- Email: [email protected]
Molecular Cloning of a Highly Conserved Mouse and Human Integral Membrane Protein (Itm1) and Genetic Mapping to Mouse Chromosome 9
GENOMICS
31, 295–300 (1996) 0051
ARTICLE NO.
Molecular Cloning of a Highly Conserved Mouse and Human Integral Membrane Protein (Itm1) and Genetic Mapping to Mouse Chromosome 9 GUIZHU HONG,* WILLY DELEERSNIJDER,† CHRISTINE A. KOZAK,‡ ERIC VAN MARCK,§ PRZEMKO TYLZANOWSKI,* AND JOSEPH MERREGAERT*,1 *Department of Biochemistry, Laboratory of Molecular Biotechnology, University of Antwerp, Universiteitsplein 1, 2610 Wilrijk, Belgium; †N.V. Innogenetics, S.A., Industriepark, Zwijnaarde, 9052 Ghent, Belgium; ‡National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland 20892; and §Department of Pathology, University of Antwerp, 2610 Wilrijk, Belgium Received May 3, 1995; accepted November 2, 1995
We have isolated and characterized a novel cDNA coding for a highly hydrophobic protein (B5) from a fetal mouse mandibular condyle cDNA library. The full-length mouse B5 cDNA is 3095 nucleotides long and contains a potential open reading frame coding for a protein of 705 amino acids with a calculated molecular weight of 80.5 kDa. The B5 mRNA is differentially polyadenylated, with the most abundant transcript having a length of 2.7 kb. The human homolog of B5 was isolated from a cDNA testis library. The predicted amino acid sequence of the human B5 is 98.5% identical to that of mouse. The most striking feature of the B5 protein is the presence of numerous (10–14) potential transmembrane domains, characteristic of an integral membrane protein. Similarity searches in public databanks reveal that B5 is 58% similar to the T12A2.2 gene of Caenorhabditis elegans and 60% similar to the STT3 gene of Saccharomyces cerevisiae. Furthermore, the report of an EST sequence (Accession No. Z13858) related to the human B5, but identical to the STT3 gene, indicates that B5 belongs to a larger gene family coding for novel putative transmembrane proteins. This family exhibits a remarkable degree of conservation in different species. The gene for B5, designated Itm1 (Integral membrane protein 1), is located on mouse chromosome 9. q 1996 Academic Press, Inc. INTRODUCTION
In an effort to characterize the early stages of osteogenic differentiation, we are screening a cDNA library Sequence data from this article have been deposited with the GenBank/EMBL Data Libraries under Accession Nos. L34260 (mouse B5), L38961 (human B5), and U25345 (mouse promoter). 1 To whom all correspondence should be addressed. Department of Biochemistry, Laboratory of Molecular Biotechnology, Universitaire Instelling Antwerpen, Universiteitsplein 1, 2610 Wilrijk, Belgium. Telephone: 32-3-820-2311. Fax: 32-3-820-2248. E-mail: merrega@ uia.ua.ac.be. 2 Abbreviations used: PCR, polymerase chain reaction; kb, kilobases; RACE, rapid amplification of cDNA ends; EST, expressed sequence tag; E, embryonic.
of mouse mandibular condyles to isolate genes that may be modulated during this process (W. Deleersnijder et al., in preparation). The mandibular condyle is a cartilaginous protrusion of the mandible that is initially involved in the growth of the mandible and subsequently serves as an articulating surface for the squamosomandibular joint. When explanted in vitro, prenatal mouse mandibular condyles undergo osteogenic differentiation. Under these conditions, the perichondrial progenitor cells differentiate into osteoblasts rather than chondroblasts and sequentially express a number of bone-typifying markers (Strauss et al., 1990). This property offers a unique opportunity to time precisely the onset of osteogenesis and permits isolation of transcripts that may be crucial to this process. We have isolated a few cDNA clones that were apparently differentially expressed at the onset of the in vitro induced osteogenesis. One of these clones, B5, was analyzed further. Here, we describe the isolation and characterization of mouse and human full-length cDNA clones of B5. Sequence analysis indicates that B5 is a novel gene related to T12A2.2 of Caenorhabditis elegans and the STT3 gene of Saccharomyces cerevisiae. B5 contains multiple membrane spanning domains, implying that it is an integral membrane protein. The gene, designated Itm1 (Integral membrane protein 1), has been mapped by linkage analysis to mouse chromosome 9. MATERIALS AND METHODS Isolation of mouse cDNA. Mandibular condyles were dissected from mouse fetuses at Day 18 of embryonic development (E18)2 and either immediately frozen in liquid nitrogen or cultured for an additional 18–24 h (E18 / 1d) before freezing. cDNA libraries were constructed from both the E18 and the E18 / 1d condyles in the pSPORT1 vector using the Superscript plasmid system (GIBCOBRL). Clone B5 was originally isolated from the E18 / 1d cDNA library by differential screening using nonsubtracted probe from the E18 / 1d library and subtracted probe obtained by subtracting E18
295
/ m4752f3842
01-09-96 20:54:24
gnma
0888-7543/96 $12.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AP-Genomics
296
HONG ET AL.
/ 1d-library-derived cDNA with in vitro transcribed cRNA from the E18 library (W. Deleersnijder et al., in preparation). Approximately 5 1 105 colonies from the E18 / 1d mouse condyle cDNA library were rescreened by standard methods (Maniatis et al., 1989) with 32P-labeled B5 probe (random primer labeling kit, Stratagene). From this screening, two positive clones, B12 and B28, were isolated. A 360-bp 5*-end fragment produced by PCR from the longer clone B28 was subsequently used as a probe to rescreen the E18 / 1d condyle cDNA library, yielding eight overlapping clones (B30, B31A, B31B, BX, BX2, BX4, BX5, and BX7). Isolation of human B5 cDNA. A human testis cDNA library (in lgt11) was a gift from Dr. B. Oostra (Leiden, The Netherlands). Approximately 2 1 105 plaques from this library were screened using a 186-bp radiolabeled PCR fragment of mouse B5 (corresponding to amino acids 561–623) as hybridization probe. Five positive phage clones were obtained and purified. Phage DNAs were isolated (Maniatis et al., 1989) and subcloned into the plasmid vector pUC18 (Pharmacia). Isolation of the mouse B5 genomic clone. A BALB/c mouse liver genomic library in the EMBL SP6/T7 l phage vector was purchased from Clontech (USA). Approximately 1 1 106 plaques of the genomic library were screened using a 420-bp 5*-end fragment produced by PCR amplification from clone BX. Two positive phage clones were identified, and their DNAs were analyzed by digestion with BamHI, EcoRI, or SstI. These products of digestion were blotted and hybridized with the 420-bp fragment derived from BX. The positive fragments were purified by GeneClean (BIO 101) and subcloned into the plasmid vectors pUC18 or pSPORT1. Identification of the 5*-end by rapid amplification of cDNA ends (5*-RACE). The 5*-end sequence of mouse B5 cDNA was obtained using the 5*-RACE system (GIBCO-BRL) according to the manufacturer’s instructions. Two specific antisense primers of B5 were used: MSP1 (400–423), 5* ATGGAGTACATGCTAGACTGCAGC 3*; and MSP2 (93–112), 5* TCTAGATCGCGAGCGGCCGCCCTCTTGACATCAATGGGTGGC 3* (numbers indicates positions