present. Crayfish bGBP is also highly glycosylated with mannose, glucose and fucose as the main monomers [27]. The deduced amino acid sequence of the shrimp BGBP-HDL has 54% identity to the crayfish bGBP [27] and, considering conservative replacements, these proteins are 73% similar (Fig. 3). Two glucanase-like stretches were found in P. leniusculus bGBP, but no glucanese activity was detected [27]; these regions are also found in the shrimp bGBPHDL, corresponding to residues 456 –476 and 911– 931 (Figs. 2 and 3). Shrimp bGBP-HDL shares with crayfish bGBP the Arg-Gly-Asp (RGD) motif observed in proteins with established cellular adhesion function [34]. After alignment of both sequences, the shrimp RGD site (amino acids 782– 784) piles up with a conserved RGE site in the crayfish sequence; it is known that RGD/E sites have a similar function to the cognate
RGD motif [35]. In P. leniusculus, a synthetic peptide RGES induced degranulation and spreading of blood cells but it had no influence on bGBP binding to fixed blood cells; however, it was not possible to rule out that other regions might be necessary for bGBP binding to blood cell receptor [27], but this has not been investigated in shrimp. Since bGBP-HDL is circulating in hemolymph and only the b-glucanbGBP complex can trigger defence reactions, it is likely that a conformational change is required for binding to hemocytes receptors; therefore other regions of the proteins may play an important role. Additional support for processing of the precursor also arises from analysis of the predicted secondary structure of the processed polypeptide and the experimental evidence obtained by circular dicroism; the shrimp bGBP-HDL polypeptide is predicted to contain 50.2% b-sheets, 10.5% a-helices, and 39.3% random coils, in agreement with the experimentally determined data of 53% b-sheets, 20% a-helix and 27% random coils and turns [16]. Since comparisons against GenBank led only to significant similarities to the crayfish bGBP, bioinformatic methods were used to identify other features consistent with the bifunctional role as lipoprotein and glucan-binding protein of the bGBP-HDL. HCA [21] was chosen for comparisons, because of its known sensitivity to identify sequence similarity and secondary structure elements in amino acid sequences. Two important regions in bGBP-HDLs were chosen for the HCA analysis. First, the shrimp bGBP-HDL amino acid terminus that is highly conserved at the sequence as well as in the pattern of hydrophobic
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
721
Fig. 3. Alignment of the amino acid sequence of P. vannamei bGBP-HDL (GenBank AY249858) and P. leniusculus bGBP (GenBank X80687), using Clustal X. Identical residues are in white with black background and conserved residues are denoted in white with gray background. Gaps were introduced to obtain maximal sequence alignment. The number is based on the sequence of the shrimp bGBP-HDL.
722
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 3 (continued )
residues as observed by the cluster Leu-Phe-Leu-MetPhe in shrimp and Leu-Val-Phe-Leu-Phe in crayfish (Fig. 4, panel A). Second, the region surrounding the RGD/E motif, where the residues are Val-Tyr and Phe-Met in shrimp and Val-Val-Tyr and Val-Phe in crayfish (Fig. 4, panel B), perhaps related to a particular feature of the protein. HCA analysis did not predict a secondary structure element on the RGD/ E motif indicating that probably it is part of a coil or loop exposed in the folded protein. The secondary structure prediction of b-sheets, remarkably matches the experimentally determined values obtained by circular dichroism spectroscopy [16]. b-sheets are proposed as important structural elements for the function of non-exchangeable lipids at the lipoprotein binding cavity [36].
Tissue-specific expression of bGBP-HDL was analyzed by RNA blot and RT-PCR. Total RNA was extracted from hepatopancreas, hemocytes, muscle, pleopods and gills from white shrimp. Northern blot of hepatopancreas RNA detected two bands with approximate sizes of 6 and 4 kb (Fig. 5, panel A) and a signal, albeit faint, was detected in the dot blot of RNA from muscle, pleopods and gills (Fig. 5, panel B). The 6 kb transcript size corresponds well with the complete sequence whereas the size of the 4 kb corresponds well with the size of the coding sequence. If there is some processing at the mRNA level is still unknown. Because bGBP was only detected in hepatopancreas from P. leniusculus [27], we wanted to get a comparative estimation of the bGBP-HDL transcript abundance in
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
723
Fig. 4. Sequence alignment of selected regions of P. vannamei bGBP-HDL and P. leniusculus bGBP, and hydrophobic cluster analysis (HCA) plots of the corresponding regions. Clusters of hydrophobic residues are boxed. Glycine residues are represented by filled diamonds. Proline is represented by a star and serine by a box with dot inside. Panel A, mature N-terminal sequence. Panel B, RGD domain. Amino acid numbering is assigned using the mature protein N-terminus.
the different tissues. Therefore, RT-PCR was carried out using internal primers for bGBP-HDL and actin as a control (Fig. 5, panel C). The result was similar to the dot blot; higher abundance in hepatopancreas, followed by gills and pleopods and a faint band from muscle, but no PCR product was detected in hemocytes. This contrasts with the reports in crayfish using Northern blotting, where a signal was only detected in hepatopancreas RNA [27]. This may represent a difference between the expression of the bGBP-HDL in a freshwater and a marine decapod crustacean or may be due to the sensitivity of the technique. Nevertheless, hepatopancreas appears to be the main tissue expressing the bGBP-HDL gene.
Taking in consideration the amount of DNA obtained in the PCR using bGBP-HDL primers or actin, a densitometric evaluation of the gel bands estimates roughly, that in shrimp hepatopancreas, the actin PCR product is 4.8 times more abundant that the bGBP-HDL, whereas hepatopancreas bGBP-HDL is 29, 4 and 2 times more abundant than the muscle, gills and pleopods transcripts, respectively. RT-PCR amplification was only due to the amount of mRNAs present, since the RNA preparation did not contain genomic DNA (Fig. 4, panel D). Another b-glucan binding protein was recently purified and cloned from hemocytes of P. leniusculus [13] and P. monodon [15] and from hepatopancreas
724
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 5. Detection of bGBP-HDL transcripts. Panel A, Northern blot of hepatopancreas total RNA (20 mg). Panel B, dot blot of total RNA (4 mg). Panel C, RT-PCR. Panel D, RT-PCR of an actin fragment amplified from total RNA subjected to reverse transcription (þRT) and control (2RT). The identity of the fragments was verified by sequencing. The bands intensity of the RT-PCR for bGBP-HDL and actin products (panel C), were quantified using Image Analysis Software (Kodak Digital Science. Hepatopancreas (H), Hemocytes (Hm), muscle (M), pleopods (P) and gills (G) from P. vannamei.
of P. stylirostris [14], but these three are approximately 30 –45 kDa proteins and not reported to be lipoproteins. Nevertheless, they contain RGD binding and glucanase-like domains. Interestingly, expression of the P. stylirostris LGBP was shown to be upregulated in virus infected shrimp, with series of up and down regulations of the proPO gene as the virus infection progressed [14], but they appear to be unrelated to the bGBP-HDLs from shrimp and crayfish. In summary, two different glucan binding proteins appear to be synthesized by decapod crustaceans. They differ remarkably in size and only one is known to be a lipoprotein. The bGBP-HDL secondary structure (a-helix and b-sheets) content are similar to insect high density lipophorins, whereas, the integrin-motifs and glucanase-like domains are found in PRP involved in innate immunity, explaining at least partially, the structural-bifunctional role of the shrimp bGBP-HDL. The high abundance of the bGBP-HDL transcript in hepatopancreas, is probably related to its role as a major lipid storage gland and synthesizer of hemolymph proteins, similar to the insect fat body.
