- Email: [email protected]
Molecular cloning of chick pineal tryptophan hydroxylase and circadian oscillation of its mRNA levels
We have previously shown that the level of [ “S]mrthionine incorporation into tryptophan hydroxylase (TPH) shows ;t circadian protein oscillation perhihts in constant darkness. peaks in the early night and can be in cultured chick pineal cells. The TP phase-shifted by light, in parallel to the effect of these treatments on melatonin synthesis. We have cloned and sequenced a full-length cDNA for chick pineal TPH. Levels of TPH mRNA show a robust diurnal oxillation both in viva and in vitro. The rhythm in TPH mRNA also persists in constant darkness. suggesting that TPH mRNA synthesis and/or turnover is regulated by an endogenous circadian clock in cultured chick pineal cells. The circadian oscillation of TPH constitutes the first described circadian rhythm of ;1 chick pineal gene at the mRNA level. rhythm
A low-amplitude
1. Introduction
circadian rhythm
in the enzymatic
activity of
In the pineal gland. melatonin i5 3ynthesizcd in ;I circadian manner by the sequential action of the enzymes tryptophan hydroxylase (TPH, EC I. 14.16.4). aromatic-t_amino acid decarboxylase (EC 4.1.1.28 ), arylalkylamine IV-acetyltransferase (NAT, EC 2.3.1.873 and hydroxyindole-0-methyltransferase (HIOMT, EC 2.1.1.4) [20]. The gene for mammalian NAT has recently been cloned. and a significant nocturnal rise in rat NAT mRNA has been documented [3,6]. in dissociated chick pineal cells. a circadian rhythm in melatonin synthesis and the activity of the rate-limiting enzyme NAT has been described [9,23]; this circadian oscillation is dependent on de novo protein synthesis [8], which is required daily at specific circadian phases [28]. In screening for proteins which oscillate in a circadian manner in chick pineal cultures. we have recently shown that incorporation of [“S]methionine into TPH is also regulated by the circadian oscillator in chick pineal cells, and that a diurnal oscillation in the abundance of TPH protein exists both in vivo and in vitro [ 141.
* Corresponding author. Fax: -t 1 (847) 467465 52 I 1; E-mail: [email protected]
or + 1 (847) 491-
TPH has been documented in both rat pineal gland [2~.26] and chicken retina [%I. Furthermore. the nocturnal rise in TPH activity is inhibited by cycloheximide in both systems [25,26,29]. In addition, a transcriptionally regulated circadian rhythm in TPH gene expression has recently been described in X~ttc>/~u.s retina [ 171. In order to elucidate the molecular mechanisms by which the circadian osciiiator regulates TPH gene expression in chick pineal cultures, we have cloned chicken TPH from a pineal cDNA library and evaluated its mRNA levels in the pineal both in vivo and in vitro. We report here the complete coding sequence of chick pineal TPH and document a circadian oscillation in TPH mRNA in cultured chick pineal cells.
aterials and methods
Cell culture chemicals were obtained as previously described [ 11; molecular biology reagents were from Pharmacia (Uppsala. Sweden); oligonucleotides were custom-
0169-328X/96/$15.00 Copyright 0 1996 Elsevier Science B.V. All rights reserved. Pff SO 169-328X(96)00 104-O
ordered from Integrated DNA Technologies (Coralville, IA); all radiochemicals were from New England Nuclear (Boston, MA). All other chemicals were purchased from Sigma (St. Louis. MO).
analysis was carried out with GeneWorks (version 2.4) a Macintosh computer.
2.2. Cell cultlln?
Pineal glands from -., 100 chicks hatched on the sa day (2-4 weeks old, depending on the experiment) were col!ccted at four 6-h intervals during a 1ight:dark 12: 12 cycle (LD), and mRNA was isolated using a micro-FastTrack mRNA isolation kit (Invitrogen). For in vitro experiments, chick pineal cells were dispersed as previously described [ 11.On day 3 of culture, total RNA was isolated at four 6-h interval.,c zither in LD or constant darkness (DD) using a microscale total RNA isolation kit (Clontech). an LD For the DD experiment, cultures were entrained ; RNA 12: 12 cycle for two days and then transferred to collection began 6 h after lights-off. and was performed in darkness using an infrared viewer (FJW Industries). Samples (1 +g of mRNA or 4 l~lg of total RNA) were denatured and separated by gel electrophoresis as in Sambrook et al. [24]. Gels were blotted onto Duralon membranes (Stratagene) in 10 X SSC. Hybridization and washing conditions were the same as the ones used for library screening. RNA blots were prehybridized for 3 h at 42OC, hybridized overnight with the TPHlO or ACT3 probes at w 10h c.p.nn.jml, and washed at high stringency as outlined above. Blots were exposed for several durations to X-OMAT autoradiography film with an intensifying screen, and autoradiograms with signals below saturation level were scanned and quantified using the Quantity One software program (version 2.2) from PDl.
The dispersal of chick pineal ceils and other cell culture procedures were performed as previously described [l I.
