Molecular Cloning of an Estrogen Receptor β Subtype from the Goldfish,Carassius auratus

General and Comparative Endocrinology 113, 388–400 (1999) Article ID gcen.1998.7217, available online at http://www.idealibrary.com on

Molecular Cloning of an Estrogen Receptor ␤ Subtype from the Goldfish, Carassius auratus Anna Tchoudakova, Sapana Pathak, and Gloria V. Callard Department of Biology, Boston University, 5 Cummington Street, Boston, Massachusetts 02215 Accepted October 25, 1998

Estrogen controls diverse developmental and physiological processes in all vertebrates studied. Among the targets of estrogen action are the female and male reproductive tracts, the pituitary, and regions of the brain (Clark et al., 1992; Lindzey and Korach, 1997). Most estrogen actions are mediated by an estrogen receptor (ER) that functions as a ligand-dependent transcription factor. The ER is a member of the nuclear receptor superfamily that includes receptors for other steroid hormone classes, thyroid hormone, vitamin D, retinoids, ecdysone, and a large number of orphan receptors which have no known ligands (Mangelsdorf et al., 1995). ER complementary DNAs (cDNAs) have been isolated and characterized in representative vertebrates from fish to mammals and, in humans and rodents, two ER subtypes (␣ and ␤) have been identified (Green et al., 1986; Greene et al., 1986; Krust et al., 1986; Koike et al., 1987; Pakdel et al., 1990; Kuiper et al., 1996; Mosselman et al., 1996). Based on sequence similarity, ERs are divided into six regions termed A–F (Krust et al., 1986). The C or DNA-binding domain (DBD) located in the middle of the ER is the most conserved region and contains two zinc-binding motifs (Freedman et al., 1988) that interact with specific DNA sequences known as estrogen response elements (ERE) in the regulatory region of target genes. The carboxy-terminal half of the receptor encompasses the conserved E or ligandbinding domain (LBD), which also contains sequences required for receptor dimerization and transcriptional activation (AF-2). The A/B region harboring a second activation function (AF-1; for review, Beato et al., 1995),

The brain of many teleost fish species, including the goldfish Carassius auratus, expresses exceptionally high levels of cytochrome P450 aromatase (estrogen synthetase). To begin investigating the molecular and cellular targets of estrogen action in goldfish brain, a polymerase chain reaction (PCR) cloning strategy was used to isolate an estrogen receptor (ER) complementary DNA (cDNA). The 2283-bp cDNA isolated from goldfish liver encoded a protein of 568 amino acids (aa) with an estimated molecular weight of 63,539. The goldfish ER had high overall sequence identity when compared to other vertebrate ER sequences: eel (64%), human ␤ subtype (59%), human ␣ subtype (46%), medaka (46%), and rainbow trout (47%). The highest degree of conservation was seen in the DNA-binding (94–100%) and ligand-binding (67– 79%) domains. Phylogenetic analysis of the ER gene family indicated that the goldfish and eel ER are most closely related to mammalian ER␤ subtypes, whereas previously identified fish, amphibian, and avian ER forms cluster separately with mammalian ER␣ subtypes. Using the goldfish ER cDNA (here designated gfER␤), multiple mRNA species (3.1– 8.6 kb) were detected by Northern blot analysis in goldfish liver and ovary but expression was below detection in brain. Using reverse transcription-PCR analysis, gfER␤ mRNA was detected in forebrain, mid/hindbrain, pituitary, retina, liver, ovary, and testis. Further studies are required to determine whether an additional ER␣ subtype is present in the goldfish and whether ER␣ or ER␤ forms have evolutionary precedence in vertebrates. r 1999 Academic Press Key Words: estrogen receptor; goldfish; brain; liver; aromatase.

388

0016-6480/99 $30.00 Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

Goldfish Estrogen Receptor ␤

the D or hinge region, and the F region are poorly conserved among different ERs (Krust et al., 1986). In teleost fish, hepatic ER have been extensively studied in terms of its control of yolk protein synthesis (Pakdel et al., 1989). Although all reported teleostean ER cDNAs have been isolated from liver, they have been used as probes in Northern blots or in situ hybridization to demonstrate the presence of ER mRNA in the fish brain, pituitary, and retina (Pakdel et al., 1990; Salbert et al., 1993; Begay et al., 1994), thus confirming earlier autoradiographic studies which describe estrogen-concentrating cells in the fish brain– pituitary complex (Morell et al., 1975; Davis et al., 1977; Kim et al., 1978; Fine et al., 1990). Experiments in several fish species, including the goldfish (Carassius auratus) indicate that estrogen and aromatizable androgen acting at the level of the brain and pituitary exert negative and positive feedback effects on gonadotropin and growth hormone synthesis and secretion (Trudeau, 1997; Zou et al., 1997). In contrast to hepatic ER, which are targeted by circulating estrogen, ER occupancy and activation in the brain and pituitary are determined, in part, by estrogen synthesized in situ from circulating androgen. Because the activity of the estrogen biosynthetic pathway in the goldfish brain is 100 to 1000 times higher than in the brain of other vertebrates, and ⬎10 times higher than in the ovaries of the same fish, this teleostean species has been an interesting model for investigating brain mechanisms of cytochrome P450 aromatase (P450arom) expression (Callard et al., 1990). P450arom (the product of CYPl9 gene) is the catalytic unit of the enzyme complex controlling aromatization of androgen to estrogen (Simpson et al., 1997). Recently, we reported that goldfish has two distinct CYPl9 loci which encode different P450arom isozymes in brain and ovary (respectively, CYPl9B/P450aromB and CYPl9A/P450aromA; Tchoudakova and Callard, 1998). Northern blot analysis using the brain-derived cDNA as a hybridization probe showed that high accumulated levels of P450aromB-specific mRNA account for high enzyme activity in goldfish brain (Gelinas et al., 1998). Superimposed on high constitutive expression is a severalfold seasonal increase in P450arom mRNA and enzyme activity during the reproductively active period, which can be mimicked by treatment of reproductively inactive fish with estro-

389

gen or aromatizable androgen (Pasmanik and Callard, 1988; Pasmanik et al., 1988; Gelinas et al., 1998). Isolation and sequence analysis of the 58-flanking region of the CYPl9B gene has revealed an ERE and two ERE half-sites within 350 bp upstream of the TATA box (Tchoudakova and Callard, 1996). As an initial step toward investigating estrogen’s role in regulating CYPl9B gene expression and identifying additional genes, cells, and processes targeted by neural estrogen biosynthesis, we report the cloning of a cDNA which is the goldfish homolog of mammalian ER␤ subtypes (gfER␤). Also described are the size, number, and tissue distribution of gfER␤ mRNAs as determined by Northern blot and reverse transcription– polymerase chain reaction (RT-PCR) analyses.

