Molecular cloning of feline CC–chemokine cDNAs

Veterinary Immunology and Immunopathology 65 (1998) 113±123

Molecular cloning of feline CC±chemokine cDNAs Yasuyuki Endo*, Takuya Mizuno, Yoshiaki Nishimura, Yuko Goto, Toshihiro Watari, Hajime Tsujimoto, Atsuhiko Hasegawa Department of Veterinary Internal Medicine, Graduate School of Agricultural and Life Sciences, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113, Japan

Abstract cDNA clones of feline chemokines, MIP-1, MIP-1 and RANTES, were molecularly isolated with the purpose of using these sequences for future investigation of the inhibitory effects on lentivirus entry and their role in immunological functions. The feline MIP-1 and MIP-1 cDNA clones spanned their entire coding regions encoding 93 and 92 amino acids, respectively. The amino acid sequences of feline MIP-1 and MIP-1 compared to those of their human, mouse and rat counterparts showed similarities of 75.3±79.6% and 73.9±88.0%, respectively. Feline MIP-1 and MIP-1 had four conserved cysteines with a structure made up of the first two cysteines that are characteristic of the CC±chemokine subfamily. The amino terminal of these MIP-1 and MIP-1 sequences was distinctly hydrophobic, suggesting that they may function as signal peptides. A partial cDNA clone consisting of 193 bp was obtained for feline RANTES, and it also showed a high degree of sequence similarity to those of other species and contained the characteristic structure made up of adjacent cysteines. These molecular clones of feline chemokines will be useful in the examination of their inhibitory effect on the cellular entry of feline immunodeficiency virus. # 1998 Elsevier Science B.V. All rights reserved. Keywords: Cat; CC±chemokine; Molecular cloning

* Corresponding author. Tel.: +81 3 3811 3961; fax: +81 3 5800 6866; e-mail: [email protected] Abbreviations: AIDS, acquired immunodeficiency syndrome; bp, base pair; CCR, CC±chemokine receptor; CXCR, CXC±chemokine receptor; FIV, feline immunodeficiency virus; HIV, human immunodeficiency virus; MIP-1, macrophage inflammatory protein-1; PCR, polymerase chain reaction; RANTES, regulated on activation, normal T expressed and secreted; SDF-1, stromal cell derived factor-1; SIV, simian immunodeficiency virus 0165-2427/98/$ ± see front matter # 1998 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 5 - 2 4 2 7 ( 9 8 ) 0 0 1 4 7 - 0

114

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

1. Introduction Feline immunodeficiency virus (FIV) was first isolated in 1986 from domestic cats in the USA (Pedersen et al., 1987). FIV is a lentivirus capable of producing various immunological abnormalities and terminal immunodeficiency syndrome in domestic cats (Yamamoto et al., 1988; Sparger et al., 1989). The distribution of FIV is worldwide with a large enough portion of domestic cats being infected so that FIV is considered a significant pathogen for these animals (Pedersen et al., 1987; Harbour et al., 1988; Yamamoto et al., 1988; Ishida et al., 1989). In addition, the FIV cat system is an attractive animal model for human immunodeficiency virus (HIV) infection, because infections from the lentiviruses FIV and HIV induce similar immune dysfunctions in their hosts (Pedersen et al., 1989). HIV-1 co-receptors, other than CD4 molecule, are necessary for cellular entry of HIV-1 (Ashorn et al., 1990; Alkhaitib et al., 1996; Bleul et al., 1996; Choe et al., 1996; Deng et al., 1996; Doranz et al., 1996; Dragic et al., 1996; Feng et al., 1996; Oberlin et al., 1996). Macrophage-tropic isolates of HIV-1 use mainly the CC±chemokine receptor 5 (CCR5) which is also a receptor for RANTES, MIP-1 and MIP-1 (Cocchi et al., 1995; Alkhaitib et al., 1996; Choe et al., 1996; Deng et al., 1996; Doranz et al., 1996; Dragic et al., 1996). T-cell-tropic isolates use the CXC±chemokine receptor 4 (CXCR4), also known as LESTR or fusin, which is a receptor for SDF-1 (Bleul et al., 1996; Feng et al., 1996; Oberlin et al., 1996). These chemokines, RANTES, MIP-1 and MIP-1 for macrophage-tropic HIV-1 strains or SDF-1 for T-cell-tropic HIV-1 strains, reportedly inhibit HIV-1 replication by blocking cell entry through competition for or desensitization of CCR5 and CXCR4 (Cocchi et al., 1995; Bleul et al., 1996; Oberlin et al., 1996). Furthermore, as is the case for HIV-1, HIV-2 and SIV also use these chemokine receptors as co-receptor for cell entry (Endres et al., 1996; Chen et al., 1997; Hill et al., 1997; Marcon et al., 1997). These findings opened new perspectives for the therapy of HIV infection. Although FIV has been studied in comparison with HIV, the cellular receptor of FIV has not been identified yet. Recently, Willett et al., 1997a, b suggested that FIV might use CXCR4 as a receptor or a co-receptor, and that the mechanism of cell entry through CXCR4 as a receptor or a co-receptor was common in lentiviruses. If FIV uses these chemokine receptors as a receptor or a co-receptor for cell entry, it might be possible to inhibit FIV replication with these chemokines. In the present study, cDNA clones of CC±chemokines including MIP-1, MIP-1 and RANTES were molecularly isolated and characterized as a fundamental step in the investigation of their inhibitory effect on FIV replication. 2. Materials and methods 2.1. Preparation of feline spleen cDNA library Poly (A)‡ RNA was extracted from a frozen feline spleen with a Fast Track mRNA Isolation Kit (Invitogen, San Diego, CA). Reverse transcription of poly (A)‡ RNA was performed with a cDNA synthesis kit (Pharmacia, Uppsala, Sweden).