on the mouse cDNA sequence; the adapter primer, containing the NotI restriction site, is underlined). Briefly, the first-strand cDNA was produced from 20 ng BALB/c 3T3 poly(A)/ RNA by reverse transcription using MSP1 as the first primer and subsequently tailing the 5*-end with dCTP and terminal dexoynucleotidyltransferase. The tailed cDNA was PCR amplified using MPS2 and an anchor primer that anneals to the homopolymeric C-tail and contains a SalI restriction site (supplied with the kit). The PCR product was digested with NotI and SalI, purified with GeneClean (BIO 101), and subcloned into pSPORT1 digested with NotI and SalI. The clones were sequenced as described below. The 5*-end of the human cDNA was obtained in a similar way. One hundred nanograms of total RNA from human lung was used to synthesize the first-strand cDNA. Two specific antisense primers of human B5 were used (positions refer to the human cDNA sequence; the adapter primer is underlined): HSP1 (793–813), 5* ATCCGGTGAGAGAAACGGCC 3 *; and HSP2 (733–752), 5* TCTAGATCGCGAGCGGCCGCCCTCAGGAACACATAACCTCCC 3*. All primers were obtained from Eurogentec (Belgium). PCR analysis was performed on a Perkin–Elmer-Cetus 9600 apparatus. DNA isolation, sequencing, and computer analysis. Phage DNA was isolated from plate lysates as described (Maniatis et al., 1989). Plasmid DNA isolation was performed according to standard protocols (Qiagen). The nucleotide sequence of the cDNA inserts was determined via the dideoxy chain termination method, using [a-35S]dATP and Sequenase 2.0 (Amersham). Various software packages were used in the course of this study and are mentioned under Results. Northern blot analysis. Total RNA was extracted from various tissues of newborn mice according to the protocol of Chirgwin et al. (1971a). RNA samples (10 mg total RNA) were denatured in 50% formamide, 2.2 M formaldehyde (10 min at 707C); chilled on ice; and separated on a denaturing agarose gel in Mops buffer (50 mM 3-[Nmorpholino]propanesulfonic acid, 1 mM EDTA, pH 7.0) containing 2.2 M formaldehyde. The RNA was transferred to Hybond-N/ mem-
/ m4752f3842
01-09-96 20:54:24
gnma
branes by capillary blotting, and UV-crosslinked blots were hybridized overnight at 427C in 51 SSC, 50% formamide, 51 Denhardt’s, and 1% SDS and washed to a final stringency of 11 SCC at 427C. Genetic mapping. The mouse gene for B5 was mapped by analyses of the progeny of two sets of crosses: (NFS/N or C58/J 1 Mus mus musculus) 1 M. m. musculus (Kozak et al., 1990) and (NFS/N 1 Mus spretus) 1 M. spretus or C58/J (Adamson et al., 1991). Progeny of these crosses have been typed for over 800 markers, including the chromosome 9 markers Icam1 (intercellular adhesion molecule 1), Obcam (opioid binding cell adhesion molecule), Cbl2 (casitas B lineage lymphoma), and Fli1 (Friend leukemia virus integration site). Icam1, Obcam, and Fli1 were typed as previously described (Chakraborti et al., 1993), and Cbl2 was typed using the probe described previously (Regnier et al., 1989) following digestion with PvuII in the M. m. musculus cross and HindIII in the M. spretus cross. Linkage distances were determined according to Green (1981), and gene order was established by minimizing the number of recombinants.
RESULTS
Isolation and Sequence Analysis of Full-Length Mouse B5 cDNA Differential screening of the E18 / 1d library using subtracted (E18 / 1d minus E18) and not subtracted (E18 / 1d) complex cDNA probes led to the isolation of several clones, including clone B5, that hybridized more strongly to the subtracted probe than to the probe that was not subtracted. Although the differential expression of B5 could not be confirmed in later experiments, the specific expression pattern of the B5 clone as demonstrated by in situ hybridization and Northern blot analysis (Hong et al., unpublished results) initially encouraged us to characterize it in more detail. To isolate the full-length cDNA clone of B5, repetitive rescreening of the E18 / 1d library with probes from the 5*-part of the available cDNA allowed the isolation of 10 overlapping cDNA clones. From sequence analysis of the collection of overlapping cDNA clones, it could be deduced that the B5 transcript is differentially polyadenylated. The polyadenylation signals in front of positions 2727–2738 appear to be the most commonly used (8 clones of 11, including B5). This would yield a mRNA length that is in agreement with the 2.7-kb band that is observed by Northern blot analysis (see below). No trace of transcripts of different size could be detected on this blot. 5*-RACE on RNA from the BALB/c 3T3 cell line extended the cDNA sequence obtained from these clones by only 6 bases. The longest open reading frame could start at position 112, although this presumed start codon is surrounded by an imperfect Kozak consensus sequence (GCCA/GCCAUGG) for initiation of translation (Kozak, 1991). The complete cDNA sequence is 3095 nucleotides long (Accession No. L34260) and contains one large open reading frame, coding for a protein of 705 amino acids with a predicted Mr of 80,597 Da. Based on the name of the initial cDNA clone, we refer to this protein as B5. The overall deduced B5 protein sequence is very hydrophobic. Depending on the algorithm used, between 10 (Klein et al., 1985) and 14 (Eisenberg et al., 1984)
AP-Genomics
B5, A HIGHLY CONSERVED PUTATIVE TRANSMEMBRANE PROTEIN
FIG. 1. Hydropathicity plot of the mouse B5 protein. The hydropathic index was determined by the Kyte–Doolittle algorithm with a 15-amino-acid window. Positive values indicate hydrophobic regions, and negative values point to hydrophilic regions. Putative transmembrane domains predicted according to the algorithms of Klein et al. (1985) or Eisenberg et al. (1984) are indicated.
membrane spanning domains are predicted. Figure 1 shows the hydropathicity plot of the B5 protein according to the Kyte–Doolittle algorithm (1982) and indicates the corresponding transmembrane domains. Six of the 10 cysteine residues are found within these transmembrane regions. There are four potential Nglycosylation sites as well as 1 glycosaminoglycan attachment site in the B5 sequence. Furthermore, there are 8 potential casein kinase II and 10 protein kinase C phosphorylation sites. Similarity searches in public databanks (EMBL, GenBank, and PIR) indicated that the B5 gene is about 60% homologous to the C. elegans gene T12A2.2 (Accession No. U13019) (Wilson et al., 1994) and to the yeast gene STT3 (Accession No. P39007) (Yoshida et al.). A remarkable similarity is present at the protein level, where the three proteins share about 56% identity and 70% similarity (Fig. 2). Furthermore, computer searches detected a 65% homology with a 343-bp expressed sequence tag (EST) (Accession No. Z13858) obtained from a T-lymphoblastoid cell line (ATCC No. CCL119). Alignment of the predicted amino acid sequence (93 amino acids) of the long open reading frame of this EST with the sequences of mouse B5, T12A2.2, and STT3 showed that this EST sequence is completely identical to the yeast STT3 gene (amino acid positions 497–590). There is 71% homology with mouse B5 (positions 507–599), while the homology with the T12A2.2 gene is 63%.