2.3. Library screening Partial cDNA TPH fragments were generated by PCR using a chick pineal AZAPII (Stratagene) cDNA library
constructed from mRNA isolated from cultured chick pineal cells immediately after lights-off (Zeitgeber time or ZT 12, ZT 0 defined as the time of light onset in a 1ight:dark 12: 12 cycle). Sequence information from the 5’ region of previously isolated partial clones [ 121 was used to design TPHlO, generated by PCR with forward primer TPHS (SCAGGAGAAGCATGTGAACC3 ) and reverse primer TPH6R (5’GCTTGTAG’TTCATAGCCAGG3’), spanning a 354-bp segment of chicken TPH homologous to a mouse TPH sequence spanning residues 217-57 1 1271. A chicken @actin partial cDNA fragment (ACT3) was generated by PCR using the ZT 12 cDNA library, with PCR forward primer ACT1 (S’GCGTGACATCAAGGAGAAGCJ) and reverse primer ACT2R (5’CCACATCACACTTCATGATGG3’), spanning a 236-bp segment of the chicken p-actin coding sequence (GenBank accession No. LO8165). All PCR products were gel-purified and labeled with [“‘P]dCTP by random-priming using the Ready-to-Go kit (Pharmacia). Hybridization solution consisted of 50% formamide, 10% dextran sulfate, 1 M NaCl, 1% SDS and herring sperm DNA (100 @g/ml). Hybridization was performed overnight at 42OC; the nitrocellulose filters were washed for 15 min with 2 X SSC/O. 1% SDS at room temperature, and 3 X 15 min with 0.2 X SSC/O.l% SDS at 65°C. The ZT 12 cDNA library (10” pfu) was screened with probe TPH 10, and after three rounds of screening five putative clones were isolated and excised with the ExAssist/SOLR cell system (Stratagene) according to the manufacturer’s protocols. The 5’end of the largest clone (pTPH-37, 3.4 kb long) was sequenced until a region of perfect overlap with a previously isolated partial clone was found. 2.4. DNA seqttertcing Dideoxynucleotide DNA sequencing was performed by ‘primer-walking’ with the Sequenase 2.0 kit (United States Biochemical) according to the manufacturer’s protocol. Sequence autoradiograms were scanned, read and visually inspected with the DNA Code software program (version 2.1) from PDI (Huntington Station, NY), using a Sun Microsystems Sparcstation2 (SunOS 4.1.1). Sequence
on
2.5. Northern blots
3. Results 3.1. Molecular cloning cf chickert TPH The ZT 12 chick pineal AZAPII cDNA library was screened with the TPHlO probe. The longest isolated clone (pTPH-37) measured 3.4 kb and appeared to be a full-length cDNA. Sequence results showed that pTPH-37 contained a 1338bp open reading frame, encoding a 445-amino-acid protein with a predicted molecular weight of 51 kDa and an isoelectric point of 6.3 (GeneWorks). The 5’ untranslated region (UTR) was 82 bp long, whereas the 3’ UTR was found to be N 2 kb long. The chicken TPH coding region has 68% nucleotide identity with either mouse or Xertopus TPH. Although two in-frame ATG codons were found adjacent to each other near the translation initiation site, only the second one had an adenosine residue at the - 3 position, in accordance with the ribosomal binding site consensus sequence of Kozak [21]; it also aligned perfectly with the rat, rabbit and human TPH initiation codons. The termination codon was found at the same position as that of isoforms of TPH from other species.
27
A Northern blot of chicken pincal gland m with T 10 revealed a strongly hybridizing kb in size and a mu weaker signal -+.3.6 2). Changes in both nds occurred in paral transcript was found to hybridize wit probe ACT3, in agree al. [2]. Chicken pineal a diurnal fashion in vi at ZT 12, preceding the peak in observed previously in Western bl obed with antiantibody [ 141.
An oscillation in TP mRNA levels detected in whole pineal glands may not be preserved in dispersed chick pineal cells. Furthermore. olecular manipulation and promoter analysis of the TP gene requires in vitro conditions, which impose a limitation on the amount of RNA that can be extracted. Therefore, the above experiment was replicated in cell culture. In agreement with the in viva results, dissociated chick pineal cells maintained in LD 12: 12 show a robust oscillation in TPH mRNA abundance on the third day of culture (Fig. 3). The temporal profile ot
Hisan TTH >lotxeTPH Chicken TPH Xencps T?H
Fill?. 2. Top panel. Northern blot of mRNA obtained at four different point+, from pincal gland3 of chicks maintained in LD 1’: I?. probed the TPH 10 and ACT3 prohc~. T~vo TPH transcripts can he detected. at z 4 Lb d onL? Lit - 3 (7 hh:chicka @-actin mRNA migrare\ at hh. Botrom panel. normalization of the stronger TPH signal to the signal, showing a robust diurnal oscillation of TPH mRNA in viva.
rime with one 5 I .8 actin
the oscillation is consistent with the rhythm in [ 35S]methionine incorporation into TPH protein observed previously. which showed a peak at ZT !I- 16 and a trough at ZT O-4 [I-I].
When dissociated chick pineal ~~115 art‘ transferred DD. they maintain a qualitatively similar oscillation
to in
ii 60
97
Hman T?!i t-'o**se . Y TPH C>lzken T?li %XICQl?S TPH
153
tiumn TPH Mouse TP!i Chicken TPH Xenopus TPH
259 262 260 296
Humn TPH Hcusc TPH C!-tic:ken TPH Xcnopus T?H
359 362 360 396
Humn TPH Mouse TPH Chicken TPH Xencpus TPH
444 447 445 481
162 160 196
Fig. I. Deduced chicken TPH amino acid sequence, aligned with the human [J]. mouse [27] and Xt~nc~prrs [ 171TPH sequences. Amino acid identities arc boxed. The five cysteines conserved among all hydroxylases are marked by white dots; the four cysteines conserved only in TPH are marked by black dots: two serines, marked by arrows at positions 58 and 261. are putative phosphorylation sites. Note the insertional mutation cf an aspartate residue at position of chicken pineal TPH. including the 5’ UTR and th; first 157 bases of the 3’ UTR. is 102 of the chicken sequence. The complete codin,0 sequence . available from GenBank (accession no. U26428).
28
Actin
+
0
6
12 18
Zeitgeber time Fig. 3. Northern blot of total RNA obtained at four different time points from dissociatedchick pineal cells maintained in LD 12: 12.probed with the TPHIO and ACT3 probes. Top panel. TPH s~pnal: middle panel. actin signal; bottom panel. normalization of the 4kb TPH mRNA to actin mRNA showing a robust diurnal oscillation of TPH mRNA in vitro.