MATERIALS AND METHODS All general reagents were purchased from Sigma Chemical Company (St. Louis, MO), Fisher Scientific (Houston, TX), and Promega (Madison, WI). Custom oligonucleotides were purchased from Ransom Hill Bioscience Inc. (Ramona, CA). DNA restriction and modifying enzymes and pGEM-T Easy vector were acquired from Promega. 32P-radiolabeled nucleotides were from DuPont/New England Nuclear Corp. (Boston, MA). Adult goldfish (4–5 in. long) were purchased from Grassyfork Fisheries (Martinsville, IN) between December and May.

Oligonucleotides The following oligonucleotides were used as PCR primers (Nos. 1–9) (Fig. 1) or for Southern blot analysis (No. 10) of the ER cDNA. Nucleotide numbers (nt) refer to the goldfish ER cDNA (see Fig. 2). Oligonucleotides 11 and 12 were used for PCR and oligonucleotide 13 was used for Southern blot analysis of the goldfish ␤-actin cDNA. Numbering of nucleotide residues of ␤-actin cDNA is according to the zebrafish ␤-actin cDNA (Danio rerio; Accession Number AF057040): Oligonucleotide 1, nt 972–997, 58 ATHCARGGDCAYAAYGRCTAYATSTG 38; oligonucleotide 2, nt 1572– 1598, 58 RAAGATYTCMRCCATRCCCTCYACACA 38 (IBU group codes were used: D ⫽ A ⫹ G ⫹ T; H ⫽ A ⫹ C ⫹ T; M ⫽ A ⫹ C; R ⫽ A ⫹ G; S ⫽ G ⫹ C; Y ⫽ C ⫹ T);

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

390

oligonucleotide 3, nt 1454–1479, 58 TTTGCTGGAGTGCTGCTGGTTAGAGG 38; oligonucleotide 4, nt 1023–1044, 58 AGCTTTTGCGCCGGTTCTTGTC 38; oligonucleotide 5, nt 1007–1033, 58 CGGTTCTTGTCGATGGTGCACTGGTTG 38; oligonucleotide 6, nt 65–88, 58 AACAGCGATCAAATCAAGCAGTGC 38; oligonucleotide 7, nt 2100–2126, 58 CTCCCGAAACTAGAGATCATTCTTCAG 38; oligonucleotide 8, nt 1118–1137, 58 CTACCAACAAAGAGGAGCAC 38; oligonucleotide 9, nt 1494–1513, 58 TTAACAGACCGCCACATCAG 38; oligonucleotide 10, nt 1272–1291, 58 TCTGCATCCATGATTCGAGC 38; oligonucleotide 11, nt 885–908, 58 ACCTTCAACTCCATCATGAAGTG 38; oligonucleotide 12, nt 1060–1083; 58 GCCACCGATCCAGACAGAGTATT 38; and oligonucleotide 13, nt 980–1005, 58 TGCTGACCGTATGCAGAAGGAGATC 38.

Tchoudakova, Pathak, and Callard

PCR was carried out as described for 38-RACE but using primer 5. Products of the 58- and 38-RACE were purified from 1.5% agarose gel, subcloned into pGEM-T easy vector, and sequenced. The 2.3-kb cDNA was generated by PCR using the Advantage-High Fidelity PCR kit (Clontech), primers 6 and 7, and an aliquot (10%) of the RT reaction generated from the goldfish liver total RNA with an oligo(dT) primer. Thirty PCR cycles consisted of denaturation at 94°C for 30 s, annealing at 56°C for 45 s, and primer extension at 72°C for 5 min. A product of the predicted size was purified from a 1.2% agarose gel and subcloned into pGEM-T Easy vector. Two separate amplification reactions were combined, and three independent cDNA clones derived therefrom were sequenced.

DNA Sequence and Phylogenetic Analysis RT-PCR Cloning of the Goldfish Estrogen Receptor cDNA Eight micrograms of total RNA isolated from liver (see below) was used for RT with 250 ng of random primers and SuperScript II reverse transcriptase (GibcoBRL, Gaithersburg, MD). The reaction was performed according to the manufacturer’s instructions. The strategy used for PCR cloning is shown in Fig. 1. An aliquot (15%) of the RT reaction was amplified with degenerate primers 1 and 2 in 50-µl final volume containing reaction buffer supplied by the manufacturer, 2 mM MgCl2, 200 µM deoxynucleotide triphosphates, 2 µM each primer, and 2.5 U Taq DNA polymerase (Promega). The following PCR conditions were used for the first 5 cycles: 94°C for 30 s, 43°C for 45 s, 72°C for 1 min; during the remaining 35 cycles the annealing temperature was increased from 43 to 50°C. The resulting PCR fragment was purified from 2% agarose using GeneClean III kit (BIO 101 Inc, Vista, CA), subcloned into pGEM-T Easy vector and sequenced. The extension of the cDNA fragment was done using Marathon kit (Clontech, Palo Alto, CA) according to the manufacturer’s protocol. For the 38-rapid amplification of cDNA ends (RACE), an oligo(dT)-primed cDNA library was constructed and amplified with primer 3 and an adaptor-specific primer supplied by the manufacturer. Amplification consisted of the first five cycles, 94°C for 30 s, 72°C for 3 min, followed by 40 cycles, 94°C for 20 s, 68°C for 3 min. For the 58’-RACE, a cDNA library was constructed using gene-specific primer 4.

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

Sequencing of successive ER cDNA fragments was performed on double-stranded DNA with Sequenase (US Biochemical Corp., Cleveland, OH) according to the manufacturer’s recommendations. Sequencing of the 2.3-kb cDNA was carried out at the DNA/Protein Core Facility at the Boston University School of Medicine using dye-terminator cycle sequencing on a Model 373A automated sequencer (PE Applied Biosystems, Foster City, CA). Sequence analysis was performed using the WI Package Version 9.0 (Genetics Computer Group, Madison, WI). Multiple sequence alignment was done using the CLUSTAL W method (Thompson et al., 1994). PAUP 3.1 (Swofford, 1993) was used for inferring the evolutionary relationships. A heuristic search with the completed 100 random addition sequence replicates and 100 bootstrap replicates was performed.