297
tion, as in the case of mouse B5. Four clones had a polyadenylation signal at position 2443 (corresponding to the first infrequently used poly(A) signal of mouse B5), whereas the polyadenylation signal of another clone was at position 2704 (corresponding to the poly(A) signal that is predominantly used in the mouse). From these clones and additional 5*-RACE analysis, a complete human B5 cDNA sequence was obtained. The fulllength cDNA sequence of human B5 codes for a protein of 705 amino acids with a predicted Mr of 80,572 Da (Accession No. L38961). Comparison of predicted protein sequences between mouse B5 and human B5 reveals that they differ at positions 4, 128, 133, 193, 415, 454, 608, 611, and 681. Figure 2 shows the alignment of the deduced amino acids for human B5, mouse B5, T12A2.2, and STT3. The deduced amino acid sequence of the partial EST cDNA has 71% homology with human B5 (amino acid positions 507–599). Northern Blot Analysis Northern blot analysis of total RNA from various tissues of mouse embryo revealed that a single transcript of approximately 2.7 kb is present in all tested tissues: brain, heart, liver, lung, skin, tail, calvaria, and pawn (data reviewed but not shown). This 2.7-kb transcript was also found in the mouse osteogenic stromal cell line MN7 (Mathieu et al., 1992), the mouse fibroblastic cell line BALB 3T3 (Aaronson and Todaro, 1968), and the rat C6 glioma cell line (Benda et al., 1968). Promoter Structure of the Mouse B5 Gene To characterize B5 regulatory sequences, a mouse liver genomic library was screened with a 420-bp cDNA probe from the 5*-end of BX. Two positive phages, GC1 and GC2, were isolated. An insert derived from phage GC2 DNA was subcloned into pSPORT1, yielding plasmid pGC2. Restriction enzyme analysis and partial sequence analysis indicated that pGC2 contained approximately 1500 bp upstream of the presumed transcriptional start, in addition to 50 bp from exon 1 and 150 bp from intron 1 (Fig. 3). The putative promoter sequence from pGC2 was determined (Accession No. U25345). The B5 promoter contains a TATA box at positions 058 to 051. Computer analysis reveals that the promoter sequence contains more than 20 putative binding sites for transcription factors (Faisst and Meyer, 1992) such as Myb (0437 to 0432), SP1 (0487 to 0481), GCF (0212 to 0206; 036 to 031), E2A (0811 to 0805), and PPAR (0751 to 0746). This is schematically depicted in Fig. 3.
Isolation and Sequence Analysis of the Human B5 cDNA
Genetic Mapping of the Mouse B5 Gene
Because of the strong expression of B5 in testis, a human testis cDNA library was screened with the mouse B5 cDNA probe. Five positive clones were isolated and characterized. Partial DNA sequence analysis at their 3*-ends revealed differential polyadenyla-
Parental M. m. musculus produced a B5 reactive PstI fragment of 6.6 kb, and NFS/N generated a fragment of 6.3 kb. ApaI digestion produced B5 reactive fragments of ú28 kb in NFS/N and M. spretus DNAs; the spretus fragment was larger and could clearly be distin-
/ m4752f3842
01-09-96 20:54:24
gnma
AP-Genomics
298
HONG ET AL.
FIG. 2. Alignment of the amino acid sequences of Itm1, ITM1, T12A2.2 of C. elegans, and STT3 of S. cerevisiae. The conserved amino acids in the four proteins are indicated in black boxes. The alignment was performed with the GCG software package.
guished from the NFS/N fragment on 0.4% agarose gels. Inheritance of the 6.3-kb fragment in M. m. musculus crosses, the larger of the ApaI fragments in the C58/J progeny of the M. spretus crosses, and the smaller of the ApaI fragments in the M. spretus backcross progeny were compared with the inheritance of 800 markers previously typed in these mice. The gene for B5, designated Itm1 was mapped to proximal chromosome 9 just distal to the locus Fli1 (Fig. 4). This places Itm1 in a region of chromosome 9 with linkage homology to human chromosome 11, sug-
FIG. 3. The 5*-upstream putative regulatory region of the mouse Itm1 gene. The potential regulatory elements and the exon1/intron1 configuration of the mouse Itm1 gene contained within pGC2 are indicated.
/ m4752f3842
01-09-96 20:54:24
gnma
gesting a location for the human homolog. Confirmation of this assignment was obtained from characterization of a panel of rodent 1 human somatic cell hybrids (BIOS, New Haven, CT) for human B5 reactive fragments (unpublished data). DISCUSSION
This paper describes the isolation of mouse and human cDNA clones coding for a novel integral membrane protein, termed B5. Both mouse and human B5 code for a protein of 705 amino acids, with a predicted Mr of, respectively, 80,597 and 80,572 Da. The most striking feature of mouse B5 is the presence of numerous computer-predicted transmembrane domains (10–14 transmembrane domains). This indicates that B5 could be an integral membrane protein. The B5 transcript is detected as a 2.7-kb mRNA band by Northern blot analysis using total RNA of the mouse
AP-Genomics
B5, A HIGHLY CONSERVED PUTATIVE TRANSMEMBRANE PROTEIN
FIG. 4. An abbreviated map of mouse chromosome 9 showing the localization of the mouse Itm1 gene. To the right of the map are recombination fractions between adjacent loci; the first fraction is from the M. m. musculus cross, and the second is from the M. spretus cross. In parentheses are the recombinational distances { standard errors. To the left of the map are human map locations for the underlined genes.
osteogenic stromal cell line MN7. The transcript appears to be differentially polyadenylated, as revealed by the isolation of cDNA clones with poly(A) tails at different locations. However, there appears to be one major site of polyadenylation in the mouse as well as in the human B5 transcript. Interestingly, the polyadenylation signal that is preferentially used in human B5 corresponds to a minor poly(A) signal in mouse and vice versa. The biological significance of this differential polyadenylation is very interesting and needs further investigation. The B5 promoter was partially characterized. It contains a degenerated TATA box and several potential binding sites for the transcription factors SP1, GCF, E2A, Myb, and PPAR. Myb plays a critical role in cell proliferation and differentiation (Ness et al., 1989), which corresponds to our observation that the Itm1 transcript appears to be expressed predominantly in tissues undergoing active proliferation and differentiation (Hong et al., unpublished results). PPAR is a member of the steroid hormone receptor superfamily. The PPAR responsive element (PPRE) is composed of a direct repeat of the half-site motif 5*-TGA/TCCT-3* (Kliewer et al., 1992). However, an additional PPRE half-site motif is apparently not present in the promoter sequence, as known thus far. A remarkable characteristic is the very high degree of evolutionary conservation between mouse and human B5 (98.5%). This suggests that B5 is under severe structural constraints to exert its biological activity. Homology searches in public DNA and protein data-
/ m4752f3842
01-09-96 20:54:24
gnma
299
banks identified B5 homology with the T12A2.2 gene from C. elegans and the STT3 gene from S. cerevisiae. DNA sequence database searches identified complete homology between the yeast STT3 gene and a short anonymous human cDNA sequence deposited as an EST sequence (Z13858). The predicted amino acid sequence of this EST showed only 71% homology with mouse B5, suggesting that this EST sequence is the human counterpart of STT3. Since the human B5 gene is much more similar to mouse B5 than to this human EST sequence, we propose that B5 could be a member of a larger family of transmembrane proteins containing STT3, B5, T12A2.2, and other unidentified genes as members. The gene coding for B5, designated Itm1, is localized on mouse chromosome 9. Based on the human–mouse homology and our unpublished results, the human ITM1 gene is likely to map to 11q23–q24, a region associated with chromosomal translocations, several oncogenes, and the human congenital preneoplastic syndrome, ataxia telangiectasia (Gatti et al., 1988). The t(11,14)(q23,q32) translocation is a rare translocation associated with malignant non-Hodgkin lymphoma (Bloomfield et al., 1983). Recently, the molecular cloning of a novel 11q23 breakpoint from a non-Hodgkin lymphoma and the mapping of this breakpoint to chromosome 11 was reported (Meerabux et al., 1994). It would be interesting to see whether the ITM1 gene is involved in any of these disorders. At this point we can only speculate as to what the biological role of the Itm1 gene product might be. No homology was detected with the large family of cell surface receptors with seven transmembrane domains. Also, the Itm1-encoded protein does not seem to contain domains with enzymatic activity; it is probably not involved in direct transmembrane signaling. The multitude of transmembrane domains found in B5 is, however, a characteristic feature of transporter proteins (Howard, 1993). One large subfamily of this type is represented by the ABC (ATP binding cassette) superfamily of active transporters. As Itm1 does not contain an ATP binding motif, it appears not to belong to this subgroup. Examples from non-ABC transporter proteins include the Na//glucose cotransporter (11 TMDs) (Hediger et al., 1987), a proton-coupled oligopeptide transporter (12 TMDs) (Fei et al., 1994), and a vasopressin-regulated urea transporter (10 TMDs) (You et al., 1993). We therefore tentatively hypothesize that the Itm1 protein is a novel type of permease/transporter membrane protein. The STT3 gene of yeast, originally isolated as a staurosporine-sensitive mutant, was found to be essential for cell growth irrespective of osmotic support. STT3 mutants are defective in protein glycosylation (Yoshida et al.). Our sequence data show that although the yeast STT3 gene product belongs to the same family as B5, it is nevertheless distinct. It is therefore not clear whether B5 is also involved in protein glycosylation. The yeast system would offer an excellent opportunity to test whether the Itm1 gene is
AP-Genomics
300
HONG ET AL.
