- Email: [email protected]
Molecular cloning, organellar targeting and developmental expression of mitochondrial chaperone HSP60 in Toxoplasma gondii
Molecular and Biochemical Parasitology 111 (2000) 319 – 332 www.parasitology-online.com.
Molecular cloning, organellar targeting and developmental expression of mitochondrial chaperone HSP60 in Toxoplasma gondii Catherine Toursel, Florence Dzierszinski, Annie Bernigaud, Marle`ne Mortuaire, Stanislas Tomavo * Laboratoire de Chimie Biologique, Centre National de la Recherche Scientifique UMR 8576, Uni6ersite´ des Sciences et Technologies de Lille, 59655 Villeneu6e d’Ascq, France Received 18 May 2000; received in revised form 1 August 2000; accepted 14 August 2000
Abstract The obligate intracellular protozoan parasite Toxoplasma gondii has a single tubular mitochondrion. During infection, it recruits the host cell’s mitochondria abutting to the intracellular vacuole, that contains the parasites. The respective contribution of host and parasitic mitochondria in the intracellular growth of T. gondii remains unknown. Heat shock protein, HSP60 has been reported in all eukaryotes examined, as an essential chaperone required for the folding and multimeric complex assembly of mitochondrial proteins. Here, we report the isolation and molecular characterization of two cDNAs corresponding to a single T. gondii gene coding for HSP60. Using a model fusion protein, preHSP60-chloramphenicol acetyl transferase (CAT), we demonstrate that the classical 22 amino acid mitochondrial presequence and the adjacent 32 amino acids of the mature protein are both required for the in vivo import into T. gondii mitochondria. The T. gondii HSP60 gene composed of five introns and six exons is transcribed into two related but differently spliced transcripts. Whereas the two transcripts can be detected in both developmental stages within the intermediate host, their levels are significantly increased in bradyzoites when compared to tachyzoites. By immunoblot analysis, the predicted 60-kDa protien corresponding to HSP60 was detected in both tachyzoite and bradyzoite forms. Using immunofluorescence assays, the polyclonal antibodies specific to T. gondii HSP60 recognized the mitochondrion in tachyzoites, as expected. In contrast, these antibodies reacted against two unknown vesicular bodies which are distinct from the classical mitochondrial pattern in bradyzoites. Taken together, these expression patterns of mitochondrial chaperone HSP60 suggests stage-specific induction of the respiratory pathway in the protozoan parasite T. gondii. © 2000 Elsevier Science B.V. All rights reserved.
Abbre6iations: CAT = chloramphenicol acetyl transferase; EST = expressed sequence tag; HFF = human foreskin fibroblast; HSP = heat shock protein; IFA = immunofluorescence assay; IPTG = isopropyl-1-thio-b-D-galactopyranoside; ORF = open reading frame; RACE = rapid amplification of cDNA ends. Note: Nucleotide sequence data reported in this paper have been submitted to the GenBank™ database with the accession number(s): AF065609 (cDNA1), AF065610 (cDNA2) and AF116462 (genomic DNA). * Corresponding author. Tel.: +33-03-20436941; fax: + 33-03-20436555. E-mail address: [email protected] (S. Tomavo). 0166-6851/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0166-6851(00)00324-8
320
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
Keywords: Mitochondrial HSP60; Targeting; Developmental expression; Toxoplasma gondii
1. Introduction In most eukaryotic cells, the general functions of mitochondria (e.g. cellular respiration and ATP production, many intermediary metabolic pathways, apoptosis) are abundantly documented. In the apicomplexan parasite Toxoplasma gondii, almost nothing is known about the respective functions of this organelle in intracellular tachyzoite and bradyzoite forms. Although there is evidence showing that a dye called mitoTracker accumulates into the mitochondria of intracellular tachyzoites [1], other experiments demonstrated the lack of rhodamine-123 uptake, suggesting the absence of mitochondrial membrane potential in the intracellular growing tachyzoites [2]. We and others have reported that specific inhibition of the mitochondrial electron transport chain by drugs such as oligomycin, antimycin, myxothiazol and hydroxynaphthoquinone (atovaquone) which are capable of blocking the replication of intracellular tachyzoites, also promotes conversion of tachyzoites into encysted bradyzoites [3 – 6]. Therefore doubts have been raised concerning the requirement for oxidative phosphorylation by the mitochondrion of T. gondii at all stages. Mitochondria contain nuclear-encoded heat shock proteins such as HSP10, HSP60 and HSP70 which function selectively as mitochondrial chaperones in the post-translational assembly of multimeric proteins encoded by both nuclear and mitochondrial genes [7 – 10]. Mitochondrial chaperones are essential for the biogenesis of mitochondria as a whole and therefore for all possible functions likely to be assumed by these organelles [9,11]. We thus believe that these molecules define ideal targets for investigations concerning the possible role of mitochondria in the two major developmental stages, tachyzoite and encysted bradyzoite of T. gondii. In this study, we report the isolation and characterization of a T. gondii gene that encodes mitochondrial chaperone HSP60.
2. Materials and methods
2.1. Parasite growth The 76K PLK strains of T. gondii were used because of the ease in culturing these parasites in vitro and to obtain encysted bradyzoites from chronically infected mice. Tachyzoites were grown in monolayer cultures of human foreskin fibroblasts (HFF) at 37°C in Dulbecco’s modified Eagle’s medium (Gibco) containing 10% of fetal calf serum (Dutscher). After host cell lysis, tachyzoites were purified from the host cell material by passage through a 3 mm-pore size filter (Nucleopore). Cysts were isolated from brains of mice or Fisher rats infected with tachyzoites or cysts (76K strain) for 6 weeks. Cysts were purified by isopycnic centrifugation on a percoll gradient and encysted bradyzoites were freed after digestion with 0.5% pepsin–HCl (pH 2.0) containing 170 mM NaCl [12].
2.2. Rapid amplification of cDNA ends and RT-PCR To obtain full-length cDNAs, Rapid ampliflication of cDNA ends (RACE) was performed according to the manufacturer’s recommendation (Marathon cDNA Amplification Kit, Clontech). Specific oligonucleotides for HSP60 gene were designed using the nucleotide sequence of a cDNA clone isolated previously from a T. gondii subtractive library [13]. For 5% RACE, two fragments of 587 and 599 bp were amplified by PCR using primers A: 5%-ACCGTCGCGGCCCACCTTCTC-3% and AP1, followed by nested PCR with B: 5%-GTCTCCGTTCGCCGAGATCGT-3% and AP2. The 3% end DNA fragment was amplified using primers C: 5%CCGGGAGCCCAGTTGGTGAAG-3% and AP1, followed by a first nested PCR with D: 5%-CGCCGGTGACGGGACAACCAC-3% and AP2. Finally, a second nested PCR using E: 5%-CCGTGGATGCGGGAAT
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
GAACC-3% and AP2 was performed. PCR products were cloned into the TA-Cloning pCRII vector (Invitrogen) and sequenced using an ALF express automated sequencer (Pharmacia Biotech). RT-PCR was used to confirm the existence of the two full-length cDNAs (designated cDNA 1 and cDNA2) by using F: 5%-CCTTGGCCTCCTTTCTTCTCT-3% and G: 5%-CTAGTACATGCCTCCCATGCC-3% (cDNA1) or H: 5%-ATGTACATCCACTGTTATTTC-3% and G (cDNA2). These cDNAs were cloned and sequenced.
2.3. Measurement of mRNA le6els by RT-PCR Total RNA was isolated from encysted bradyzoites and tachyzoites as described above. For controls, total RNA from uninfected brain cells of mice and HFF was also isolated. For RT-PCR, total RNA was digested with DNase, and the absence of DNA was checked by PCR before reverse transcription. One mg of purified total RNA was reverse transcribed for the 42°C in a buffer containing 1 mM of oligo(dT)18 primer, 2 mM of dNTP and 25 U of AMV reverse transcriptase (Boehringer Mannheim). The reaction mixture was heat inactivated at 70°C for 15 min. PCR amplifications were performed using 5 U of Taq DNA polymerase (Promega) in 100 ml reaction volumes containing 10 mM Tris – HCI (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl2, 200 mM of dNTP and 100 pM of each primer. Thermal cycling conditions were: (1) denaturation at 94°C for 1 min; (2) annealing at 50 – 60°C (depending upon each pair primer); (3) elongation at 72°C for 2 min; (4) at the end, an additional extension was done at 72°C for 10 min. The PCR primers derived from T. gondii a-tubulin genes [14], 5%-ATGAGAGAGGTTATCAGCATC-3% and 5%-TTAGTACTCGTCACCATAGCC-3% and actin gene [15], 5%-ATCGTCGCGCATTGTGAC-3% and 5%-TCGGGATCCAGATGGCGGATGAAAAAG-3% were used as controls. The pair primers of HSP60 were F – G and H –G, respectively. PCR products were electrophoresed on 1% agarose gels, stained with ethidium bromide, scanned and quantified using a computer program (htpp://rsb.info.nih.gov/nihimage/).
321
2.4. Expression of recombinant HSP60 protein The ORF of T. gondii HSP60 contained in cDNA1 was digested with EcoRI and SacII The fragment of 856 bp corresponding to the COOHterminal protein sequence of 285 amino acids was purified from the agarose gel by Gene Clean and cloned in the expresssion His-Patch ThioFusion™ vector (Invitrogen). Expression of the recombinant protein fused to HP-thioredoxin was induced by adding 1 mM IPTG (Isopropyl-b-D-thiogalactopyranoside) when the culture of transformed E. coli grown at 37°C reached an OD600 of 0.6. Cultures were grown for an additional 3 h period and then harvested by centrifugation. Cells were resuspended in 20 mM sodium phosphate, 500 mM NaCl (pH 7.8), broken by French cell and centrifuged for 10 min at 4°C, 14 000 × g. The lysate was subjected to SDS-PAGE on a 13% polyacrylamide gel and the 45 kDa fusion protein was electroeluted at 3 W for 3 h using the little blue tank (ISCO, Inc.). Three BALB/c mice were immunized with 100 mg of purified recombinant protein in complete Freund’s adjuvant and challenged every two weeks with three successive injections by 50 mg of recombinant protein in incomplete Freund’s adjuvant (Sigma).
2.5. Construction of mitochondrial targeting plasmids The fragment DNA corresponding to five presequence signals within the N-terminus of 62 amino acids of HSP60 protein were obtained by PCR using the plasmid containing cDNA1. For PCR amplification of presequence Hsp60(37-62), primers, I: 5%GGGGATGCATATGCTTGCAGGATGCAACCGCCTGGCA-3% and J: 5%GGGGATGCATAATTACCACGTTGCGTCCCTTCGG-3% yielded a product of 83 bp. Primers for Hsp60(1-25) were K: 5%GGGGATGCATATGCTTGCCCGCGCTTCAGCGAGAGTT - 3 % and (L) 5%-GGGGATGCATGCTGCTGGCATGGCGAACCTGAAA-3% for a fragment with a size of 83 bp. A 119-bp product of Hsp60(1-36) was obtained with primers K and M (5%-GGGGATGCATCTGGTTTCTGGCGTCACAGCC
322
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
GAACCG-3%). For Hsp60(1-54), K and N ( 5 % - GGGGATGCATGCCGAGAGTGACTCCGACTGCGTC-3%) were used for the amplification of a fragment of 170 bp, while K and J gave a 194-bp product for Hsp60(1-62). The amplified fragments were purified from Low Melting Point agarose (Gibco BRL) using two phenol extractions at 65°C followed by ethanol precipitation. In order to generate the fusion protein between the presequence of Hsp60 and CAT (Hsp60(x-y)CAT), the amplified framents above were introduced between the NsiI site of the TUB7 /CAT transfection vector of T. gondii which contains a TUB1 promoter upstream of the AUG start codon of CAT and the SAG1 3% sequence downstream of the stop codon [16]. The resulting fusion proteins were named Hsp60(1-25)-CAT, Hsp60(136)-CAT, Hsp60(1-54)-CAT, Hsp60(1-62)CAT and Hsp60(37-62)-CAT, respectively. All plasmid constructs were checked for the accuracy of nucleotide contents by sequencing.