However, the recent high number of ESTs with similarity to proteins involved in immune defence found in hepatopancreas from several Penaeids, has led to the proposal that the otherwise considered mainly as a digestive gland, may play an important role in defence [28]. Whether the expression of the bGBP-HDL is regulated in response to dietary lipids or infections, remains to be investigated.
Acknowledgements This work was funded by grants from Consejo Nacional de Ciencia y Tecnologı´a, Me´xico (29091 and 36926) to GYP and from International Foundations for Science (A/2500). M.G. RomoFigueroa had a graduate fellowship from Consejo Nacional de Ciencia y Tecnologı´a (Me´xico). We express our gratitude to Drs Maria Islas-Osuna and John H. Law for advice and critical reading of the manuscript, to Dr T. Gollas-Galva´n for technical help and Dr J. Herna´ndez-Lo´ pez and MSc E. Villalpando for providing and keeping the experimental shrimps.
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
References [1] Janeway CA, Medzhitov R. Innate immune recognition: mechanisms and pathways. Annu Rev Immunol 2002;20: 197–216. [2] Yu XQ, Zhu YF, Ma C, Fabrick JA, Kanost MR. Pattern recognition proteins in Manduca sexta plasma. Insect Biochem Mol Biol 2002;32:1287–93. [3] Vargas-Albores F, Jime´nez-Vega F, Yepiz-Plascencia G. Purification and comparison of b-1,3-glucan binding protein from white shrimp (Penaeus vannamei). Comp Biochem Physiol 1997;116B:453 –8. [4] Vargas-Albores F, Yepiz-Plascencia G. Beta glucan binding protein and its role in shrimp immune response. Aquaculture 2000;191:13– 21. [5] Yepiz-Plascencia G, Vargas-Albores F, Jimenez-Vega F, Ruiz-Verdugo LM, Romo-Figueroa G. Shrimp plasma HDL and b-glucan binding protein (BGBP): comparison of biochemical characteristics. Comp Biochem Physiol 1998; 121B:309–14. [6] Hall M, VanHeusden MC, So¨derha¨ll K. Identification of the major lipoproteins in crayfish hemolymph as proteins involved in immune recognition and clotting. Biochem Biophys Res Commun 1995;216:939– 46. [7] Ruiz-Verdugo LM, Garcı´a-Ban˜uelos M, Vargas-Albores F, Higuera-Ciapara I, Yepiz-Plascencia GM. Amino acids and lipids of the plasma HDL from the white shrimp Penaeus vannamei Boone. Comp Biochem Physiol 1997; 118B:91–6. [8] Yepiz-Plascencia G, Sotelo-Mundo R, Vazquez-Moreno L, Ziegler R, Higuera-Ciapara I. A non-sex-specific hemolymph lipoprotein from the white shrimp Penaeus vannamei Boone. Isolation and partial characterization. Comp Biochem Physiol 1995;111B:181–7. [9] Yepiz-Plascencia G, Jime´nez-Vega F, Romo-Figueroa MG, Sotelo-Mundo RR, Vargas-Albores F. Molecular characterization of the bifunctional VHDL-CP from the hemolymph of white shrimp Penaeus vannamei. Comp Biochem Physiol 2002;132B:585–92. [10] Yepiz-Plascencia G, Vargas-Albores F, Jimenez-Vega F, Ruiz-Verdugo LM, Romo-Figueroa G. Comparison of shrimp high density lipoprotein and beta glucan binding protein. In: Flegel TW, editor. Advances in Shrimp Biotechnology. Bangok: National Center for Genetic Engineering and Biotechnology; 1998. p. 153 –8. [11] Komatsu M, Ando S. A very-high-density lipoprotein with clotting ability from hemolymph of sand crayfish, Ibacus ciliatus. Biosci Biotech Biochem 1998;62:459–63. [12] Ma C, Kanost MR. A b1,3-glucan recognition protein from an insect, Manduca sexta, agglutinates microorganisms and activates the phenoloxidase cascade. J Biol Chem 2000;275: 7505–14. [13] Lee SY, Wang R, So¨derha¨ll K. A lipopolysaccharide- and b-1,3-glucan-binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization and cDNA cloning. J Biol Chem 2000;275: 1337–43.
725
[14] Roux MM, Pain A, Klimpel KR, Dhar AK. The lipopolysaccharide and B-1,3-glucan binding protein gene is upregulated in white spot virus-infected shrimp (Penaeus stylirostris). J Virol 2002;76:7140–9. [15] Sritunyalucksana K, Lee SY, Soderhall K. A beta-1,3-glucan binding protein from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2002;26:237–45. [16] Vargas-Requena CL, Herna´ndez-Santoyo A, Yepiz-Plascencia G, Vargas-Albores F, Higuera-Ciapara I, Rodrı´guez-Romero A, Soulages JL, Sotelo-Mundo Rogerio R. Biophysical evidence of lipid and carbohydrate binding activities of shrimp high density lipoprotein/B glucan binding protein. Protein Pept Lett 2002;9:337–44. [17] Vargas-Albores F, Guzma´n-Murillo MA, Ochoa JL. An anticoagulant solution for haemolymph collection and prophenoloxidase studies of Penaeid shrimp (Penaeus californiensis). Comp Biochem Physiol 1993;106A:299 –303. [18] Jimenez-Vega F, Sotelo-Mundo R, Ascencio F, VargasAlbores F. 1,3-b-D glucan binding protein (BGBP) from the white shrimp, Penaeus vannamei, is also a heparin binding protein. Fish Shellfish Immunol 2002;13:171–8. [19] Altschul SF, Gish G, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403 –10. [20] Woodcock S, Mornon JP, Henrissat B. Detection of secondary structure elements in proteins by hydrophobic cluster analysis. Protein Eng 1992;5:629– 35. [21] Lemesle-Varloot L, Henrissat B, Gaboriaud C, Bissery V, Morgat A, Mornon JP. Hydrophobic cluster analysis: procedures to derive structural and functional information from 2D-representation of protein sequences. Biochimie 1990;72: 555 –74. [22] Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol 1982;157: 105 –32. [23] Jones DT. Protein secondary structure prediction based on position-specific scoring matrices. J Mol Biol 1999;292: 195 –202. [24] McGuffin LJ, Bryson K, Jones DT. The PSIPRED protein structure prediction server. Bioinformatics 2000;16:404–5. [25] Fourney RM, Miyakoshi J, Day III RS, Paterson MC. Northern blotting: efficient RNA staining and transfer. Focus 1988;10: 5– 7. [26] Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor; 1989. [27] Cerenius L, Liang Z, Duvic B, Keyser P, Hellman U, TapioPalva E, Iwanaga S, So¨derha¨ll K. Structure and biological activity of a 1,3-b-D -glucan-binding protein in crustacean blood. J Biol Chem 1994;269:29462–7. [28] Gross PS, Bartlett TC, Browdy CL, Chapman RW, Warr GW. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific white shrimp, Litopenaeus vannamei, and the Atlantic white shrimp, L. setiferus. Dev Comp Immunol 2001;25:565–77. [29] Zhang L, Ge L, Parimoo S, Stenn K, Prouty SM. Human stearoyl-CoA desaturase: alternative transcripts generated from a single gene by usage of tandem polyadenylation sites. Biochem J 1999;349:255– 2645.