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

115

Table 1 Sequences of oligonucleotide primers and their locations Chemokines

Primersa

Sequences (50 ±30 )

Locations (n.t.)b

MIP-1

HA1S HA2S HA3S HA4S FA1S FA2S HA1R FA1R FA2R HA2R HA3R HB1S HB2S FB1S FB2S HB1R FB1R HB2R HB3R HR1S HR2S HR1R HR2R

CTGCTCA(A/G)(A/C)ATCATG(A/C)AGGTCTCCAC ATG(A/C)AGGTCTCCAC(C/T)(A/G)CTGCCCTTG CAGTCC(C/T)TT(C/T)T(C/T)(G/T)G(C/T)TCTGCTGACA AGCCCACATTCCGTCACCTGCTCAGAATC ATGGCTCTCTCTGCAGTCAGGTC CTATGTCTCCAAGCAGATTCCAC TCAGGCA(C/T)TCAG(C/T)TCTAGGTC CCAGGCCATTCAGGCACTCAGCTCCAAGTC CTTCTGGTTTGAAAGATAACCCC AAGAGTCCC(A/T)C(A/G)(A/G)TGTGGCT ATAG(A/G)AGA(G/T)G(G/T)AGCT(A/G)TG(C/G)AGG CAA(C/T)ACCATGAAGCTCTGCGTG CTGCAG(C/T)C(C/T)CA(C/G)CTCTG(A/T)G(A/C)AAACC TCCTTTCTCTCCTTGTGCTAGTGG TCTCAGCACCAATGGGCTCAG G(C/T)C(G/T)CTGAGC(A/T)GCTCAGTTC AGGCTGCTGGTCTCAAAGTAATCCAC AGCAGAGAAACAGTGACAGTGGACCATC CTAAACTAATATAAATAATGGAAA GCCTCTCC(A/G)C(A/G)GGTACCATGAAG ATCCTCA(C/T)TGC(A/T)(A/G)CTGCCCTCTGCGC C(C/T)CTC(C/T)ATCCTAGCTCATCTCCAAA CTAGCTCATCTCCAAA(G/T)AGTTGATGTA

ÿ1214 125 ÿ58ÿ34 ÿ291 4360 108130 279259 288259 203181 425406 386365 ÿ715 ÿ42ÿ18 2043 6585 292273 170140 511484 460437 ÿ176 3156 285261 276250

MIP-1

RANTES

a

HA, HB and HR primers were synthesized based on the sequences of human, mouse and rat chemokine cDNAs. FA and FB primers were prepared from the seqence data of feline CC± chemokine cDNAs obtained in this study. b Locations of HA, HB and HR primers are shown as nucleotide numbers of human MIP-1 (Obaru et al., 1986), MIP-1 (Lipes et al., 1988) and RANTES (Schall et al., 1988). Locations of FA, FB and FR primers synthesized from feline chemokine cDNA sequences are shown as nucleotide numbers corresponding to those in their human homologues.

