Molecular cloning, recombinant expression and characterization of GMCSF from the rhesus monkey, Macaca mulatta

Developmental and Comparative Immunology 40 (2013) 69–77

Contents lists available at SciVerse ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Molecular cloning, recombinant expression and characterization of GMCSF from the rhesus monkey, Macaca mulatta Ze Tao a,b, Hao Yang a, Dianlong Jia b, Lin Wan a, Jingqiu Cheng a, Xiaofeng Lu a,b,⇑ a b

Key Lab of Transplant Engineering and Immunology, Ministry of Health, West China Hospital, Sichuan University, Chengdu 610041, China Regenerative Medicine Research Center, West China Hospital, Sichuan University, Chengdu 610041, China

a r t i c l e

i n f o

Article history: Received 21 November 2012 Revised 7 January 2013 Accepted 7 January 2013 Available online 23 January 2013 Keywords: Granulocyte–macrophage colonystimulating factor Autoimmune disease Immunotherapy Rhesus monkey

a b s t r a c t Recent studies have found that, in addition to hematopoiesis, granulocyte–macrophage colony-stimulating factor (GMCSF) plays pivotal roles in multiple immune disorders. The gene encoding Macaca mulatta GMCSF (mmGMCSF) was cloned from stimulated peripheral blood mononuclear cells (PBMCs). Concanavalin A (Con A) and mismatched allogeneic antigen-stimulation significantly increased the production of mmGMCSF by monkey PBMCs. The gene encoding mature mmGMCSF was first expressed as a soluble fusion protein in Escherichia coli, and native mmGMCSF was further prepared by protease cleavage. The recombinant mmGMCSF induced antigen-presenting dendritic cells from monkey PBMCs, suggesting a central role of mmGMCSF in the immune system of the rhesus monkey. Although the predicted mature mmGMCSF protein differs from human GMCSF (hGMCSF) at six amino acid residues, mmGMCSF showed a strong ability to support human TF-1 cell survival. Additional co-immunoprecipitation experiments revealed that mmGMCSF cross reacts with the hGMCSF receptor (hGMCSFR). In addition, the hGMCSFneutralizing agents hGMCSFR-Fc and anti-hGMCSF antibody reduced the biological effects of mmGMCSF on TF-1 cells. These results suggest that recombinant mmGMCSF might be used for the in vitro evaluation of novel hGMCSF-neutralizing agents prior to the in vivo preclinical evaluation of these agents in the rhesus monkey model. Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction Granulocyte–macrophage colony-stimulating factor (GMCSF) is an immune modulatory cytokine produced by various cell types, including T cells, macrophages, endothelial cells, alveolar epithelial cells, fibroblasts, and some cancer cells (Shi et al., 2006; Eubank et al., 2009; Bayne et al., 2012). GM-CSF exerts biological effects by binding to a heterodimeric receptor expressed on monocytes, macrophages, granulocytes, lymphocytes, endothelial cells, and alveolar epithelial cells (Griffin et al., 1990). GMCSF is responsible for the survival, proliferation, activation, and differentiation of the macrophage and granulocyte lineages (Hercus et al., 2012). Accordingly, GMCSF was originally defined as a hemopoietic growth factor, regulating normal and malignant hematopoiesis (Burgess and Metcalf, 1980). Recombinant human GMCSF (hGMCSF) was first used in the early 1990s to restore the hematopoietic dysfunctions of patients with neutropenia and aplastic anemia (Armitage, ⇑ Corresponding author at: Key Lab of Transplant Engineering and Immunology, Ministry of Health, West China Hospital, Sichuan University, Chengdu 610041, China. Tel.: +86 28 85164031; fax: +86 28 85164034. E-mail address: [email protected] (X. Lu). 0145-305X/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.dci.2013.01.006

1998). Today, recombinant hGMCSF is widely used to accelerate the recovery of myeloid cells after chemotherapy (Gasmi et al., 2012). In addition to hematopoiesis, GMCSF has many other functions. GMCSF can act on mature myeloid cells and stimulate the hyperproduction of functionally primed effector cells, and thus might augment immune responses against malignant disease and infection (Gurion et al., 2012). GMCSF also exerts antitumor activity by stimulating tumor-educated macrophages secret soluble vascular endothelial growth factor receptor 1 (sVEGFR-1) (Eubank et al., 2009; Roda et al., 2011). The vascular endothelial growth factor (VEGF) that is produced by tumor-educated macrophages is closely linked to tumor metastasis and angiogenesis. In animal models of breast cancer and melanoma, both Eubank et al. (2009) and Roda et al. (2011) found that the intratumoral injection of GMCSF stimulates macrophages to secrete sVEGFR-1, which neutralizes VEGF and thus inhibits tumor growth. However, several recent studies have shown that GMCSF might facilitate the immune escape of many types of cancers. Tumor-derived GMCSF was found to stimulate bone marrow progenitor cells to differentiate into myeloidderived suppressor cells, which can inhibit the proliferation and anti-tumor function of effector T cells (Morales et al., 2010; Dolcetti et al., 2010; Bayne et al., 2012). In addition, Gutschalk et al.