726
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
[30] Tufail M, Lee JM, Hatakeyama M, Oishi K, Takeda M. Cloning of vitellogenin cDNA of the American cockroach, Periplaneta americana (Dictyoptera), and its structural and expression analyses. Arch Insect Biochem Physiol 2000;45: 37–46. [31] Chen Y-N, Tseng D-Y, Ho P-Y, Kuo C-M. Site of vitellogenin synthesis determined from cDNA encoding a vitellogenin fragment in the freshwater giant prawn Macrobrachium rosenbergii. Mol Rep Dev 1999;54:215 –22. [32] Hirai M, Watanabe D, Kiyota A, Chinzei Y. Nucleotide sequence of vitellogenin mRNA in the bean bug, Riptortus clavatus: analysis of processing in the fat body and ovary. Insect Biochem Mol Biol 1998;28:537–47. [33] Yepiz-Plascencia G, Gollas-Galva´n T, Vargas-Albores F, Garcı´a-Banuelos M. Synthesis of hemolymph high-density
lipoprotein b-glucan binding protein by Penaeus vannamei shrimp hepatopancreas. Mar Biotechnol 2000;2:485–92. [34] Ouaissi MA. Role of the RGD sequence in parasite adhesion to host cells. Parasitol Today 1988;4:169–73. [35] Hoeflich A, Reisinger R, Vargas GA, Elmlinger MW, Schuett B, Jehle PM, Renner-Muller I, Lahm H, Russo VC, Wolf E. Mutation of the RGD sequence does not affect plasma membrane association and growth inhibitory effects of elevated IGFBP-2 in vivo. FEBS Lett 2002;523:63–7. [36] Mann CJ, Anderson TA, Read J, Chester SA, Harrison GB, Kochl S, Ritchie PJ, Bradbury P, Hussain FS, Amey J, Vanloo B, Rosseneu M, Infante R, Hancock JM, Levitt DG, Banaszak LJ, Scott J, Shoulders CC. The structure of vitellogenin provides a molecular model for the assembly and secretion of atherogenic lipoproteins. J Mol Biol 1999;285:391 –408.
Molecular cloning of a b-glucan pattern-recognition lipoprotein from the white shrimp Penaeus (Litopenaeus) vannamei: correlations between the deduced amino acid sequence and the native protein structureq Marı´a Gabriela Romo-Figueroaa, Claudia Vargas-Requenaa, Rogerio R. Sotelo-Mundoa, Francisco Vargas-Alboresb, Inocencio Higuera-Ciaparac, Kenneth So¨derha¨lld, Gloria Yepiz-Plascenciaa,* a
Molecular Biology of Aquatic Organisms, DTAOA, Centro de Investigacio´n en Alimentacio´n y Desarrollo, A.C., P.O. Box 1735, Hermosillo, Sonora 83000, Me´xico b Marine Biotechnology, Centro de Investigacio´n en Alimentacio´n y Desarrollo, A.C.; P.O. Box 1735, Hermosillo, Sonora 83000, Me´xico c Unidad Guaymas, Centro de Investigacio´n en Alimentacio´n y Desarrollo, A.C.; P.O. Box 1735, Hermosillo, Sonora 83000, Me´xico d Department of Comparative Physiology, Evolutionary Biology Centre, Uppsala University, Sweden Received 11 May 2003; revised 13 November 2003; accepted 29 November 2003
Abstract The hemolymph pattern-recognition b-glucan binding protein from the white shrimp Penaeus (Litopenaeus) vannamei is also a high density lipoprotein (bGBP-HDL) involved in innate immunity. The bGBP-HDL full length cDNA sequence determined was 6.3 kb long, and contains a long 30 UTR region with a polyadenylation signal and a poly-Aþ tail. The open reading frame is 1454 amino acids long and the N-terminal residue of the mature protein is localized in position 198 of the ORF. Comparison of the bGBP-HDL amino acid sequence against GenBank detected only significant similarity to bGBP from the crayfish Pacifastacus leniusculus. bGBP-HDL is expressed in hepatopancreas, muscle, pleopods and gills, but not in hemocytes as determined by RT-PCR. We discuss the analysis of the deduced primary sequence in terms of the predicted secondary structure, glucanase-like and RGD motives relevant to its dual roles in defence and lipid transport. q 2003 Elsevier Ltd. All rights reserved. Keywords: Shrimp; Prawn; b-1,3-Glucan-binding protein; cDNA; RGD-motif; Glucanase-like; Glucan; Pattern-recognition; High density lipoprotein
Abbreviations: EST, expressed sequence tag; GBP, glucan binding protein; b-GBP, b-1,3-glucan-binding protein; HDL, high density lipoprotein; LGBP, lipopolysaccharide- and b-1,3-glucan-binding protein; MALDI-TOF, matrix assisted lasser desorption time of flight mass spectroscopy; PAGE, polyacrylamide gel electrophoresis; proPO, prophenoloxidase; VHDL, very high density lipoprotein. q The nucleotide sequence reported was submitted to GenBank and is available under accession number: AY249858. * Corresponding author. Tel.: þ 52-662-2892400x350; fax: þ52-662-2800421. E-mail address: [email protected] (G. Yepiz-Plascencia). 0145-305X/$ - see front matter q 2003 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2003.11.008
714
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
1. Introduction In the innate immunity system of vertebrates and invertebrates, pattern-recognition proteins (PRP) recognize and bind molecules with structural features called molecular patterns [1]. These patterns are present in the surface of microorganisms but absent from animals. Although PRPs lack the binding specificity of antibodies, they recognize and bind carbohydrates such as b-1,3-glucans, lipopolysaccharides (LPS), lipoteichoic acid and peptidoglycans present on the surface of bacteria and fungi [1,2]. In shrimp, a plasma b-glucan binding protein (bGBP) was identified as a , 100-kDa PRP that upon binding b-glucans triggers the activation of the prophenoloxidase (proPO) system in hemocytes, a central component of the defence system [3,4]. The shrimp bGBP is also a high density lipoprotein (HDL) involved in the transport of lipids [5], as was originally shown for the crayfish Pacifastacus leniusculus [6]. bGBP-HDL is a lipoglycoprotein that contains high-mannose type oligosaccharides and approximately 50% lipids, with phospholipids as the pre-dominant lipid class [7]. Non-sex specific high density (HDL) [8]; and very-high density lipoproteins (VHDL) [9] have been found in shrimp and both are involved in the defence system as previously reported. The HDL is the same protein described as b-glucan binding protein (bGBP) and VHDL is the clotting protein (CP). This bifunctionality has been described in white shrimp P. vannamei [5], yellowleg shrimp Penaeus californiensis [10], freshwater crayfish P. leniusculus [6] and sand crayfish Ibacus ciliatus [11]. The shrimp bGBP-HDL differs from other PRPs that bind LPS and b1,3-glucans called LGBPs or b1,3-glucans (GBP or bGRPs). LGBP and GBP are also involved in proPO activation upon binding of their cognate ligand, although they are not lipoproteins, and do not have significant amino acid sequence similarity to crayfish bGBP. GBP’s and LBGP’s have been described from different invertebrates such as the hornworm Manduca sexta [12], the crayfish P. leniusculus [13], and the shrimps Penaeus stylirostris [14] and Penaeus monodon [15]. Secondary structure reflects protein folding and can be related to protein function. Recently, it was demonstrated by using circular dicroism spectroscopy that bGBP-HDL is composed mainly of b-sheets