functionally exchangeable with the STT3 gene. It would also allow us to initiate the in vivo structure function analysis of the B5 protein. In conclusion, a novel gene termed Itm1 has been isolated and localized on mouse chromosome 9. This gene codes for a putative transporter protein that is extremely conserved between mouse and human and belongs to a larger gene family. ACKNOWLEDGMENTS This work was partially supported by the Vlaams Actieprogramma Biotechnologie (VLAB/034 and T.O.P./027). G. Hong gratefully acknowledges the financial support from Innogenetics n.v. (Ghent, Belgium). The authors thank Dr. A. Van de Voorde for helpful discussions and encouragement during the course of this study, and Professor Y. Anraku and Dr. S. Yoshida for the communication of the results on the STT3 gene of S. cerevisiae prior to publication.
REFERENCES Aaronson, S. A., and Todaro, G. J. (1968). Development of 3T3-like lines from BALB/c mouse embryo cultures: Transformation susceptibility to SV40. J. Cell Physiol. 72: 141–148. Adamson, M. C., Silver, J., and Kozak, C. A. (1991). The mouse homolog of the Gibbon ape leukemia virus receptor: Genetic mapping and a possible receptor function in rodents. Virology 183(2): 778–781. Benda, P., Lightbody, J., Sato, G., Levine, L., and Sweet, W. (1968). Differentiated rat glia cell strain in tissue culture. Science 161: 370–371. Bloomfield, C. D., Arthur, C. D., Frizzera, G., Levine, E. G., Peterson, B. A. and Gajl-Peczalska, K. J. (1983). Nonrandom chromosome abnormalities in lymphoma. Cancer Res. 43: 2975–2984. Chakraborti, A., Lippman, D. L., Loh, H. H., Kozak, C. A., and Lee, N. M. (1993). Genetic mapping of opioid binding protein gene(s) to mouse Chromosome 9. Mamm. Genome 4(3): 179–182. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294–5299. Eisenberg, D., Schwarz, E., Komaromy, M., and Wall, R. (1984). Analysis of membrane and surface protein sequences with the hydrophobic moment plot. J. Mol. Biol. 179: 125–142. Faisst, S., and Meyer, S. (1992). Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res. 20: 3–26. Fei, Y-J., Kanai, Y., Nussberger, S., Ganapathy, V., Leibach, F. H., Romero, M. F., Singh, S. K., Boron, W. F., and Hediger, M. A. (1994). Expression cloning of a mammalian proton-coupled oligopeptide transporter. Nature 368: 563–566. Gatti, R. A., Berkel, I., Boder, E., Braedt, G., Charmley, P., Concannon, P., Ersoy, F., Foroud, T., Jaspers, G. N., Lange, K., Lathrop, M. G., Leppert, M., Nakamura, Y., O’Connell, P., Paterson, M., Salser, W., Sanal, O., Silver, J., Sparker, S. R., Susi, E., Weeks, E. D., Wei, S., White, R., Yoder, F., et al. (1988). Localization of an ataxia-telangiectasia gene chromosome 11q22–23. Nature 336: 577–580. Green, E. L. (1981). ‘‘Genetics and Probability in Animal Breeding Experiments,’’ MacMillan Co., New York. Hediger, M. A., Coady, M. J., Ikeda, T. S., and Wright, E. M. (1987).
/ m4752f3842
01-09-96 20:54:24
gnma
Expression cloning and cDNA sequencing of the Na//glucose transporter. Nature 330: 379–381. Howard, R. P. (1993). ‘‘Molecular Biology of Membranes: Structure and Function,’’ pp. 27–32, Plenum, New York and London. Klein, P., Kanehisa, M., and Delisi, C. (1985). The detection and classification of membrane-spanning proteins. Biochim. Biophys. Acta 815: 468–476. Kliewer, S. A., Umesono, K., Noonan, D. J., Heyman, R. A., and Evans, R. M. (1992). Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature 358: 771–774. Kozak, C. A., Peyser, M., Krall, M., Mariano, T. M., Kumar, C. S., Pestka, S., and Mock, B. A. (1990). Molecular genetic markers spanning mouse chromosome 10. Genomics 8: 519–524. Kozak, M. (1991). An analysis of vertebrate mRNA sequences: Intimations of translational control. J. Cell. Biol. 115: 887–903. Kyte, J., and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105–132. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989). ‘‘Molecular Cloning: A Laboratory Manual,’’ Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Mathieu, E., Schoeters, G., Vander Plaetse, F., and Merregaert, J. (1992). Establishment of an osteogenic cell line derived from adult mouse bone marrow stroma by use of a recombinant retrovirus. Calcif. Tissue Int. 50: 362–371. Meerabux, J. M., Cotter, F. E., Kearney, L., Nizetic, D., Dhut, S., Gibbons, B., Lister, T. A., and Young, B. D. (1994). Molecular cloning of a novel 11q23 breakpoint associated with non-Hodgkin’s lymphoma. Oncogene 9: 893–898. Ness, S. A., Marknell, A., and Graf, T. (1989). The v-myb oncogene product binds to and activates the promyelocyte-specific mim-1 gene. Cell 59: 1115–1125. Regnier, D. C., Kozak, C. A., Kingsley, D. M., Jenkins, N. A., Copeland, N. G., Langdon, W. Y., and Morse, H. C. (1989). Identification of two murine loci homologous to the v-abl oncogene. J. Virol. 63: 3678–3682. Strauss, P. G., Closs, E. I., Schmidt, J., and Erfle, F. (1990). Gene expression during osteogenic differentiation in mandibular condyles in vitro. J. Cell Biol. 110: 1369–1378. Weiss, A., Von der Mark, K., and Silbermann, M. (1986). A tissue culture system supporting cartilage cell differentiation, extracellular mineralization and subsequent bone formation, using mouse condylar progenitor cells. Cell Differ. 19: 103–113. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., Burton, J., Connell, M., Copsey, T., Cooper, J., Coulson, A., Craxton, M., Dear, S., Du, Z., Durbin, R., Favello, A., Fraser, A., Fulton, L., Gardner, A., Green, P., Hawkins, T., Hillier, L., Jier, M., Johnston, L., Jones, M., Kershaw, J., Kirsten, J., Laisster, N., Latreille, P., Lightning, J., Lloyd, C., Mortimore, B., O’Callaghan, M., Parson, J., Percy, C., Rifken, L., Roopra, A., Saunders, D., Shownkeen, R., Sims, M., Smaldon, N., Smith, A., Smith, M., Sonnhammer, E., Staden, R., Sulston, J., Thierry-Mieg, J., Thomas, K., Vaudin, M., Vaughan, K., Waterston, R., Watson, A., Weinstock, L., Wilkinson-Sproat, J., and Wohldman, P. (1994). 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368: 32–38. Yoshida, S., Ohya, Y., Nakan, A., and Apraku, Y. (1995). STT3, a novel gene related to the PKC1/STT1 protein kinase pathway, is involved in protein glycosylation in yeast. Gene 164: 167–172. You, G., Smith, C. P., Kanai, Y., Lee, W-S., Steizner, M., and Hediger, M. A. (1993). Cloning and characterization of the vasopressin-regulated urea transporter. Nature 365: 844–847.