RNA Isolation and Northern Blot Analysis Different tissues of 50 fish (mixed males and females; ratio ⬇1:1) were pooled by type and total RNA was extracted using Tri Reagent (Molecular Research Center, Cincinnati, OH). Poly(A)-enriched RNA was purified from total RNA of the goldfish forebrain, ovary, and liver with the Poly(A)Pure kit (Ambion, Austin, TX). Ten micrograms per lane of poly(A) RNA was fractionated on a 1% formaldehyde agarose gel, transferred to Magnacharge nylon membrane (MSI, Westborough, MA), and baked under vacuum at 80°C

Goldfish Estrogen Receptor ␤

for 1 h. The molecular weight markers were the 0.24- to 9.5-kb RNA Ladders (Gibco-BRL). The RNA blot was prehybridized overnight in 50% formamide, 5⫻ SSPE, 5⫻ Denhardt’s solution, 100 µg/ml calf thymus DNA, and 0.1% SDS. The 2.3-kb ER cDNA probe was labeled by random priming to a specific activity of 1 ⫻ 109 cpm/µg (Feinberg and Vogelstein, 1983). Hybridization was performed at 42° C overnight in the prehybridization buffer except 2⫻ Denhardt’s solution was used. The final wash of the blot was at 60°C in 0.1⫻ SSPE/0.1% SDS. After autoradiography and stripping of the probe, the membrane was reprobed under the same conditions with a 1-kb goldfish actin cDNA (derived by RT-PCR with degenerate primers, our unpublished data) to standardize for loading.

RT-PCR One microgram of total RNA extracted from forebrain, mid/hindbrain, pituitary, ovary, liver, retina, and testis was reverse transcribed using oligo(dT) primer and SuperScript II reverse transcriptase (GibcoBRL) according to the manufacturer’s instructions. Ten percent of the RT reaction was added to 50-µl PCR reactions containing the same components as described above for PCR with degenerate primers 1 and 2. Primers 8 and 9 (0.2 µM each; located in putative exons 4 and 5; Ponglikitmongkol et al., 1988) together with the actin primer pair 11 and 12 at a lower concentration (0.07 µM each) were used for amplification. Thirty-five cycles consisted of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and primer extension at 72°C for 1 min. A negative control reaction (no cDNA) was also performed. PCR products were separated on a 2% agarose gel, transferred to Magnacharge nylon membrane, and hybridized at 55°C in buffer containing 1% bovine serum albumin, 1 mM EDTA, 0.5 M NaHPO4, pH 7.2, and 7% SDS (Church and Gilbert, 1984). Oligonucleotide 10 complementary to the goldfish ER cDNA was labeled with [␥-32P]ATP and T4 polynucleotide kinase and used as a probe for Southern blot analysis (Sambrook et al., 1989). The membrane was washed twice, 5 min each time, in 6⫻ SSC/0.1% SDS at room temperature. After autoradiography, the probe was stripped and the membrane was reprobed using oligonucleotide 13 complementary to the actin cDNA fragment.

391

RESULTS Isolation and Sequence Analysis of Goldfish ER cDNA An ER cDNA was cloned from goldfish liver by an RT-PCR strategy in four steps (Fig. 1). Initially, using degenerate primers 1 and 2 chosen from highly conserved regions of known ER sequences, a central 600-bp fragment with a high degree of sequence similarity to ER was produced (Fig. 1). The same methods applied to brain and ovarian RNA gave no products of the predicted size. The ends of the goldfish liver ER cDNA, each ⬇1-kb in size, were then generated by 58/38-RACE using sequences derived from the isolated 600-bp fragment (primers 5 and 3, respectively). Finally, the 2.3-kb cDNA was obtained by PCR with primers 6 and 7. The products of two independent PCR reactions were combined and cloned into a pGEM vector. Three clones were selected for sequencing. Sequence analysis showed that the isolated goldfish ER cDNA (clone gfER1) consists of a 58-untranslated region (UTR) of 380 bp, an open reading frame (ORF) of 1704 bp, and a 38- UTR of 199 bp. The nucleotide and deduced amino acid sequence are shown in Fig. 2. The ORF encodes a polypeptide of 568 amino acid residues with an estimated molecular weight of 63,539. Two potential in-frame ATG initiation codons are located in proximity to the first ATG. A short ORF of 16 amino acids (in a different reading frame from that of ER) is found within the 58-untranslated region (underlining, Fig. 2). Nucleotide sequence comparison of the gfER1 clone with two additional clones (gfER2 and gfER3)

FIG. 1. Cloning strategy for isolating the goldfish estrogen receptor cDNA using RT-PCR and 58/38-RACE. Relative positions of degenerate (1 and 2) and goldfish ER cDNA-specific primers (3–7) are shown (see Materials and Methods). The open bar indicates the ORF.

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

FIG. 2. The nucleotide and deduced amino acid sequence of the goldfish estrogen receptor. The numbers on the right refer to the nucleotide and amino acid (shown in boldface type) sequences. The short ORF in the 58-untranslated region is shown with double underlining.

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

392

Goldfish Estrogen Receptor ␤

identified several differences. Two nucleotide residues, 181 (T to C) and 2099 (G to A), were substituted in the untranslated regions of the gfER2 and gfER3 clones (for numbering, refer to Fig. 2). Five more nucleotide substitutions were localized within the ORF of the gfER2 and gfER3 clones and they occurred at residues 821 (T to G), 968 (G to A), 1562 (T to C), 1814 (T to C), and 2069 (T to C). Only one of these, T821G, resulted in the replacement of an amino acid residue (S148A). Additionally, clone gfER3 had an insertion of 90 nucleotides at position G1558, which caused a translational frameshift and introduced a stop codon after amino acid residue N400 (Fig. 3A). Interestingly, the insertion occurred at a position corresponding to the exon 5/intron boundary of the human ER␣ (Ponglikitmongkol et al., 1988) and the exon 7/intron boundary of the trout (Le Roux et al., 1993) ER genes. Clone gfER2 had a nine-nucleotide deletion at residue A1865 (Fig. 3B), and both clones gfER2 and gfER3 had a small insertion at A2065, which resulted in a translational frameshift (Fig. 3C). Comparison of the goldfish ER amino acid sequence to those of mammals, birds, amphibians, and fish shows that the overall percentage of identity ranges from 44 to 64% (for reference, see legend to Fig. 4). The mammalian ER␤ subtypes and the eel ER share 59–

FIG. 3. Nucleotide sequence alignment of the goldfish estrogen receptor cDNA clones showing regions (A–C) with deletions or insertions. Deduced amino acid sequences resulting from the insertions are shown under each alignment. The arrowhead represents an exon/intron boundary in the trout and human ER genes (for reference, see Results).