(53%) similar to the secondary structure content of insect lipophorin HDLs (M. sexta, Locusta migratoria and Triatoma infestans) [16]. To further obtain insights about the basis of the bifunctionality of the shrimp bGBP-HDL, both as a PRP and as a lipoprotein, we have obtained the complete cDNA nucleotide sequence from the white shrimp P. vannamei, deduced its amino acid sequence and tried to correlate the predicted primary sequence with the native protein roles.
2. Materials and methods 2.1. Protein purification bGBP-HDL was obtained from juvenile white shrimps P. vannamei grown in an experimental tide pond (Center for Biological Research, Guaymas, Sonora) and maintained in an aquarium (salinity: 36 ppt) until used. Hemolymph was withdrawn from the pleopod base of the first abdominal segment using a 1.0 ml syringe with 27 gauge needle and containing two volumes of pre-cooled (10 8C) anticoagulant solution (450 mM NaCl, 10 mM KCl, 10 mM EDTA·Na2, 10 mM HEPES, pH 7.3, 850 mOsm/kg 10 mM EDTA·Na2) [17]. Hemocytes were removed by centrifugation at 800 £ g for 5 min and the cell-free plasma dialyzed against distilled water overnight. bGBP-HDL was purified using heparin affinity chromatography as previously described [16,18]. 2.2. Determination of internal partial amino acid sequences Purified bGBP-HDL was separated by SDS-PAGE and transferred to Immobilon P membrane (0.4 (M Millipore), stained with Coomassie Blue and the band cut from the membrane. Amino terminal amino acid sequences were previously obtained by Edman degradation [3,7]. Internal peptides sequences were obtained by digestion of the purified protein with trypsin and the resulting digest was subjected to MALDI-TOF MS performed on a Perseptive Biosystems Voyager-DE STR at Harvard Microchemistry Facility (Cambridge, MA).
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
2.3. cDNA cloning and sequencing A white shrimp unidirectional cDNA library was constructed from juvenile intermolt shrimps as follows. Hepatopancreas were dissected, rinsed with RNase-free shrimp anticoagulant solution, immediately homogenized in a guanidinium isothiocyanate solution using a Polytron and total RNA was isolated using the RNaid Matrix (BIO 101, La Jolla, CA). PolyAþ RNA was purified using Dynabeads (Dynal, Oslo, Norway) following the manufacturer’s instructions. A cDNA library was constructed using the ZAP Expressw cDNA Synthesis Kit, following the manufacturer recommendations (Stratagene, La Jolla, CA). Primers for PCR amplification of a cDNA fragment encoding bGBP-HDL were designed based on amino acid sequences of the amino terminus and two internal fragments (Table 1). PCR was carried out in a 50 ml reaction containing 50 mM KCl, 10 mM Tris –HCl, (pH 8.3), 250 m dNTPs (each), 1.5 mM MgCl2, 0.5 mM each primers and 4 ml of the hepatopancreas cDNA library under the following conditions: 3 min, 94 8C, (one cycle); 1 min, 55 8C, 3 min,72 8C (1 cycle); 3 min, 94 8C; 1 min, 42 8C; 3 min, 72 8C (1 cycle); 3 min, 94 8C; 1 min, 52 8C; 3 min, 72 8C (33 cycles); and 10 min at 72 8C (1 cycle). PCR products were cloned into a pCR 2.1-TOPO TA cloning vector (Invitrogen, Carlsbad, CA) following
715
the manufacturer instructions. The recombinant products were designated as pPvBLp1 (primer pairs 1Fw and 5Rv) and pPvBLp2 (primer pairs 1Fw and 6Rv). Primers were also designed based on an expressed sequence tag (EST; dbEST Id: 6347782, GenBank BF024091), to amplify the 50 UTR (Table 1). 2.4. Probes and screening A probe was prepared using the bGBP-HDL fragment (, 2 kb) contained in pPvBLp2, labeled with digoxigenin (DIG) by random-priming labeling (Boehringer – Mannheim – Roche, Indianapolis, IN). For screening of the hepatopancreas cDNA library, approximately 250 000 plaques were blotted onto Nylon (Hybond þ , Amersham, Pharmacia Biotech) membranes and hybridizations carried out overnight (16 h) at 65 8C in 5 £ SSC, 0.1% N-laurylsarcosine, 0.02% SDS and 1% blocking reagent. The filters were washed twice with 2 £ SSC, 0.1% SDS at room temperature for 5 min, and twice with 0.1 £ SSC, 0.1% SDS at 68 8C for 15 min under constant agitation. The filters were rinsed briefly with washing buffer (maleic acid buffer (0.1 M maleic acid, 0.15 M NaCl; pH 7.5), 0.3% Tween 20 (v/v)) and incubated with 1 £ blocking solution (Boehringer – Mannheim) for 30 min, then incubated with anti-DIG-AP conjugate (150 mU/ml) in blocking solution and washed
Table 1 Partial amino acid sequences of bGBP-HDL and nucleotide sequences of primers Primer name
DNA sequence
Position
Amino acid sequences
1Fwa 5Rvb 6Rvb 5UTRa3 5UTRb3 5MR 1F 4R 6F 13R
GGGNCARGCIWSIYTIGCNGGNAAYTTYAA GAGGGTTTIATRTCNGCIATRTTIATRTC GCYTCIATRTTNCCYTCNARIGTYTC TATGGAAACAGATCTGGAAGAG GACATTGATAACAGAGAGGAGC CCAGTAAGAGCCAAGATCTC CCTTGGTCAGAATGAAATCAC TCGATCCTCTCGAAGTCTTCG TCAATATGGAAATGAGCACG GGAAGCTGTAATCCAGATC
646–674 2332–2357 2539–2564 NI 277–298 865–884 1269–1289 5817–5837 3005–3024 3754–3772
GQASLAGNFN DINIADINP ETLEGNIEA NI DIDNTEE EILALTG LGQNEIT 30 UTR NMEMST DVDYSF
3 a b
UTR, designed based on EST (dbEST Id: 6347782, GenBank BF024091); NI, not included. Degenerate primer designed based on the N-terminal sequence. Degenerate primers designed based on internal peptide sequences.