2.2. Polymerase chain reaction (PCR) amplification Feline MIP-1, MIP 1- and RANTES cDNAs were isolated by nested or semi-nested PCR from feline spleen cDNA. Sequences of the PCR primers for MIP-1, MIP-1 and RANTES were based on the nucleotide sequences of the conserved regions of human, mouse and rat homologues (Obaru et al., 1986; Davatelis et al., 1988; Lipes et al., 1988; Schall et al., 1988, 1992; Sherry et al., 1988, Shanley et al., 1995). Primer sequences and their locations in the cDNAs are shown in Table 1 and Fig. 1. Reaction mixtures (50 ml) contained a pair of primers (0.4 mM each), 1 mg of template DNA, Taq DNA polymerase (0.75 unit) and the reagents recommended by the manufacturer (Takara, Kyoto, Japan). The first PCR reaction involved 30 cycles of denaturation (948C, 1 min), annealing (378C, 1 min) and polymerization (728C, 1 min). One microliter from the first PCR product was placed in the second reaction that underwent 30 cycles of denaturation

116

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

Fig. 1. Schematic showing the locations of primers used for amplification of (a) MIP-1, (b) MIP-1 and (c) RANTES cDNAs. Arrow heads indicate primers; horizontal bars predicted PCR products.

(948C, 1 min), annealing (558C, 1 min) and polymerization (728C, 1 min). PCR products were analyzed by 3% agarose gel electrophoresis and then directly cloned into the plasmid vector using a TA-cloning kit (Invitrogen). Escherichia coli, INVF0 cells (Invitrogen), were transformed with the ligation mixture and plated onto LB agar plates containing ampicillin (50 mg mlÿ1) and 5-bromo-4-chloro-3-indolyl- -D-galactoside (36 mg mlÿ1). Plasmid DNAs were extracted with QIAGEN plasmid kit (Qiagen, Studio City, CA). 2.3. Nucleotide sequence analyses of feline chemokine cDNAs The inserts of the plasmids were sequenced by the dideoxy chain termination method using Auto Read Sequencing kit (Pharmacia).

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

117

3. Results 3.1. Molecular cloning and sequencing of feline MIP-1 cDNA Using feline spleen cDNA as a template DNA, we performed semi-nested PCR amplification with HA1S, HA2S and HA1R primers for isolation of a cDNA clone of feline MIP-1. Electrophoresis of the second PCR product gave a DNA band with an expected size of about 280 bp. This DNA fragment amplified with the HA2S and HA1R primers were inserted into a pCR2.1 vector (Invitrogen) and sequenced. The cDNA insert of the HA2S-HA1R clone was 282 bp long. From sequence data of HA2S-HA1R clone, two primers specific to feline MIP-1 cDNA (FA1S and FA2S) were synthesized (Fig. 1(a)). Nested PCR using the FA1S and FA2S primers with HA2R and HA3R yielded a 280 bp DNA fragment (FA2S-HA3R) corresponding to the 30 -end of feline MIP-1 cDNA. Furthermore, another nested PCR using HA3S, HA4S, FA1R and FA2R primers yielded a 235 bp DNA fragment (HA4S-FA2R) corresponding to the 50 -end of feline MIP-1 cDNA. From these PCR fragments, FA2S-HA3R and HA4S-FA2R, the feline MIP-1 cDNA sequence containing the whole coding region and 30 non-coding region was determined (Fig. 2(a)). Fig. 3(a) shows the alignment of the deduced amino acid sequence of feline MIP-1 with those of human, mouse and rat MIP-1. At the amino acid level, feline MIP-1 showed similarities between 75.3±79.6% with its human, mouse and rat counterparts. Four cysteine residues including two adjacent cysteines which are conserved among species were also found in feline MIP-1, which is a characteristic structure for the CC±chemokine subfamily. In hydrophilicity analysis, feline MIP-1 contained a hydrophobic N-terminus, corresponding to its signal peptide (Fig. 4(a)). 3.2. Molecular cloning and sequencing of feline MIP-1 cDNA From HB2S-FB1R and FB2S-HB3R DNA fragments using the same strategy employed for the cloning of feline MIP-1 cDNA, we determined the nucleotide sequence of feline MIP-1 cDNA encompassing the entire coding region and the 30 and 50 non-coding regions, as shown in Fig. 1(b). The deduced amino acid sequence of feline MiP-1 (Fig. 2(b)) shared a high degree of sequence similarity (73.9±88.0%) with human, mouse and rat MIP-1 sequences (Fig. 3(b)). Like MIP-1 of other species, the four cysteine residues with two adjacent cysteines were conserved in feline MIP-1 . One potential N-linked glycosylation site was observed in cat and mouse MIP-1 . In hydrophilicity analysis, feline MIP-1 also had a hydrophobic N-terminus, this degree of hydrophobicity points to its possible function as a signal peptide (Fig. 4(b)). 3.3. Molecular cloning and sequencing of feline RANTES cDNA Feline RANTES cDNA was amplified by using nested-PCR with inner primers (HR2S and HR2R) followed by outer primers (HR1S and HR1R). The sequence of HR2S-HR2R fragment did not cover the whole coding region of RANTES cDNA (Fig. 2(c)). The