393

FIG. 4. Domain structure of the goldfish estrogen receptor. Sequence identity with the eel, human ␤, rat ␤, mouse ␤, human ␣, trout, and medaka ER. The six domains A–F (Krust et al., 1986) are indicated above the schematic representation of the goldfish (gfER), eel (eER; Todo et al., 1996), human ␤ (hER␤; Mosselman et al., 1996), rat ␤ (rER␤; Kuiper et al., 1996), mouse ␤ (mER␤; Tremblay et al., 1997), human ␣ (hER␣; Greene et al., 1986), rainbow trout (rtER; Pakdel et al., 1990), and medaka (mdER; GenBank Accession Number 17006707). The total number of amino acid residues is shown in the right-hand column, and the numbers above each receptor refer to the position of amino acid residues. The percentage of identity of each domain relative to the goldfish ER is indicated within the box representing the corresponding domain. The alignment method of Needleman and Wunsch (1970) was used to calculate percent identity.

64% overall identity of their amino acid residues when compared to the goldfish ER. Other species, including fish, share 44–48% sequence identity with the goldfish ER. Based on the nomenclature for domain structure described by Krust et al. (1986), the DNA-binding domain (or C region) of the goldfish ER between residues 170 and 235 has a high percentage identity (94–100%) when compared to the corresponding region of all other ER sequences (Fig. 4). The ligandbinding domain (or E region, residues 296–532) has 67–79% identity with the eel ER and human, rat, and murine ER␤ subtypes and 56–57% identity with the mammalian ER␣ subtype and ERs of other fish. The hinge or D region, which separates domains C and E, is not significantly conserved and shares only 26–37% identity with other ER. A low percentage of identity was also found when the goldfish amino-terminal

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

394

modulating (A/B) region was compared to A/B regions of other ERs, but the goldfish ER shared a higher degree of identity with the eel ER (49%) and with mammalian ER␤s (31–36%) than with mammalian ER␣ subtypes (21%) and other fish ER (⬇20%). Finally, region F was poorly conserved and percentages (27– 31%) were similar regardless of species or ER subtype. The alignment of the amino acid sequences of the C

Tchoudakova, Pathak, and Callard

(DBD) and E (LBD) regions of the goldfish ER to other species and subtypes of ER is shown in Fig. 5. A high degree of conservation of residues within established functional motifs is evident, e.g., the position of eight cysteine and surrounding residues which constitute the two zinc-binding motifs (CI and CII, C region; Schwabe et al., l993), and structural elements involved in formation of the ligand binding cavity and contrib-

FIG. 5. Alignment of the amino acid sequences of the C and E regions of the goldfish, eel, human ␤, rat ␤, mouse ␤, human ␣, trout, and medaka ER. Alignment was done using the CLUSTAL W method (Thompson et al., 1994). Amino acid residues identical to the goldfish ER are represented by dashes. The zinc-binding motifs containing 8 cysteine residues (●) are underlined (Region C). In Region E, secondary structural elements of the human ER␣8 LBD involved in formation of the 17␤-estradiol (E2)-binding cavity are boxed. Helix 12 (human ER␣ amino acids, Leu 539 to His 547) which has an essential element for transactivation is indicated in the last box (Brzozowski et al., 1997).

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

Goldfish Estrogen Receptor ␤

395

uting to transcriptional activation (boxed, E region; Brzozowski et al., 1997). Analysis of the goldfish ER with MotifFinder program showed potential sites for phosphorylation by cAMP- and cGMP-dependent protein kinases at position 218 (RRKS), and several casein kinase II and protein kinase C phosphorylation sites. A mitogenactivated protein kinase phosphorylation site found in ER␣ subtypes (Kato et al., 1995) and in mouse ER␤ (Tremblay et al., 1997) was absent in the gfER. An ER gene tree was constructed to study relationships among different types of ERs. Regions without length variations were used in the analysis and included 318 conserved amino acid residues corresponding to the DBD and LBD of the aligned ER sequences. The two most parsimonious trees were retained and differed only in the branching order of medaka, seabream, and tilapia. Figure 6 depicts one of the two most parsimonious ER trees and shows that mammalian ER␤s and eel and goldfish ERs form a separate group. Thus, we have designated the identified goldfish cDNA as gfER␤.

Identification of the Goldfish ER␤ mRNAs To characterize the tissue-specific expression of the goldfish ER␤ mRNA(s), the 2.3-kb goldfish ER␤ cDNA was used as a probe in Northern blot analysis of RNA isolated from forebrain, ovary, and liver. Six goldfish liver mRNAs hybridized to the probe under high stringency conditions (Fig. 7). Three predominant mRNAs were approximately 4.8, 3.8, and 3.1 kb in length. Bands of similar size were identified with ovarian mRNA. No clear bands were detected in the forebrain mRNA, indicating that expression of goldfish ER was below the level of detection in this tissue under the conditions of our Northern blot analysis. Three minor mRNA species (approximately 8.6, 7.2, and 6.1 kb) were identified in liver but not ovary. Loading and integrity of the RNA isolated from different tissues was confirmed by hybridizing the same blot with a goldfish actin cDNA probe (Fig. 7). These results indicate that multiple ER mRNAs are expressed in the goldfish ovary and liver and that steady-state mRNA levels are higher in liver than ovary but only weakly expressed in forebrain.

FIG. 6. Phylogenetic tree of vertebrate estrogen receptors. One of the most parsimonious trees (421 steps) for the ER sequences was found using PAUP 3.1 (Swofford, 1993). Branch lengths are proportional to the number of steps along each branch. Support indices (the number of additional steps required in a tree without the node in question; Bremer, 1988) and bootstrap percentages are given above and below branches, respectively. Consistency index (CI) equals 0.87. ER sequences used for analysis are chicken (Krust et al., 1986), zebrafinch (Jacobs et al., 1996), mouse ␣ (White et al., 1987), rat ␣ (Koike et al., 1987), pig (Bokenkamp et al., 1994), sheep (Madigou et al., 1996), frog (Weiler et al., 1987), seabream (Touhata et al., 1998), tilapia (Tan et al., 1995), and salmon (GenBank Accession Number 1706708). Additional sequences are referenced in legend to Fig. 4.