AP-Genomics
31, 295–300 (1996) 0051
ARTICLE NO.
Molecular Cloning of a Highly Conserved Mouse and Human Integral Membrane Protein (Itm1) and Genetic Mapping to Mouse Chromosome 9 GUIZHU HONG,* WILLY DELEERSNIJDER,† CHRISTINE A. KOZAK,‡ ERIC VAN MARCK,§ PRZEMKO TYLZANOWSKI,* AND JOSEPH MERREGAERT*,1 *Department of Biochemistry, Laboratory of Molecular Biotechnology, University of Antwerp, Universiteitsplein 1, 2610 Wilrijk, Belgium; †N.V. Innogenetics, S.A., Industriepark, Zwijnaarde, 9052 Ghent, Belgium; ‡National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland 20892; and §Department of Pathology, University of Antwerp, 2610 Wilrijk, Belgium Received May 3, 1995; accepted November 2, 1995
We have isolated and characterized a novel cDNA coding for a highly hydrophobic protein (B5) from a fetal mouse mandibular condyle cDNA library. The full-length mouse B5 cDNA is 3095 nucleotides long and contains a potential open reading frame coding for a protein of 705 amino acids with a calculated molecular weight of 80.5 kDa. The B5 mRNA is differentially polyadenylated, with the most abundant transcript having a length of 2.7 kb. The human homolog of B5 was isolated from a cDNA testis library. The predicted amino acid sequence of the human B5 is 98.5% identical to that of mouse. The most striking feature of the B5 protein is the presence of numerous (10–14) potential transmembrane domains, characteristic of an integral membrane protein. Similarity searches in public databanks reveal that B5 is 58% similar to the T12A2.2 gene of Caenorhabditis elegans and 60% similar to the STT3 gene of Saccharomyces cerevisiae. Furthermore, the report of an EST sequence (Accession No. Z13858) related to the human B5, but identical to the STT3 gene, indicates that B5 belongs to a larger gene family coding for novel putative transmembrane proteins. This family exhibits a remarkable degree of conservation in different species. The gene for B5, designated Itm1 (Integral membrane protein 1), is located on mouse chromosome 9. q 1996 Academic Press, Inc. INTRODUCTION
In an effort to characterize the early stages of osteogenic differentiation, we are screening a cDNA library Sequence data from this article have been deposited with the GenBank/EMBL Data Libraries under Accession Nos. L34260 (mouse B5), L38961 (human B5), and U25345 (mouse promoter). 1 To whom all correspondence should be addressed. Department of Biochemistry, Laboratory of Molecular Biotechnology, Universitaire Instelling Antwerpen, Universiteitsplein 1, 2610 Wilrijk, Belgium. Telephone: 32-3-820-2311. Fax: 32-3-820-2248. E-mail: merrega@ uia.ua.ac.be. 2 Abbreviations used: PCR, polymerase chain reaction; kb, kilobases; RACE, rapid amplification of cDNA ends; EST, expressed sequence tag; E, embryonic.
of mouse mandibular condyles to isolate genes that may be modulated during this process (W. Deleersnijder et al., in preparation). The mandibular condyle is a cartilaginous protrusion of the mandible that is initially involved in the growth of the mandible and subsequently serves as an articulating surface for the squamosomandibular joint. When explanted in vitro, prenatal mouse mandibular condyles undergo osteogenic differentiation. Under these conditions, the perichondrial progenitor cells differentiate into osteoblasts rather than chondroblasts and sequentially express a number of bone-typifying markers (Strauss et al., 1990). This property offers a unique opportunity to time precisely the onset of osteogenesis and permits isolation of transcripts that may be crucial to this process. We have isolated a few cDNA clones that were apparently differentially expressed at the onset of the in vitro induced osteogenesis. One of these clones, B5, was analyzed further. Here, we describe the isolation and characterization of mouse and human full-length cDNA clones of B5. Sequence analysis indicates that B5 is a novel gene related to T12A2.2 of Caenorhabditis elegans and the STT3 gene of Saccharomyces cerevisiae. B5 contains multiple membrane spanning domains, implying that it is an integral membrane protein. The gene, designated Itm1 (Integral membrane protein 1), has been mapped by linkage analysis to mouse chromosome 9. MATERIALS AND METHODS Isolation of mouse cDNA. Mandibular condyles were dissected from mouse fetuses at Day 18 of embryonic development (E18)2 and either immediately frozen in liquid nitrogen or cultured for an additional 18–24 h (E18 / 1d) before freezing. cDNA libraries were constructed from both the E18 and the E18 / 1d condyles in the pSPORT1 vector using the Superscript plasmid system (GIBCOBRL). Clone B5 was originally isolated from the E18 / 1d cDNA library by differential screening using nonsubtracted probe from the E18 / 1d library and subtracted probe obtained by subtracting E18
295
/ m4752f3842
01-09-96 20:54:24
gnma
0888-7543/96 $12.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AP-Genomics
296
HONG ET AL.
/ 1d-library-derived cDNA with in vitro transcribed cRNA from the E18 library (W. Deleersnijder et al., in preparation). Approximately 5 1 105 colonies from the E18 / 1d mouse condyle cDNA library were rescreened by standard methods (Maniatis et al., 1989) with 32P-labeled B5 probe (random primer labeling kit, Stratagene). From this screening, two positive clones, B12 and B28, were isolated. A 360-bp 5*-end fragment produced by PCR from the longer clone B28 was subsequently used as a probe to rescreen the E18 / 1d condyle cDNA library, yielding eight overlapping clones (B30, B31A, B31B, BX, BX2, BX4, BX5, and BX7). Isolation of human B5 cDNA. A human testis cDNA library (in lgt11) was a gift from Dr. B. Oostra (Leiden, The Netherlands). Approximately 2 1 105 plaques from this library were screened using a 186-bp radiolabeled PCR fragment of mouse B5 (corresponding to amino acids 561–623) as hybridization probe. Five positive phage clones were obtained and purified. Phage DNAs were isolated (Maniatis et al., 1989) and subcloned into the plasmid vector pUC18 (Pharmacia). Isolation of the mouse B5 genomic clone. A BALB/c mouse liver genomic library in the EMBL SP6/T7 l phage vector was purchased from Clontech (USA). Approximately 1 1 106 plaques of the genomic library were screened using a 420-bp 5*-end fragment produced by PCR amplification from clone BX. Two positive phage clones were identified, and their DNAs were analyzed by digestion with BamHI, EcoRI, or SstI. These products of digestion were blotted and hybridized with the 420-bp fragment derived from BX. The positive fragments were purified by GeneClean (BIO 101) and subcloned into the plasmid vectors pUC18 or pSPORT1. Identification of the 5*-end by rapid amplification of cDNA ends (5*-RACE). The 5*-end sequence of mouse B5 cDNA was obtained using the 5*-RACE system (GIBCO-BRL) according to the manufacturer’s instructions. Two specific antisense primers of B5 were used: MSP1 (400–423), 5* ATGGAGTACATGCTAGACTGCAGC 3*; and MSP2 (93–112), 5* TCTAGATCGCGAGCGGCCGCCCTCTTGACATCAATGGGTGGC 3* (numbers indicates positions on the mouse cDNA sequence; the adapter primer, containing the NotI restriction