70

Z. Tao et al. / Developmental and Comparative Immunology 40 (2013) 69–77

(2006) and Revoltella et al. (2012) found that recombinant hGMCSF could stimulate the proliferation of head and neck squamous cell carcinoma and glioma in vitro and in vivo. These results suggest the necessity of the further detailed evaluation of GMCSFbased therapy in cancer patients. GMCSF was also suggested to be a proinflammatory cytokine, playing pivotal roles in various inflammatory diseases such as rheumatoid arthritis and multiple sclerosis (McGeachy, 2011). Early studies revealed that the overexpression of GMCSF leads to sterile inflammation accompanied by the accumulation of macrophages and dendritic cells, in addition to the recruitment of CD4+ and CD8+ T cells at inflammatory sites. In contrast, these studies showed that inflammation was limited in GMCSFdeficient mice (Shi et al., 2006). In addition, it was found that professional antigen-presenting dendritic cells (DCs) could be induced from hematopoietic precursors in vitro by GMCSF alone (Conti and Gessani, 2008). Moreover, GMCSF was found to be critical for DC-promoted T cell population expansion and Th17 differentiation in vivo (King et al., 2010). It was recently observed that the GMCSF produced by Th17 cells can increase IL23 secretion from DCs and that this IL23 can further prompt Th17-mediated inflammation (Codarri et al., 2011; El-Behi et al., 2011). Accordingly, the generation and promotion of DC function by T cell-derived GMCSF has been linked to several autoimmune diseases (McGeachy, 2011). A recent study even found that GMCSF was required for the development of pain in both the inflammatory pain and arthritis experimental models (Onuora, 2012). These findings suggest that GMCSF might represent a therapeutic target, especially in these autoimmune diseases. Several GMCSF antagonists have been developed and are undergoing clinical trials for rheumatoid arthritis (Cornish et al., 2009). However, dysfunctions in GMCSF hinder the maturation of alveolar macrophages, which leads to pulmonary alveolar proteinosis (Greenhill and Kotton, 2009) and cystic fibrosis (Heslet et al., 2012). Therefore, the inhalation but not neutralization of GMCSF might be needed to treat these diseases (Ohashi et al., 2012). Taken together, these data indicate that GMCSF plays important roles in normal hematopoiesis and the pathogenesis of many immune disorders. The GMCSF gene has been identified or predicted in a wide range of animals, but only the bovine (Leong et al., 1989), mouse (Ulich et al., 1990), human (Raines et al., 1991), canine (Nash et al., 1991), rat (Oaks et al., 1995), feline (Dunham and Bruce, 2004), chicken (Chaturvedi et al., 2010), and porcine (Kwak et al., 2012) GMCSF proteins have been characterized. The close evolutionary relationship between humans and rhesus monkeys has led to the wide use of these animals in biomedical research. However, the biological activity of GMCSF might be species-specific (Leong et al., 1989). In addition, the amino acid sequences of mature hGMCSF and predicted Macaca mulatta GMCSF (mmGMCSF) differ at six discrete positions, suggesting that it is better to use mmGMCSF for pathogenesis research in the rhesus monkey model. Moreover, the cross-reaction between hGMCSF-neutralizing agents and mmGMCSF must be examined in vitro before launching in vivo experiments. Therefore, a large amount of mmGMCSF is also required for the preclinical evaluation of novel hGMCSF-neutralizing agents. In this paper, we first cloned the gene encoding mmGMCSF and detected the expression of this protein in the peripheral blood monocytes (PBMCs) of rhesus monkeys under different conditions. Subsequently, we produced the mature mmGMCSF protein in Escherichia coli and examined the biological activity of the protein in terms of cell survival and the generation of DCs. Finally, we investigated the interaction between hGMCSF-neutralizing agents and mmGMCSF.

2. Material and methods 2.1. Animals Three 2- to 3-year-old rhesus monkeys (M. mulatta) were purchased from the Pingan Primate Rearing and Research Center at Chengdu in the Sichuan province of China. All of these monkeys were captive-bred and housed in the Animal Center of the Hospital in accordance with the Guide for the Care and Use of Laboratory Animals of West China Hospital and Sichuan University. All of the animal protocols used in this study were approved by the Hospital Animal Care and Use Committee.