TPH mRNA levels, with a trough at circadian time 0 and a subsequent rise which are independent of light input (Fig. 4). The slight decrease in amplitude is consistent with the differences documented previously at the protein level, since the rhythm in TPH [‘“S]methionine incorporation also damps in DD [ 141.
TPH Actin
?? ? ?1.5 ? 3 5 1.0 Eo .d 3 d
0.5 0.0 18” 0
6
12
Circadian time Fig. 4. Northern blot of total RNA obtained at four different time points from dissociated chick pineal ceils maintained in DD, probed with the TPHlO and ACT3 probes. Top panel, TPH signal; middle panel, actin signal; bottom panel, normalization of TPH mRNA to actin mRNA showing a circadian oscillation of TPH mRNA in vitro. The first time point(18 1indicates6 h after lights-off. and is therefore considered part of the preceding light:dark cycle. ??
We have isolated a full-length cDNA clone coding for chick pincal TPH. Its predicted molecular isoelectric point are consistent with protein d native pl of 6.3 corresponds to the most basic TPH isoforms detected in two-dimensional Western blots, suggesting the existence of a mechanism for posttional regulation of TPH. The sequence of chicken highly homologous to published sequences o [4,7,17,18,27], and includes the five cysteines of the catalytic region that are common to other hydroxylases as well as four TPH-specific cysteines. Chicken TP similar to mammalian TPHs in that it lacks the 37-aminoacid segment found in the amino terminus of Xerzoptrs TPH [ 171. It also contains two putative phosphorylation sites: there is a consensus site for CAMP-dependent phosphorylation at Se? and a consensus site for phosphorylation by CaNi kinase II at Se?’ [7]; both modes of phosphorylation have been implicated in TPH regulation [ 10,11,15,16]. A third putative phosphorylation site (Ser”’ in mouse TPH) is absent from both the chicken and Xenc>/jus TPH sequences. The functional significance of each phosphorylation site remains to be determined, although phosphorylation of TPH by either PKA or CaM kinase II is necessary for binding and activation of TPH by protein 14-3-3 [ 16,191. Consistent with the multiple phosphorylation sites, three different protein isoforms of chicken TPH, of identical molecular weight and slightly different isoelectric points, can be detected in two-dimensional Western blots [ 141. In agreement with the temporal profile of TPH protein expression [ 141. the steady state level of chicken TPH mRNA shows a diurnal oscillation both in vivo and in vitro. The decrease and subsequent rise of TPH mRNA occurs in the absence of light input in vitro, suggesting that it is driven by an endogenous circadian clock and that circadian regulation of TPH is pre-translational. This oscillation is consistent with the circadian rhythm of TPH [” Slmethionine incorporation previously shown on the second day of constant darkness [ 141. The oscillation of TPH reported here is the first described circadian rhythm of gene expression in the chick pineal. Although Bernard et al. [2] showed a three-fold diurnal rhythm in the abundance of chick pineal HIOMT mRNA, they did not document the persistence of the HIOMT rhythm in constant conditions. Whether the regulation of TPH gene expression occurs at the transcriptional level remains to be determined, although recent results in Xeizoplcs f 171 indicate that this might indeed be the case. The genes for ovine [6] and rat [3] NAT have recently been cloiied, and high-amplitude oscillations in mammalian pineal NAT mRNA levels have been documented. These results are consistent with the well-known circadian rhythm in NAT enzyme activity [20], and suggest that the oscillation of melatonin in the pineal gland is generated in
with the pattern of doleacetic acid levels Ehwl. M.. Pe~et. P. and Maitre, M.. Tryptophan hydroxylase synthe4s I\ induced hy 3’.5’-cqzlic adcnosine nmwphosphatr during circadian rhythm
n conclusion,
we have eloneu
chick
in the rut pinwl
fland.
J.
~~‘1’1ft~fJf’/IP/tZ..
57
(
represents the first clock-controlled gene in dissociated chick pineal cells. Thus. it joins a growing family of clock-controlled genes in several ecausc in nonvertebrate species (reviewed in [I rnal~~~na~iar~ vertebrates ~~~d~~/~dua~ 1 ceils contain a circadian clock [22,28], characteriz of promoter elements in clock-controlled genes may lead to a better understanding of the regulation of gene expression by the vertebrate circadian oscillator.
Flow. J.C.. C‘it~cwlitut-t ltrc% c.otttr.ol rff‘ pr’rtlcitt c~.\prcs\iott ortd cff’ ttichrlottii~ ~.vtttlti~~i~ in i~trltrrtmi cdlicA pirtiwl CY//S: rqirltrtion It:\pfoplttttt h~rft~t.vvl~rw. Ph.D. Di\wrtation. 199.5. Northnatern l’niicr~rt~. Flow/.
J.C. and Tahahadai. J.S.. The circadian clad,: from ~~wlax~lt~
IO heha\iour.
.4tttt..21c~l.. 27 ! i Wi 14XI -190.
~IUTL’L. J.C. and Tahaha4~i. clock-controlled
J.S.. Quantn,tti~e
2D gel analysrs 01
proteins in cultured chick pineal cell\:
of tryptophan hgdroxylase.
J. Hiol. Klt~thtt~.~ (
Fujimia.
Ii..
H. and Okuno, S.. Regulation
of tyrwine
Yamauchi. T.. Nakata.
3-monooxygcnase
h
R~wsd~lt~
Firt~ritct~ Atir tt~tc’c’.~.Elw-
S.. Yamauchi.
T.. lwbc,
RCL C~ttttrtttrrtt.. 19-I
v.
Grwn.
C.B. and Bc\harw.
i\
( 1993)
Grcnncl. cIIX.4
6’
( 199.4)
H.E.. Lcdlq.
clock
in
c\prcv+ion
,Ycrro/w\ /rwrt\
F.D..