Tissue Distribution of the Goldfish ER␤ by RT-PCR Analysis Because Northern blot analysis failed to detect ER␤ mRNA in forebrain, a more sensitive method of detection, RT-PCR, was used to study tissue sites of expression. Forward primer 8 was chosen within the highly variable hinge region to ensure ER␤ subtype specificity of the PCR product. The specificity of RT-PCR products was confirmed by Southern blot analysis with an

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

396

Tchoudakova, Pathak, and Callard

actin-specific primer pair (at lower concentration) was simultaneously used in each reaction, and an actinspecific oligonucleotide probe was then used for hybridization. Besides liver and ovarian tissues, the goldfish ER␤ mRNA was detected in testis, pituitary, forebrain, mid/hindbrain, and retina.

DISCUSSION

FIG. 7. Northern blot analysis of goldfish poly(A) RNA. Approximately 10 µg of poly(A) RNA isolated from forebrain (FB), ovary (OV), and liver (LV) was size fractionated, blotted to a nylon membrane, and hybridized with the 32P-labeled 2-kb goldfish ER␤ cDNA. The same RNA blot was reprobed with a 1-kb 32P-labeled goldfish actin cDNA fragment. Exposures were 6 days for the ER probe and 12 h for the actin probe.

oligonucleotide probe 10 corresponding to the nucleotide sequence between the specific PCR primers. Figure 8 shows that a product of the expected size (⬃400 bp) was amplified from total RNA of several tissue types using the goldfish ER␤-specific primers. An

FIG. 8. Tissue distribution of the goldfish estrogen receptor ␤ mRNA as determined by RT-PCR and Southern blot analysis. One microgram of total RNA from forebrain (FB), mid/hindbrain (HB), pituitary (PT), retina (RT), liver (LV), ovary (OV), and testis (TS) was reverse transcribed and amplified using goldfish ER␤-specific primers. The products (⬃400 bp) were hybridized with an oligonucleotide probe specific for goldfish ER␤. An actin cDNA fragment was coamplified by RT-PCR using actin-specific primers, and products (⬃200 bp) were detected by Southern blot analysis after hybridization with an actin-specific oligonucleotide probe. Exposures were 2 h for the ER probe and 1 h for the actin probe.

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

The physiological actions of estrogen are mediated mainly through a nuclear ER. In 1986, the ER␣ cDNAs of the human (Green et al., 1986; Greene et al., 1986) and chicken (Krust et al., 1986) were cloned. Consequent availability of ER (now termed ␣ subtype) cDNA probes led to characterization of ER in many other vertebrates, including fish: rainbow trout (Pakdel et al., 1990), tilapia (Tan et al., 1995), medaka (GenBank Accession Number 17006707), salmon (GenBank Accession Number 1706708), Japanese eel (Todo et al., 1996), and red seabream (Touhata et al., 1998). In 1996, a second receptor subtype (designated ER␤) was cloned by RT-PCR of rat prostate using degenerate primers (Kuiper et al., 1996) and quickly confirmed in human (Mosselman et al., 1996) and mouse (Tremblay et al., 1997). This report describes the molecular cloning of the goldfish homolog of an ER␤ subtype. The ER␤ cDNA isolated from goldfish liver encodes a protein of 537–568 amino acids, depending on which of the three ATGs are used. All known mammalian ER␣ subtypes are between 595 and 600 aa in length whereas ER␤ subtypes range from 485 to 530 aa. Avian and amphibian ER forms are slightly shorter (586–589 aa) than mammalian ER␣ subtypes, and the fish ER range from 573 to 583 aa (for reference, see legends to Figs. 4 and 6; Ogawa et al., 1998; Petersen et al., 1998). The variability in size of the amino-terminal domain A/B is the major contributory factor to overall size differences among different ER. Sequence analysis of the goldfish ER␤ cDNA showed that the 380-bp 58untranslated region contains a short ORF of 16 amino acids. A small ORF with uncharacterized functions has also been identified in the 58-untranslated regions of ER cDNAs from several other species (Green et al., l986; Krust et al., l986; Koike et al., l987; Weiler et al., l987; White et al., l987; Pakdel et al., l989; Madigou et al., l996).

Goldfish Estrogen Receptor ␤

A comparison of the amino acid sequence of the goldfish ER to the human (␣), human (␤), rat (␤), mouse (␤), rainbow trout, medaka, and eel ER shows high levels of identity in DBD and LBD domains. The DBD is the most conserved (94–100% identity) among ER and contains two zinc-binding motifs, which are known to form structures which recognize and bind to ER-specific target sites in the DNA. Thus, the high percentage of identity between the goldfish ER DBD and DBDs of other ER suggests similar mechanisms for receptor binding to ERE (Schwabe et al., 1993). The goldfish LBD has 67–68% amino acid identity with the human, rat, and mouse ER␤ subtypes, 79% with the eel ER, and 56–57% with the human ER␣ subtype and the rainbow trout and medaka ER. Structural studies of the human ER␣ LBD have identified amino acids involved in estradiol binding, such as Ala 350, Glu 353, Leu 387, Arg 394, Ile 424, Gly 521, His 524, and Leu 525 (Brzozowski et al., 1997). All of these amino acid residues are conserved in goldfish ER␤ (Ala 331, Glu 334, Leu 368, Arg 375, Ile 405, Gly 502, His 505, and Leu 506). The transcriptional activation function (AF-2) of the LBD of the human ER␣ is centered on a helix 12 (Leu 539 to His 547; Fig. 5). The corresponding region in the gfER␤ is identical to human ER␣ which suggests that ER from phylogenetically distant species modulate transcription in a similar manner. The truncated form of the goldfish ER (clone gfER3) lacks part of the LBD which includes AF-2 (see discussion below). The A/B region of the gfER␤ is most homologous to the eel A/B (49% identity) and mammalian ␤ subtypes (31–35% identity), compared to only 19–21% identity with all other ER forms, including fish. Sequence differences in the A/B domain distinguish ER␣- and ER␤ subtypes of mammals and imply differential transactivation functions (Mosselman et al., 1996; Tremblay et al., 1997). Although the D and F regions of the goldfish ER␤ do not share significant percentage of identity with the corresponding regions of other ERs, these regions are known to be highly variable (Mangelsdorf et al., 1995). Goldfish have twice as many chromosomes as other cyprinid fishes and are considered to be tetraploid (Ohno, 1970). Consistent with the presence of four alleles per fish, sequence variability has been reported for several isolated goldfish genes (Risinger and