716
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
twice with washing buffer and finally equilibrated with detection buffer (0.1 M Tris– HCl, 0.1 M NaCl, 50 mM MgCl2, pH 9.5). Positive plaques were detected with NBT/BCIP. Putative positive plaques were subjected to secondary and tertiary screening until pure. Plasmids were obtained from phagemids by in vivo excision using ExAssist Helper phage with E. coli XLOLR (Stratagene) and used for sequencing. Subcloning and primer walking was used to obtain the complete nucleotide sequence of both strands (100%) of the cDNA. Specific primers were designed based on the previously obtained sequence. 2.5. DNA sequencing and sequence analysis All clones were thoroughly sequenced by the dideoxy chain-termination method at the LMSE facility (Laboratory of Molecular and Systematic Evolution) at the University of Arizona. The cDNA sequence was analysed with the DNASIS v 2.5 (Hitachi Software Engineering America, Ltd). The nucleotide and deduced protein sequence was compared to non-redundant nucleotide, EST, and protein databases using the BLAST algorithm [19] at the National Center for Biotechnology Information, Bethesda, MD (http://www.ncbi.nlm.nih. gov/BLAST/) and ProtParam was used to analyze the deduced protein characteristics (http://ca.expasy. org/tools/protparam.html). bGBP-HDL predicted polypeptide sequence was also analysed by hydrophobicity using the hydrophobic cluster analysis (HCA) method [20 – 22] and the secondary structure was predicted using the PSIPRED algorithm [23,24] as implemented in the web accessible server available at http://bioinf.cs.ucl.ac.uk/psipred/ psiform.html. 2.6. Northern and RNA dot blot analysis Total RNA from P. vannamei hepatopancreas was isolated using TRIzol (Gibco, BRL), 20 mg were denatured in formamide and separated in denaturing agarose-gel (1% agarose/1 M formaldehyde) [25], vacuum blotted to nylon membranes and crosslinked by UV treatment. A PCR fragment of 4568 bp was generated using internal primers (1F and 4R corresponding to positions 1269 – 5837 of the complete cDNA sequence and 25 ng of DNA were
labeled with a-32P dCTP by random primer labeling and used for Northern hybridization. Alongside, an RNA dot blot was done containing 4 mg of total RNA from hepatopancreas, muscle, pleopods and gills. Membranes were pre-hybridized for 1 h at 65 8C in 5 £ SSC (20 £ SSC 3 M NaCl, 0.3 M sodium citrate, pH 7.0), 5 £ Denhardt’s solution (100 £ Denhardt’s solution: 2% (w/v) bovine serum albumin, 2% (w/v) Ficoll and 2% polyvinylpyrrolidone), 0.1% SDS and 100 mg/ml herring sperm DNA [26], the probe added and hybridization done for 24 h at 65 8C. The membranes were washed with 2 £ SSC, 0.1% SDS 15 min at room temperature, 2 £ SSC, 0.5% SDS 15 min at 60 8C, 0.2 £ SSC, 0.1% SDS 30 min at 60 8C and 0.1 £ SSC, 0.1% SDS 1 h at 68 8C, and subjected to autoradiography at 2 80 8C with BIOMAX films (Kodak) using intensifying screens. 2.7. Reverse transcriptase-PCR analysis (RT-PCR) Hepatopancreas, hemocytes, muscle, pleopods and gills total RNA were pre-treated with DNAse I (1 U/mg of total RNA) and 1.2 mg were reverse transcribed using oligo dT and SuperScript II reverse transcriptase (Gibco, BRL). The cDNA from the different tissues was amplified by PCR using the internal primers 6Fw and 13R that produce a fragment of 767 bp. Two primers were designed to amplify the b-Actin transcript (GenBank AF300705) from the same RNA for comparisons and designated as Act-Fw (positions 652-671) and Act-Rv (1197-1216). PCR products were separated by electrophoresis on a 1.0% agarose gel and visualised by ethidium bromide staining. Transcripts abundance respect to actin was estimated by band intensity densitometry using Kodak Digital Science ID Image Analysis Software v 3.0 (New Haven, CT).
3. Results and discussion By using degenerate primers designed from the amino acid sequence of the mature N-terminus and two internal peptides, a , 1.8 and 2.0 kb fragments were obtained by PCR from the hepatopancreas cDNA library (Fig 1). The deduced amino acid sequence of these fragments was similar to bGBP
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 1. Restriction map and overlapping clones of the bGBP-HDL from P. vannamei. The complete sequence is 6379 bp long with overlapping clones: pPvBLpUTR, pPvBLp1 and pPvBLp2 obtained using a PCR strategy and pPvBLp3, isolated from the cDNA library using pPvBLp2 as a probe. Restriction sites S: Sal I, E: Eco RI, X: Xho I. The corresponding positions of the clones with respect to the complete sequence are: pPvBLpUTR, nucleotide positions 1-884; pPvBLp1, 646-2357; pPvBLp2, 646-2564 and pPvBLp3, 805-6379.