Reed. L.L. 4
Full-ILV~I~
Woo. S.I...
for rahhil tr\ pk>ph;tn h)drcIuylasc: l‘liilC*llOllUl domains
~~d.tliw
01 Lu’oinal~l: tiuUu0 acid hydloh) lasts.
l’riw.
T.. Yamauchi. T. and Fujisawa.
phan S-moncwxygenase and tyrosine 3monooxygcnasc 2 I9 (1987) and Takahashi.
J.S.. Temperature
compensation
Bernard. M.. Guerlotte. Voism.
J.
P.. Collin.
regulation of hydroxyindole
in the chicken
pineal gland: day/night
effects of light and darkness.
Bidim.
J.-P. and O-methyl-
change\ 1.. 200
and
( 1993)
J.. V
and Snyder. S.H..
encoding serotonin N-acetyltransferase
Diurnal
variation
in
in pincal gland. Nlr-
ture, 378 (1995) 783-785. [4] Boularand. S.. Darmon. M.C.. Ganem. Y .. Launay. J.M. and Mallet. J.. Complete coding sequence of human rryptophan hydroxylase. Ndcic Acids Res., I8 ( 1990) 4257. [5] Cassone. Menaker.
V.M.. M..
Takahashi. Dynamics
J.S..
Blaha.
of noradrenergic
C.D..
Law.
circadian
chicken pineal gland. Brtlirt Rvs.. 38-l ( I9861 33-l-34
R.F. input
to
and the
I.
Baler. R.. Weller, J.L.. Namboodiri. Koonin, E.V. and Klein. D.C.. Pineal serotonin N-acetyl-
[6] Coon. S.L.. M.A.A..
D.C..
Roseboom.
P.H..
protein hinase II. fiEl3.S 1.011..
Au&a&.
D.A..
Namboodiri.
M.A.A.
and Wheler.
Indole metabolism in the mammalian pineal gland. In R.J.
G.H.T..
T/w P~mwl Glmtl.
CRC,
Boca Raton. FL.
I98 I.
pp.
I w-227. Koxak.
M.. Compilation
and analysis of sequences upstream from
1hc translational start site in cukaryotic mRNA\. IZ
( 1983)
Pickard.
66 I-664. [3] Borjigin. mRNA
Klein.
trypto-
in lhc pres-
79-82.
Reiter (Ed.).
J.. Cogne. M.. Grew.
P.. Transcriptional
transferase long-term
and
IS ( I9OS)568 I -5692.
Neurwsci..
[z]
. calmodulin-dcpcndcnt
ence of Ca’+
Barrett, R.K.
:llld
~V~tll. & clil.
SC*;. USA, 83 ( 1987) ss30-5534. lchimura. T.. Isobe. T.. Okuyama.
temperature entraimnent of the chick pincal ceil circadian cloth.
./.
retina.
XX-‘4X.
H.. Brain 14-3-3 protein is an activator protein that activate\
efcrences
inter-
Nictchti.
I-U- I49
J.C.. Tr>ptophan h!dro~ylaw
I-rgulrr~d h> ;L circadian
.Vc~rtt~f~~~/lf~ttl..
T. and
of the pho
airion of lr) ptc ,rh;in hydroxy~asc M ilh the I-1-3-3 protein. Hiftplt!
by
Etr;?ttw Krg-
I X3.
Y.. Ikuta. N.. Omata.
. T.. Demonstration
Ichimura
In P. Cohen (Ed. 1.
Wtr~.v~~hrtt~lttti~tt~ -
Ne\v Yorh. 19X-4. pp. l67-
Furukunu.
1906).
and tryptophan S-monooxygenasc
pho\phor~lation-depliosphorylatit~n. +r.
We thank Cameron Flint and Gene Minner for excellent photographic assistance. This work was supported by predoctoral NRSA F30 MH 10 189 to J.C.F., predoctoral NRSA A F32 F3 I MH 10287 to K.J.S.. postdoctoral _3%92. MH10369 to R.K.B., and NiH Gralit> Rf7 R01 NH31 2 11 and an NSF Center for Biological Timing Grant to J.S.T.
circadian
rqularion
htiotr
[I]
)
1991
lS113-1521.
circadian
Ntrckic~ kid.~
RPS..
X57-872. G.E.
and Tang,
W.-X..
rhythm in melatonin
Individual secretion,
pineal CCIIS exhibit
HIU~II Kc.\..
a
627 (IW?)
I-tl-l-w. Robertson. L.M. and Takahashi. J.S.. Circadian cloth in cell culture. 1. Oscillation of melatonin release from dissociated chick pineal cells in flow-~llrough microcarrier
Sambrook,J.. Ld~orirrfq
culture, J. N0lrro.sc.i.. X ( 19%)
Fritsch, E.F. and Maniatis. T.. Mokc*dt~~
?hrmal.
Cold
Sprin,o Harbor
Laboratory
Iz-:! 1.
ClftttitW:
(1
Press. Cold
Spring Harbor. 1989.
fjhibuya,
H., Toru,
M. and Watanabe,
S. A circadian
tryptophan hydroxylase in rat pineals. RI&~/I Rt*.s.. 368.
rhythm (11
1% ( 1978).%a-
[26] Sitaram. B.R. and Lees, G.J. Diurnal rhythm and turnover of tryptophan hydroxylase in the pineal gland of the rat, J. Neurod~em., 31 (1978) 1021-1026. [27] Stall. 1.. Kozak, C.A. and Goldman, D. Characterization and chromosomal mapping of a cDNA encoding tryptophan hydroxylase from a mouse mastocytoma cell line, Genomics, 7 (1990) 88-96. [28] Takahashi. J.S.. Murakami. N.. Nikaido, S.S.. Pratt, B.L. and
Robertson. L.M. The avian pineal. a vertebrate model system of the circadian oscillator: cellular regulation of circadian rhythms by iigirr. second messengers, and macrvmolecular synthesis. K~wnt ,!%g. Harm Rex., 45 (1989) 279-352. [29] Thomas. K.B. and Iuvone. P.M. Circadian rhythm of tryptophan hydroxylase activity in chicken retina. C4l. Mo/. Ncl~rrthio/.. I I (1991) 51 I-527.