2.6. Transfection and selection of T. gondii stable transformants Plasmid constructs were isolated using the Qiagen standard protocol. Purified tachyzoites (107 parasites) were mixed with 50 mg circular DNA and transfected using BTX ECM 600 electroporator as previously described [16]. Transfected parasites were inoculated onto confluent monolayers of HFF in 12-mm glass coverslips for immunofluorescence assays. For stable transformants, 50 mg of linearized Hsp60(1-54)-CAT plasmid by Asp 718 were electroporated in 2 × 107 tachyzoites of T. gondii (the 76K strain). The parasites were transferred back to HFF after electroporation and 28 h later, they were selected with 20 mM chloramphenicol [17]. After 4 weeks, the chloramphenicol-resistant parasites were cloned and one clone was used for further analysis.
2.7. Indirect immunofluorescence assay and electron microscopy Transfected or untransfected parasites were grown on HFF for 24 h. Cells were fixed in 4% formaldehyde for 30 min and processed for IFA according to the method previously described [13].
For electron microscopy, the resuspended pellets were directly fixed in 2.5% glutaraldehyde-0.1 M sodium cacodylate (pH 7.2), dehydrated in graded ethanol solutions, and embedded in Epon. Serial thin sections were made and after staining in 2% uranyl acetate, the preparations were observed on a Hitachi H-600 electron microscope.
2.8. Isolation and purification of mitochondria Mitochondria of T. gondii were purified with a subfractionation method using 5 × 108 PS4-CAT stable transformants according to a method previously described by Leriche and Dubremetz [18]. Four fractions were collected, diluted to a final concentration of 1 M sucrose and centrifuged at 190 000 × g for 1 h using a SW40 rotor. Pellets were collected in TES and processed for Western blotting analysis.
2.9. In 6itro transformation of encysted bradyzoites into tachyzoites Hundred thousand of encysted bradyzoites, were inoculated onto a confluent monolayer of HFF. Kinetics of HSP60 protein expression was followed by IFA after 3, l8 and 42 h post-infection using anti-HSP60 serum (1:10). Monoclonal antibodies specific, to the tachyzoite surface protein SAG1 or to the bradyzoite specific protein P21 were used as controls.
3. Results
3.1. Cloning of the full-length HSP60 cDNAs of T. gondii and protein sequence analyses We have previously cloned a 411 bp cDNA displaying 75%, protein sequence identity with Plasmodium falciparum HSP60 [13]. This novel cDNA clone has no homology to any of the expressed sequence tags (EST) reported recently for the two developmental stages, tachyzoite and bradyzoite of T. gondii [19,20]. We have designed a set of oligonucleotide primers which allowed the generation of 5% and 3% ends through RACE PCR. Four identical clones containing 1992 nucleotides,
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
were isolated for the 3% end DNA fragment. However, two DNA fragments consisting of 587 bp (cDNA1) and 599 bp (cDNA2) with a 180 nucleotide-totally-divergent sequence at the 5% end were obtained in 5% RACE experiments. The relative numbers of 5% RACE clones coding for cDNA1 and cDNA2 were estimated at 5:1. The data were consistent with the presence of two distinct cDNAs potentially encoding the HSP60 protein of T. gondii. This was confirmed when two oligonucleotide primers designed within the divergent sequence were separately used in combination with one common primer chosen in the 3% end sequence. Two cDNAs of 2430 and 2442 bp (designated cDNA1 and cDNA2) were amplified by PCR, respectively. Their complete nucleotide sequences confirmed the existence of two potentially encoding cDNAs in T. gondii. The two cDNAs showed 93% identity at the nucleotide level and confirmed the presence of the 5% end divergent region. While the cDNA1 sequence can be translated to a full-length ORF, cDNA2 lacks an initiator ATG codon. Instead, a stop codon preceding a putative ATG codon is found. We cannot find in cDNA2 an alternative start codon anywhere else in a predicted ORF with similar length to that of other HSP60 proteins. Only the cDNAl nucleotide sequence had a 1725-bp ORF which encodes a 575 amino acid polypeptide encompassing the entire HSP60 protein with a predicted molecular mass of 60 kDa. An amino acid sequence alignment of T. gondii HSP60 and other HSP60 sequences is shown in Fig. 1. A high degree of sequence identity with that of another apicomplexan parasite P. falciparum (67.65%) is observed. Human HSP60 display 54.97% sequence identity with T. gondii HSP60. Several structural motifs that are characteristic of HSP60 proteins are also present in T. gondii HSP60, including the signature peptide known as ATP-binding site (boxed amino acid residues in Fig. 1). The carboxyl terminus of the T. gondii HSP60 contains the highly conserved repeat GGM motif (GGMxxGGMxGGMGGM, bold sequence in Fig. 1) found at the carboxy termini of all other HSP60 and GroEL proteins [7,21,22]. Like other eukaryotic HSP60 proteins, a putative mitochondrial targeting signal containing
323
Fig. 1. Alignment of the amino acid sequences of Toxoplasma gondii, Plasmodium falciparum and Homo sapiens HSP60. (*), identical amino acids; ( ), conserved residues. The number of amino acids in each HSP60 and the percentage of similarity to HSP60 of T. gondii are indicated. The GGM repeat motif present at the C-terminus and the putative mitochondrial targeting sequence of T. gondii and those of the HSP60s illustrated are shown in bold type. The ATP-binding motif is boxed.
324
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
Fig. 2. (A) Southern gel analysis was performed by using DNA from T. gondii (strain 76K) or from uninfected fibroblast cells digested with different restriction enzymes. The blot was hybridized with a 315-bp DNA probe corresponding to nucleotides 326–641 of T. gondii HSP60 cDNA. (B) Gene structure of T. gondii HSP60 and its comparison to cDNA1 and cDNA2. Boxes correspond to exons deduced from cDNA sequences. The exon 1 only found in cDNA1 will be connected to exon 2 by splicing the intron between these two exons. The unspliced exon 2 is only found in cDNA2 which lack exon 1. The start codon is indicated by the arrow and stop codons are marked with asterisks. The restriction enzyme sites are indicated.
Arg, Lys and His residues is found in the N-terminal extension (25 amino acids) of T. gondii HSP60 (bold sequence in Fig. 1).
3.2. HSP60 gene organization in T. gondii genome When Southern blots of restriction enzyme digests of T. gondii DNA were probed with a 460bp DNA fragment common to both cDNA1 and cDNA2 under conditions of high stringency, a simple pattern of hybridizing fragments was observed (Fig. 2A). One band was seen mostly and only two fragments were obtained as expected for restriction enzyme cutting once within the HSP60 sequence (Fig. 2A, lane BamHI/A6aII). Thus, it is likely that the HSP60 gene occurs as a single copy in the T. gondii genome. A genomic library of T. gondii (strain PLK) was screened with a probe prepared from the 1458-bp DNA fragment common to cDNA1 and cDNA2. A 15-kb DNA insert that contained the HSP60 coding region was isolated. From this, an
EcoRV-fragment of approximately 4 Kb was subcloned in the Bluescript SK + plasmid and sequenced. Comparison of cDNA and genomic DNA nucleotide sequences revealed five introns of 422, 707, 227, 401 and 250 bp, respectively (Fig. 2B). These introns contained the typical GT/AG consensus splicing signal. We found that excision of the introns from the primary transcript resulted in two mature HSP60 mRNAs corresponding to cDNA1 and cDNA2, respectively. This result established that cDNA1 and cDNA2 clones amplified by PCR are truly transcribed from the single-copy HSP60 gene identified in this study (Fig. 2B). In addition, the genomic sequence confirms the lack of an initiator codon in cDNA2 and the presence of the stop codons.
3.3. Both a classical N-terminal presequence and its adjacent peptide are required for mitochondrial targeting of HSP60 in T. gondii We have produced deletions in the sequence encoding the 62 N-terminal residues. These in-
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
clude 5% (PS2) and 3% (PS1, PS3 and PS4) deletions of the N-terminal 62 amino acids of the HSP60 protein. We included a positive control consisting of the whole N-terminal 62 amino acid sequence (PS5) (Fig. 3A). These mitochondrial targeting presequences were fused to the chloramphenicol acetyl transferase (CAT) gene in the TUB7 /CAT T. gondii expression vector (Fig. 3B). In parasites transiently transfected, all five constructs displayed CAT activity with a level comparable to the parental plasmid, suggesting that the insertion of these presequences does not abolish the transcriptional activity of the tubulin promoter of the TUB7 /CAT plasmid. To assess the location of CAT, immunofluorescence assays (IFA) were performed on transfected tachyzoites grown in HFF cells using a rabbit CAT antiserum. We found that only PS4, and PS5 constructs consisting of 54 and 62 amino acids respectively, were capable of targeting the CAT reporter to the mitochondrion of T. gondii tachyzoites (Fig. 4, panels G – H and I – J). In contrast, the IFA staining obtained after transfection of the other three constructs PS1, PS2 or PS3-CAT appeared as a diffuse signal throughout
325
the cytosol of parasites (panel A–F). However, the CAT signal is more intensely distributed at the apical extremity of the parasites for the PS1 and PS2 constructs which correspond to 25 and 36 amino acids of the N-terminus of HSP60 (panel B and F). PS2 (containing the 25 amino acids from the mature part of the protein) however gave a more diffuse signal throughout the entire cytosol (Fig. 4, panel D). Identical cytoplasmic localization was observed when the initial TUB7 /CAT construct alone was transfected in the parasites.
3.4. Localization of the CAT reporter and HSP60 in T. gondii mitochondria Several attempts to localize HSP60 and CAT by immuno-electron microscopy were unsuccessful. As alternative approach, we have examined the localization of the CAT reporter using a cell fractionation method relying on stably transformed tachyzoites obtained after transfection of the PS4 plasmid. Parasite extracts obtained from tachyzoites stably transformed with PS4-CAT were separated on discontinous sucrose gradients (Fig. 5, panel A). Electron microscopy showed
Fig. 3. Chloramphenicol acetyl transferase (CAT) derived constructs used for import experiments. (A) N-terminal extension (62 amino acids) of HSP60 protein (WT) contains positively charged amino acids Arg, His and Lys as expected for mitochondrial presequence. Four plasmid constructs named Hsp60(37-62)-CAT or PS2, Hsp60(1-25)-CAT or PS1, Hsp60(1-36)-CAT or PS3 and Hsp60(1-54)-CAT or PS4 were generated after deletion at the 3% or 5% nucleotide ends of region shown in (A). The whole N-terminal 62 amino acid sequence (Hsp60(1-62)-CAT or PS5) was also used as control. (B) The targeting constructs were achieved by cloning the fragments DNA generated by PCR between tubulin promoter (70 bp) and CAT reporter (600 bp) of a T. gondii transfection vector which is also composed of SAG1 3% UTR (300 bp).