2.2. Gene cloning and sequence analysis To electronically clone the mmGMCSF gene, we performed a BLAST search for the genomic M. mulatta database (http:// www.ncbi.nlm.nih.gov/projects/mapview/map_search.cgi?taxid= 9544) with the gene encoding hGMCSF (Gene bank accession NM_000758.2) as a reference sequence. To obtain the full-length cDNA sequence for mmGMCSF, a pair of primers was designed from the homologous hGMCSF sequence identified in the monkey genomic database. The primers used here include: Forward: 50 AAGGATCCAGGCTAAAGTT CTCTGGAGGATGT-30 (BamHI site is underlined); Reverse: AAATGTCGACTCACTCCTGGA CTGGCTCCC (SalI site is underlined). Venous blood was collected from the monkeys into plastic tubes with 0.11 M trisodium citrate. Peripheral blood mononuclear cells (PBMCs) were isolated using the procedures described by Zhu et al. (2011). Total RNA was isolated from the freshly isolated PBMCs and the Con A-stimulated PBMCs by using RNAiso Plus (Takara, Japan) according to the manufacturer’s instructions. The first strand of cDNA was synthesized from the total RNA with the PrimeScript II RTase and Oligod(T) primers provided in the PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Japan). Platinum Pfx DNA polymerase (Invitrogen, Carlsbad, CA, USA) was used for the PCR. The PCR protocol was as follows: initial denaturation at 94 °C for 10 min, followed by 35 cycles of melting at 94 °C for 45 s, annealing at 50 °C for 1 min, and extension at 68 °C for 1 min. The PCR products were purified with a DNA-binding column and further analyzed with a DNA Sequencer. Multiple sequence alignments and phylogenies were generated by using MEGA software version 5.0 (http://www.megasoftware.net/beta/) according to the protocol described by Zhu et al. (2011). The signal peptide was predicted using programs from the ExPASy website (http://ca.expasy.org/). Sequence homology was also assessed using the BLAST program from NCBI (http:// www.ncbi.nlm.nih.gov).

2.3. Recombinant expression of mmGMCSF in E. coli It is known that small ubiquitin-like modifier (SUMO)-tags may increase the expression and solubility of fusion proteins. Moreover, interested native proteins were produced from SUMO-fusion proteins by SUMO-protease cleavage (Butt et al., 2005). A gene encoding the SUMO-mmGMCSF fusion protein, which contains the SUMO tag and mature mmGMCSF, was synthesized. BamHI and SalI restriction sites were introduced at the 50 and 30 ends of the fusion gene, respectively. The BamHI/SalI digested fusion gene was subcloned into a pET32a plasmid containing the Trx fusion tag, resulting in the construction of the pET32-Trx-SUMO-mmGMCSF expression vector. The presence of an additional 6His-tag in the pET32a plasmid allows the detection of the fusion protein with an anti-His-tag antibody.

Z. Tao et al. / Developmental and Comparative Immunology 40 (2013) 69–77

To produce the fusion protein, the pET32-Trx-SUMOmmGMCSF expression plasmid was transformed into competent E. coli BL21 Rosetta (DE3) cells. The bacteria derived from a single colony of transformed E. coli BL21 were inoculated into 5 ml LB broth and cultured overnight at 37 °C in the presence of ampicillin (100 lg/ml) and chloramphenicol (34 lg/ml). Subsequently, the culture was diluted 1:1000 with fresh LB broth containing antibiotics and again cultured at 37 °C. When the bacteria entered the log phase of growth (A600nm 0.8–1.0), 0.1 mM isopropyl-D-thiogalactoside (IPTG) was added into the culture to induce the expression of the fusion protein. After 4 h of induction at 37 °C, the cells were harvested by centrifuging at 7000g for 10 min at 4 °C. The bacterial pellets were resuspended at 5 ml/g in binding buffer (50 mM phosphate, pH 8.0, 300 mM NaCl, 20 mM imidazole, and 1 mM phenylmethylsulfonyl fluoride) and were pulse sonicated for 30 min (10 s pulse and 35 s resting on ice, 400 W). The supernatant was collected by centrifuging twice at 50,000g for 10 min at 4 °C. The fusion protein was purified with Ni-NTA resin (Genscript, Nanjing, China), which was used according to the manufacturer’s instructions. The eluted protein was collected and dialyzed against buffer (20 mM Tris–HCl, pH 8.0, 20% glycerol) overnight at 4 °C. The purified fusion protein was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) and western blotting. The protein concentrations were determined with a Bradford assay, which used bovine serum albumin (BSA) as a standard. 2.4. SUMO protease cleavage and further purification The cleavage reaction system was set up according to the manufacturer’s instructions for the CoolCutter™ SUMO protease (GeneCopoeiaInc., MD, USA). Briefly, approximately 40 lg fusion protein was digested with 8 units SUMO protease at 30 °C for 1 h. The time-dependent protein cleavage was detected by SDS–PAGE analysis. After digestion with the protease, 15 ll Ni-NTA resin was added to the digested proteins and further incubated at 4 °C for 1 h. The resin was subsequently discarded by centrifuging at 10,000g for 5 min at 4 °C. The supernatant, which contained the tag-free mmGMCSF, was collected and stored at 70 °C for further use. 2.5. SDS–PAGE and western blotting SDS–PAGE was performed according to the protocol of Laemmli (1970). Briefly, the proteins were separated on a 15% gel and visualized by coomassie brilliant blue staining. For the western blotting, the separated proteins were transferred onto a polyvinylidenedifluoride (PVDF) membrane, which was subsequently incubated with a horseradish peroxidase (HRP)-labeled antibody against the 6His-tag or an antibody against hGMCSF and the relevant secondary antibody. The chromogen-based detection reagent (Millipore, MA, USA) was used to visualize the target proteins. 2.6. Enzyme-linked immunosorbent assay An enzyme-linked immunosorbent assay (ELISA) (Dakewe, Shenzhen, China) containing an antibody against hGMCSF was used to quantify mmGMCSF. The cross reaction between this antibody and mmGMCSF was verified by western blotting. The sample (100 ll) containing mmGMCSF was added to the well and incubated for 2 h at room temperature. Subsequently, a biotinylated antibody against hGMCSF was added to the well and incubated for 60 min, after which streptavidin-HRP was added to the well and incubated for 30 min at room temperature. Finally, the reaction was stopped after the addition of tetramethylbenzidine