118

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

Fig. 2. Nucleotide and deduced amino acid sequences of feline MIP-1, MIP-1 and RANTES cDNAs. Residues are numbered from the 50 end of the coding region. The predicted amino acid sequences are shown by the single letter-amino acid code under the nucleotide sequences. The nucleotide sequence data of feline MIP1, MIP-1 and RANTES in this study will appear in the DDBJ/GenBank/EMBL nucleotide sequence databases with accession numbers AB003366, AB003367 and AB003368, respectively.

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

119

Fig. 3. Comparison of the predicted MIP-1, MIP-1 and RANTES amino acid sequences of different species. The amino acid sequences of feline (a) MIP-1, (b) MIP-1 and (c) RANTES cDNA were aligned with those of human, mouse and rat counterparts. Asterisks indicate identity with amino acids of feline MIP-1, MIP-1 and RANTES sequences and dashes indicate gaps introduced for maximal alignment. Potential N-linked glycosylation sites are underlined. Four cysteine residues conserved among species are boxed.

partial nucleotide and deduced amino acid sequences of feline RANTES cDNA showed high sequence similarities (76.6±78.1%) with those of human, mouse and rat RANTES (Fig. 3(c)). As shown in MIP-1 and MIP-1 , the four cysteine residues with two adjacent cysteines were also conserved in feline RANTES.

120

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

Fig. 4. Comparison of hydrophilicity/hydrophobicity plots (Hopp and Wood, 1983) of feline MIP-1, MIIP-1 and RANTES. Positive values on the Y-axis indicate hydrophilic regions. The X-axis indicates amino acid residues numbered from the methionine. (a) MIP-1, (b) MIP-1 and (c) RANTES.

4. Discussion Chemokines are defined by their common structural motif consisting of four conserved cysteine residues that form two characteristic intramolecular disulfide bridges (Baggiolini