A low-amplitude
1. Introduction
circadian rhythm
in the enzymatic
activity of
In the pineal gland. melatonin i5 3ynthesizcd in ;I circadian manner by the sequential action of the enzymes tryptophan hydroxylase (TPH, EC I. 14.16.4). aromatic-t_amino acid decarboxylase (EC 4.1.1.28 ), arylalkylamine IV-acetyltransferase (NAT, EC 2.3.1.873 and hydroxyindole-0-methyltransferase (HIOMT, EC 2.1.1.4) [20]. The gene for mammalian NAT has recently been cloned. and a significant nocturnal rise in rat NAT mRNA has been documented [3,6]. in dissociated chick pineal cells. a circadian rhythm in melatonin synthesis and the activity of the rate-limiting enzyme NAT has been described [9,23]; this circadian oscillation is dependent on de novo protein synthesis [8], which is required daily at specific circadian phases [28]. In screening for proteins which oscillate in a circadian manner in chick pineal cultures. we have recently shown that incorporation of [“S]methionine into TPH is also regulated by the circadian oscillator in chick pineal cells, and that a diurnal oscillation in the abundance of TPH protein exists both in vivo and in vitro [ 141.
* Corresponding author. Fax: -t 1 (847) 467465 52 I 1; E-mail: [email protected]
or + 1 (847) 491-
TPH has been documented in both rat pineal gland [2~.26] and chicken retina [%I. Furthermore. the nocturnal rise in TPH activity is inhibited by cycloheximide in both systems [25,26,29]. In addition, a transcriptionally regulated circadian rhythm in TPH gene expression has recently been described in X~ttc>/~u.s retina [ 171. In order to elucidate the molecular mechanisms by which the circadian osciiiator regulates TPH gene expression in chick pineal cultures, we have cloned chicken TPH from a pineal cDNA library and evaluated its mRNA levels in the pineal both in vivo and in vitro. We report here the complete coding sequence of chick pineal TPH and document a circadian oscillation in TPH mRNA in cultured chick pineal cells.
aterials and methods
Cell culture chemicals were obtained as previously described [ 11; molecular biology reagents were from Pharmacia (Uppsala. Sweden); oligonucleotides were custom-
0169-328X/96/$15.00 Copyright 0 1996 Elsevier Science B.V. All rights reserved. Pff SO 169-328X(96)00 104-O
ordered from Integrated DNA Technologies (Coralville, IA); all radiochemicals were from New England Nuclear (Boston, MA). All other chemicals were purchased from Sigma (St. Louis. MO).
analysis was carried out with GeneWorks (version 2.4) a Macintosh computer.
2.2. Cell cultlln?
Pineal glands from -., 100 chicks hatched on the sa day (2-4 weeks old, depending on the experiment) were col!ccted at four 6-h intervals during a 1ight:dark 12: 12 cycle (LD), and mRNA was isolated using a micro-FastTrack mRNA isolation kit (Invitrogen). For in vitro experiments, chick pineal cells were dispersed as previously described [ 11.On day 3 of culture, total RNA was isolated at four 6-h interval.,c zither in LD or constant darkness (DD) using a microscale total RNA isolation kit (Clontech). an LD For the DD experiment, cultures were entrained ; RNA 12: 12 cycle for two days and then transferred to collection began 6 h after lights-off. and was performed in darkness using an infrared viewer (FJW Industries). Samples (1 +g of mRNA or 4 l~lg of total RNA) were denatured and separated by gel electrophoresis as in Sambrook et al. [24]. Gels were blotted onto Duralon membranes (Stratagene) in 10 X SSC. Hybridization and washing conditions were the same as the ones used for library screening. RNA blots were prehybridized for 3 h at 42OC, hybridized overnight with the TPHlO or ACT3 probes at w 10h c.p.nn.jml, and washed at high stringency as outlined above. Blots were exposed for several durations to X-OMAT autoradiography film with an intensifying screen, and autoradiograms with signals below saturation level were scanned and quantified using the Quantity One software program (version 2.2) from PDl.
The dispersal of chick pineal ceils and other cell culture procedures were performed as previously described [l I.