71

(TMB), and the absorbance at 450 nm was measured using a microplate reader. 2.7. Co-immunoprecipitation assay Approximately 25 lg mmGMCSF in 50 ll PBS was preincubated with different amounts of hGMCSFR-Fc containing the extracellular domain of hGMCSF receptor-alpha and human IgG1 Fc fragment or anti-hGMCSF antibody (Sino Biological Inc., Beijing, China) at room temperature for 1 h. Subsequently, 10 ll protein A resin was added to the mixture, which was incubated at 4 °C for another 1 h. Finally, the resin was collected by centrifuging the mixture at 3000g for 3 min. After being washed three times with 0.5 ml PBS, the resin was boiled in 50 ll SDS–PAGE loading buffer for 20 min. The mmGMCSF in the supernatant was detected by western blotting with an antibody against hGMCSF. Recombinant mmGMCSF was used as a positive control. 2.8. Measurement of mmGMCSF biological activity The human erythroleukemia cell line TF-1 is a factor-dependent cell line that was used in the mmGMCSF biological activity assay, which was performed according to the description provided by Das et al. (2011) with some modifications. Briefly, TF-1 cells were cultured in RPMI 1640 (Invitrogen, Carlsbad, CA, USA) supplemented with 2 mM L-glutamine, 10% (v/v) fetal bovine serum (FBS), 2 ng/ml hGMCSF-Fc containing hGMCSF and human IgG1 Fc fragment, 100 U/ml penicillin, and 100 lg/ml streptomycin at 37 °C with 5% CO2. For the bioactivity assay, exponentially growing cells were collected and washed three times with PBS. Subsequently, the cells were further cultured in medium containing 2.5% FBS. After overnight starvation, 5  103 cells in 100 ll medium containing 5% FBS were plated into 96-well plates and cultured for 36–48 h in presence or absence of GMCSF. To quantitatively determine the cell viability, 10 ll CCK-8 (Cell Counting Kit-8, Dojindo, shanghai, China) was added to the wells and the cells were further incubated for 4 h. The absorbance was then measured at 450 nm using a microplate reader (Bio-Rad, CA, USA). The cell viability was also analyzed by using the LIVE/DEAD BacLight bacterial viability kit (Molecular Probes, CA, USA) according to the manufacturer’s instructions. To determine the effect of hGMCSF-neutralizing agents on mmGMCSF, the bioactivity of mmGMCSF in the presence or absence of these agents was compared. Before being added to the cells, mmGMCSF was incubated with an hGMCSF-specific receptor or antibody (Sino Biological Inc., Beijing, China) for 30 min at room temperature. Subsequently, the bioactivity of the neutralized mmGMCSF was measured in TF1 cells with the CCK-8 solution. 2.9. Generation of dendritic cells from monkey peripheral blood mononuclear cells Monkey PBMCs were resuspended in RPMI 1640 containing 10% FBS, 2 mM glutamine, 100 IU/ml penicillin, and 100 lg/ml streptomycin at a density of 1  106 cells/ml. After being cultured at 37 °C for 2 h, the non-adherent cells were removed and the adherent cells were further cultured in the presence of 20 ng/ml human interleukin 4 (hIL4, Sino Biological Inc., Beijing, China) and 100 ng/ml mmGMCSF. Half of the medium was changed every two days. After being cultured for 6 days, the cells were cultured for two additional days after adding 20 ng/ml M. mulatta TNF-alpha (mmTNF-alpha) prepared by Jia et al. (2012) to the medium containing hIL4 and mmGMCSF. The morphology of the mature dendritic cells was observed under phase-contrast microscopy. The expression of major histocompatibility complex class II