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

121

et al., 1994; Rollins, 1997). The chemokine family is divided into four subfamilies, CXC (), CC ( ), C ( ) and CX3C, based on the position of cysteines after the cleavage site (Baggiolini et al., 1994; Kelner et al., 1994; Bazan et al., 1997; Pan et al., 1997; Rollins, 1997). One of the typical CXC±chemokine is interleukin (IL)-8 (Baggiolini et al., 1994). The first two cysteines of chemokines in this subfamily are separated by one amino acid. On the other hand, MIP-1, MIP-1 and RANTES belong to CC±chemokine subfamily with its characteristic structure of two adjacent cysteines (Baggiolini et al., 1994; Rollins, 1997). The recently isolated lymphotactin and fractalkine are classified in C ( ) and CX3C± chemokine subfamilies, respectively (Kelner et al., 1994; Bazan et al., 1997; Pan et al., 1997). In the present study, we isolated and sequenced cDNAs containing the entire coding regions of feline MIP-1 and MIP-1 and the partial coding region of feline RANTES from feline spleen. Feline MIP-1 and MIP-1 cDNAs encodes open reading frames of 93 and 92 amino acids, respectively, and their deduced amino acid sequences showed significant similarities with those of human, mouse and rat counterparts (Obaru et al., 1986; Davatelis et al., 1988; Lipes et al., 1988; Sherry et al., 1988; Shanley et al., 1995). Both feline MIP-1 and MIP-1 contained four cysteine residues including two adjacent amino-proximal cysteines characteristic of the CC±chemokine subfamily. In the hydrophilicity analysis, both feline MIP-1 and MIP-1 contained hydrophobic Ntermini which might correspond to a region of signal peptide (Obaru et al., 1986; Davatelis et al., 1988; Lipes et al., 1988; Sherry et al., 1988). Although the exact Ntermini of the mature form of feline MIP-1 and MIP-1 are not known, the N-terminal 23 amino acids are considered to be removed in feline MIP-1 and MIP-1 during the processing of these molecules as judged from their alignment with human, mouse and rat counterparts (Obaru et al., 1986; Davatelis et al., 1988; Lipes et al., 1988; Sherry et al., 1988; Shanley et al., 1995). The molecular weights of mature forms of both feline MIP1 and MIP-1 were tentatively calculated as 7.8 kDa. Based on the sequences of the feline RANTES cDNA isolated in this study that did not span the complete coding region, a case can be made for the possible origination of RANTES cDNA from the CC±chemokine subfamily of genes; the predicted amino acid sequence of feline RANTES was significantly similar to those of its human, mouse and rat counterparts and it contained four cysteine residues with an adjacent structure made up of two cysteines (Schall et al., 1988, 1992; Baggiolini et al., 1994). Chemokines are a group of cytokines which attract and activate leukocytes and mediate inflammation. In addition to this function, CC±chemokines and CXC±chemokines, respectively, inhibit the cell entry of macrophage-tropic and T-cell-tropic HIVs by blocking the chemokine receptors as co-receptors for HIV entry (Cocchi et al., 1995; Bleul et al., 1996; Oberlin et al., 1996). Recently, (Willett et al., 1997a, b) showed that FIV uses CXCR4 as a receptor or a co-receptor . FIV also might use CCRs as a receptor or a co-receptor, because monocytes and macrophages are efficiently infected with FIV (Brunner and Pedersen, 1989). If the inhibitory effect of MIP-1, MIP-1 and RANTES on FIV replication is confirmed in the susceptible cells, then these chemokines would be candidates for treatment of FIV infection. In the present study, we molecularly isolated and characterized feline MIP-1, MIP-1 and RANTES cDNAs; these cloned sequences are tools designed to provide