site, is underlined). Briefly, the first-strand cDNA was produced from 20 ng BALB/c 3T3 poly(A)/ RNA by reverse transcription using MSP1 as the first primer and subsequently tailing the 5*-end with dCTP and terminal dexoynucleotidyltransferase. The tailed cDNA was PCR amplified using MPS2 and an anchor primer that anneals to the homopolymeric C-tail and contains a SalI restriction site (supplied with the kit). The PCR product was digested with NotI and SalI, purified with GeneClean (BIO 101), and subcloned into pSPORT1 digested with NotI and SalI. The clones were sequenced as described below. The 5*-end of the human cDNA was obtained in a similar way. One hundred nanograms of total RNA from human lung was used to synthesize the first-strand cDNA. Two specific antisense primers of human B5 were used (positions refer to the human cDNA sequence; the adapter primer is underlined): HSP1 (793–813), 5* ATCCGGTGAGAGAAACGGCC 3 *; and HSP2 (733–752), 5* TCTAGATCGCGAGCGGCCGCCCTCAGGAACACATAACCTCCC 3*. All primers were obtained from Eurogentec (Belgium). PCR analysis was performed on a Perkin–Elmer-Cetus 9600 apparatus. DNA isolation, sequencing, and computer analysis. Phage DNA was isolated from plate lysates as described (Maniatis et al., 1989). Plasmid DNA isolation was performed according to standard protocols (Qiagen). The nucleotide sequence of the cDNA inserts was determined via the dideoxy chain termination method, using [a-35S]dATP and Sequenase 2.0 (Amersham). Various software packages were used in the course of this study and are mentioned under Results. Northern blot analysis. Total RNA was extracted from various tissues of newborn mice according to the protocol of Chirgwin et al. (1971a). RNA samples (10 mg total RNA) were denatured in 50% formamide, 2.2 M formaldehyde (10 min at 707C); chilled on ice; and separated on a denaturing agarose gel in Mops buffer (50 mM 3-[Nmorpholino]propanesulfonic acid, 1 mM EDTA, pH 7.0) containing 2.2 M formaldehyde. The RNA was transferred to Hybond-N/ mem-
/ m4752f3842
01-09-96 20:54:24
gnma
branes by capillary blotting, and UV-crosslinked blots were hybridized overnight at 427C in 51 SSC, 50% formamide, 51 Denhardt’s, and 1% SDS and washed to a final stringency of 11 SCC at 427C. Genetic mapping. The mouse gene for B5 was mapped by analyses of the progeny of two sets of crosses: (NFS/N or C58/J 1 Mus mus musculus) 1 M. m. musculus (Kozak et al., 1990) and (NFS/N 1 Mus spretus) 1 M. spretus or C58/J (Adamson et al., 1991). Progeny of these crosses have been typed for over 800 markers, including the chromosome 9 markers Icam1 (intercellular adhesion molecule 1), Obcam (opioid binding cell adhesion molecule), Cbl2 (casitas B lineage lymphoma), and Fli1 (Friend leukemia virus integration site). Icam1, Obcam, and Fli1 were typed as previously described (Chakraborti et al., 1993), and Cbl2 was typed using the probe described previously (Regnier et al., 1989) following digestion with PvuII in the M. m. musculus cross and HindIII in the M. spretus cross. Linkage distances were determined according to Green (1981), and gene order was established by minimizing the number of recombinants.
RESULTS
Isolation and Sequence Analysis of Full-Length Mouse B5 cDNA Differential screening of the E18 / 1d library using subtracted (E18 / 1d minus E18) and not subtracted (E18 / 1d) complex cDNA probes led to the isolation of several clones, including clone B5, that hybridized more strongly to the subtracted probe than to the probe that was not subtracted. Although the differential expression of B5 could not be confirmed in later experiments, the specific expression pattern of the B5 clone as demonstrated by in situ hybridization and Northern blot analysis (Hong et al., unpublished results) initially encouraged us to characterize it in more detail. To isolate the full-length cDNA clone of B5, repetitive rescreening of the E18 / 1d library with probes from the 5*-part of the available cDNA allowed the isolation of 10 overlapping cDNA clones. From sequence analysis of the collection of overlapping cDNA clones, it could be deduced that the B5 transcript is differentially polyadenylated. The polyadenylation signals in front of positions 2727–2738 appear to be the most commonly used (8 clones of 11, including B5). This would yield a mRNA length that is in agreement with the 2.7-kb band that is observed by Northern blot analysis (see below). No trace of transcripts of different size could be detected on this blot. 5*-RACE on RNA from the BALB/c 3T3 cell line extended the cDNA sequence obtained from these clones by only 6 bases. The longest open reading frame could start at position 112, although this presumed start codon is surrounded by an imperfect Kozak consensus sequence (GCCA/GCCAUGG) for initiation of translation (Kozak, 1991). The complete cDNA sequence is 3095 nucleotides long (Accession No. L34260) and contains one large open reading frame, coding for a protein of 705 amino acids with a predicted Mr of 80,597 Da. Based on the name of the initial cDNA clone, we refer to this protein as B5. The overall deduced B5 protein sequence is very hydrophobic. Depending on the algorithm used, between 10 (Klein et al., 1985) and 14 (Eisenberg et al., 1984)
AP-Genomics
B5, A HIGHLY CONSERVED PUTATIVE TRANSMEMBRANE PROTEIN
FIG. 1. Hydropathicity plot of the mouse B5 protein. The hydropathic index was determined by the Kyte–Doolittle algorithm with a 15-amino-acid window. Positive values indicate hydrophobic regions, and negative values point to hydrophilic regions. Putative transmembrane domains predicted according to the algorithms of Klein et al. (1985) or Eisenberg et al. (1984) are indicated.
membrane spanning domains are predicted. Figure 1 shows the hydropathicity plot of the B5 protein according to the Kyte–Doolittle algorithm (1982) and indicates the corresponding transmembrane domains. Six of the 10 cysteine residues are found within these transmembrane regions. There are four potential Nglycosylation sites as well as 1 glycosaminoglycan attachment site in the B5 sequence. Furthermore, there are 8 potential casein kinase II and 10 protein kinase C phosphorylation sites. Similarity searches in public databanks (EMBL, GenBank, and PIR) indicated that the B5 gene is about 60% homologous to the C. elegans gene T12A2.2 (Accession No. U13019) (Wilson et al., 1994) and to the yeast gene STT3 (Accession No. P39007) (Yoshida et al.). A remarkable similarity is present at the protein level, where the three proteins share about 56% identity and 70% similarity (Fig. 2). Furthermore, computer searches detected a 65% homology with a 343-bp expressed sequence tag (EST) (Accession No. Z13858) obtained from a T-lymphoblastoid cell line (ATCC No. CCL119). Alignment of the predicted amino acid sequence (93 amino acids) of the long open reading frame of this EST with the sequences of mouse B5, T12A2.2, and STT3 showed that this EST sequence is completely identical to the yeast STT3 gene (amino acid positions 497–590). There is 71% homology with mouse B5 (positions 507–599), while the homology with the T12A2.2 gene is 63%.