72

Z. Tao et al. / Developmental and Comparative Immunology 40 (2013) 69–77

(MHC II) was detected by flow cytometry with an antibody against HLA DR (Biolegend, San Diego, CA, USA). 2.10. Lymphocyte proliferation assays Freshly isolated PBMCs were resuspended at a density of 1  106 cells/ml and were further cultured at 37 °C in a humidified atmosphere containing 5% CO2 in the presence of 10 lg/ml concanavalin A (Con A, Sigma, St. Louis, MO, USA). Freshly isolated PBMCs (2  105 cells/well) were used as the responder cells in the mixed lymphocyte reaction (MLR). The same number of PBMCs or a different number of DCs derived from mismatched allogeneic monkeys were used as the stimulator cells. Lymphocyte proliferation was determined with an overnight pulse with BrdU (Cell Proliferation ELISA, BrdU, Roche Applied Science, USA). 2.11. Statistical analysis The results are expressed as the means ± S.D. of three or more experiments. One way ANOVA was performed using SPSS software version 13.0. 3. Results 3.1. Cloning and sequence analysis of mmGMCSF The BLAST search for the monkey genomic database identified three gene fragments that are highly homologous to the fragments corresponding to nucleotides 1–191, 231–360, and 359–781 of hGMCSF. The mmGMCSF gene candidate was constructed with Vector NTI software. To obtain a full length mmGMCSF gene, two primers matching the nucleotide sequence were designed from the predicted mmGMCSF gene. A transcript amplified from Con A-stimulated monkey PBMCs revealed a 432 bp open-reading frame (ORF) encoding a 144 amino acid long polypeptide. This transcript was identical to the mmGMCSF gene fragment identified in the monkey genomic database. Moreover, this transcript was highly homologous to the hGMCSF gene. The polypeptide derived from this transcript is also highly homologous to hGMCSF. These results suggested that this amplicon was mmGMCSF. A phylogenetic analysis of the mmGMCSF sequence placed this protein within the GMCSF family (Fig. 1A). A sequence analysis suggested that the mmGMCSF precursor contains a signal peptide (1–17 aa). The mmGMCSF sequence is highly homologous to GMCSF from oliva bamboo, which contains only three different amino acid residues. The amino acid identity between mmGMCSF and hGMCSF was determined to be approximately 96%. Six amino acid residues in the mature hGMCSF, the serine (S) at position 26, the lysine (K) at position 55, the valine (V) at position 60, the serine (S) at position 71, the glycine (G) at position 85, and the glutamine (Q) at position 122, were replaced by glycine (G), glutamic acid (E), isoleucine (I), threonine (T), arginine (R) and glutamic acid (E) in mmGMCSF, respectively (Fig. 1B). 3.2. Expression of mmGMCSF in stimulated lymphocytes from the rhesus monkey RT-PCR analysis demonstrated that mmGMCSF is undetectable in freshly isolated monkey PBMCs. After stimulation with 10 lg/ ml Con A for 72 h, the PBMCs exhibited a significantly increased mmGMCSF mRNA content (Fig. 2A, left panel). An ELISA demonstrated that mmGMCSF is not detected in the medium of monkey PBMCs in the absence of Con A, whereas mmGMCSF accumulated the in medium in a time-dependent manner in the presence of Con A (Fig. 2A, middle panel). The time-dependent accumulation

of mmGMCSF in the culture medium of PBMCs was also detected in a 5 d MLR system (Fig. 2B). The increase in mmGMCSF production was consistent with the proliferation of PBMCs after stimulation with Con A (Fig. 2A, right panel) or allogeneic PBMCs (Fig. 2B, right panel). Con A and allogeneic PBMCs are known to activate T cells. These data suggest that the mmGMCSF that accumulated in the medium was predominantly produced by activated T cells. 3.3. Preparation of the Trx-SUMO-mmGMCSF fusion protein and native mmGMCSF To facilitate the soluble expression of mmGMCSF in E. coli, mmGMCSF was designed to be expressed as a fusion protein. For this purpose, the gene encoding SUMO-mmGMCSF was synthesized and subcloned into pET32a plasmid, resulting in the creation of the pET32-Trx-SUMO-mmGMCSF expression vector (Fig. 3A). The expression vector was transformed into E. coli BL21 Rosetta (DE3) cells, which provide rare codons. As shown in Fig. 3B the addition of IPTG for 4 h caused the induction and accumulation of a protein with an approximate molecular weight of 45 kD in the bacteria. Sonication demonstrated that most of the induced protein existed in the soluble bacterial fraction. After being bound by the Ni-NTA resin, the induced protein was purified to homogeneity. This protein was further identified as Trx-SUMO-mmGMCSF by western blotting with an antibody against the 6His-tag and an antibody against hGMCSF, respectively. Under these conditions, approximately 10 mg soluble protein could be recovered at 70% purity from a 1-liter culture of bacteria. To prepare native mmGMCSF, the Trx-SUMO-mmGMCSF fusion protein was cleaved by SUMO protease. As shown in Fig. 4, the single band of purified fusion protein (45 kD, Fig. 4, lane 1) was cut into two bands with molecular weights of approximately 32 and 14 kD (Fig. 4, lane 2). Based on the apparent molecular weights, these two bands corresponded to the cleaved TrxSUMO-tag (32 kD) and mmGMCSF (14 kD), respectively. After further purifying the protein with Ni-NTA resin, most of the cleaved Trx-SUMO-tag remained bound to the gel (Fig. 4, lane 3) and the native mmGMCSF remained in the supernatant (Fig. 4, lane 4). The efficient cleavage of Trx-SUMO-mmGMCSF and the purification of native mmGMCSF were further verified by western blotting with an antibody against hGMCSF (Fig. 4). 3.4. Bioactivity of the Trx-SUMO-mmGMCSF fusion protein and native mmGMCSF It is known that the factor-dependent cell line TF1 proliferates in response to hGMCSF. After overnight starvation, TF1 cells usually die within 48–72 h in absence of hGMCSF. As shown in Fig. 5A, most of the TF1 cells were stained by PI, indicating that the cells had died after being cultured for 48 h in the absence of hGMCSF-Fc. In contrast, almost all of the TF1 cells incubated in the presence of 2 ng/ml hGMCSF-Fc were stained by SYTO 9, which indicated the presence of live cells. These results indicate that TF1 is hGMCSF-dependent. Interestingly, supplementing the medium with either mmGMCSF or Trx-SUMO-mmGMCSF maintained the viability of the starved TF1 cells during the subsequent culture period. An additional dose-dependent analysis showed that mmGMCSF is similar to hGMCSF-Fc in the ability to support the growth of TF-1 cells (Fig. 5B). Trx-SUMO-mmGMCSF was less efficient than mmGMCSF in the TF1 proliferation assay, but this difference was not significant. These results demonstrate that both the mmGMCSF and Trx-SUMO-mmGMCSF produced by bacteria are effective at supporting the growth of human TF1 cells. It is known that hGMCSF can induce progenitor cells to differentiate into immature DCs in the presence of hIL4 (Conti and Gessani, 2008). To test the ability of mmGMCSF to induce DCs, progenitor