397

Larhammar, 1993). The sequence variability that we have found among goldfish ER␤ cDNAs may, therefore, be due to tetraploidy or, alternatively, to polymorphisms among individuals contributing to the pooled RNA used as a template. Of the three clones sequenced, gfER3 is especially interesting because of a 90-nucleotide insertion in the LBD at a position corresponding to the exon 7–8 junction of the trout (Le Roux et al., 1993) and exon 5–6 junction of the human (Ponglikitmongkol et al., 1988) ER genes. Although putative intron 5 of the goldfish ER lacks the highly conserved GT and AG dinucleotides at the donor and acceptor sites, the gfER3 clone may be a partially spliced mRNA variant. On the other hand, the 90nucleotide insertion may be the result of alternative splicing of the transcript. An ER␤ splice variant containing 54 additional nucleotides in the LBD has been found in the rat ovary, prostate, pituitary, muscle, and brain (Chu and Fuller, l997; Petersen et al., 1998). Interestingly, the insertion in the rat ER␤ also occurred at the junction between exons 5 and 6 (Chu and Fuller, 1997) and resulted in an additional 18 amino acids in the LBD. The rat ER␤ variant (termed ER␤2) has been shown to be a specific, functional estrogen receptor capable of forming heterodimers with ER␤ and ER␣ (Petersen et al., 1998). In the case of the gfER3 variant, insertion produces a truncated form of the receptor lacking half of the LBD; thus this form may function as a dominant negative regulator of gfER␤. Although the cDNAs were amplified with high fidelity Taq polymerase, we cannot rule out the possibility that at least some of the differences among clones reflect PCR artifacts. Nonetheless, all of the clones isolated were ER␤. Although the degenerate primers we used to obtain the initial cDNA fragment corresponded to sequences in the DBD and LBD that are conserved in both ␣ and ␤ subtypes, and liver RNA had yielded ER␣-like cDNAs in other fishes, we found no evidence for a hepatic ER␣ in goldfish. Likewise, 58-RACE clones generated with primers targeting conserved sequences within the DBD were exclusively of the ER␤ type. These observations do not rule out a second goldfish ER form. Southern blot analysis of genomic DNA isolated from another polyploid fish, the rainbow trout, was suggestive of two different genes encoding the ER (Le Roux et al., l993). A purposeful search for two ER genes in a wider range of

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

398

species should help to resolve evolutionary relationships and may also provide insights into subtypespecific functions. One of the two most parsimonious trees derived from computer analysis of available ER sequences demonstrates that mammalian ER␤ forms and goldfish and eel ER cluster separately from other ER, including mammalian subtypes of ER␣. Modern teleosts comprise four distinct fish lineages, but the relationships within and between lineages are complex and not fully resolved. According to Lauder and Liem (1983), eels (Order: Elopomorpha) and goldfish (Order: Euteleostei; Superorder: Ostariophysi) are more ancient than the other euteleosts, including Salmoniformes (salmon and trout) and the highly derived Acanthopterygii (medaka, seabream, and tilapia). The relatedness of eel and goldfish ER␤ sequences supports this interpretation of teleostean phylogeny. The presence of both ␣ and ␤ ER subtypes in the human, rat, and mouse, and one or the other subtype in different fish species, indicates that the gene duplication event which led to separate ␣ and ␤ lineages occurred in a common ancestor of mammals and fish. Furthermore, there is a higher degree of conservation within a given receptor lineage across species than there is between receptor subtypes in the same or closely related species: e.g., gfER␤ is more closely related to human ER␤ than to trout ER␣. This signifies some important function and adaptive value for two receptor forms during the course of evolution. Differential functions of ␣ and ␤ ER are not yet fully clarified. Similar to findings with eel ER (Todo et al., 1996), and ER␤ subtypes in mouse and human (Mosselman et al., 1996; Tremblay et al., 1997), Northern blot analysis identified multiple mRNAs which hybridize to the gfER␤ cDNA clone. Since ER cDNAs isolated from other species have long 38-untranslated region, the large mRNAs (⬇8.6, 7.2, and 6.1 kb) encoding the goldfish ER may arise due to usage of distal polyadenylation signals. All identified mRNAs are large enough to contain the entire ER-coding sequence and, in this respect, the goldfish differs from the eel in which some of the transcripts are shorter than the ORF (1.2–1.5 kb). Multiple ER mRNAs categorized as ER␣ subtypes have also been found in two polyploid species, Xenopus (Weiler et al., 1987) and rainbow trout (Pakdel et al., 1990); therefore, different sized gfER␤ transcripts in

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

Tchoudakova, Pathak, and Callard

the goldfish may in part be due to multiple genes of the ER␤ type. To study the tissue distribution of goldfish ER mRNA, RT-PCR analysis was used to amplify a segment between the ER␤-specific hinge (D) region and part of the highly conserved LBD (E) region. The results are consistent with a broad range of expression of ER␤ as has been found in other species (Couse et al., 1997; Kuiper et al., 1997). In goldfish, the highest expression levels are found in liver and gonads, whereas lower levels are measured in neural tissues. Results of Northern analysis and our lack of success in cloning the ER cDNA from goldfish brain confirm the differences between gonadal and neural tissues that are seen with RT-PCR. The gonads are favored sites of expression of ER␤ in rodents (Kuiper et al., 1997), and the areas of the brain which have low or undetectable levels of ER␣ mRNA express high levels of ER␤ (e.g., hippocampus; Shughrue et al., 1997). In conclusion, availability of an ER␤ cDNA will allow us to study its anatomical and functional relationship, if any, with P450arom expression in goldfish brain. Although these studies contribute to our understanding of the ER gene family, further studies are necessary to explain the biological and evolutionary significance of the existence of two different ER subtypes.