297
tion, as in the case of mouse B5. Four clones had a polyadenylation signal at position 2443 (corresponding to the first infrequently used poly(A) signal of mouse B5), whereas the polyadenylation signal of another clone was at position 2704 (corresponding to the poly(A) signal that is predominantly used in the mouse). From these clones and additional 5*-RACE analysis, a complete human B5 cDNA sequence was obtained. The fulllength cDNA sequence of human B5 codes for a protein of 705 amino acids with a predicted Mr of 80,572 Da (Accession No. L38961). Comparison of predicted protein sequences between mouse B5 and human B5 reveals that they differ at positions 4, 128, 133, 193, 415, 454, 608, 611, and 681. Figure 2 shows the alignment of the deduced amino acids for human B5, mouse B5, T12A2.2, and STT3. The deduced amino acid sequence of the partial EST cDNA has 71% homology with human B5 (amino acid positions 507–599). Northern Blot Analysis Northern blot analysis of total RNA from various tissues of mouse embryo revealed that a single transcript of approximately 2.7 kb is present in all tested tissues: brain, heart, liver, lung, skin, tail, calvaria, and pawn (data reviewed but not shown). This 2.7-kb transcript was also found in the mouse osteogenic stromal cell line MN7 (Mathieu et al., 1992), the mouse fibroblastic cell line BALB 3T3 (Aaronson and Todaro, 1968), and the rat C6 glioma cell line (Benda et al., 1968). Promoter Structure of the Mouse B5 Gene To characterize B5 regulatory sequences, a mouse liver genomic library was screened with a 420-bp cDNA probe from the 5*-end of BX. Two positive phages, GC1 and GC2, were isolated. An insert derived from phage GC2 DNA was subcloned into pSPORT1, yielding plasmid pGC2. Restriction enzyme analysis and partial sequence analysis indicated that pGC2 contained approximately 1500 bp upstream of the presumed transcriptional start, in addition to 50 bp from exon 1 and 150 bp from intron 1 (Fig. 3). The putative promoter sequence from pGC2 was determined (Accession No. U25345). The B5 promoter contains a TATA box at positions 058 to 051. Computer analysis reveals that the promoter sequence contains more than 20 putative binding sites for transcription factors (Faisst and Meyer, 1992) such as Myb (0437 to 0432), SP1 (0487 to 0481), GCF (0212 to 0206; 036 to 031), E2A (0811 to 0805), and PPAR (0751 to 0746). This is schematically depicted in Fig. 3.
Isolation and Sequence Analysis of the Human B5 cDNA
Genetic Mapping of the Mouse B5 Gene
Because of the strong expression of B5 in testis, a human testis cDNA library was screened with the mouse B5 cDNA probe. Five positive clones were isolated and characterized. Partial DNA sequence analysis at their 3*-ends revealed differential polyadenyla-
Parental M. m. musculus produced a B5 reactive PstI fragment of 6.6 kb, and NFS/N generated a fragment of 6.3 kb. ApaI digestion produced B5 reactive fragments of ú28 kb in NFS/N and M. spretus DNAs; the spretus fragment was larger and could clearly be distin-
/ m4752f3842
01-09-96 20:54:24
gnma
AP-Genomics
298
HONG ET AL.
FIG. 2. Alignment of the amino acid sequences of Itm1, ITM1, T12A2.2 of C. elegans, and STT3 of S. cerevisiae. The conserved amino acids in the four proteins are indicated in black boxes. The alignment was performed with the GCG software package.
guished from the NFS/N fragment on 0.4% agarose gels. Inheritance of the 6.3-kb fragment in M. m. musculus crosses, the larger of the ApaI fragments in the C58/J progeny of the M. spretus crosses, and the smaller of the ApaI fragments in the M. spretus backcross progeny were compared with the inheritance of 800 markers previously typed in these mice. The gene for B5, designated Itm1 was mapped to proximal chromosome 9 just distal to the locus Fli1 (Fig. 4). This places Itm1 in a region of chromosome 9 with linkage homology to human chromosome 11, sug-
FIG. 3. The 5*-upstream putative regulatory region of the mouse Itm1 gene. The potential regulatory elements and the exon1/intron1 configuration of the mouse Itm1 gene contained within pGC2 are indicated.
/ m4752f3842
01-09-96 20:54:24
gnma
gesting a location for the human homolog. Confirmation of this assignment was obtained from characterization of a panel of rodent 1 human somatic cell hybrids (BIOS, New Haven, CT) for human B5 reactive fragments (unpublished data). DISCUSSION
This paper describes the isolation of mouse and human cDNA clones coding for a novel integral membrane protein, termed B5. Both mouse and human B5 code for a protein of 705 amino acids, with a predicted Mr of, respectively, 80,597 and 80,572 Da. The most striking feature of mouse B5 is the presence of numerous computer-predicted transmembrane domains (10–14 transmembrane domains). This indicates that B5 could be an integral membrane protein. The B5 transcript is detected as a 2.7-kb mRNA band by Northern blot analysis using total RNA of the mouse
AP-Genomics
B5, A HIGHLY CONSERVED PUTATIVE TRANSMEMBRANE PROTEIN
FIG. 4. An abbreviated map of mouse chromosome 9 showing the localization of the mouse Itm1 gene. To the right of the map are recombination fractions between adjacent loci; the first fraction is from the M. m. musculus cross, and the second is from the M. spretus cross. In parentheses are the recombinational distances { standard errors. To the left of the map are human map locations for the underlined genes.
osteogenic stromal cell line MN7. The transcript appears to be differentially polyadenylated, as revealed by the isolation of cDNA clones with poly(A) tails at different locations. However, there appears to be one major site of polyadenylation in the mouse as well as in the human B5 transcript. Interestingly, the polyadenylation signal that is preferentially used in human B5 corresponds to a minor poly(A) signal in mouse and vice versa. The biological significance of this differential polyadenylation is very interesting and needs further investigation. The B5 promoter was partially characterized. It contains a degenerated TATA box and several potential binding sites for the transcription factors SP1, GCF, E2A, Myb, and PPAR. Myb plays a critical role in cell proliferation and differentiation (Ness et al., 1989), which corresponds to our observation that the Itm1 transcript appears to be expressed predominantly in tissues undergoing active proliferation and differentiation (Hong et al., unpublished results). PPAR is a member of the steroid hormone receptor superfamily. The PPAR responsive element (PPRE) is composed of a direct repeat of the half-site motif 5*-TGA/TCCT-3* (Kliewer et al., 1992). However, an additional PPRE half-site motif is apparently not present in the promoter sequence, as known thus far. A remarkable characteristic is the very high degree of evolutionary conservation between mouse and human B5 (98.5%). This suggests that B5 is under severe structural constraints to exert its biological activity. Homology searches in public DNA and protein data-
/ m4752f3842
01-09-96 20:54:24
gnma
299
banks identified B5 homology with the T12A2.2 gene from C. elegans and the STT3 gene from S. cerevisiae. DNA sequence database searches identified complete homology between the yeast STT3 gene and a short anonymous human cDNA sequence deposited as an EST sequence (Z13858). The predicted amino acid sequence of this EST showed only 71% homology with mouse B5, suggesting that this EST sequence is the human counterpart of STT3. Since the human B5 gene is much more similar to mouse B5 than to this human EST sequence, we propose that B5 could be a member of a larger family of transmembrane proteins containing STT3, B5, T12A2.2, and other unidentified genes as members. The gene coding for B5, designated Itm1, is localized on mouse chromosome 9. Based on the human–mouse homology and our unpublished results, the human ITM1 gene is likely to map to 11q23–q24, a region associated with chromosomal translocations, several oncogenes, and the human congenital preneoplastic syndrome, ataxia telangiectasia (Gatti et al., 1988). The t(11,14)(q23,q32) translocation is a rare translocation associated with malignant non-Hodgkin lymphoma (Bloomfield et al., 1983). Recently, the molecular cloning of a novel 11q23 breakpoint from a non-Hodgkin lymphoma and the mapping of this breakpoint to chromosome 11 was reported (Meerabux et al., 1994). It would be interesting to see whether the ITM1 gene is involved in any of these disorders. At this point we can only speculate as to what the biological role of the Itm1 gene product might be. No homology was detected with the large family of cell surface receptors with seven transmembrane domains. Also, the Itm1-encoded protein does not seem to contain domains with enzymatic activity; it is probably not involved in direct transmembrane signaling. The multitude of transmembrane domains found in B5 is, however, a characteristic feature of transporter proteins (Howard, 1993). One large subfamily of this type is represented by the ABC (ATP binding cassette) superfamily of active transporters. As Itm1 does not contain an ATP binding motif, it appears not to belong to this subgroup. Examples from non-ABC transporter proteins include the Na//glucose cotransporter (11 TMDs) (Hediger et al., 1987), a proton-coupled oligopeptide transporter (12 TMDs) (Fei et al., 1994), and a vasopressin-regulated urea transporter (10 TMDs) (You et al., 1993). We therefore tentatively hypothesize that the Itm1 protein is a novel type of permease/transporter membrane protein. The STT3 gene of yeast, originally isolated as a staurosporine-sensitive mutant, was found to be essential for cell growth irrespective of osmotic support. STT3 mutants are defective in protein glycosylation (Yoshida et al.). Our sequence data show that although the yeast STT3 gene product belongs to the same family as B5, it is nevertheless distinct. It is therefore not clear whether B5 is also involved in protein glycosylation. The yeast system would offer an excellent opportunity to test whether the Itm1 gene is
AP-Genomics
300
HONG ET AL.