2.3. Library screening Partial cDNA TPH fragments were generated by PCR using a chick pineal AZAPII (Stratagene) cDNA library
constructed from mRNA isolated from cultured chick pineal cells immediately after lights-off (Zeitgeber time or ZT 12, ZT 0 defined as the time of light onset in a 1ight:dark 12: 12 cycle). Sequence information from the 5’ region of previously isolated partial clones [ 121 was used to design TPHlO, generated by PCR with forward primer TPHS (SCAGGAGAAGCATGTGAACC3 ) and reverse primer TPH6R (5’GCTTGTAG’TTCATAGCCAGG3’), spanning a 354-bp segment of chicken TPH homologous to a mouse TPH sequence spanning residues 217-57 1 1271. A chicken @actin partial cDNA fragment (ACT3) was generated by PCR using the ZT 12 cDNA library, with PCR forward primer ACT1 (S’GCGTGACATCAAGGAGAAGCJ) and reverse primer ACT2R (5’CCACATCACACTTCATGATGG3’), spanning a 236-bp segment of the chicken p-actin coding sequence (GenBank accession No. LO8165). All PCR products were gel-purified and labeled with [“‘P]dCTP by random-priming using the Ready-to-Go kit (Pharmacia). Hybridization solution consisted of 50% formamide, 10% dextran sulfate, 1 M NaCl, 1% SDS and herring sperm DNA (100 @g/ml). Hybridization was performed overnight at 42OC; the nitrocellulose filters were washed for 15 min with 2 X SSC/O. 1% SDS at room temperature, and 3 X 15 min with 0.2 X SSC/O.l% SDS at 65°C. The ZT 12 cDNA library (10” pfu) was screened with probe TPH 10, and after three rounds of screening five putative clones were isolated and excised with the ExAssist/SOLR cell system (Stratagene) according to the manufacturer’s protocols. The 5’end of the largest clone (pTPH-37, 3.4 kb long) was sequenced until a region of perfect overlap with a previously isolated partial clone was found. 2.4. DNA seqttertcing Dideoxynucleotide DNA sequencing was performed by ‘primer-walking’ with the Sequenase 2.0 kit (United States Biochemical) according to the manufacturer’s protocol. Sequence autoradiograms were scanned, read and visually inspected with the DNA Code software program (version 2.1) from PDI (Huntington Station, NY), using a Sun Microsystems Sparcstation2 (SunOS 4.1.1). Sequence
on
2.5. Northern blots
3. Results 3.1. Molecular cloning cf chickert TPH The ZT 12 chick pineal AZAPII cDNA library was screened with the TPHlO probe. The longest isolated clone (pTPH-37) measured 3.4 kb and appeared to be a full-length cDNA. Sequence results showed that pTPH-37 contained a 1338bp open reading frame, encoding a 445-amino-acid protein with a predicted molecular weight of 51 kDa and an isoelectric point of 6.3 (GeneWorks). The 5’ untranslated region (UTR) was 82 bp long, whereas the 3’ UTR was found to be N 2 kb long. The chicken TPH coding region has 68% nucleotide identity with either mouse or Xertopus TPH. Although two in-frame ATG codons were found adjacent to each other near the translation initiation site, only the second one had an adenosine residue at the - 3 position, in accordance with the ribosomal binding site consensus sequence of Kozak [21]; it also aligned perfectly with the rat, rabbit and human TPH initiation codons. The termination codon was found at the same position as that of isoforms of TPH from other species.
27
A Northern blot of chicken pincal gland m with T 10 revealed a strongly hybridizing kb in size and a mu weaker signal -+.3.6 2). Changes in both nds occurred in paral transcript was found to hybridize wit probe ACT3, in agree al. [2]. Chicken pineal a diurnal fashion in vi at ZT 12, preceding the peak in observed previously in Western bl obed with antiantibody [ 141.
An oscillation in TP mRNA levels detected in whole pineal glands may not be preserved in dispersed chick pineal cells. Furthermore. olecular manipulation and promoter analysis of the TP gene requires in vitro conditions, which impose a limitation on the amount of RNA that can be extracted. Therefore, the above experiment was replicated in cell culture. In agreement with the in viva results, dissociated chick pineal cells maintained in LD 12: 12 show a robust oscillation in TPH mRNA abundance on the third day of culture (Fig. 3). The temporal profile ot
Hisan TTH >lotxeTPH Chicken TPH Xencps T?H
Fill?. 2. Top panel. Northern blot of mRNA obtained at four different point+, from pincal gland3 of chicks maintained in LD 1’: I?. probed the TPH 10 and ACT3 prohc~. T~vo TPH transcripts can he detected. at z 4 Lb d onL? Lit - 3 (7 hh:chicka @-actin mRNA migrare\ at hh. Botrom panel. normalization of the stronger TPH signal to the signal, showing a robust diurnal oscillation of TPH mRNA in viva.
rime with one 5 I .8 actin
the oscillation is consistent with the rhythm in [ 35S]methionine incorporation into TPH protein observed previously. which showed a peak at ZT !I- 16 and a trough at ZT O-4 [I-I].
When dissociated chick pineal ~~115 art‘ transferred DD. they maintain a qualitatively similar oscillation
to in
ii 60
97
Hman T?!i t-'o**se . Y TPH C>lzken T?li %XICQl?S TPH
153
tiumn TPH Mouse TP!i Chicken TPH Xenopus TPH
259 262 260 296
Humn TPH Hcusc TPH C!-tic:ken TPH Xcnopus T?H
359 362 360 396
Humn TPH Mouse TPH Chicken TPH Xencpus TPH
444 447 445 481
162 160 196
Fig. I. Deduced chicken TPH amino acid sequence, aligned with the human [J]. mouse [27] and Xt~nc~prrs [ 171TPH sequences. Amino acid identities arc boxed. The five cysteines conserved among all hydroxylases are marked by white dots; the four cysteines conserved only in TPH are marked by black dots: two serines, marked by arrows at positions 58 and 261. are putative phosphorylation sites. Note the insertional mutation cf an aspartate residue at position of chicken pineal TPH. including the 5’ UTR and th; first 157 bases of the 3’ UTR. is 102 of the chicken sequence. The complete codin,0 sequence . available from GenBank (accession no. U26428).
28
Actin
+
0
6
12 18
Zeitgeber time Fig. 3. Northern blot of total RNA obtained at four different time points from dissociatedchick pineal cells maintained in LD 12: 12.probed with the TPHIO and ACT3 probes. Top panel. TPH s~pnal: middle panel. actin signal; bottom panel. normalization of the 4kb TPH mRNA to actin mRNA showing a robust diurnal oscillation of TPH mRNA in vitro.
TPH mRNA levels, with a trough at circadian time 0 and a subsequent rise which are independent of light input (Fig. 4). The slight decrease in amplitude is consistent with the differences documented previously at the protein level, since the rhythm in TPH [‘“S]methionine incorporation also damps in DD [ 141.