ACKNOWLEDGMENTS The authors are grateful to Dr. Michael Sorenson of this department for his help in phylogenetic analysis. We thank Reynaldo Sequerra and Roshana Sikora for technical help. This research was supported by a grant from the National Science Foundation (IBN 96 05053), an Endocrine Society Undergraduate Summer Fellowship (SP), and a traineeship (AT) from the National Institutes of Health (2T32 HD073897). The nucleotide sequence reported in this paper has been submitted to the GenBank/EMBL Data Bank with Accession Number AF061269.

REFERENCES Beato, M., Herrlich, P., and Schutz, G. (1995). Steroid hormone receptors: many actors in search of a plot. Cell 83, 851–857. Begay, V., Valotaire, Y., Ravault, J. P., Collin, J. P., and Falcon, J. (1994).

Goldfish Estrogen Receptor ␤ Detection of estrogen receptor mRNA in trout pineal and retina: Estradiol-17␤ modulates melatonin production by cultured pineal photoreceptor cells. Gen. Comp. Endocrinol. 93, 61–69. Bokenkamp, D., Jungblut, P. W., and Thole, H. H. (1994). The C-terminal half of the porcine estradiol receptor contains no post-translational modification: determination of the primary structure. Mol. Cell. Endocrinol. 104, 163–172. Bremer, K. (1988). The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42, 795–803. Brzozowski, A. M., Pike, A. C., Dauter, Z., Hubbard, R. E., Bonn, T., Engstrom, O., Ohman, L., Greene, G. L., Gustafsson, J. A., and Carlquist, M. (1997). Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389, 753–758. Callard, G. V., Schlinger, B., and Pasmanik, M. (1990). Nonmammalian vertebrate models in studies of brain-steroid interactions. J. Exp. Zool. Suppl. 4, 6–16. Chu, S., and Fuller, P. J. (1997). Identification of a splice variant of the rat estrogen receptor beta gene. Mol. Cell. Endocrinol. 132, 195–199. Church, G. M., and Gilbert, W. (1984). Genomic sequencing. Proc. Natl. Acad. Sci. USA 81, 1991–1995. Clark, J. H., Schrader, W. T., and O’Malley, B. W. (1992). Mechanisms of action of steroid hormones. In ‘‘Textbook of Endocrinology’’ (J. D. Wilson, and D. W. Foster, Eds), pp. 35–90. Saunders, New York. Couse, J. F., Lindzey, J., Grandien, K., Gustafsson, J. A., and Korach, K. S. (1997). Tissue distribution and quantitative analysis of estrogen receptor-alpha (ERalpha) and estrogen receptor-beta (ERbeta) messenger ribonucleic acid in the wild-type and ERalphaknockout mouse. Endocrinology 138, 4613–4621. Davis, R. E., Morrell, J. I., Pfaff, D. W. (1977). Autoradiographic localization of sex steroid-concentrating cells in the brain of the teleost Macropodus opercularis (Osteichthyes: Belontiidae). Gen. Comp. Endocrinol. 33, 496–505. Feinberg, A. P., andVogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6–13. Fine, M. L., Keefer, D. A., and Russel-Mergenthal, H. (1990). Autoradiographic localization of estrogen-concentrating cells in the brain and pituitary of the oyster toadfish. Brain. Res. 536, 207–219. Freedman, L. P., Luisi, B. F., Korszun, Z. R., Basavappa, R., Sigler, P. B., and Yamamoto, K. R. (1988). The function and structure of the metal coordination sites within the glucocorticoid receptor DNA binding domain. Nature 334, 543–546. Gelinas, D., Pitoc, G. A., and Callard, G. V. (1998). Isolation of a goldfish brain cytochrome P450 aromatase cDNA: mRNA expression during the seasonal cycle and after steroid treatment. Mol. Cell. Endocrinol. 138, 81–93. Green, S., Walter, P., Kumar, V., Krust, A., Bornert, J. M., Argos, P., and Chambon, P. (1986). Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320, 134–139. Greene, G. L., Gilna, P., Waterfield, M., Baker, A., Hort, Y., and Shine, J. (1986). Sequence and expression of human estrogen receptor complementary DNA. Science 231, 1150–1154. Jacobs, E. C., Arnold, A. P., and Campagnoni, A. T. (1996). Zebra

399 finch estrogen receptor cDNA: cloning and mRNA expression. J. Steroid. Biochem. Mol. Biol. 59, 135–145. Kato, S., Endoh, H., Masuhiro, Y., Kitamoto, T., Uchiyama, S., Sasaki, H., Masushige, S., Gotoh, Y., Nishida, E., Kawashima, H., Metzger, D., and Chambon, P. (1995). Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 270, 1491–1494. Kim, Y. S., Stumpf, W. E., and Sar, M. (1978). Topography of estrogen target cells in the forebrain of goldfish, Carassius auratus. J. Comp. Neurol. 182, 611–620. Koike, S., Sakai, M., and Muramatsu, M. (1987). Molecular cloning and characterization of rat estrogen receptor cDNA. Nucleic Acids Res. 15, 2499–2513. Krust, A., Green, S., Argos, P., Kumar, V., Walter, P., Bornert, J. M., and Chambon, P. (1986). The chicken oestrogen receptor sequence: homology with v-erbA and the human oestrogen and glucocorticoid receptors. EMBO J. 5, 891–897. Kuiper, G. G., Carlsson, B., Grandien, K., Enmark, E., Haggblad, J., Nilsson, S., and Gustafsson, J. A. (1997). Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 138, 863–870. Kuiper, G. G., Enmark, E., Pelto-Huikko, M., Nilsson, S., and Gustafsson, J. A. (1996). Cloning of a novel receptor expressed in rat prostate and ovary. Proc. Natl. Acad. Sci. USA 93, 5925–5930. Lauder, G. V., and Liem, K. F. (1983). The evolution and interrelationships of the actinopterygian fishes. Bull. Mus. Comp. Zool., Harvard 150, 95–197. Le Roux, M. G., Theze, N., Wolff, J., and Le Pennec, J. P. (1993). Organization of a rainbow trout estrogen receptor gene. Biochim. Biophys. Acta 1172, 226–230. Lindzey, J., and Korach, K. S. (1997). Developmental and physiological effects of estrogen receptor gene disruption in mice. Trends. Endocrinol. Metab. 8, 137–145. Madigou, T., Tiffoche, C., Lazennec, G., Pelletier, J., and Thieulant, M. L. (1996). The sheep estrogen receptor: Cloning and regulation of expression in the hypothalamo-pituitary axis. Mol. Cell. Endocrinol. 121, 153–163. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995). The nuclear receptor superfamily: The second decade. Cell 83, 835–839. Morrell, J. I., Kelley, D. B., and Pfaff, D. W. (1975). Sex steroid binding in the brain of vertebrates. Proc. Int. Symp. Brain-Endocr. Interact. 2, 230–256. Mosselman, S., Polman, J., and Dijkema, R. (1996). ER beta: identification and characterization of a novel human estrogen receptor. FEBS Lett. 392, 49–53. Needleman, S. B., and Wunsch, C. D. (1970). A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol. 48, 443–453. Ogawa, S., Inoue, S., Watanabe, T., Hiroi, H., Orimo, A., Hosoi, T., Ouchi, Y., and Muramatsu, M. (1998). The complete primary structure of human estrogen receptor beta (hER beta) and its heterodimerization with ER alpha in vivo and in vitro. Biochem. Biophys. Res. Commun. 243, 122–126.