functionally exchangeable with the STT3 gene. It would also allow us to initiate the in vivo structure function analysis of the B5 protein. In conclusion, a novel gene termed Itm1 has been isolated and localized on mouse chromosome 9. This gene codes for a putative transporter protein that is extremely conserved between mouse and human and belongs to a larger gene family. ACKNOWLEDGMENTS This work was partially supported by the Vlaams Actieprogramma Biotechnologie (VLAB/034 and T.O.P./027). G. Hong gratefully acknowledges the financial support from Innogenetics n.v. (Ghent, Belgium). The authors thank Dr. A. Van de Voorde for helpful discussions and encouragement during the course of this study, and Professor Y. Anraku and Dr. S. Yoshida for the communication of the results on the STT3 gene of S. cerevisiae prior to publication.
REFERENCES Aaronson, S. A., and Todaro, G. J. (1968). Development of 3T3-like lines from BALB/c mouse embryo cultures: Transformation susceptibility to SV40. J. Cell Physiol. 72: 141–148. Adamson, M. C., Silver, J., and Kozak, C. A. (1991). The mouse homolog of the Gibbon ape leukemia virus receptor: Genetic mapping and a possible receptor function in rodents. Virology 183(2): 778–781. Benda, P., Lightbody, J., Sato, G., Levine, L., and Sweet, W. (1968). Differentiated rat glia cell strain in tissue culture. Science 161: 370–371. Bloomfield, C. D., Arthur, C. D., Frizzera, G., Levine, E. G., Peterson, B. A. and Gajl-Peczalska, K. J. (1983). Nonrandom chromosome abnormalities in lymphoma. Cancer Res. 43: 2975–2984. Chakraborti, A., Lippman, D. L., Loh, H. H., Kozak, C. A., and Lee, N. M. (1993). Genetic mapping of opioid binding protein gene(s) to mouse Chromosome 9. Mamm. Genome 4(3): 179–182. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294–5299. Eisenberg, D., Schwarz, E., Komaromy, M., and Wall, R. (1984). Analysis of membrane and surface protein sequences with the hydrophobic moment plot. J. Mol. Biol. 179: 125–142. Faisst, S., and Meyer, S. (1992). Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res. 20: 3–26. Fei, Y-J., Kanai, Y., Nussberger, S., Ganapathy, V., Leibach, F. H., Romero, M. F., Singh, S. K., Boron, W. F., and Hediger, M. A. (1994). Expression cloning of a mammalian proton-coupled oligopeptide transporter. Nature 368: 563–566. Gatti, R. A., Berkel, I., Boder, E., Braedt, G., Charmley, P., Concannon, P., Ersoy, F., Foroud, T., Jaspers, G. N., Lange, K., Lathrop, M. G., Leppert, M., Nakamura, Y., O’Connell, P., Paterson, M., Salser, W., Sanal, O., Silver, J., Sparker, S. R., Susi, E., Weeks, E. D., Wei, S., White, R., Yoder, F., et al. (1988). Localization of an ataxia-telangiectasia gene chromosome 11q22–23. Nature 336: 577–580. Green, E. L. (1981). ‘‘Genetics and Probability in Animal Breeding Experiments,’’ MacMillan Co., New York. Hediger, M. A., Coady, M. J., Ikeda, T. S., and Wright, E. M. (1987).
/ m4752f3842
01-09-96 20:54:24
gnma
Expression cloning and cDNA sequencing of the Na//glucose transporter. Nature 330: 379–381. Howard, R. P. (1993). ‘‘Molecular Biology of Membranes: Structure and Function,’’ pp. 27–32, Plenum, New York and London. Klein, P., Kanehisa, M., and Delisi, C. (1985). The detection and classification of membrane-spanning proteins. Biochim. Biophys. Acta 815: 468–476. Kliewer, S. A., Umesono, K., Noonan, D. J., Heyman, R. A., and Evans, R. M. (1992). Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature 358: 771–774. Kozak, C. A., Peyser, M., Krall, M., Mariano, T. M., Kumar, C. S., Pestka, S., and Mock, B. A. (1990). Molecular genetic markers spanning mouse chromosome 10. Genomics 8: 519–524. Kozak, M. (1991). An analysis of vertebrate mRNA sequences: Intimations of translational control. J. Cell. Biol. 115: 887–903. Kyte, J., and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105–132. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989). ‘‘Molecular Cloning: A Laboratory Manual,’’ Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Mathieu, E., Schoeters, G., Vander Plaetse, F., and Merregaert, J. (1992). Establishment of an osteogenic cell line derived from adult mouse bone marrow stroma by use of a recombinant retrovirus. Calcif. Tissue Int. 50: 362–371. Meerabux, J. M., Cotter, F. E., Kearney, L., Nizetic, D., Dhut, S., Gibbons, B., Lister, T. A., and Young, B. D. (1994). Molecular cloning of a novel 11q23 breakpoint associated with non-Hodgkin’s lymphoma. Oncogene 9: 893–898. Ness, S. A., Marknell, A., and Graf, T. (1989). The v-myb oncogene product binds to and activates the promyelocyte-specific mim-1 gene. Cell 59: 1115–1125. Regnier, D. C., Kozak, C. A., Kingsley, D. M., Jenkins, N. A., Copeland, N. G., Langdon, W. Y., and Morse, H. C. (1989). Identification of two murine loci homologous to the v-abl oncogene. J. Virol. 63: 3678–3682. Strauss, P. G., Closs, E. I., Schmidt, J., and Erfle, F. (1990). Gene expression during osteogenic differentiation in mandibular condyles in vitro. J. Cell Biol. 110: 1369–1378. Weiss, A., Von der Mark, K., and Silbermann, M. (1986). A tissue culture system supporting cartilage cell differentiation, extracellular mineralization and subsequent bone formation, using mouse condylar progenitor cells. Cell Differ. 19: 103–113. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., Burton, J., Connell, M., Copsey, T., Cooper, J., Coulson, A., Craxton, M., Dear, S., Du, Z., Durbin, R., Favello, A., Fraser, A., Fulton, L., Gardner, A., Green, P., Hawkins, T., Hillier, L., Jier, M., Johnston, L., Jones, M., Kershaw, J., Kirsten, J., Laisster, N., Latreille, P., Lightning, J., Lloyd, C., Mortimore, B., O’Callaghan, M., Parson, J., Percy, C., Rifken, L., Roopra, A., Saunders, D., Shownkeen, R., Sims, M., Smaldon, N., Smith, A., Smith, M., Sonnhammer, E., Staden, R., Sulston, J., Thierry-Mieg, J., Thomas, K., Vaudin, M., Vaughan, K., Waterston, R., Watson, A., Weinstock, L., Wilkinson-Sproat, J., and Wohldman, P. (1994). 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368: 32–38. Yoshida, S., Ohya, Y., Nakan, A., and Apraku, Y. (1995). STT3, a novel gene related to the PKC1/STT1 protein kinase pathway, is involved in protein glycosylation in yeast. Gene 164: 167–172. You, G., Smith, C. P., Kanai, Y., Lee, W-S., Steizner, M., and Hediger, M. A. (1993). Cloning and characterization of the vasopressin-regulated urea transporter. Nature 365: 844–847.
AP-Genomics