TPH Actin
?? ? ?1.5 ? 3 5 1.0 Eo .d 3 d
0.5 0.0 18” 0
6
12
Circadian time Fig. 4. Northern blot of total RNA obtained at four different time points from dissociated chick pineal ceils maintained in DD, probed with the TPHlO and ACT3 probes. Top panel, TPH signal; middle panel, actin signal; bottom panel, normalization of TPH mRNA to actin mRNA showing a circadian oscillation of TPH mRNA in vitro. The first time point(18 1indicates6 h after lights-off. and is therefore considered part of the preceding light:dark cycle. ??
We have isolated a full-length cDNA clone coding for chick pincal TPH. Its predicted molecular isoelectric point are consistent with protein d native pl of 6.3 corresponds to the most basic TPH isoforms detected in two-dimensional Western blots, suggesting the existence of a mechanism for posttional regulation of TPH. The sequence of chicken highly homologous to published sequences o [4,7,17,18,27], and includes the five cysteines of the catalytic region that are common to other hydroxylases as well as four TPH-specific cysteines. Chicken TP similar to mammalian TPHs in that it lacks the 37-aminoacid segment found in the amino terminus of Xerzoptrs TPH [ 171. It also contains two putative phosphorylation sites: there is a consensus site for CAMP-dependent phosphorylation at Se? and a consensus site for phosphorylation by CaNi kinase II at Se?’ [7]; both modes of phosphorylation have been implicated in TPH regulation [ 10,11,15,16]. A third putative phosphorylation site (Ser”’ in mouse TPH) is absent from both the chicken and Xenc>/jus TPH sequences. The functional significance of each phosphorylation site remains to be determined, although phosphorylation of TPH by either PKA or CaM kinase II is necessary for binding and activation of TPH by protein 14-3-3 [ 16,191. Consistent with the multiple phosphorylation sites, three different protein isoforms of chicken TPH, of identical molecular weight and slightly different isoelectric points, can be detected in two-dimensional Western blots [ 141. In agreement with the temporal profile of TPH protein expression [ 141. the steady state level of chicken TPH mRNA shows a diurnal oscillation both in vivo and in vitro. The decrease and subsequent rise of TPH mRNA occurs in the absence of light input in vitro, suggesting that it is driven by an endogenous circadian clock and that circadian regulation of TPH is pre-translational. This oscillation is consistent with the circadian rhythm of TPH [” Slmethionine incorporation previously shown on the second day of constant darkness [ 141. The oscillation of TPH reported here is the first described circadian rhythm of gene expression in the chick pineal. Although Bernard et al. [2] showed a three-fold diurnal rhythm in the abundance of chick pineal HIOMT mRNA, they did not document the persistence of the HIOMT rhythm in constant conditions. Whether the regulation of TPH gene expression occurs at the transcriptional level remains to be determined, although recent results in Xeizoplcs f 171 indicate that this might indeed be the case. The genes for ovine [6] and rat [3] NAT have recently been cloiied, and high-amplitude oscillations in mammalian pineal NAT mRNA levels have been documented. These results are consistent with the well-known circadian rhythm in NAT enzyme activity [20], and suggest that the oscillation of melatonin in the pineal gland is generated in
with the pattern of doleacetic acid levels Ehwl. M.. Pe~et. P. and Maitre, M.. Tryptophan hydroxylase synthe4s I\ induced hy 3’.5’-cqzlic adcnosine nmwphosphatr during circadian rhythm
n conclusion,
we have eloneu
chick
in the rut pinwl
fland.
J.
~~‘1’1ft~fJf’/IP/tZ..
57
(
represents the first clock-controlled gene in dissociated chick pineal cells. Thus. it joins a growing family of clock-controlled genes in several ecausc in nonvertebrate species (reviewed in [I rnal~~~na~iar~ vertebrates ~~~d~~/~dua~ 1 ceils contain a circadian clock [22,28], characteriz of promoter elements in clock-controlled genes may lead to a better understanding of the regulation of gene expression by the vertebrate circadian oscillator.
Flow. J.C.. C‘it~cwlitut-t ltrc% c.otttr.ol rff‘ pr’rtlcitt c~.\prcs\iott ortd cff’ ttichrlottii~ ~.vtttlti~~i~ in i~trltrrtmi cdlicA pirtiwl CY//S: rqirltrtion It:\pfoplttttt h~rft~t.vvl~rw. Ph.D. Di\wrtation. 199.5. Northnatern l’niicr~rt~. Flow/.
J.C. and Tahahadai. J.S.. The circadian clad,: from ~~wlax~lt~
IO heha\iour.
.4tttt..21c~l.. 27 ! i Wi 14XI -190.
~IUTL’L. J.C. and Tahaha4~i. clock-controlled
J.S.. Quantn,tti~e
2D gel analysrs 01
proteins in cultured chick pineal cell\:
of tryptophan hgdroxylase.
J. Hiol. Klt~thtt~.~ (
Fujimia.
Ii..
H. and Okuno, S.. Regulation
of tyrwine
Yamauchi. T.. Nakata.
3-monooxygcnase
h
R~wsd~lt~
Firt~ritct~ Atir tt~tc’c’.~.Elw-
S.. Yamauchi.
T.. lwbc,
RCL C~ttttrtttrrtt.. 19-I
v.
Grwn.
C.B. and Bc\harw.
i\
( 1993)
Grcnncl. cIIX.4
6’
( 199.4)
H.E.. Lcdlq.
clock
in
c\prcv+ion
,Ycrro/w\ /rwrt\
F.D..
Reed. L.L. 4
Full-ILV~I~
Woo. S.I...
for rahhil tr\ pk>ph;tn h)drcIuylasc: l‘liilC*llOllUl domains
~~d.tliw
01 Lu’oinal~l: tiuUu0 acid hydloh) lasts.
l’riw.
T.. Yamauchi. T. and Fujisawa.
phan S-moncwxygenase and tyrosine 3monooxygcnasc 2 I9 (1987) and Takahashi.