from the freshwater crayfish, P. leniusculus [27]. Using the 2.0 kb clone as a probe, 250 000 plaques from the hepatopancreas cDNA library were screened and 27 putative clones obtained in the first screening. After tertiary screening, five different clones with inserts of approximately 4.5 kb were obtained; all the clones differed in their 50 -ends and did not contain the sequence corresponding to the N-terminus of the bGBP-HDL. To obtain the 50 region of the bGBP-HDL cDNA, we used an EST from GenBank named PvP 352 (dbEST Id: 6347782, GenBank BF024091) reported by other authors [28]. This EST is 906 bp long, contains several ambiguities and overlapped by approximately 200 bp with the sequence that we had obtained from the clones using degenerate primers and corresponding to N-terminus of the mature protein (pPvBLp1 and pPvBLp2, Fig. 1). Based on this EST, we designed two forward primers: 5UTRa and 5UTRb. PCR was carried out using every one of these primers in combination with 5MR and cDNA as template. The PCR products sequences were overlapped and aligned to obtain the full length cDNA sequence of the bGBP-HDL (Figs. 1 and 2). The complete cDNA (6379 bp) encodes a deduced 1454 amino acid residue protein. The Nterminal amino acid of the mature bGBP-HDL
717
(DAGQASLAGNFNSLRFNMKTPFERA) [5] is found 197 residues after the first methionine (Fig. 2). The cDNA sequence contained a polyadenylation signal AATAAA twelve nucleotides upstream the polyAþ tail. A long 30 -untranslated sequence of 1966 nucleotides was present between the termination codon and the polyAþ. This region contains two ATTTA (positions 6142 and 6153) destabilization mRNA motifs that are involved in mRNA decay [29] and has 96% nucleotide identity with a 618 nt EST (PsP 471 L99-05 Litopenaeus setiferus cDNA, GenBank accession BF024578.1) with as yet, unassigned identification. The bGBP-HDL cDNA sequence contains an open reading frame of 1454 amino acids that contains the previously determined amino terminal sequence [5] and three internal amino acid sequences obtained by tryptic digestion (Fig. 2). The first Met residue is present 197 residues upstream the mature N-terminus and there is no consensus secretion signal peptide. Although this is a long fragment that is removed to generate the mature N-terminus of the protein, a segment of 109 residues occurs also in the crayfish bGBP [27] and these regions are also homologous between these two proteins (Fig. 3). Potential processing sites for the precursor protein are found near the mature N- and C-termini in both, shrimp and crayfish. The sequence RSKR conforming to the (R(K)/XX/R(K) paired-basic motif is found in positions 2 12 to 2 15 and a second site is located in positions 1091– 1094 with residues RVRR; thus it is possible that the bGBP-HDL precursor polypeptide is proteolytically processed at both extremes to produce the mature protein. This paired-basic motif is a processing site that is recognized by subtilisin-like proprotein convertase [30] and it is involved in the proteolytic processing of proteins such as vitellin from Macrobrachium rosenbergii [31] and in mosquito Aedes aegypti pro-vitellogenin, inducible during vitellogenesis [32]. Since we detected previously a , 140 kDa protein in western blots of crude protein extracts and in in vitro translated mRNA from hepatopancreas [33], it appears that this is the true precursor protein. Perhaps, this unusual N-terminal region of the precursor protein plays a role in the correct folding, lipid loading mechanism and/or secretion of the protein and compensates for the lack
718
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 2. Nucleotide sequence and deduced amino acid sequence of bGBP-HDL cDNA. The deduced amino acid sequence is shown above the cDNA nucleotide sequence. The amino acid sequence of the N-terminal of the mature protein is shown in bold and the internal peptides are bold and italics. The RGD sequence is in bold and parenthesis. The putative glucanase regions are double underlined. The(R(K)/X/X/R(K)) sites are underlined. The polyadenylation signal are marked with (00 ) and underlined. The stop codon is marked with an asterisk (*). The mRNA destabilization elements are shown in bold and dot underlined.
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 2 (continued )
719
720
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 2 (continued )
of a typical secretion signal peptide, but this remains still unknown. The N-terminal sequence of the bGBP-HDL is a highly conserved region between two Penaeid shrimps [5,10] and the freshwater crayfish [27]. Four O-glycosylation (187-T, 980-T, 415-S, and 1191-S) and five N-glycosylation (374-N, 395-N, 628-N, 685N and 956-N) potential sites were also found in the deduced primary sequence (Fig. 2). The presence of carbohydrates in this protein was reported [3,8]; however, attempts to detect changes in migration of the purified protein after deglycosylation were unsuccessful, perhaps related to the amount of carbohydrates present or to an interference by the lipids present. Crayfish bGBP is also highly glycosylated with mannose, glucose and fucose as the main monomers [27]. The deduced amino acid sequence of the shrimp BGBP-HDL has 54% identity to the crayfish bGBP [27] and, considering conservative replacements, these proteins are 73% similar (Fig. 3). Two glucanase-like stretches were found in P. leniusculus bGBP, but no glucanese activity was detected [27]; these regions are also found in the shrimp bGBPHDL, corresponding to residues 456 –476 and 911– 931 (Figs. 2 and 3). Shrimp bGBP-HDL shares with crayfish bGBP the Arg-Gly-Asp (RGD) motif observed in proteins with established cellular adhesion function [34]. After alignment of both sequences, the shrimp RGD site (amino acids 782– 784) piles up with a conserved RGE site in the crayfish sequence; it is known that RGD/E sites have a similar function to the cognate
RGD motif [35]. In P. leniusculus, a synthetic peptide RGES induced degranulation and spreading of blood cells but it had no influence on bGBP binding to fixed blood cells; however, it was not possible to rule out that other regions might be necessary for bGBP binding to blood cell receptor [27], but this has not been investigated in shrimp. Since bGBP-HDL is circulating in hemolymph and only the b-glucanbGBP complex can trigger defence reactions, it is likely that a conformational change is required for binding to hemocytes receptors; therefore other regions of the proteins may play an important role. Additional support for processing of the precursor also arises from analysis of the predicted secondary structure of the processed polypeptide and the experimental evidence obtained by circular dicroism; the shrimp bGBP-HDL polypeptide is predicted to contain 50.2% b-sheets, 10.5% a-helices, and 39.3% random coils, in agreement with the experimentally determined data of 53% b-sheets, 20% a-helix and 27% random coils and turns [16]. Since comparisons against GenBank led only to significant similarities to the crayfish bGBP, bioinformatic methods were used to identify other features consistent with the bifunctional role as lipoprotein and glucan-binding protein of the bGBP-HDL. HCA [21] was chosen for comparisons, because of its known sensitivity to identify sequence similarity and secondary structure elements in amino acid sequences. Two important regions in bGBP-HDLs were chosen for the HCA analysis. First, the shrimp bGBP-HDL amino acid terminus that is highly conserved at the sequence as well as in the pattern of hydrophobic
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
721
Fig. 3. Alignment of the amino acid sequence of P. vannamei bGBP-HDL (GenBank AY249858) and P. leniusculus bGBP (GenBank X80687), using Clustal X. Identical residues are in white with black background and conserved residues are denoted in white with gray background. Gaps were introduced to obtain maximal sequence alignment. The number is based on the sequence of the shrimp bGBP-HDL.
722
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 3 (continued )
residues as observed by the cluster Leu-Phe-Leu-MetPhe in shrimp and Leu-Val-Phe-Leu-Phe in crayfish (Fig. 4, panel A). Second, the region surrounding the RGD/E motif, where the residues are Val-Tyr and Phe-Met in shrimp and Val-Val-Tyr and Val-Phe in crayfish (Fig. 4, panel B), perhaps related to a particular feature of the protein. HCA analysis did not predict a secondary structure element on the RGD/ E motif indicating that probably it is part of a coil or loop exposed in the folded protein. The secondary structure prediction of b-sheets, remarkably matches the experimentally determined values obtained by circular dichroism spectroscopy [16]. b-sheets are proposed as important structural elements for the function of non-exchangeable lipids at the lipoprotein binding cavity [36].