326
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
transformed tachyzoites. The IFA of the CAT signal is shown in panel B (Fig. 6) and appears in the mitochondria of stably transformed tachyzoites. The contrast phase microscopy of intracellular parasites illustrated is shown in panel A. The IF pattern of CAT is identical to the signal of the anti-HSP60 serum (panel C) directed against the recombinant HSP60 protein of T. gondii (see details in Section 2). Panel D demonstrates the co-localization of the IF signals due to the CAT reporter (panel B) and that of endogenous HSP60 (panel C).
3.5. Comparati6e analysis of HSP60 transcripts, in the two de6elopmental stages of T. gondii
Fig. 4. In vivo import of CAT reporter into the mitochondrion of T. gondii. Immunofluorescence of transiently transfected tachyzoites with PS1 (panel B), PS2 (panel D), PS3 (panel F), PS4 (panel H) and PS5 (panel J). The intracellular tachyzoites used for IFA are evidenced by the phase constrast pictures shown in panels A, C, E, G and I. Note the labelling of the apical extremity for PS1 and PS3 while the entire cytosol was stained when PS2 was used. PS4 and PS5 plasmids gave a typical mitochondrial labelling pattern of T. gondii (panel H and J). Bar = 10 mm.
that T. gondii mitochondria was found predominantly in fraction b (panel C) while fraction c was enriched mostly in membrane ghosts (panel D). The different fractions were immunoblotted with anti-CAT antibodies (panel B). A clear enrichment of CAT reporter was observed in the mitochondria-enriched fraction b (1.4 – 1.6 M interface), demonstrating the localization of CAT in the mitochondria of T. gondii tachyzoites. In addition to this, we used double immunofluorescence assays to co-localize the CAT reporter and the endogenous HSP60 in the stably
We further investigated the presence of HSP60 mRNA level in the rapidly growing virulent tachyzoites and in the slowly replicating encysted bradyzoites. To this end, RT-PCRs were performed because there were limitations in obtaining sufficient cysts in vivo for Northern blots. To ensure that equal quantities of each mRNA were being compared, the actin and tubulin genes were used as controls (Fig. 7A and B). Based on the nearly constant level of actin mRNA amplified in 10 000 equivalent parasites, we noticed that both mRNAs transcribed from the HSP60 gene are clearly detected in the tachyzoite and bradyzoite forms of T. gondii (Fig. 7A). Even if both mRNAs transcribed from the HSP60 gene are clearly detected in the tachyzoite and bradyzoite forms of T. gondii, a semi-quantitative RT-PCR reveals that their level of expression are increased in encysted bradyzoites (Fig. 7B). The levels of the two HSP60 mRNAs, mRNA1 and mRNA2, were estimated to be sixfold and 25-fold higher respectively, in encysted bradyzoites when compared to tachyzoites. Collectively, our results indicate that HSP60 gene is over-expressed at the transcriptional level in the in-vivo cysts of T. gondii
3.6. De6elopmental expression of the chaperone HSP60 required for mitochondrial functions in T. gondii Before investigating the expression of HSP60 protein in T. gondii we checked that equal cell
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
Fig. 5. (A) Mitochondria were isolated from stably transformed PS4-CAT tachyzoites by loading disrupted parasites on a discontinuous sucrose gradient. Four fractions (a, b, c, and d) enriched with different parasite organelles were obtained after ultracentrifugation. (B) These fractions were separated by SDS-PAGE. Western blot analysis using anti-CAT serum shows that the CAT reporter localized in fraction b enriched in T. gondii mitochondria. Total protein lysates from tachyzoites of PS4-CAT transformants (lane 1), the T. gondii wild type tachyzoites (lane 2) and uninfected HFF (lane 3) were used as controls. (C and D) Ultrastructural images showing the purified mitochondria recovered in fraction b (sucrose gradient interface between 1.4–1.6 M) and the fraction c. Insert represents 2-fold magnification of T. gondii mitochondrion.
327
numbers of the two developmental stages, tachyzoites and bradyzoites were being compared. This was demonstrated through Western blots using monoclonal antibodies directed against actin (Fig. 8A, panel actin). We further checked the expression patterns of stage specific proteins. The tachyzoite specific protein SAG1 (Fig. 8B, panel P30 or SAG1) and the two bradyzoite specific proteins P21 and P36 (Fig. 8B, panels P36 and P21) were monitored through the use of monoclonal antibodies. Western blots relying on polyclonal antibodies raised against the recombinant HSP60 revealed the presence of the 60 kDa protein in both tachyzoite and bradyzoite stages (Fig. 8B, panel HSP60, black and grew arrows). The level of the HSP60 protein in bradyzoites was approximately two-fold higher than that of tachyzoites. However, two proteins of 56 kDa (white stars), 25–28 kDa and high molecular mass bands were also detected in the bradyzoites. These high molecular mass bands and the other cross-reacting proteins were also found when the secondary conjugated antibodies were used alone, suggesting that they represent contaminating immunoglobulins (heavy and light chains) or other proteins from infected mice brain. Thus, the 25–28 kDa proteins were absent from the blots corresponding to P30 (SAG1), P36 and P21 (Fig. 8B) because the protein lysates were analyzed in polyacrylamide gel electrophoresis under nonreducing conditions, preventing dissociation of the Ig chains. It should be noted that our monoclonal antibodies specific to SAG1, P36 and P21 only recognize the respective non-reduced forms. The HSP60 panel corresponds to an SDS-PAGE which was performed under reduced conditions. As controls, the antiTgHSP60 serum reacted specifically either to the recombinant HSP60 protein in total proteins lysate prepared from the transformed E. coli (Fig. 8D, compare lane 1 and 2) or to the purified recombinant HSP60 (Fig. 8C, lane rHSP60). Importantly, the specificity of the anti-TgHSP60 was demonstrated by the lack of cross-reactivity against proteins from both uninfected human fibroblast (Fig. 8C, lane H) and murine cells (Fig. 8C, lane M). In addition, the anti-TgHSP60 does not cross-react to the host cell mitochondria in
328
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
against the recombinant HSP60 protein and of monoclonal antibodies directed against stage-specific proteins. To do this, the bradyzoites released after pepsin digestion were inoculated onto fibroblast monolayer cells. The IFA pattern of the mitochondrial HSP60 as detected in tachyzoites remained absent 3 h post-infection from encysted bradyzoites inoculated in culture (Fig. 9, panel B).
Fig. 6. Co-localization of endogenous HSP60 and CAT. Stable transfectants were obtained after PS4-CAT electroporation into T. gondii tachyzoites. The intracellular tachyzoites used for IFA were evidenced by the phase constrast pictures displayed in panel A. Panel B shows the IF staining of mitochondria of stably transformed parasites using the anti-CAT serum. Panel C, immunofluorescence pattern of the anti-HSP60 serum on the same parasites using double IF assays. Panel D, co-localization of IF signals of endogenous HSP60 (shown in panel C) and that of CAT reporter targeted into the mitochondria (panel B). Bar = 10 mm.
the IFA experiments where intracellular tachyzoites (inside HFF cells) were used (Fig. 6 and Fig. 9). Altogether, our data indicate that a polyclonal antiserum specific to the T. gondii mitochondrial HSP60 was generated. We conclude that despite the increased mRNA level in encysted bradyzoites, the 60-kDa protein corresponding to HSP60 is detected in both virulent tachyzoites and dormant encysted bradyzoites.
3.7. The polyclonal antibodies specific to HSP60 protein identified two 6esicular bodies in bradyzoites instead of the classical tubular mitochondrial pattern As discussed above, strong evidence suggests that the HSP60 protein can be detected in both tachyzoites and bradyzoites. In order to check if the 60-kDa protein detected in total extract of bradyzoites by Western blot is also located in the mitochondrion as seen for tachyzoites, we examined the spatial localization of HSP60 through the use of both polyclonal antibodies generated
Fig. 7. Comparative analysis of the HSP60 mRNA level in the two developmental stages of T. gondii. (A) Results of RT-PCR with primers to the full-length ORF of T. gondii HSP60 by using total RNA from tachyzoites and in-vivo encysted bradyzoites (104 parasites of each stage). The actin primers, RNA from uninfected human fibroblasts (HFF cells) or mice (Murine cells) were used as controls. (B) Overexpression of HSP60 gene in encysted bradyzoites was confirmed by using semiquantitative RT-PCR performed with ten-fold serial dilutions of tachyzoite and bradyzoite cDNAs. The a-tubulin primers were used as controls.
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
329
Fig. 8. Developmental expression of HSP60 protein in T. gondii. Total proteins from either 1.5 × 106 tachyzoites (lane T) or 2 × 102 cysts isolated from the brain of infected mice (lane B) were assayed for HSP60 expression by Western blots. Western blots were incubated either with the monoclonal antibodies specific to the actin (panel A, actin), the tachyzoite-specific surface protein (panel B, SAG1), the bradyzoite-specific proteins (panel B, P21 and P36) or with the polyclonal antibodies against the HSP60 (panel B, HSP60). Black and grey arrows indicate the 60-kDa protein corresponding to HSP60 in tachyzoite and bradyzoite, respectively. Panel C corresponds to the reactivity of anti-TgHSP60 serum against total protein extracts from uninfected human fibroblasts (lane H), uninfected murine cells (lane M) and purified recombinant HSP60 (lane rHSP60). Panel D shows the total protein extract of the transformed E. coli expressing the recombinant HSP60 (lane 1) which was probed with the anti-TgHSP60 serum (lane 2).
However, the antibodies recognized two vesicles beneath the bradyzoite nucleus. This result suggests that the HSP60 protein is not located within the bradyzoite mitochondrion. The parasites examined 3 h post-infection still expressed the bradyzoite-specific protein P21 (panel D) but not the tachyzoite specific protein SAG1 (panel F). Some parasites displayed expression of the HSP60 signal 18 h post-infection. This signal was localized within the mitochondrion (panel H) while the remaining parasites still showed the vesicular pattern found in bradyzoites (panel H). The pattern of HSP60 staining in the mitochondrion did not appear to coincide with the expression of the tachyzoite-specific surface antigen SAG1 (panel L) while the parasites still expressed the bradyzoite-specific protein, P21 (panel J). Once reinitiated, HSP60 staining accumulates and persists during the replication and growth of parasites tested 42 h post-infection (panel N), while the signal of the bradyzoite-specific protein P21 is restricted to few spots (panel P). Conversely, the tachyzoite-specific protein SAG1 is now de-
tectable (panel R). These data establish that the mitochondrial pattern of HSP60 reappears and becomes detectable earlier than the tachyzoite marker protein SAG1 and before the complete disappearance of the bradyzoite-specific protein P21. This suggests that mitochondria of encysted bradyzoites may acquire the ability to import the chaperone HSP60 protein as soon as they are committed to switch back to rapidly dividing tachyzoites.