122

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

information about how FIV enters cells that may serve as a basis for therapy of FIV infection. Acknowledgements This work was supported by grants from the Ministry of Education, Science, Sports and Culture and from the Ministry of Health and Welfare in Japan. This work was also supported by a Grant-in-aid of Recombinant Cytokine's Project provided by the Ministry of Agriculture, Forestry and Fisheries, Japan (RCP1988-3110). References Alkhaitib, G., Combadiere, C., Broader, C.C., Feng, Y., Kennedy, P.E., Murphy, P.M., Berger, E.A., 1996. CCCKR5: A RANTES, MIP-1, MIP-1 receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272, 1955±1958. Ashorn, P.A., Berger, E.A., Moss, B., 1990. Human immunodeficiency virus envelope glycoprotein/CD4mediated fusion of nonprimate cells with human cells. J. Virol. 64, 2149±2156. Baggiolini, M., Dewald, B., Moser, B., 1994. Interleukin-8 and related chemotactic cytokines-CXC and CC chemokines. Adv. Immunol. 55, 97±179. Bazan, J.F., Bacon, K.B., Hardiman, G., Wang, W., Soo, K., Rossi, D., Greaves, D.R., Zlotnik, A., Schall, T.J., 1997. A new class of membrane-bound chemokine with a CX3C motif. Nature 385, 640±644. Bleul, C.C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J., Springer, T.A., 1996. The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature 382, 829±833. Brunner, D., Pedersen, N.C., 1989. Infection of peritoneal macrophages in vitro and in vivo with feline immunodeficiency virus. J. Virol. 63, 5483±5488. Chen, Z., Zhou, P., Ho, D.D., Landau, N.R., Marx, P.A., 1997. Genetically divergent strains of simian immunodeficiency virus use CCR5 as a co-receptor for entry. J. Virol. 71, 2705±2714. Choe, H., Farzan, M., Sun, Y., Sullivan, N., Rollins, B., Ponath, P.D., Wu, L., Mackay, C.R., LaRosa, G., Newman, W., Gerard, C., Sodroski, J., 1996. The -chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV isolates. Cell 85, 1135±1148. Cocchi, F., DeVico, A.L., Garzino-Demo, A., Arya, S.K., Gallo, R.C., Lusso, P., 1995. Identification of RANTES, MIP-1, and MIP-1 as the major HIV suppressive factors produced by CD8‡ T cells. Science 270, 1811±1815. Davatelis, G., Tekamp-Olson, P., Wolpe, S.D., Hermsen, K., Leudke, C., Gallegos, C., Coit, D., Merryweather, J., Cerami, A., 1988. Cloning and characterization of a cDNA for murine macropaheg inflammatory protein (MIP), a novel monokine with inflammatory and chemotactic properties. J. Exp. Med. 167, 1939±1944. Deng, H., Liu, R., Ellmeir, W., Choe, S., Unutmaz, D., Burlhart, M., Di Marzio, P., Marmon, S., Sutton, R.E., Hill, C.M., Davis, C.B., Peiper, S.C., Schall, T.J., Littman, D.R., Landau, N.R., 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381, 661±666. Doranz, B.J., Rucher, J., Yi, Y., Smyth, R.J., Samson, M., Peiper, S.C., Parmentier, M., Collman, R.G., Doms, R.W., 1996. A dual-tropic primary HIV-1 isolate that uses fusin and the -chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion co-factors. Cell 85, 1149±1158. Dragic, T., Litwin, T., Allaway, G.P., Martin, S.R., Huang, Y., Nagashima, K.A., Cayanan, C., Maddon, P.J., Koup, R.A., Moore, J.P., Paxton, W.A., 1996. HIV-1 entry into CD4‡ cells is mediated by the chemokine receptor CC-CKR5. Natur. 381, 667±673. Endres, M.J., Clapham, P.R., Marsh, M., Ahuja, M., Turner, J.D., McKnight, A., Thomas, J.F., StoebenauHaggarty, B., Choe, S., Vance, P.J., Wells, T.N.C., Power, C.A., Sutterwala, S.S., Doms, R.W., Landau, N.R., Hoxie, J.A., 1996. CD4-independent infection by HIV-2 is mediated by fusin/CXCR4. Cell 87, 745±756.