Tissue-specific expression of bGBP-HDL was analyzed by RNA blot and RT-PCR. Total RNA was extracted from hepatopancreas, hemocytes, muscle, pleopods and gills from white shrimp. Northern blot of hepatopancreas RNA detected two bands with approximate sizes of 6 and 4 kb (Fig. 5, panel A) and a signal, albeit faint, was detected in the dot blot of RNA from muscle, pleopods and gills (Fig. 5, panel B). The 6 kb transcript size corresponds well with the complete sequence whereas the size of the 4 kb corresponds well with the size of the coding sequence. If there is some processing at the mRNA level is still unknown. Because bGBP was only detected in hepatopancreas from P. leniusculus [27], we wanted to get a comparative estimation of the bGBP-HDL transcript abundance in
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
723
Fig. 4. Sequence alignment of selected regions of P. vannamei bGBP-HDL and P. leniusculus bGBP, and hydrophobic cluster analysis (HCA) plots of the corresponding regions. Clusters of hydrophobic residues are boxed. Glycine residues are represented by filled diamonds. Proline is represented by a star and serine by a box with dot inside. Panel A, mature N-terminal sequence. Panel B, RGD domain. Amino acid numbering is assigned using the mature protein N-terminus.
the different tissues. Therefore, RT-PCR was carried out using internal primers for bGBP-HDL and actin as a control (Fig. 5, panel C). The result was similar to the dot blot; higher abundance in hepatopancreas, followed by gills and pleopods and a faint band from muscle, but no PCR product was detected in hemocytes. This contrasts with the reports in crayfish using Northern blotting, where a signal was only detected in hepatopancreas RNA [27]. This may represent a difference between the expression of the bGBP-HDL in a freshwater and a marine decapod crustacean or may be due to the sensitivity of the technique. Nevertheless, hepatopancreas appears to be the main tissue expressing the bGBP-HDL gene.
Taking in consideration the amount of DNA obtained in the PCR using bGBP-HDL primers or actin, a densitometric evaluation of the gel bands estimates roughly, that in shrimp hepatopancreas, the actin PCR product is 4.8 times more abundant that the bGBP-HDL, whereas hepatopancreas bGBP-HDL is 29, 4 and 2 times more abundant than the muscle, gills and pleopods transcripts, respectively. RT-PCR amplification was only due to the amount of mRNAs present, since the RNA preparation did not contain genomic DNA (Fig. 4, panel D). Another b-glucan binding protein was recently purified and cloned from hemocytes of P. leniusculus [13] and P. monodon [15] and from hepatopancreas
724
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
Fig. 5. Detection of bGBP-HDL transcripts. Panel A, Northern blot of hepatopancreas total RNA (20 mg). Panel B, dot blot of total RNA (4 mg). Panel C, RT-PCR. Panel D, RT-PCR of an actin fragment amplified from total RNA subjected to reverse transcription (þRT) and control (2RT). The identity of the fragments was verified by sequencing. The bands intensity of the RT-PCR for bGBP-HDL and actin products (panel C), were quantified using Image Analysis Software (Kodak Digital Science. Hepatopancreas (H), Hemocytes (Hm), muscle (M), pleopods (P) and gills (G) from P. vannamei.
of P. stylirostris [14], but these three are approximately 30 –45 kDa proteins and not reported to be lipoproteins. Nevertheless, they contain RGD binding and glucanase-like domains. Interestingly, expression of the P. stylirostris LGBP was shown to be upregulated in virus infected shrimp, with series of up and down regulations of the proPO gene as the virus infection progressed [14], but they appear to be unrelated to the bGBP-HDLs from shrimp and crayfish. In summary, two different glucan binding proteins appear to be synthesized by decapod crustaceans. They differ remarkably in size and only one is known to be a lipoprotein. The bGBP-HDL secondary structure (a-helix and b-sheets) content are similar to insect high density lipophorins, whereas, the integrin-motifs and glucanase-like domains are found in PRP involved in innate immunity, explaining at least partially, the structural-bifunctional role of the shrimp bGBP-HDL. The high abundance of the bGBP-HDL transcript in hepatopancreas, is probably related to its role as a major lipid storage gland and synthesizer of hemolymph proteins, similar to the insect fat body.
However, the recent high number of ESTs with similarity to proteins involved in immune defence found in hepatopancreas from several Penaeids, has led to the proposal that the otherwise considered mainly as a digestive gland, may play an important role in defence [28]. Whether the expression of the bGBP-HDL is regulated in response to dietary lipids or infections, remains to be investigated.
Acknowledgements This work was funded by grants from Consejo Nacional de Ciencia y Tecnologı´a, Me´xico (29091 and 36926) to GYP and from International Foundations for Science (A/2500). M.G. RomoFigueroa had a graduate fellowship from Consejo Nacional de Ciencia y Tecnologı´a (Me´xico). We express our gratitude to Drs Maria Islas-Osuna and John H. Law for advice and critical reading of the manuscript, to Dr T. Gollas-Galva´n for technical help and Dr J. Herna´ndez-Lo´ pez and MSc E. Villalpando for providing and keeping the experimental shrimps.
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
References [1] Janeway CA, Medzhitov R. Innate immune recognition: mechanisms and pathways. Annu Rev Immunol 2002;20: 197–216. [2] Yu XQ, Zhu YF, Ma C, Fabrick JA, Kanost MR. Pattern recognition proteins in Manduca sexta plasma. Insect Biochem Mol Biol 2002;32:1287–93. [3] Vargas-Albores F, Jime´nez-Vega F, Yepiz-Plascencia G. Purification and comparison of b-1,3-glucan binding protein from white shrimp (Penaeus vannamei). Comp Biochem Physiol 1997;116B:453 –8. [4] Vargas-Albores F, Yepiz-Plascencia G. Beta glucan binding protein and its role in shrimp immune response. Aquaculture 2000;191:13– 21. [5] Yepiz-Plascencia G, Vargas-Albores F, Jimenez-Vega F, Ruiz-Verdugo LM, Romo-Figueroa G. Shrimp plasma HDL and b-glucan binding protein (BGBP): comparison of biochemical characteristics. Comp Biochem Physiol 1998; 121B:309–14. [6] Hall M, VanHeusden MC, So¨derha¨ll K. Identification of the major lipoproteins in crayfish hemolymph as proteins involved in immune recognition and clotting. Biochem Biophys Res Commun 1995;216:939– 46. [7] Ruiz-Verdugo LM, Garcı´a-Ban˜uelos M, Vargas-Albores F, Higuera-Ciapara I, Yepiz-Plascencia GM. Amino acids and lipids of the plasma HDL from the white shrimp Penaeus vannamei Boone. Comp Biochem Physiol 1997; 118B:91–6. [8] Yepiz-Plascencia G, Sotelo-Mundo R, Vazquez-Moreno L, Ziegler R, Higuera-Ciapara I. A non-sex-specific hemolymph lipoprotein from the white shrimp Penaeus vannamei Boone. Isolation and partial characterization. Comp Biochem Physiol 1995;111B:181–7. [9] Yepiz-Plascencia G, Jime´nez-Vega F, Romo-Figueroa MG, Sotelo-Mundo RR, Vargas-Albores F. Molecular characterization of the bifunctional VHDL-CP from the hemolymph of white shrimp Penaeus vannamei. Comp Biochem Physiol 2002;132B:585–92. [10] Yepiz-Plascencia G, Vargas-Albores F, Jimenez-Vega F, Ruiz-Verdugo LM, Romo-Figueroa G. Comparison of shrimp high density lipoprotein and beta glucan binding protein. In: Flegel TW, editor. Advances in Shrimp Biotechnology. Bangok: National Center for Genetic Engineering and Biotechnology; 1998. p. 153 –8. [11] Komatsu M, Ando S. A very-high-density lipoprotein with clotting ability from hemolymph of sand crayfish, Ibacus ciliatus. Biosci Biotech Biochem 1998;62:459–63. [12] Ma C, Kanost MR. A b1,3-glucan recognition protein from an insect, Manduca sexta, agglutinates microorganisms and activates the phenoloxidase cascade. J Biol Chem 2000;275: 7505–14. [13] Lee SY, Wang R, So¨derha¨ll K. A lipopolysaccharide- and b-1,3-glucan-binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization and cDNA cloning. J Biol Chem 2000;275: 1337–43.