J.S.. Temperature
compensation
Bernard. M.. Guerlotte. Voism.
J.
P.. Collin.
regulation of hydroxyindole
in the chicken
pineal gland: day/night
effects of light and darkness.
Bidim.
J.-P. and O-methyl-
change\ 1.. 200
and
( 1993)
J.. V
and Snyder. S.H..
encoding serotonin N-acetyltransferase
Diurnal
variation
in
in pincal gland. Nlr-
ture, 378 (1995) 783-785. [4] Boularand. S.. Darmon. M.C.. Ganem. Y .. Launay. J.M. and Mallet. J.. Complete coding sequence of human rryptophan hydroxylase. Ndcic Acids Res., I8 ( 1990) 4257. [5] Cassone. Menaker.
V.M.. M..
Takahashi. Dynamics
J.S..
Blaha.
of noradrenergic
C.D..
Law.
circadian
chicken pineal gland. Brtlirt Rvs.. 38-l ( I9861 33-l-34
R.F. input
to
and the
I.
Baler. R.. Weller, J.L.. Namboodiri. Koonin, E.V. and Klein. D.C.. Pineal serotonin N-acetyl-
[6] Coon. S.L.. M.A.A..
D.C..
Roseboom.
P.H..
protein hinase II. fiEl3.S 1.011..
Au&a&.
D.A..
Namboodiri.
M.A.A.
and Wheler.
Indole metabolism in the mammalian pineal gland. In R.J.
G.H.T..
T/w P~mwl Glmtl.
CRC,
Boca Raton. FL.
I98 I.
pp.
I w-227. Koxak.
M.. Compilation
and analysis of sequences upstream from
1hc translational start site in cukaryotic mRNA\. IZ
( 1983)
Pickard.
66 I-664. [3] Borjigin. mRNA
Klein.
trypto-
in lhc pres-
79-82.
Reiter (Ed.).
J.. Cogne. M.. Grew.
P.. Transcriptional
transferase long-term
and
IS ( I9OS)568 I -5692.
Neurwsci..
[z]
. calmodulin-dcpcndcnt
ence of Ca’+
Barrett, R.K.
:llld
~V~tll. & clil.
SC*;. USA, 83 ( 1987) ss30-5534. lchimura. T.. Isobe. T.. Okuyama.
temperature entraimnent of the chick pincal ceil circadian cloth.
./.
retina.
XX-‘4X.
H.. Brain 14-3-3 protein is an activator protein that activate\
efcrences
inter-
Nictchti.
I-U- I49
J.C.. Tr>ptophan h!dro~ylaw
I-rgulrr~d h> ;L circadian
.Vc~rtt~f~~~/lf~ttl..
T. and
of the pho
airion of lr) ptc ,rh;in hydroxy~asc M ilh the I-1-3-3 protein. Hiftplt!
by
Etr;?ttw Krg-
I X3.
Y.. Ikuta. N.. Omata.
. T.. Demonstration
Ichimura
In P. Cohen (Ed. 1.
Wtr~.v~~hrtt~lttti~tt~ -
Ne\v Yorh. 19X-4. pp. l67-
Furukunu.
1906).
and tryptophan S-monooxygenasc
pho\phor~lation-depliosphorylatit~n. +r.
We thank Cameron Flint and Gene Minner for excellent photographic assistance. This work was supported by predoctoral NRSA F30 MH 10 189 to J.C.F., predoctoral NRSA A F32 F3 I MH 10287 to K.J.S.. postdoctoral _3%92. MH10369 to R.K.B., and NiH Gralit> Rf7 R01 NH31 2 11 and an NSF Center for Biological Timing Grant to J.S.T.
circadian
rqularion
htiotr
[I]
)
1991
lS113-1521.
circadian
Ntrckic~ kid.~
RPS..
X57-872. G.E.
and Tang,
W.-X..
rhythm in melatonin
Individual secretion,
pineal CCIIS exhibit
HIU~II Kc.\..
a
627 (IW?)
I-tl-l-w. Robertson. L.M. and Takahashi. J.S.. Circadian cloth in cell culture. 1. Oscillation of melatonin release from dissociated chick pineal cells in flow-~llrough microcarrier
Sambrook,J.. Ld~orirrfq
culture, J. N0lrro.sc.i.. X ( 19%)
Fritsch, E.F. and Maniatis. T.. Mokc*dt~~
?hrmal.
Cold
Sprin,o Harbor
Laboratory
Iz-:! 1.
ClftttitW:
(1
Press. Cold
Spring Harbor. 1989.
fjhibuya,
H., Toru,
M. and Watanabe,
S. A circadian
tryptophan hydroxylase in rat pineals. RI&~/I Rt*.s.. 368.
rhythm (11
1% ( 1978).%a-
[26] Sitaram. B.R. and Lees, G.J. Diurnal rhythm and turnover of tryptophan hydroxylase in the pineal gland of the rat, J. Neurod~em., 31 (1978) 1021-1026. [27] Stall. 1.. Kozak, C.A. and Goldman, D. Characterization and chromosomal mapping of a cDNA encoding tryptophan hydroxylase from a mouse mastocytoma cell line, Genomics, 7 (1990) 88-96. [28] Takahashi. J.S.. Murakami. N.. Nikaido, S.S.. Pratt, B.L. and
Robertson. L.M. The avian pineal. a vertebrate model system of the circadian oscillator: cellular regulation of circadian rhythms by iigirr. second messengers, and macrvmolecular synthesis. K~wnt ,!%g. Harm Rex., 45 (1989) 279-352. [29] Thomas. K.B. and Iuvone. P.M. Circadian rhythm of tryptophan hydroxylase activity in chicken retina. C4l. Mo/. Ncl~rrthio/.. I I (1991) 51 I-527.