4. Discussion In the present study, we demonstrate that a gene encoding HSP60, a chaperone that was demonstrated in several eukaryotes [7–10] to be essential for folding and assembly of mitochondrial oligomeric proteins, is selectively expressed during the intracellular development of T. gondii. We investigated different aspects of the organization and expression of the T. gondii HSP60 gene. It contains five introns and the splicing of these
330
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
introns produces two distinct mRNAs which were initially identified as two homologous cDNAs having two divergent 5% end region of approximately 180 nucleotides. Interestingly, only one cDNA (cDNA1) possesses a full-length open reading frame of 1725 bp. The full-length ORF of cDNA1 encodes a 60-kDa polypeptide. The size and structural properties including the presence of N-terminal targeting presequence and COOH-terminal repeat GGM motifs suggest that the 60kDa protein of T. gondii presented here is a member of the mitochondrial HSP60 chaperone family. In addition to this, immunolocalization experiments performed with antibodies raised against recombinant fusion proteins prove that the cDNA1 protein product is indeed located in the unique mitochondrion of the parasite. The amino-terminal extension including the putative mitochondrial import signal of 22 amino acids and a peptide of the mature part (32 amino acids) of HSP60 protein the T. gondii is clearly important for mitochondrial targeting in vivo. It should be noted that strong evidence indicates that the cleavable pre-sequence of several mitochondrial precursor proteins is sufficient to direct an attached polypeptide into the mitochondrial matrix
[23,24]. For example, the first twelve amino acids of a yeast mitochondrial outer membrane protein carries sufficient information to direct a nuclearencoded cytochrome oxidase subunit to the mitochondrial inner membrane [25]. It appears to us that the putative mitochondrial presequence of 22 amino acids is not capable to alone target the CAT reporter into the T. gondii mitochondria in vivo and, a contribution of the mature protein sequence is required. This is in good agreement with earlier in vitro studies which have shown that part of the mature protein plays a role in the specific binding of some preproteins to the mitochondrial import receptors [26,27]. To our knowledge, our results provide the first experimental evidence for the requirement of both N-terminal presequence and peptide tail on the mature protein for mitochondrial import in vivo. It is interesting to note that the existence of HSP60 and the import of CAT reporter into mitochondria of intracellular tachyzoites using its mitochondrial targeting signal, do indeed support that the tachyzoite mitochondrion maintains a membrane potential, as described by others [28,29]. Little is known about the physiological function of the unique T. gondii mitochondrion. Based on
Fig. 9. Phase-contrast microscopy (panels A, C, E, G, I, K, M, O and Q) and immunofluorescence of encysted bradyzoites inoculated onto a confluent HFF monolayer. IFA were performed after 3, 18 and 42 h post-inoculation using the polyclonal antibodies directed against HSP60 (panels B, H and N), the monoclonal antibodies directed against the bradyzoite-specific protein P21 (panels D, J and P) or the monoclonal antibodies directed against the tachyzoite-specific protein SAG1 (panels F, L and R). Bar = 10 mm.
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
the molecular mechanisms of mitochondrial protein import reported to date, it appears that electrochemical gradient should exist in the mitochondria of intracellular tachyzoites if only, because it is required for import of both fusion protein pHSP60-CAT and endogenous HSP60 into mitochondria of T. gondii. In addition, our results indicate that HSP60 is constitutively expressed in the tachyzoite and fully differentiated bradyzoite stages. Despite that mRNA levels are simultaneously increased in bradyzoites, the HSP60 protein could be detected in both tachyzoites and bradyzoites. However, the HSP60 protein appears to be targeted in two vesicular bodies distinct from the mitochondrion of the encysted bradyzoites. Because the polyclonal antibodies used here recognized the classical mitochondrial pattern in tachyzoites, these latter finding suggests that the HSP60 protein is not located in the mitochondrion of the encysted bradyzoites but within two unknown vesicles. It should be mentioned that the ultrastructural morphology of mitochondrion in the encysted bradyzoite seems to be similar to that of tachyzoite (Dubremetz JF, personal communication, and our unpublished observations). The precise nature of these two vesicles remains to be determined because our polyclonal antibodies unfortunately do not work in immuno-electron microscopy. Nevertheless, the identification of other organelles bearing the HSP60 protein suggests that the mitochondria of encysted bradyzoites may not be capable of importing this chaperone because of a probable lack of the mitochondrial membrane potential. Because HSP60 is likely to condition all functional mitochondria, these results suggest that active import and proper assembly of multimeric proteins take place only in the mitochondria of the tachyzoite forms. Thus, active mitochondria may not be required at the encysted bradyzoite stage of T. gondii. Others have reported the absence of essential enzymes of the TCA cycle in bradyzoites [30]. The absence of HSP60 in mitochondria, of encysted bradyzoites, that we now describe greatly expands this observation. These observations provide an elegant explanation for the increase of numerous bradyzoite-specific glycolytic enzymes [31,32]. Indeed this increase is
331
expected as an adaptive response to maintain a suitable ATP pool in conditions where respiration is blocked. We believe that the molecular characterizations reported here confirm HSP60 as a physiologically relevant target of studies aimed at understanding mitochondrial biogenesis and its function in growth and development of the various stages of T. gondii. Acknowledgements We would like to thank Dr. Christian Slomianny for his help in preparing the figures. We thank Drs. S. Ball and J. Vamecq for critical reading of the manuscript. C. Toursel and F. Dzierszinski are recipients of predoctoral fellowships from the Ministe`re de l’Enseignement Supe´rieur et de la Recherche, the Fondation pour la Recherche Me´dicale (FRM) and the Agence Nationale pour la Recherche sur le Sida (ANRS), respectively. This work was supported by grants from the FRM, the ANRS, Ensemble contre le Sida (Sidaction), the Centre National de Recherche Scientifique (CNRS) and the Institut National de Recherche Me´dicale et Scientifique (INSERM). References [1] Sinai AP, Webster P, Joiner KA. Association of host cell endoplasmic reticulum and mitochondria with the Toxoplasma gondii parasitophorous vacuole membrane: a high affinity interaction. J Cell Sci 1997;110:2117 – 28. [2] Tanabe K, Murakami K. Reduction in the mitochondrial membrane potential of Toxoplasma gondii after invasion of host cells. J Cell Sci 1984;70:73 – 81. [3] Araujo FG, Huskinson J, Remington JS. Remarkable in 6itro and in 6i6o activities of the hydroxynaphtoquinone 566C80 against tachyzoites and tissue cysts of Toxoplasma gondii. Antimicrob Agents Chemother 1991;35:293 – 9. [4] Araujo FG, Huskinson-Mark J, Gutteridge WE, Remington JS. In 6itro and in 6i6o activities of the hydroxynaphtoquinone 566C80 against the cyst form of Toxoplasma gondii. Antimicrob Agents Chemother 1992;36:326 – 30. [5] Bohne W, Heesemann J, Gross U. Reduced replication of Toxoplasma gondii is necessary for induction of bradyzoite-specific antigens: a possible role for nitric oxide in triggering stage conversion. Infect Immun 1994;62:1761 – 7.
332
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
[6] Tomavo S, Boothroyd JC. Interconnection between organellar functions, development and drug resistance in the protozoan parasite, Toxoplasma gondii. Int J Parasitol 1995;25:1293 – 9. [7] Hemmingsen SM, Woolford C, van der Vies SM, et al. Homologous plant and bacterial proteins chaperone oligomeric protein assembly. Nature 1988;333:330–4. [8] Cheng MY, Hartl UF, Martin J, et al. Mitochondrial heat-shock protein Hsp60 is essential for assembly of proteins imported into yeast mitochondria. Nature 1989;337:620 – 5. [9] Georgopoulos C, Welch WJ. Role of the major heat shock proteins as molecular chaperones. Annu Rev Cell Biol 1993;9:601 – 34. [10] Bukau B, Horwich AL. The Hsp70 and Hsp60 chaperone machines. Cell 1998;92:351–66. [11] Attardi G, Schatz G. Biogenesis of mitochondria. Ann Rev Cell Biol 1988;4:289–333. [12] Tomavo S, Fortier B, Soete M, Ansel C, Camus D, Dubremetz JF. Characterization of bradyzoite-specific antigens of Toxoplasma gondii. Infect Immun 1991;59:3750 – 3. [13] Yahiaoui B, Dzierszinski F, Bernigaud A, Slomianny C, Camus D, Tomavo S. Isolation and characterization of a subtractive library enriched for developmentally regulated transcripts expressed during encystation of Toxoplasma gondii. Mol Biochem Parasitol 1999;99:223–35. [14] Nagel SD, Boothroyd JC. The a- and b-tubulins of Toxoplasma gondii are encoded by single copy genes containing multiple introns. Mol Biochem Parasitol 1988;29:261 – 73. [15] Dobrowolski JM, Sibley LD. Toxoplasma invasion of mammalian cells is powered by the actin cytoskeleton of the parasite. Cell 1996;84:933–9. [16] Soldati D, Boothroyd JC. Transient transfection and expression in the obligate intracellular parasite Toxoplasm gondii. Science 1993;260:349–52. [17] Kim K, Soldati D, Boothroyd JC. Gene replacement in Toxoplasma gondii with chlormaphenicol acetyltransferase as selectable marker. Science 1993;262:911–4. [18] Leriche MA, Dubremetz JF. Characterization of the protein contents of rhoptries and dense granules of Toxoplasma gondii tachyzoites by subcellular fractionation and monoclonal antibodies. Mol Biochem Parasitol 1991;45:249 – 60. [19] Ajioka J, Boothroyd JC, Brunk BP, et al. Gene discovery by EST sequencing in Toxoplasma gondii reveals sequences restricted to the Apicomplexa. Genome Res 1998;8:18 – 28.
.
[20] Manger ID, Hehl A, Parmley S, et al. Expressed sequence tag analysis of the bradyzoite stage of Toxoplasma gondii: identification of developmentally regulated genes. Infect Immun 1998;66:1632 – 7. [21] Syin C, Goldman ND. Cloning of a Plasmodium falciparum gene related to the human 60-kDa heat shock protein. Mol Biochem Parasitol 1996;79:13 – 9. [22] Tsugeki R, Mori H, Nishimura M. Purification, cDNA cloning and Northern-blot analysis of mitochondrial chaperonin 60 from pumpkin cotyledons. Eur J Biochem 1992;209:453 – 8. [23] Neupert W. Protein import into mitochondria. Annu Rev Biochem 1997;66:863 – 917. [24] Pfanner N, Craig EA, Ho¨nlinger A. Mitochondrial preprotein translocase. Annu Rev Cell Dev Biol 1997;13:25 – 51. [25] Hurt EC, Mu¨ller U, Schatz G. The first twelve amino acids of a yeast mitochondrial outer membrane protein can direct a nuclear-encoded cytochrome oxidase subunit to the mitochondrial inner membrane. EMBO J 1985;4:3509 – 18. [26] Pfanner N, Mu¨ller HK, Harmey MA, Neupert W. Mitochondrial protein import: involvement of the mature part of a cleavable precursor protein in the binding to receptor sites. EMBO J 1987;6:3449 – 54. [27] Brix J, Ru¨diger S, Bukau B, Schneider-Mergener J, Pfanner N. Distribution of binding sequences for the mitochondrial import receptors Tom20, Tom22, and Tom70 in a presequence-carrying preprotein and a non-cleavable preprotein. J Biol Chem 1999;274:16522– 30. [28] Vercesi AE, Rodrigues CO, Uyemura SA, Zhong L, Moreno SN. Respiration and oxidative phosphorylation in the apicomplexan parasite Toxoplasma gondii. J Biol Chem 1998;273:31040– 7. [29] Melo EJ, Attias M, De Souza W. The single mitochondrion of tachyzoites of Toxoplasma gondii. J Struct Biol 2000;130:27 – 33. [30] Denton H, Roberts CW, Alexander J, Thong KW, Coombs GH. Enzymes of energy metabolism in the bradyzoites and tachyzoites of Toxoplasma gondii. FEMS Microbiol Lett 1996;137:103 – 8. [31] Yang S, Parmley SF. Toxoplasma gondii expresses two distinct lactate dehydrogenase homologous genes during its life cycle in intermediate hosts. Gene 1997;184:1 – 12. [32] Dzierszinski F, Popescu O, Toursel C, Slommiany C, Yahiaoui B, Tomavo S. The protozoan parasite Toxoplasma gondii expresses two functional plant-like glycolytic enzymes: implications for evolutionary origin of apicomplexans. J Biol Chem 1999;274:24888– 95.