725
[14] Roux MM, Pain A, Klimpel KR, Dhar AK. The lipopolysaccharide and B-1,3-glucan binding protein gene is upregulated in white spot virus-infected shrimp (Penaeus stylirostris). J Virol 2002;76:7140–9. [15] Sritunyalucksana K, Lee SY, Soderhall K. A beta-1,3-glucan binding protein from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2002;26:237–45. [16] Vargas-Requena CL, Herna´ndez-Santoyo A, Yepiz-Plascencia G, Vargas-Albores F, Higuera-Ciapara I, Rodrı´guez-Romero A, Soulages JL, Sotelo-Mundo Rogerio R. Biophysical evidence of lipid and carbohydrate binding activities of shrimp high density lipoprotein/B glucan binding protein. Protein Pept Lett 2002;9:337–44. [17] Vargas-Albores F, Guzma´n-Murillo MA, Ochoa JL. An anticoagulant solution for haemolymph collection and prophenoloxidase studies of Penaeid shrimp (Penaeus californiensis). Comp Biochem Physiol 1993;106A:299 –303. [18] Jimenez-Vega F, Sotelo-Mundo R, Ascencio F, VargasAlbores F. 1,3-b-D glucan binding protein (BGBP) from the white shrimp, Penaeus vannamei, is also a heparin binding protein. Fish Shellfish Immunol 2002;13:171–8. [19] Altschul SF, Gish G, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403 –10. [20] Woodcock S, Mornon JP, Henrissat B. Detection of secondary structure elements in proteins by hydrophobic cluster analysis. Protein Eng 1992;5:629– 35. [21] Lemesle-Varloot L, Henrissat B, Gaboriaud C, Bissery V, Morgat A, Mornon JP. Hydrophobic cluster analysis: procedures to derive structural and functional information from 2D-representation of protein sequences. Biochimie 1990;72: 555 –74. [22] Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol 1982;157: 105 –32. [23] Jones DT. Protein secondary structure prediction based on position-specific scoring matrices. J Mol Biol 1999;292: 195 –202. [24] McGuffin LJ, Bryson K, Jones DT. The PSIPRED protein structure prediction server. Bioinformatics 2000;16:404–5. [25] Fourney RM, Miyakoshi J, Day III RS, Paterson MC. Northern blotting: efficient RNA staining and transfer. Focus 1988;10: 5– 7. [26] Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor; 1989. [27] Cerenius L, Liang Z, Duvic B, Keyser P, Hellman U, TapioPalva E, Iwanaga S, So¨derha¨ll K. Structure and biological activity of a 1,3-b-D -glucan-binding protein in crustacean blood. J Biol Chem 1994;269:29462–7. [28] Gross PS, Bartlett TC, Browdy CL, Chapman RW, Warr GW. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific white shrimp, Litopenaeus vannamei, and the Atlantic white shrimp, L. setiferus. Dev Comp Immunol 2001;25:565–77. [29] Zhang L, Ge L, Parimoo S, Stenn K, Prouty SM. Human stearoyl-CoA desaturase: alternative transcripts generated from a single gene by usage of tandem polyadenylation sites. Biochem J 1999;349:255– 2645.
726
M.G. Romo-Figueroa et al. / Developmental and Comparative Immunology 28 (2004) 713–726
[30] Tufail M, Lee JM, Hatakeyama M, Oishi K, Takeda M. Cloning of vitellogenin cDNA of the American cockroach, Periplaneta americana (Dictyoptera), and its structural and expression analyses. Arch Insect Biochem Physiol 2000;45: 37–46. [31] Chen Y-N, Tseng D-Y, Ho P-Y, Kuo C-M. Site of vitellogenin synthesis determined from cDNA encoding a vitellogenin fragment in the freshwater giant prawn Macrobrachium rosenbergii. Mol Rep Dev 1999;54:215 –22. [32] Hirai M, Watanabe D, Kiyota A, Chinzei Y. Nucleotide sequence of vitellogenin mRNA in the bean bug, Riptortus clavatus: analysis of processing in the fat body and ovary. Insect Biochem Mol Biol 1998;28:537–47. [33] Yepiz-Plascencia G, Gollas-Galva´n T, Vargas-Albores F, Garcı´a-Banuelos M. Synthesis of hemolymph high-density
lipoprotein b-glucan binding protein by Penaeus vannamei shrimp hepatopancreas. Mar Biotechnol 2000;2:485–92. [34] Ouaissi MA. Role of the RGD sequence in parasite adhesion to host cells. Parasitol Today 1988;4:169–73. [35] Hoeflich A, Reisinger R, Vargas GA, Elmlinger MW, Schuett B, Jehle PM, Renner-Muller I, Lahm H, Russo VC, Wolf E. Mutation of the RGD sequence does not affect plasma membrane association and growth inhibitory effects of elevated IGFBP-2 in vivo. FEBS Lett 2002;523:63–7. [36] Mann CJ, Anderson TA, Read J, Chester SA, Harrison GB, Kochl S, Ritchie PJ, Bradbury P, Hussain FS, Amey J, Vanloo B, Rosseneu M, Infante R, Hancock JM, Levitt DG, Banaszak LJ, Scott J, Shoulders CC. The structure of vitellogenin provides a molecular model for the assembly and secretion of atherogenic lipoproteins. J Mol Biol 1999;285:391 –408.