Z. Tao et al. / Developmental and Comparative Immunology 40 (2013) 69–77

73

Fig. 1. Phylogenetic tree (A) and sequence alignment (B) of mammalian GMCSF. A: The phylogenetic tree was constructed using the neighbor-joining method; the numbers at each node indicate the percentage of bootstrap replicates that produced the same branching pattern. B: Alignment of GMCSF molecules. The dots indicate those residues that are identical to the mmGMCSF sequence. The dashes indicate residues that are deleted in the indicated sequence.

cells from monkey peripheral blood were cultured in medium containing mmGMCSF and hIL4 and subsequently matured using mmTNF-alpha. After being cultured for 6 days and matured with mmTNF-alpha for 2 days, many of the cells observed exhibited the typical dendrites of mature DCs (Fig. 5C, insert). However, the cells cultured without mmGMCSF were round and lacked dendrites. Flow cytometry assays showed that these cells expressed MHC II (Fig. 5C). We further tested the antigen-presenting ability of these cells with an MLR. As shown in Fig. 5D, the cultured DCs dose-dependently stimulated the proliferation of monkey lymphocytes. These results demonstrate that the mmGMCSF produced in E. coli can induce mature DCs with antigen-presenting ability. 3.5. Inhibition of mmGMCSF bioactivity by hGMCSF-neutralizing agents Both the extracellular domains of the hGMCSF receptors and the hGMCSF antibody might neutralize hGMCSF as a result of their

high affinity. To investigate the cross-reactivity between hGMCSF-neutralizing agents and mmGMCSF, we first co-immunoprecipitated mmGMCSF and subsequently examined the ability of these hGMCSF-neutralizing agents to inhibit the mmGMCSF support of TF-1 cell growth. As shown in Fig. 6A, mmGMCSF was pulled down by hGMCSFR-Fc and the anti-hGMCSF antibody, indicating an interaction between these agents and mmGMCSF. To determine the ability of these agents to reduce the biological activity of mmGMCSF, the hGMCSFR-Fc and anti-hGMCSF antibody were preincubated with mmGMCSF at room temperature for 30 min. The biological activity of mmGMCSF inhibited by different concentrations of the hGMCSF-neutralizing agents was subsequently determined and compared. BSA and hGMCSF-Fc were used as negative control and positive control, respectively. As shown in Fig. 6B, BSA did not reduce TF1 cell viability at concentrations as high as 5 lg/ml. However, both hGMCSFR-Fc and the anti-hGMCSF antibody clearly inhibited the biological activity of hGMCSF-Fc and mmGMCSF at concentrations as low as 0.5 lg/ml. The viability of

74

Z. Tao et al. / Developmental and Comparative Immunology 40 (2013) 69–77

Fig. 2. The correlation between mmGMCSF expression and lymphocyte proliferation. A: The Con A-stimulated expression of mmGMCSF and proliferation of monkey PBMCs. Freshly isolated monkey PBMCs were cultured in the presence (+) or absence () of Con A for 72 h. mmGMCSF expression was examined by RT-PCR, which used the GAPDH reference gene as an internal control. An ELISA kit containing an antibody against hGMCSF was used to detect the mmGMCSF protein secreted into the medium. BrdU incorporation was used to monitor lymphocyte proliferation. B: The expression of mmGMCSF and proliferation of monkey PBMCs in the MLR system. Mismatched allogeneic monkey PBMCs derived from different individuals were used to establish the MLR system. The concentration of mmGMCSF protein in the medium and the extent of lymphocyte proliferation were determined by ELISA and BrdU incorporation, respectively.

the TF1 cells was reduced by 30–50% in the presence of these agents. When the concentration of these hGMCSF-neutralizing agents was increased to 5 lg/ml, the viability of the TF1 cells was reduced by approximately 70–80%. The difference between hGMCSF-Fc and mmGMCSF in interaction to these hGMCSF-neutralizing agents is not significant. These results demonstrate that the hGMCSF-specific receptor protein and antibody could react with mmGMCSF and reduce its biological activity.