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

400 Ohno, S. (1970). ’’Evolution by Gene Duplication,’’ pp. 59–88. Springer-Verlag, Berlin/New York. Pakdel, F., Le Gac, F., Le Goff, P., and Valotaire, Y. (1990). Full-length sequence and in vitro expression of rainbow trout estrogen receptor cDNA. Mol. Cell. Endocrinol. 71, 195–204. Pakdel, F., Le Guellec, C., Vaillant, C., Le Roux, M. G., and Valotaire, Y. (1989). Identification and estrogen induction of two estrogen receptors (ER) messenger ribonucleic acids in the rainbow trout liver: sequence homology with other ERs. Mol. Endocrinol. 3, 44–51. Pasmanik, M., and Callard, G. V. (1988). Changes in brain aromatase and 5␣-reductase activities correlate significantly with seasonal reproductive cycles in goldfish (Carassius auratus). Endocrinology 122, 1349–1356. Pasmanik, M., Schlinger, B. A., and Callard, G. V. (1988). In vivo steroid regulation of aromatase and 5␣-reductase in goldfish brain and pituitary. Gen. Comp. Endocrinol. 71, 175–182. Petersen, D. N., Tkalcevic, G. T., Koza-Taylor, P. H., Turi, T. G., and Brown, T. A. (1998). Identification of estrogen receptor beta2, a functional variant of estrogen receptor beta expressed in normal rat tissues. Endocrinology 139, 1082–1092. Ponglikitmongkol, M., Green, S., and Chambon, P. (1988). Genomic organization of the human oestrogen receptor gene. EMBO J. 7, 3385–3388. Risinger, C., and Larhammar, D. (1993). Multiple loci for synapse protein SNAP-25 in the tetraploid goldfish. Proc. Natl. Acad. Sci. USA 90, 10598–10602. Salbert, G., Atteke, C., Bonnec, G., and Jego, P. (1993). Differential regulation of the estrogen receptor mRNA by estradiol in the trout hypothalamus and pituitary. Mol. Cell. Endocrinol. 96, 177–182. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). ’’Molecular Cloning: A Laboratory Manual,’’ 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schwabe, J. W., Chapman, L., Finch, J. T., and Rhodes, D. (1993). The crystal structure of the estrogen receptor DNA-binding domain bound to DNA: How receptors discriminate between their response elements. Cell 75, 567–578. Shughrue, P. J., Lane, M. V., and Merchenthaler, I. (1997). Comparative distribution of estrogen receptor-alpha and -beta mRNA in the rat central nervous system. J. Comp. Neurol. 388, 507–525. Simpson, E. R., Zhao, Y., Agarwal, V. R., Michael, M. D., Bulun, S. E., Hinshelwood, M. M., Graham-Lorence, S., Sun, T., Fisher, C. R.,

Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

Tchoudakova, Pathak, and Callard Qin, K., and Mendelson, C. R. (1997). Aromatase expression in health and disease. Recent Prog. Horm. Res. 52, 185–213. Swofford, D. L. (1993). ’’PAUP: Phylogenetic Analysis Using Parsimony,’’ Version 3.1. Illinois Natural History Survey, Champaign, IL. Tan, N. S., Lam, T. J., and Ding, J. L. (1995). Molecular cloning and sequencing of the hormone-binding domain of Oreochromis aureus estrogen receptor gene. DNA Seq. 5, 359–370. Tchoudakova, A. V., and Callard, G. V. (1996). Molecular cloning of the 58-flanking region of the goldfish brain aromatase gene. In ‘‘Program of the 26th Annual Meeting of the Society for Neuroscience, Washington, DC, 1996,’’ p. 325. [Abstract 133.12] Tchoudakova, A., and Callard, G. V. (1998). Identification of multiple CYP19 genes encoding different cytochrome P450 aromatase isozymes in brain and ovary. Endocrinology 139, 2179–2189. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673– 4680. Todo, T., Adachi, S., and Yamauchi, K. (1996). Molecular cloning and characterization of Japanese eel estrogen receptor cDNA. Mol. Cell. Endocrinol. 119, 37–45. Touhata, K., Kinoshita, M., Toyohara, H., and Sakaguchi, M. (1998). Sequence and expression of a cDNA encoding the red seabream estrogen receptor. Fish. Sci. 64, 131–135. Tremblay, G. B., Tremblay, A., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Labrie, F., and Giguere, V. (1997). Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor beta. Mol. Endocrinol. 11, 353–365. Trudeau, V. L. (1997). Neuroendocrine regulation of gonadotrophin II release and gonadal growth in the goldfish, Carassius auratus. Rev. Reprod. 2, 55–68. Weiler, I. J., Lew, D., and Shapiro, D. J. (1987). The Xenopus laevis estrogen receptor: Sequence homology with human and avian receptors and identification of multiple estrogen receptor messenger ribonucleic acids. Mol. Endocrinol. 1, 355–362. White, R., Lees, J. A., Needham, M., Ham, J., and Parker, M. (1987). Structural organization and expression of the mouse estrogen receptor. Mol. Endocrinol. 1, 735–744. Zou, J. J., Trudeau, V. L., Cui, Z., Brechin, J., Mackenzie, K., Zhu, Z., Houlihan, D. F., and Peter, R. E. (1997). Estradiol stimulates growth hormone production in female goldfish. Gen. Comp. Endocrinol. 106, 102–112.