Molecular cloning, organellar targeting and developmental expression of mitochondrial chaperone HSP60 in Toxoplasma gondii Catherine Toursel, Florence Dzierszinski, Annie Bernigaud, Marle`ne Mortuaire, Stanislas Tomavo * Laboratoire de Chimie Biologique, Centre National de la Recherche Scientifique UMR 8576, Uni6ersite´ des Sciences et Technologies de Lille, 59655 Villeneu6e d’Ascq, France Received 18 May 2000; received in revised form 1 August 2000; accepted 14 August 2000
Abstract The obligate intracellular protozoan parasite Toxoplasma gondii has a single tubular mitochondrion. During infection, it recruits the host cell’s mitochondria abutting to the intracellular vacuole, that contains the parasites. The respective contribution of host and parasitic mitochondria in the intracellular growth of T. gondii remains unknown. Heat shock protein, HSP60 has been reported in all eukaryotes examined, as an essential chaperone required for the folding and multimeric complex assembly of mitochondrial proteins. Here, we report the isolation and molecular characterization of two cDNAs corresponding to a single T. gondii gene coding for HSP60. Using a model fusion protein, preHSP60-chloramphenicol acetyl transferase (CAT), we demonstrate that the classical 22 amino acid mitochondrial presequence and the adjacent 32 amino acids of the mature protein are both required for the in vivo import into T. gondii mitochondria. The T. gondii HSP60 gene composed of five introns and six exons is transcribed into two related but differently spliced transcripts. Whereas the two transcripts can be detected in both developmental stages within the intermediate host, their levels are significantly increased in bradyzoites when compared to tachyzoites. By immunoblot analysis, the predicted 60-kDa protien corresponding to HSP60 was detected in both tachyzoite and bradyzoite forms. Using immunofluorescence assays, the polyclonal antibodies specific to T. gondii HSP60 recognized the mitochondrion in tachyzoites, as expected. In contrast, these antibodies reacted against two unknown vesicular bodies which are distinct from the classical mitochondrial pattern in bradyzoites. Taken together, these expression patterns of mitochondrial chaperone HSP60 suggests stage-specific induction of the respiratory pathway in the protozoan parasite T. gondii. © 2000 Elsevier Science B.V. All rights reserved.
Abbre6iations: CAT = chloramphenicol acetyl transferase; EST = expressed sequence tag; HFF = human foreskin fibroblast; HSP = heat shock protein; IFA = immunofluorescence assay; IPTG = isopropyl-1-thio-b-D-galactopyranoside; ORF = open reading frame; RACE = rapid amplification of cDNA ends. Note: Nucleotide sequence data reported in this paper have been submitted to the GenBank™ database with the accession number(s): AF065609 (cDNA1), AF065610 (cDNA2) and AF116462 (genomic DNA). * Corresponding author. Tel.: +33-03-20436941; fax: + 33-03-20436555. E-mail address: [email protected] (S. Tomavo). 0166-6851/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0166-6851(00)00324-8
320
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
Keywords: Mitochondrial HSP60; Targeting; Developmental expression; Toxoplasma gondii
1. Introduction In most eukaryotic cells, the general functions of mitochondria (e.g. cellular respiration and ATP production, many intermediary metabolic pathways, apoptosis) are abundantly documented. In the apicomplexan parasite Toxoplasma gondii, almost nothing is known about the respective functions of this organelle in intracellular tachyzoite and bradyzoite forms. Although there is evidence showing that a dye called mitoTracker accumulates into the mitochondria of intracellular tachyzoites [1], other experiments demonstrated the lack of rhodamine-123 uptake, suggesting the absence of mitochondrial membrane potential in the intracellular growing tachyzoites [2]. We and others have reported that specific inhibition of the mitochondrial electron transport chain by drugs such as oligomycin, antimycin, myxothiazol and hydroxynaphthoquinone (atovaquone) which are capable of blocking the replication of intracellular tachyzoites, also promotes conversion of tachyzoites into encysted bradyzoites [3 – 6]. Therefore doubts have been raised concerning the requirement for oxidative phosphorylation by the mitochondrion of T. gondii at all stages. Mitochondria contain nuclear-encoded heat shock proteins such as HSP10, HSP60 and HSP70 which function selectively as mitochondrial chaperones in the post-translational assembly of multimeric proteins encoded by both nuclear and mitochondrial genes [7 – 10]. Mitochondrial chaperones are essential for the biogenesis of mitochondria as a whole and therefore for all possible functions likely to be assumed by these organelles [9,11]. We thus believe that these molecules define ideal targets for investigations concerning the possible role of mitochondria in the two major developmental stages, tachyzoite and encysted bradyzoite of T. gondii. In this study, we report the isolation and characterization of a T. gondii gene that encodes mitochondrial chaperone HSP60.
2. Materials and methods
2.1. Parasite growth The 76K PLK strains of T. gondii were used because of the ease in culturing these parasites in vitro and to obtain encysted bradyzoites from chronically infected mice. Tachyzoites were grown in monolayer cultures of human foreskin fibroblasts (HFF) at 37°C in Dulbecco’s modified Eagle’s medium (Gibco) containing 10% of fetal calf serum (Dutscher). After host cell lysis, tachyzoites were purified from the host cell material by passage through a 3 mm-pore size filter (Nucleopore). Cysts were isolated from brains of mice or Fisher rats infected with tachyzoites or cysts (76K strain) for 6 weeks. Cysts were purified by isopycnic centrifugation on a percoll gradient and encysted bradyzoites were freed after digestion with 0.5% pepsin–HCl (pH 2.0) containing 170 mM NaCl [12].
2.2. Rapid amplification of cDNA ends and RT-PCR To obtain full-length cDNAs, Rapid ampliflication of cDNA ends (RACE) was performed according to the manufacturer’s recommendation (Marathon cDNA Amplification Kit, Clontech). Specific oligonucleotides for HSP60 gene were designed using the nucleotide sequence of a cDNA clone isolated previously from a T. gondii subtractive library [13]. For 5% RACE, two fragments of 587 and 599 bp were amplified by PCR using primers A: 5%-ACCGTCGCGGCCCACCTTCTC-3% and AP1, followed by nested PCR with B: 5%-GTCTCCGTTCGCCGAGATCGT-3% and AP2. The 3% end DNA fragment was amplified using primers C: 5%CCGGGAGCCCAGTTGGTGAAG-3% and AP1, followed by a first nested PCR with D: 5%-CGCCGGTGACGGGACAACCAC-3% and AP2. Finally, a second nested PCR using E: 5%-CCGTGGATGCGGGAAT
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
GAACC-3% and AP2 was performed. PCR products were cloned into the TA-Cloning pCRII vector (Invitrogen) and sequenced using an ALF express automated sequencer (Pharmacia Biotech). RT-PCR was used to confirm the existence of the two full-length cDNAs (designated cDNA 1 and cDNA2) by using F: 5%-CCTTGGCCTCCTTTCTTCTCT-3% and G: 5%-CTAGTACATGCCTCCCATGCC-3% (cDNA1) or H: 5%-ATGTACATCCACTGTTATTTC-3% and G (cDNA2). These cDNAs were cloned and sequenced.
2.3. Measurement of mRNA le6els by RT-PCR Total RNA was isolated from encysted bradyzoites and tachyzoites as described above. For controls, total RNA from uninfected brain cells of mice and HFF was also isolated. For RT-PCR, total RNA was digested with DNase, and the absence of DNA was checked by PCR before reverse transcription. One mg of purified total RNA was reverse transcribed for the 42°C in a buffer containing 1 mM of oligo(dT)18 primer, 2 mM of dNTP and 25 U of AMV reverse transcriptase (Boehringer Mannheim). The reaction mixture was heat inactivated at 70°C for 15 min. PCR amplifications were performed using 5 U of Taq DNA polymerase (Promega) in 100 ml reaction volumes containing 10 mM Tris – HCI (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl2, 200 mM of dNTP and 100 pM of each primer. Thermal cycling conditions were: (1) denaturation at 94°C for 1 min; (2) annealing at 50 – 60°C (depending upon each pair primer); (3) elongation at 72°C for 2 min; (4) at the end, an additional extension was done at 72°C for 10 min. The PCR primers derived from T. gondii a-tubulin genes [14], 5%-ATGAGAGAGGTTATCAGCATC-3% and 5%-TTAGTACTCGTCACCATAGCC-3% and actin gene [15], 5%-ATCGTCGCGCATTGTGAC-3% and 5%-TCGGGATCCAGATGGCGGATGAAAAAG-3% were used as controls. The pair primers of HSP60 were F – G and H –G, respectively. PCR products were electrophoresed on 1% agarose gels, stained with ethidium bromide, scanned and quantified using a computer program (htpp://rsb.info.nih.gov/nihimage/).
321
2.4. Expression of recombinant HSP60 protein The ORF of T. gondii HSP60 contained in cDNA1 was digested with EcoRI and SacII The fragment of 856 bp corresponding to the COOHterminal protein sequence of 285 amino acids was purified from the agarose gel by Gene Clean and cloned in the expresssion His-Patch ThioFusion™ vector (Invitrogen). Expression of the recombinant protein fused to HP-thioredoxin was induced by adding 1 mM IPTG (Isopropyl-b-D-thiogalactopyranoside) when the culture of transformed E. coli grown at 37°C reached an OD600 of 0.6. Cultures were grown for an additional 3 h period and then harvested by centrifugation. Cells were resuspended in 20 mM sodium phosphate, 500 mM NaCl (pH 7.8), broken by French cell and centrifuged for 10 min at 4°C, 14 000 × g. The lysate was subjected to SDS-PAGE on a 13% polyacrylamide gel and the 45 kDa fusion protein was electroeluted at 3 W for 3 h using the little blue tank (ISCO, Inc.). Three BALB/c mice were immunized with 100 mg of purified recombinant protein in complete Freund’s adjuvant and challenged every two weeks with three successive injections by 50 mg of recombinant protein in incomplete Freund’s adjuvant (Sigma).
2.5. Construction of mitochondrial targeting plasmids The fragment DNA corresponding to five presequence signals within the N-terminus of 62 amino acids of HSP60 protein were obtained by PCR using the plasmid containing cDNA1. For PCR amplification of presequence Hsp60(37-62), primers, I: 5%GGGGATGCATATGCTTGCAGGATGCAACCGCCTGGCA-3% and J: 5%GGGGATGCATAATTACCACGTTGCGTCCCTTCGG-3% yielded a product of 83 bp. Primers for Hsp60(1-25) were K: 5%GGGGATGCATATGCTTGCCCGCGCTTCAGCGAGAGTT - 3 % and (L) 5%-GGGGATGCATGCTGCTGGCATGGCGAACCTGAAA-3% for a fragment with a size of 83 bp. A 119-bp product of Hsp60(1-36) was obtained with primers K and M (5%-GGGGATGCATCTGGTTTCTGGCGTCACAGCC
322
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
GAACCG-3%). For Hsp60(1-54), K and N ( 5 % - GGGGATGCATGCCGAGAGTGACTCCGACTGCGTC-3%) were used for the amplification of a fragment of 170 bp, while K and J gave a 194-bp product for Hsp60(1-62). The amplified fragments were purified from Low Melting Point agarose (Gibco BRL) using two phenol extractions at 65°C followed by ethanol precipitation. In order to generate the fusion protein between the presequence of Hsp60 and CAT (Hsp60(x-y)CAT), the amplified framents above were introduced between the NsiI site of the TUB7 /CAT transfection vector of T. gondii which contains a TUB1 promoter upstream of the AUG start codon of CAT and the SAG1 3% sequence downstream of the stop codon [16]. The resulting fusion proteins were named Hsp60(1-25)-CAT, Hsp60(136)-CAT, Hsp60(1-54)-CAT, Hsp60(1-62)CAT and Hsp60(37-62)-CAT, respectively. All plasmid constructs were checked for the accuracy of nucleotide contents by sequencing.