4. Discussion Rhesus monkeys are widely used as animal models of pathogenesis and for drug discovery for human immune diseases (Vierboom et al., 2007). In addition, GMCSF is a key mediator of many types of immune disorders (McGeachy, 2011). Therefore, it is needed to characterize the gene encoding mmGMCSF. Here, the gene encoding mmGMCSF was cloned from rhesus monkey PBMCs and expressed in a soluble form by fusion to a Trx-SUMO tag. Native mmGMCSF was prepared by cleaving the Trx-SUMOmmGMCSF fusion protein with SUMO protease. A cellular survival test demonstrated that both Trx-SUMO-mmGMCSF and mmGMCSF show similar biological activity in human TF1 cells. Moreover, the recombinant mmGMCSF can induce DCs from rhesus monkey PBMCs. mmGMCSF expression was undetectable in resting PBMCs, but Con A stimulation and co-culture with allogeneic PBMCs significantly enhanced the expression of this protein. The increase in mmGMCSF expression is tightly linked to the pro-

liferation of lymphocytes. hGMCSF-neutralizing agents, which included the soluble receptor and monoclonal antibody, were capable of interacting with mmGMCSF and reducing its effects on TF-1 survival. Several types of cells can produce GMCSF, but it is generally accepted that GMCSF is predominantly produced by T cells upon activation (Shi et al., 2006). In our experiment, the expression of mmGMCSF was only detected in Con A-stimulated PBMCs (Fig. 2A), while the expression of mmGMCSF was undetectable in resting PBMCs. Moreover, the mmGMCSF protein was secreted into the supernatant (Fig. 2B). However, it is difficult to prepare a large amount of mmGMCSF from cultured monkey PBMCs with high purity. Recombinant hGMCSF has been successfully prepared by using E. coli (Das et al., 2011) and yeast (Gasmi et al., 2012) as a host. Therefore, we hypothesized that recombinant expression might be an alternative way to produce active mmGMCSF. Because native hGMCSF formed an inclusion body in E. coli, we first tried to express mmGMCSF by fusing the protein to the small ubiquitinlike modifier (SUMO) tag, which has been shown to improve the solubility of fusion proteins. We synthesized the fusion gene encoding SUMO-mmGMCSF and inserted the gene into the pQE30 plasmid. Unfortunately, the fusion gene was expressed at a low level, and most of the protein existed as an inclusion body (data not shown). We further inserted the SUMO-mmGMCSF gene into the pGEX-4T-1 vector, which contains a GST tag that may improve the solubility of the fusion protein. While the novel fusion protein GST-SUMO-mmGMCSF was expressed at high level, most of the protein was localized to an inclusion body (data not shown).

Z. Tao et al. / Developmental and Comparative Immunology 40 (2013) 69–77

75

Fig. 3. The recombinant expression and purification of the Trx-SUMO-mmGMCSF fusion protein. A: A schematic diagram of the pET32-Trx-SUMO-mmGMCSF expression vector. The synthesized SUMO-mmGMCSF gene was inserted into the pET32(a) plasmid at BamHI and SalI sites to construct a Trx-SUMO-mmGMCSF fusion protein with an internal 6His tag. B: SDS–PAGE and western blotting of the purified fusion protein. The expression vector was transformed into E. coli BL21 and induced by the addition of IPTG. The Trx-SUMO-mmGMCSF fusion protein was purified from the soluble fraction of the induced bacteria by Ni-NTA affinity chromatography. The purity of the fusion protein was analyzed by SDS–PAGE, and size of the protein was verified by dual western blotting with antibodies against hGMCSF and 6His-tag, respectively. M: protein markers; Lane 1: Total protein from non-induced bacteria; Lane 2: Total protein from induced bacteria. Lane 3: Proteins in the soluble fraction of induced bacteria; Lane 4: Proteins in the insoluble fraction of induced bacteria. Lane 5: Purified fusion protein. Lanes 6 and 7: The purified fusion protein, as identified by western blotting with antibody against hGMCSF (lane 6) and 6His-tag (lane 7), respectively.

Fig. 4. Preparation of native mmGMCSF. The Trx-SUMO-mmGMCSF fusion protein was first cleaved by SUMO protease. Subsequently, the remaining fusion protein, the Trx-SUMO tag, and the SUMO protease were readsorbed by Ni-NTA agarose. The supernatant, which contained native mmGMCSF, was collected and analyzed by SDS–PAGE and western blotting with an antibody against hGMCSF. M: Protein markers; Lane 1: Uncleaved fusion protein; Lane 2: Cleaved fusion protein; Lane 3: Trx-SUMO tag adsorbed on Ni-NTA agarose; Lane 4: Native mmGMCSF.

Studies have shown that large amounts of soluble hGMCSF could be prepared by fusion to the Trx tag (Das et al., 2011). Therefore, we subcloned the gene encoding SUMO-mmGMCSF into pET32(a) and produced the Trx-SUMO-mmGMCSF fusion protein. The TrxSUMO-mmGMCSF fusion protein was mainly expressed as soluble form that was purified to homogeneity with Ni-NTA agarose (Fig. 3B). SUMO-fusion proteins can be cleaved by the SUMO protease to produce native proteins. We noticed that Trx-SUMO-mmGMCSF is soluble, while the native mmGMCSF precipitated after being