Y. Endo et al. / Veterinary Immunology and Immunopathology 65 (1998) 113±123

123

Feng, Y., Broader, C.C., Kennedy, P.E., Berger, E.A., 1996. HIV-1 entry co-factor: Functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272, 872±877. Harbour, D.A., Williams, P.D., Gruffydd-Jones, T.J., Burbridge, J., Pearson, G.R., 1988. Isolation of a T-lymphotrophic lentivirus from a persistently leucopenic domestic cat. Vet. Rec. 122, 84±86. Hill, C.M., Deng, H., Unutmaz, D., Kewalramani, V.N., Bastiani, L., Gorny, M.K., Zolla-Pazner, S., Littman, D.R., 1997. Envelope glycoproteins from human immunodeficiency virus types 1 and 2 and simian immunodeficiency virus can use human CCR5 as coreceptor for viral entry and make direct CD4dependent interactions with this chemokine receptor. J. Virol. 71, 6269±6304. Hopp, T.P., Wood, K.R., 1983. A computer program for predicting protein antigenic determinants. Mol. Immunol. 20, 483±489. Ishida, T., Washizu, T., Toriyabe, K., Motoyoshi, S., Pedersen, N.C., 1989. Feline immunodeficiency virus infection of cats in Japan. J. Am. Vet. Med. Assoc. 194, 221±225. Kelner, G.S., Kennedy, J., Bacon, K.B., Kleyensteuber, S., Largaespada, D.A., Jenkins, N.A., Copeland, N.G., Bazan, J.F., Moore, K.W., Schall, T.J., Zlotnik, A., 1994. Lymphotactin: A cytokine that represents a new class of chemokine. Science 266, 1395±1399. Lipes, M., Napolitano, M., Jeang, K.-T., Chang, N.T., Leonard, W.J., 1988. Identification, cloning, and characterization of and immune activation gene. Proc. Natl. Acad. Sci. USA 85, 9704±9708. Marcon, L., Choe, H., Martin, K.A., Farzan, M., Ponath, P.D., Wu, L., Newman, W., Gerard, N., Gerard, C., Sodroski, J., 1997. Utilization of C-C chemokine receptor 5 by the envelope glycoproteins of a pathogenic simian immunodeficiency virus, SIVmac239. J. Virol. 71, 2522±2527. Obaru, K., Fukuda, M., Maeda, S., Shimada, K., 1986. A cDNA clone used to study mRNA inducible in human tonsillar lymphocytes by a tumor promoter. J. Biochem. 99, 885±894. Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J.-L., Arenzana-Seisdedos, F., Schwartz, O., Heard, J.-M., Clark-Lewis, I., Legler, D.F., Loetsher, M., Baggiolini, M., Moser, B., 1996. The CXC chemokine SDF-1 is the ligand for LESTR.fusin and prevents infection by T-cell-line adapted HIV-1. Nature 382, 833±835. Pan, Y., Lloyd, C., Zhou, H., Dolich, S., Deeds, J., Gonzalo, J.A., Vath, J., Gosselin, M., Ma, J., Dussault, B., Woolf, E., Alperin, G., Culpepper, J., Gutierrez-Ramos, J.C., Gearing, D., 1997. Neurotactin, a membraneanchored chemokine unregulated in brain inflammation. Nature 387, 611±617. Pedersen, N.C., Ho, E.W., Brown, M.L., Yamamoto, J.K., 1987. Isolation of a T-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome. Science 235, 790±793. Pedersen, N.C., Yamamoto, J.K., Ishida, T., Hansen, H., 1989. Feline immunodeficiency virus infection. Vet. Immunol. Immunopathol. 21, 111±129. Rollins, B.J., . Chemokines. Blood 90, 909±928. Schall, T.J., Jongstra, J., Dyer, B.J., Jorgensen, J., Clayberger, C., Davis, M.M., Krensky, A.M., 1988. A human T cell-specific molecule is a member of a new gene family. J. Immunol. 141, 1018±1025. Schall, T.J., Simpsons, N.J., Mak, J.Y., 1992. Molecular cloning and expression of the murine RANTES cytokine: Structural and functional conservation between mouse and man. Eur. J. Immunol. 22, 1477±1481. Shanley, T.P., Schmal, H., Friedl, H.P., Jones, M.L., Ward, P.A., 1995. Role of macrophage inflammatory protein-1 (MIP-1) in acute lung injury in rats. J. Immunol. 154, 4793±4802. Sherry, B., Tekamp-Olson, P., Gallegos, C., Bauer, D., Davatelis, G., Wolpe, S.D., Masiarz, F., Coit, D., Cerami, A., 1988. Resolution of the two components of macrophage inflammatory protein 1, and cloning and characterization of one of those components, macropahge inflammatory protein 1 . J. Exp. Med. 168, 2251±2259. Sparger, E.E., Luciw, P.A., Elder, J.H., Yamamoto, J.K., Lowenstine, L.J., Pedersen, N.C., 1989. Feline immunodeficiency virus is a lentivirus associated with an AIDS-like disease in cats. AIDS 3, 43±49. Yamamoto, J.K., Sparger, E., Ho, E.W., Andersen, P.R., O'Connor, T.P., Mandell, C.P., Lowenstine, L., Munn, R., Pedersen, N.C., 1988. Pathogenesis of experimentally induced feline immunodeficiency virus infection in cats. Am. J. Vet. Res. 49, 1246±1258. Willett, B.J., Hosie, M.J., Neil, J.C., Turner, J.D., Hoxie, J.A., 1997a. Common mechanism of infection by lentiviruses, Nature 385, 587 pp. Willett, B.J., Picard, L., Hosie, M.J., Turner, J.D., Adema, K., Clapham, P.R., 1997b. Shared usage of the chemokine receptor CXCR4 by the feline and human immunodeficiency viruses. J. Virol. 71, pp. 6407±6415.