2.6. Transfection and selection of T. gondii stable transformants Plasmid constructs were isolated using the Qiagen standard protocol. Purified tachyzoites (107 parasites) were mixed with 50 mg circular DNA and transfected using BTX ECM 600 electroporator as previously described [16]. Transfected parasites were inoculated onto confluent monolayers of HFF in 12-mm glass coverslips for immunofluorescence assays. For stable transformants, 50 mg of linearized Hsp60(1-54)-CAT plasmid by Asp 718 were electroporated in 2 × 107 tachyzoites of T. gondii (the 76K strain). The parasites were transferred back to HFF after electroporation and 28 h later, they were selected with 20 mM chloramphenicol [17]. After 4 weeks, the chloramphenicol-resistant parasites were cloned and one clone was used for further analysis.
2.7. Indirect immunofluorescence assay and electron microscopy Transfected or untransfected parasites were grown on HFF for 24 h. Cells were fixed in 4% formaldehyde for 30 min and processed for IFA according to the method previously described [13].
For electron microscopy, the resuspended pellets were directly fixed in 2.5% glutaraldehyde-0.1 M sodium cacodylate (pH 7.2), dehydrated in graded ethanol solutions, and embedded in Epon. Serial thin sections were made and after staining in 2% uranyl acetate, the preparations were observed on a Hitachi H-600 electron microscope.
2.8. Isolation and purification of mitochondria Mitochondria of T. gondii were purified with a subfractionation method using 5 × 108 PS4-CAT stable transformants according to a method previously described by Leriche and Dubremetz [18]. Four fractions were collected, diluted to a final concentration of 1 M sucrose and centrifuged at 190 000 × g for 1 h using a SW40 rotor. Pellets were collected in TES and processed for Western blotting analysis.
2.9. In 6itro transformation of encysted bradyzoites into tachyzoites Hundred thousand of encysted bradyzoites, were inoculated onto a confluent monolayer of HFF. Kinetics of HSP60 protein expression was followed by IFA after 3, l8 and 42 h post-infection using anti-HSP60 serum (1:10). Monoclonal antibodies specific, to the tachyzoite surface protein SAG1 or to the bradyzoite specific protein P21 were used as controls.
3. Results
3.1. Cloning of the full-length HSP60 cDNAs of T. gondii and protein sequence analyses We have previously cloned a 411 bp cDNA displaying 75%, protein sequence identity with Plasmodium falciparum HSP60 [13]. This novel cDNA clone has no homology to any of the expressed sequence tags (EST) reported recently for the two developmental stages, tachyzoite and bradyzoite of T. gondii [19,20]. We have designed a set of oligonucleotide primers which allowed the generation of 5% and 3% ends through RACE PCR. Four identical clones containing 1992 nucleotides,
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
were isolated for the 3% end DNA fragment. However, two DNA fragments consisting of 587 bp (cDNA1) and 599 bp (cDNA2) with a 180 nucleotide-totally-divergent sequence at the 5% end were obtained in 5% RACE experiments. The relative numbers of 5% RACE clones coding for cDNA1 and cDNA2 were estimated at 5:1. The data were consistent with the presence of two distinct cDNAs potentially encoding the HSP60 protein of T. gondii. This was confirmed when two oligonucleotide primers designed within the divergent sequence were separately used in combination with one common primer chosen in the 3% end sequence. Two cDNAs of 2430 and 2442 bp (designated cDNA1 and cDNA2) were amplified by PCR, respectively. Their complete nucleotide sequences confirmed the existence of two potentially encoding cDNAs in T. gondii. The two cDNAs showed 93% identity at the nucleotide level and confirmed the presence of the 5% end divergent region. While the cDNA1 sequence can be translated to a full-length ORF, cDNA2 lacks an initiator ATG codon. Instead, a stop codon preceding a putative ATG codon is found. We cannot find in cDNA2 an alternative start codon anywhere else in a predicted ORF with similar length to that of other HSP60 proteins. Only the cDNAl nucleotide sequence had a 1725-bp ORF which encodes a 575 amino acid polypeptide encompassing the entire HSP60 protein with a predicted molecular mass of 60 kDa. An amino acid sequence alignment of T. gondii HSP60 and other HSP60 sequences is shown in Fig. 1. A high degree of sequence identity with that of another apicomplexan parasite P. falciparum (67.65%) is observed. Human HSP60 display 54.97% sequence identity with T. gondii HSP60. Several structural motifs that are characteristic of HSP60 proteins are also present in T. gondii HSP60, including the signature peptide known as ATP-binding site (boxed amino acid residues in Fig. 1). The carboxyl terminus of the T. gondii HSP60 contains the highly conserved repeat GGM motif (GGMxxGGMxGGMGGM, bold sequence in Fig. 1) found at the carboxy termini of all other HSP60 and GroEL proteins [7,21,22]. Like other eukaryotic HSP60 proteins, a putative mitochondrial targeting signal containing
323
Fig. 1. Alignment of the amino acid sequences of Toxoplasma gondii, Plasmodium falciparum and Homo sapiens HSP60. (*), identical amino acids; ( ), conserved residues. The number of amino acids in each HSP60 and the percentage of similarity to HSP60 of T. gondii are indicated. The GGM repeat motif present at the C-terminus and the putative mitochondrial targeting sequence of T. gondii and those of the HSP60s illustrated are shown in bold type. The ATP-binding motif is boxed.
324
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
Fig. 2. (A) Southern gel analysis was performed by using DNA from T. gondii (strain 76K) or from uninfected fibroblast cells digested with different restriction enzymes. The blot was hybridized with a 315-bp DNA probe corresponding to nucleotides 326–641 of T. gondii HSP60 cDNA. (B) Gene structure of T. gondii HSP60 and its comparison to cDNA1 and cDNA2. Boxes correspond to exons deduced from cDNA sequences. The exon 1 only found in cDNA1 will be connected to exon 2 by splicing the intron between these two exons. The unspliced exon 2 is only found in cDNA2 which lack exon 1. The start codon is indicated by the arrow and stop codons are marked with asterisks. The restriction enzyme sites are indicated.
Arg, Lys and His residues is found in the N-terminal extension (25 amino acids) of T. gondii HSP60 (bold sequence in Fig. 1).
3.2. HSP60 gene organization in T. gondii genome When Southern blots of restriction enzyme digests of T. gondii DNA were probed with a 460bp DNA fragment common to both cDNA1 and cDNA2 under conditions of high stringency, a simple pattern of hybridizing fragments was observed (Fig. 2A). One band was seen mostly and only two fragments were obtained as expected for restriction enzyme cutting once within the HSP60 sequence (Fig. 2A, lane BamHI/A6aII). Thus, it is likely that the HSP60 gene occurs as a single copy in the T. gondii genome. A genomic library of T. gondii (strain PLK) was screened with a probe prepared from the 1458-bp DNA fragment common to cDNA1 and cDNA2. A 15-kb DNA insert that contained the HSP60 coding region was isolated. From this, an
EcoRV-fragment of approximately 4 Kb was subcloned in the Bluescript SK + plasmid and sequenced. Comparison of cDNA and genomic DNA nucleotide sequences revealed five introns of 422, 707, 227, 401 and 250 bp, respectively (Fig. 2B). These introns contained the typical GT/AG consensus splicing signal. We found that excision of the introns from the primary transcript resulted in two mature HSP60 mRNAs corresponding to cDNA1 and cDNA2, respectively. This result established that cDNA1 and cDNA2 clones amplified by PCR are truly transcribed from the single-copy HSP60 gene identified in this study (Fig. 2B). In addition, the genomic sequence confirms the lack of an initiator codon in cDNA2 and the presence of the stop codons.
3.3. Both a classical N-terminal presequence and its adjacent peptide are required for mitochondrial targeting of HSP60 in T. gondii We have produced deletions in the sequence encoding the 62 N-terminal residues. These in-
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
clude 5% (PS2) and 3% (PS1, PS3 and PS4) deletions of the N-terminal 62 amino acids of the HSP60 protein. We included a positive control consisting of the whole N-terminal 62 amino acid sequence (PS5) (Fig. 3A). These mitochondrial targeting presequences were fused to the chloramphenicol acetyl transferase (CAT) gene in the TUB7 /CAT T. gondii expression vector (Fig. 3B). In parasites transiently transfected, all five constructs displayed CAT activity with a level comparable to the parental plasmid, suggesting that the insertion of these presequences does not abolish the transcriptional activity of the tubulin promoter of the TUB7 /CAT plasmid. To assess the location of CAT, immunofluorescence assays (IFA) were performed on transfected tachyzoites grown in HFF cells using a rabbit CAT antiserum. We found that only PS4, and PS5 constructs consisting of 54 and 62 amino acids respectively, were capable of targeting the CAT reporter to the mitochondrion of T. gondii tachyzoites (Fig. 4, panels G – H and I – J). In contrast, the IFA staining obtained after transfection of the other three constructs PS1, PS2 or PS3-CAT appeared as a diffuse signal throughout
325
the cytosol of parasites (panel A–F). However, the CAT signal is more intensely distributed at the apical extremity of the parasites for the PS1 and PS2 constructs which correspond to 25 and 36 amino acids of the N-terminus of HSP60 (panel B and F). PS2 (containing the 25 amino acids from the mature part of the protein) however gave a more diffuse signal throughout the entire cytosol (Fig. 4, panel D). Identical cytoplasmic localization was observed when the initial TUB7 /CAT construct alone was transfected in the parasites.
3.4. Localization of the CAT reporter and HSP60 in T. gondii mitochondria Several attempts to localize HSP60 and CAT by immuno-electron microscopy were unsuccessful. As alternative approach, we have examined the localization of the CAT reporter using a cell fractionation method relying on stably transformed tachyzoites obtained after transfection of the PS4 plasmid. Parasite extracts obtained from tachyzoites stably transformed with PS4-CAT were separated on discontinous sucrose gradients (Fig. 5, panel A). Electron microscopy showed
Fig. 3. Chloramphenicol acetyl transferase (CAT) derived constructs used for import experiments. (A) N-terminal extension (62 amino acids) of HSP60 protein (WT) contains positively charged amino acids Arg, His and Lys as expected for mitochondrial presequence. Four plasmid constructs named Hsp60(37-62)-CAT or PS2, Hsp60(1-25)-CAT or PS1, Hsp60(1-36)-CAT or PS3 and Hsp60(1-54)-CAT or PS4 were generated after deletion at the 3% or 5% nucleotide ends of region shown in (A). The whole N-terminal 62 amino acid sequence (Hsp60(1-62)-CAT or PS5) was also used as control. (B) The targeting constructs were achieved by cloning the fragments DNA generated by PCR between tubulin promoter (70 bp) and CAT reporter (600 bp) of a T. gondii transfection vector which is also composed of SAG1 3% UTR (300 bp).
326
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
transformed tachyzoites. The IFA of the CAT signal is shown in panel B (Fig. 6) and appears in the mitochondria of stably transformed tachyzoites. The contrast phase microscopy of intracellular parasites illustrated is shown in panel A. The IF pattern of CAT is identical to the signal of the anti-HSP60 serum (panel C) directed against the recombinant HSP60 protein of T. gondii (see details in Section 2). Panel D demonstrates the co-localization of the IF signals due to the CAT reporter (panel B) and that of endogenous HSP60 (panel C).
3.5. Comparati6e analysis of HSP60 transcripts, in the two de6elopmental stages of T. gondii
Fig. 4. In vivo import of CAT reporter into the mitochondrion of T. gondii. Immunofluorescence of transiently transfected tachyzoites with PS1 (panel B), PS2 (panel D), PS3 (panel F), PS4 (panel H) and PS5 (panel J). The intracellular tachyzoites used for IFA are evidenced by the phase constrast pictures shown in panels A, C, E, G and I. Note the labelling of the apical extremity for PS1 and PS3 while the entire cytosol was stained when PS2 was used. PS4 and PS5 plasmids gave a typical mitochondrial labelling pattern of T. gondii (panel H and J). Bar = 10 mm.
that T. gondii mitochondria was found predominantly in fraction b (panel C) while fraction c was enriched mostly in membrane ghosts (panel D). The different fractions were immunoblotted with anti-CAT antibodies (panel B). A clear enrichment of CAT reporter was observed in the mitochondria-enriched fraction b (1.4 – 1.6 M interface), demonstrating the localization of CAT in the mitochondria of T. gondii tachyzoites. In addition to this, we used double immunofluorescence assays to co-localize the CAT reporter and the endogenous HSP60 in the stably
We further investigated the presence of HSP60 mRNA level in the rapidly growing virulent tachyzoites and in the slowly replicating encysted bradyzoites. To this end, RT-PCRs were performed because there were limitations in obtaining sufficient cysts in vivo for Northern blots. To ensure that equal quantities of each mRNA were being compared, the actin and tubulin genes were used as controls (Fig. 7A and B). Based on the nearly constant level of actin mRNA amplified in 10 000 equivalent parasites, we noticed that both mRNAs transcribed from the HSP60 gene are clearly detected in the tachyzoite and bradyzoite forms of T. gondii (Fig. 7A). Even if both mRNAs transcribed from the HSP60 gene are clearly detected in the tachyzoite and bradyzoite forms of T. gondii, a semi-quantitative RT-PCR reveals that their level of expression are increased in encysted bradyzoites (Fig. 7B). The levels of the two HSP60 mRNAs, mRNA1 and mRNA2, were estimated to be sixfold and 25-fold higher respectively, in encysted bradyzoites when compared to tachyzoites. Collectively, our results indicate that HSP60 gene is over-expressed at the transcriptional level in the in-vivo cysts of T. gondii
3.6. De6elopmental expression of the chaperone HSP60 required for mitochondrial functions in T. gondii Before investigating the expression of HSP60 protein in T. gondii we checked that equal cell
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
Fig. 5. (A) Mitochondria were isolated from stably transformed PS4-CAT tachyzoites by loading disrupted parasites on a discontinuous sucrose gradient. Four fractions (a, b, c, and d) enriched with different parasite organelles were obtained after ultracentrifugation. (B) These fractions were separated by SDS-PAGE. Western blot analysis using anti-CAT serum shows that the CAT reporter localized in fraction b enriched in T. gondii mitochondria. Total protein lysates from tachyzoites of PS4-CAT transformants (lane 1), the T. gondii wild type tachyzoites (lane 2) and uninfected HFF (lane 3) were used as controls. (C and D) Ultrastructural images showing the purified mitochondria recovered in fraction b (sucrose gradient interface between 1.4–1.6 M) and the fraction c. Insert represents 2-fold magnification of T. gondii mitochondrion.
327
numbers of the two developmental stages, tachyzoites and bradyzoites were being compared. This was demonstrated through Western blots using monoclonal antibodies directed against actin (Fig. 8A, panel actin). We further checked the expression patterns of stage specific proteins. The tachyzoite specific protein SAG1 (Fig. 8B, panel P30 or SAG1) and the two bradyzoite specific proteins P21 and P36 (Fig. 8B, panels P36 and P21) were monitored through the use of monoclonal antibodies. Western blots relying on polyclonal antibodies raised against the recombinant HSP60 revealed the presence of the 60 kDa protein in both tachyzoite and bradyzoite stages (Fig. 8B, panel HSP60, black and grew arrows). The level of the HSP60 protein in bradyzoites was approximately two-fold higher than that of tachyzoites. However, two proteins of 56 kDa (white stars), 25–28 kDa and high molecular mass bands were also detected in the bradyzoites. These high molecular mass bands and the other cross-reacting proteins were also found when the secondary conjugated antibodies were used alone, suggesting that they represent contaminating immunoglobulins (heavy and light chains) or other proteins from infected mice brain. Thus, the 25–28 kDa proteins were absent from the blots corresponding to P30 (SAG1), P36 and P21 (Fig. 8B) because the protein lysates were analyzed in polyacrylamide gel electrophoresis under nonreducing conditions, preventing dissociation of the Ig chains. It should be noted that our monoclonal antibodies specific to SAG1, P36 and P21 only recognize the respective non-reduced forms. The HSP60 panel corresponds to an SDS-PAGE which was performed under reduced conditions. As controls, the antiTgHSP60 serum reacted specifically either to the recombinant HSP60 protein in total proteins lysate prepared from the transformed E. coli (Fig. 8D, compare lane 1 and 2) or to the purified recombinant HSP60 (Fig. 8C, lane rHSP60). Importantly, the specificity of the anti-TgHSP60 was demonstrated by the lack of cross-reactivity against proteins from both uninfected human fibroblast (Fig. 8C, lane H) and murine cells (Fig. 8C, lane M). In addition, the anti-TgHSP60 does not cross-react to the host cell mitochondria in
328
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
against the recombinant HSP60 protein and of monoclonal antibodies directed against stage-specific proteins. To do this, the bradyzoites released after pepsin digestion were inoculated onto fibroblast monolayer cells. The IFA pattern of the mitochondrial HSP60 as detected in tachyzoites remained absent 3 h post-infection from encysted bradyzoites inoculated in culture (Fig. 9, panel B).
Fig. 6. Co-localization of endogenous HSP60 and CAT. Stable transfectants were obtained after PS4-CAT electroporation into T. gondii tachyzoites. The intracellular tachyzoites used for IFA were evidenced by the phase constrast pictures displayed in panel A. Panel B shows the IF staining of mitochondria of stably transformed parasites using the anti-CAT serum. Panel C, immunofluorescence pattern of the anti-HSP60 serum on the same parasites using double IF assays. Panel D, co-localization of IF signals of endogenous HSP60 (shown in panel C) and that of CAT reporter targeted into the mitochondria (panel B). Bar = 10 mm.
the IFA experiments where intracellular tachyzoites (inside HFF cells) were used (Fig. 6 and Fig. 9). Altogether, our data indicate that a polyclonal antiserum specific to the T. gondii mitochondrial HSP60 was generated. We conclude that despite the increased mRNA level in encysted bradyzoites, the 60-kDa protein corresponding to HSP60 is detected in both virulent tachyzoites and dormant encysted bradyzoites.
3.7. The polyclonal antibodies specific to HSP60 protein identified two 6esicular bodies in bradyzoites instead of the classical tubular mitochondrial pattern As discussed above, strong evidence suggests that the HSP60 protein can be detected in both tachyzoites and bradyzoites. In order to check if the 60-kDa protein detected in total extract of bradyzoites by Western blot is also located in the mitochondrion as seen for tachyzoites, we examined the spatial localization of HSP60 through the use of both polyclonal antibodies generated
Fig. 7. Comparative analysis of the HSP60 mRNA level in the two developmental stages of T. gondii. (A) Results of RT-PCR with primers to the full-length ORF of T. gondii HSP60 by using total RNA from tachyzoites and in-vivo encysted bradyzoites (104 parasites of each stage). The actin primers, RNA from uninfected human fibroblasts (HFF cells) or mice (Murine cells) were used as controls. (B) Overexpression of HSP60 gene in encysted bradyzoites was confirmed by using semiquantitative RT-PCR performed with ten-fold serial dilutions of tachyzoite and bradyzoite cDNAs. The a-tubulin primers were used as controls.
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
329
Fig. 8. Developmental expression of HSP60 protein in T. gondii. Total proteins from either 1.5 × 106 tachyzoites (lane T) or 2 × 102 cysts isolated from the brain of infected mice (lane B) were assayed for HSP60 expression by Western blots. Western blots were incubated either with the monoclonal antibodies specific to the actin (panel A, actin), the tachyzoite-specific surface protein (panel B, SAG1), the bradyzoite-specific proteins (panel B, P21 and P36) or with the polyclonal antibodies against the HSP60 (panel B, HSP60). Black and grey arrows indicate the 60-kDa protein corresponding to HSP60 in tachyzoite and bradyzoite, respectively. Panel C corresponds to the reactivity of anti-TgHSP60 serum against total protein extracts from uninfected human fibroblasts (lane H), uninfected murine cells (lane M) and purified recombinant HSP60 (lane rHSP60). Panel D shows the total protein extract of the transformed E. coli expressing the recombinant HSP60 (lane 1) which was probed with the anti-TgHSP60 serum (lane 2).
However, the antibodies recognized two vesicles beneath the bradyzoite nucleus. This result suggests that the HSP60 protein is not located within the bradyzoite mitochondrion. The parasites examined 3 h post-infection still expressed the bradyzoite-specific protein P21 (panel D) but not the tachyzoite specific protein SAG1 (panel F). Some parasites displayed expression of the HSP60 signal 18 h post-infection. This signal was localized within the mitochondrion (panel H) while the remaining parasites still showed the vesicular pattern found in bradyzoites (panel H). The pattern of HSP60 staining in the mitochondrion did not appear to coincide with the expression of the tachyzoite-specific surface antigen SAG1 (panel L) while the parasites still expressed the bradyzoite-specific protein, P21 (panel J). Once reinitiated, HSP60 staining accumulates and persists during the replication and growth of parasites tested 42 h post-infection (panel N), while the signal of the bradyzoite-specific protein P21 is restricted to few spots (panel P). Conversely, the tachyzoite-specific protein SAG1 is now de-
tectable (panel R). These data establish that the mitochondrial pattern of HSP60 reappears and becomes detectable earlier than the tachyzoite marker protein SAG1 and before the complete disappearance of the bradyzoite-specific protein P21. This suggests that mitochondria of encysted bradyzoites may acquire the ability to import the chaperone HSP60 protein as soon as they are committed to switch back to rapidly dividing tachyzoites.
4. Discussion In the present study, we demonstrate that a gene encoding HSP60, a chaperone that was demonstrated in several eukaryotes [7–10] to be essential for folding and assembly of mitochondrial oligomeric proteins, is selectively expressed during the intracellular development of T. gondii. We investigated different aspects of the organization and expression of the T. gondii HSP60 gene. It contains five introns and the splicing of these
330
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
introns produces two distinct mRNAs which were initially identified as two homologous cDNAs having two divergent 5% end region of approximately 180 nucleotides. Interestingly, only one cDNA (cDNA1) possesses a full-length open reading frame of 1725 bp. The full-length ORF of cDNA1 encodes a 60-kDa polypeptide. The size and structural properties including the presence of N-terminal targeting presequence and COOH-terminal repeat GGM motifs suggest that the 60kDa protein of T. gondii presented here is a member of the mitochondrial HSP60 chaperone family. In addition to this, immunolocalization experiments performed with antibodies raised against recombinant fusion proteins prove that the cDNA1 protein product is indeed located in the unique mitochondrion of the parasite. The amino-terminal extension including the putative mitochondrial import signal of 22 amino acids and a peptide of the mature part (32 amino acids) of HSP60 protein the T. gondii is clearly important for mitochondrial targeting in vivo. It should be noted that strong evidence indicates that the cleavable pre-sequence of several mitochondrial precursor proteins is sufficient to direct an attached polypeptide into the mitochondrial matrix
[23,24]. For example, the first twelve amino acids of a yeast mitochondrial outer membrane protein carries sufficient information to direct a nuclearencoded cytochrome oxidase subunit to the mitochondrial inner membrane [25]. It appears to us that the putative mitochondrial presequence of 22 amino acids is not capable to alone target the CAT reporter into the T. gondii mitochondria in vivo and, a contribution of the mature protein sequence is required. This is in good agreement with earlier in vitro studies which have shown that part of the mature protein plays a role in the specific binding of some preproteins to the mitochondrial import receptors [26,27]. To our knowledge, our results provide the first experimental evidence for the requirement of both N-terminal presequence and peptide tail on the mature protein for mitochondrial import in vivo. It is interesting to note that the existence of HSP60 and the import of CAT reporter into mitochondria of intracellular tachyzoites using its mitochondrial targeting signal, do indeed support that the tachyzoite mitochondrion maintains a membrane potential, as described by others [28,29]. Little is known about the physiological function of the unique T. gondii mitochondrion. Based on
Fig. 9. Phase-contrast microscopy (panels A, C, E, G, I, K, M, O and Q) and immunofluorescence of encysted bradyzoites inoculated onto a confluent HFF monolayer. IFA were performed after 3, 18 and 42 h post-inoculation using the polyclonal antibodies directed against HSP60 (panels B, H and N), the monoclonal antibodies directed against the bradyzoite-specific protein P21 (panels D, J and P) or the monoclonal antibodies directed against the tachyzoite-specific protein SAG1 (panels F, L and R). Bar = 10 mm.
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
the molecular mechanisms of mitochondrial protein import reported to date, it appears that electrochemical gradient should exist in the mitochondria of intracellular tachyzoites if only, because it is required for import of both fusion protein pHSP60-CAT and endogenous HSP60 into mitochondria of T. gondii. In addition, our results indicate that HSP60 is constitutively expressed in the tachyzoite and fully differentiated bradyzoite stages. Despite that mRNA levels are simultaneously increased in bradyzoites, the HSP60 protein could be detected in both tachyzoites and bradyzoites. However, the HSP60 protein appears to be targeted in two vesicular bodies distinct from the mitochondrion of the encysted bradyzoites. Because the polyclonal antibodies used here recognized the classical mitochondrial pattern in tachyzoites, these latter finding suggests that the HSP60 protein is not located in the mitochondrion of the encysted bradyzoites but within two unknown vesicles. It should be mentioned that the ultrastructural morphology of mitochondrion in the encysted bradyzoite seems to be similar to that of tachyzoite (Dubremetz JF, personal communication, and our unpublished observations). The precise nature of these two vesicles remains to be determined because our polyclonal antibodies unfortunately do not work in immuno-electron microscopy. Nevertheless, the identification of other organelles bearing the HSP60 protein suggests that the mitochondria of encysted bradyzoites may not be capable of importing this chaperone because of a probable lack of the mitochondrial membrane potential. Because HSP60 is likely to condition all functional mitochondria, these results suggest that active import and proper assembly of multimeric proteins take place only in the mitochondria of the tachyzoite forms. Thus, active mitochondria may not be required at the encysted bradyzoite stage of T. gondii. Others have reported the absence of essential enzymes of the TCA cycle in bradyzoites [30]. The absence of HSP60 in mitochondria, of encysted bradyzoites, that we now describe greatly expands this observation. These observations provide an elegant explanation for the increase of numerous bradyzoite-specific glycolytic enzymes [31,32]. Indeed this increase is
331
expected as an adaptive response to maintain a suitable ATP pool in conditions where respiration is blocked. We believe that the molecular characterizations reported here confirm HSP60 as a physiologically relevant target of studies aimed at understanding mitochondrial biogenesis and its function in growth and development of the various stages of T. gondii. Acknowledgements We would like to thank Dr. Christian Slomianny for his help in preparing the figures. We thank Drs. S. Ball and J. Vamecq for critical reading of the manuscript. C. Toursel and F. Dzierszinski are recipients of predoctoral fellowships from the Ministe`re de l’Enseignement Supe´rieur et de la Recherche, the Fondation pour la Recherche Me´dicale (FRM) and the Agence Nationale pour la Recherche sur le Sida (ANRS), respectively. This work was supported by grants from the FRM, the ANRS, Ensemble contre le Sida (Sidaction), the Centre National de Recherche Scientifique (CNRS) and the Institut National de Recherche Me´dicale et Scientifique (INSERM). References [1] Sinai AP, Webster P, Joiner KA. Association of host cell endoplasmic reticulum and mitochondria with the Toxoplasma gondii parasitophorous vacuole membrane: a high affinity interaction. J Cell Sci 1997;110:2117 – 28. [2] Tanabe K, Murakami K. Reduction in the mitochondrial membrane potential of Toxoplasma gondii after invasion of host cells. J Cell Sci 1984;70:73 – 81. [3] Araujo FG, Huskinson J, Remington JS. Remarkable in 6itro and in 6i6o activities of the hydroxynaphtoquinone 566C80 against tachyzoites and tissue cysts of Toxoplasma gondii. Antimicrob Agents Chemother 1991;35:293 – 9. [4] Araujo FG, Huskinson-Mark J, Gutteridge WE, Remington JS. In 6itro and in 6i6o activities of the hydroxynaphtoquinone 566C80 against the cyst form of Toxoplasma gondii. Antimicrob Agents Chemother 1992;36:326 – 30. [5] Bohne W, Heesemann J, Gross U. Reduced replication of Toxoplasma gondii is necessary for induction of bradyzoite-specific antigens: a possible role for nitric oxide in triggering stage conversion. Infect Immun 1994;62:1761 – 7.
332
C. Toursel et al. / Molecular and Biochemical Parasitology 111 (2000) 319–332
[6] Tomavo S, Boothroyd JC. Interconnection between organellar functions, development and drug resistance in the protozoan parasite, Toxoplasma gondii. Int J Parasitol 1995;25:1293 – 9. [7] Hemmingsen SM, Woolford C, van der Vies SM, et al. Homologous plant and bacterial proteins chaperone oligomeric protein assembly. Nature 1988;333:330–4. [8] Cheng MY, Hartl UF, Martin J, et al. Mitochondrial heat-shock protein Hsp60 is essential for assembly of proteins imported into yeast mitochondria. Nature 1989;337:620 – 5. [9] Georgopoulos C, Welch WJ. Role of the major heat shock proteins as molecular chaperones. Annu Rev Cell Biol 1993;9:601 – 34. [10] Bukau B, Horwich AL. The Hsp70 and Hsp60 chaperone machines. Cell 1998;92:351–66. [11] Attardi G, Schatz G. Biogenesis of mitochondria. Ann Rev Cell Biol 1988;4:289–333. [12] Tomavo S, Fortier B, Soete M, Ansel C, Camus D, Dubremetz JF. Characterization of bradyzoite-specific antigens of Toxoplasma gondii. Infect Immun 1991;59:3750 – 3. [13] Yahiaoui B, Dzierszinski F, Bernigaud A, Slomianny C, Camus D, Tomavo S. Isolation and characterization of a subtractive library enriched for developmentally regulated transcripts expressed during encystation of Toxoplasma gondii. Mol Biochem Parasitol 1999;99:223–35. [14] Nagel SD, Boothroyd JC. The a- and b-tubulins of Toxoplasma gondii are encoded by single copy genes containing multiple introns. Mol Biochem Parasitol 1988;29:261 – 73. [15] Dobrowolski JM, Sibley LD. Toxoplasma invasion of mammalian cells is powered by the actin cytoskeleton of the parasite. Cell 1996;84:933–9. [16] Soldati D, Boothroyd JC. Transient transfection and expression in the obligate intracellular parasite Toxoplasm gondii. Science 1993;260:349–52. [17] Kim K, Soldati D, Boothroyd JC. Gene replacement in Toxoplasma gondii with chlormaphenicol acetyltransferase as selectable marker. Science 1993;262:911–4. [18] Leriche MA, Dubremetz JF. Characterization of the protein contents of rhoptries and dense granules of Toxoplasma gondii tachyzoites by subcellular fractionation and monoclonal antibodies. Mol Biochem Parasitol 1991;45:249 – 60. [19] Ajioka J, Boothroyd JC, Brunk BP, et al. Gene discovery by EST sequencing in Toxoplasma gondii reveals sequences restricted to the Apicomplexa. Genome Res 1998;8:18 – 28.
.
[20] Manger ID, Hehl A, Parmley S, et al. Expressed sequence tag analysis of the bradyzoite stage of Toxoplasma gondii: identification of developmentally regulated genes. Infect Immun 1998;66:1632 – 7. [21] Syin C, Goldman ND. Cloning of a Plasmodium falciparum gene related to the human 60-kDa heat shock protein. Mol Biochem Parasitol 1996;79:13 – 9. [22] Tsugeki R, Mori H, Nishimura M. Purification, cDNA cloning and Northern-blot analysis of mitochondrial chaperonin 60 from pumpkin cotyledons. Eur J Biochem 1992;209:453 – 8. [23] Neupert W. Protein import into mitochondria. Annu Rev Biochem 1997;66:863 – 917. [24] Pfanner N, Craig EA, Ho¨nlinger A. Mitochondrial preprotein translocase. Annu Rev Cell Dev Biol 1997;13:25 – 51. [25] Hurt EC, Mu¨ller U, Schatz G. The first twelve amino acids of a yeast mitochondrial outer membrane protein can direct a nuclear-encoded cytochrome oxidase subunit to the mitochondrial inner membrane. EMBO J 1985;4:3509 – 18. [26] Pfanner N, Mu¨ller HK, Harmey MA, Neupert W. Mitochondrial protein import: involvement of the mature part of a cleavable precursor protein in the binding to receptor sites. EMBO J 1987;6:3449 – 54. [27] Brix J, Ru¨diger S, Bukau B, Schneider-Mergener J, Pfanner N. Distribution of binding sequences for the mitochondrial import receptors Tom20, Tom22, and Tom70 in a presequence-carrying preprotein and a non-cleavable preprotein. J Biol Chem 1999;274:16522– 30. [28] Vercesi AE, Rodrigues CO, Uyemura SA, Zhong L, Moreno SN. Respiration and oxidative phosphorylation in the apicomplexan parasite Toxoplasma gondii. J Biol Chem 1998;273:31040– 7. [29] Melo EJ, Attias M, De Souza W. The single mitochondrion of tachyzoites of Toxoplasma gondii. J Struct Biol 2000;130:27 – 33. [30] Denton H, Roberts CW, Alexander J, Thong KW, Coombs GH. Enzymes of energy metabolism in the bradyzoites and tachyzoites of Toxoplasma gondii. FEMS Microbiol Lett 1996;137:103 – 8. [31] Yang S, Parmley SF. Toxoplasma gondii expresses two distinct lactate dehydrogenase homologous genes during its life cycle in intermediate hosts. Gene 1997;184:1 – 12. [32] Dzierszinski F, Popescu O, Toursel C, Slommiany C, Yahiaoui B, Tomavo S. The protozoan parasite Toxoplasma gondii expresses two functional plant-like glycolytic enzymes: implications for evolutionary origin of apicomplexans. J Biol Chem 1999;274:24888– 95.