cleaved from the fusion protein by SUMO protease. One possible reason for this phenomenon is that the conformation of mmGMCSF was changed drastically after release from the fusion protein. The addition of glycerol to the cleavage system effectively prevented the precipitation of native mmGMCSF (Fig. 4). Activity assays demonstrated that native mmGMCSF is similar to hGMCSF in ability to support the survival of human TF-1 cells. In addition, mmGMCSF induced functional DCs from monkey PBMCs (Fig. 4C and D) but failed to induce DCs from murine bone marrow cells (data not shown). These results suggest the species-specific character of mmGMCSF. However, mmGMCSF and hGMCSF differ at only 5 amino acid residues. This low degree of structural difference might not significantly affect the interaction between mmGMCSF and the hGMCSF receptor. Additional co-immunoprecipitation experiments verified the cross reaction between mmGMCSF and the hGMCSF receptor (Fig. 6A). Interestingly, the mmGMCSF fusion protein is similar to native mmGMCSF in the ability to support TF-1 cell survival (Fig. 5), suggesting that the fusion tag had little impact on the activity of mmGMCSF. This finding is certainly not surprising, as hGMCSF also exerts its original biological activity when fused to a wide variety of cytokines (Williams and Galipeau, 2011). GMCSF mediates many immune reactions. In our experiments, we found that the production of mmGMCSF by monkey PBMCs increased with the stimulation time in the Con A and MLR systems. Moreover, the increased secretion of mmGMCSF was accompanied by the proliferation of lymphocytes, especially T lymphocytes (Fig. 2). In addition, mmGMCSF can induce monkey DCs. Extrapolating the finding that murine GMCSF in plays a critical role in experimental autoimmune disease models (McGeachy, 2011), the mmGMCSF produced by T cells may also play a central role in

76

Z. Tao et al. / Developmental and Comparative Immunology 40 (2013) 69–77

Fig. 5. The biological function of recombinant mmGMCSF. A: TF-1 cell survival assays were performed by staining for live and dead cells. TF-1 cells were cultured in the presence or absence of GMCSF for 2 days. The cells were then dual stained with Syto 9 (green) and PI (red) and observed under a fluorescent microscope. B: TF-1 cells were cultured in the presence of native form (mmGMCSF) or fusion form (Trx-SUMO-mmGMCSF and hGMCSF-Fc) of GMCSF at indicated concentration for 2 days, after which the cell viability was examined with CCK-8 solution. The content of GMCSF in the fusion protein was quantified by ELISA with hGMCSF as a standard. C: The expression of MHC II on mmGMCSF-induced DCs. Freshly isolated monkey PBMCs were cultured in the presence of mmGMCSF and hIL4 for 6 days and subsequently matured with mmTNF-alpha for 3 days. The cells observed with phase contrast microscopy exhibited dendrites that are typical of mature DCs (mDCs, insert). The MHC II expression on these cells was examined by flow cytometry with an antibody against HLA-DR. D: The antigen presenting ability of mmGMCSF-induced DCs. The number of monkey PBMCs used as responder cells was held constant while a varying number of mmGMCSF-induced DCs were used as stimulator cells in the MLR system. BrdU incorporation was used to detect lymphocyte proliferation. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 6. mmGMCSF cross-reacts with hGMCSF-neutralizing agents. A: The co-immunoprecipitation of mmGMCSF by hGMCSF receptor protein (hGMCSFR-Fc) and an antibody against hGMCSF. Approximately 25 lg mmGMCSF was mixed with varying amounts (0–2.5 lg) of receptor protein or antibody and incubated at room temperature for 1 h. Subsequently, the protein bound to protein A resin was analyzed by western blotting with an antibody against hGMCSF. G: mmGMCSF. B: Inhibition of mmGMCSF activity by hGMCSF-neutralizing agents. mmGMCSF was mixed with hGMCSFR-Fc or the anti-hGMCSF antibody and incubated for 1 h at room temperature. The mixture was subsequently added into the TF-1 cells, and the cell viability was measured with CCK-8 solution. BSA and hGMCSF was used as negative control and positive control, respectively.

Z. Tao et al. / Developmental and Comparative Immunology 40 (2013) 69–77

the adaptive immunity of the rhesus monkey. In addition, the up regulation of hGMCSF is associated with the onset of autoimmune diseases such as rheumatoid arthritis (Kokkonen et al., 2010). Therefore, hGMCSF-neutralizing agents, including soluble receptor proteins and antibodies, might be developed as drugs for autoimmune diseases. The in vivo evaluation of novel drugs in non-human primates such as the rhesus monkey is the final preclinical trial. Therefore, it was necessary to examine the interaction between hGMCSF-neutralizing agents and mmGMCSF prior to evaluating these agents in vivo. As shown in Fig. 6B, both the hGMCSF-specific receptor and antibody dose-dependently reduced the activity of mmGMCSF, suggesting that the mmGMCSF prepared here can be used for the in vitro evaluation of hGMCSF-neutralizing agents. Taken together, these data indicate that the functional recombinant mmGMCSF produced here might be used to evaluate pathogenesis in the rhesus monkey autoimmune disease model, as well as in the preclinical evaluation of hGMCSF-neutralizing agents. Acknowledgements This project was supported by National Program for High Technology Research and Development of China 2012AA020702 (X. Lu), and Key Program for Natural Science Fund of China 30930088 (J.Q. Cheng). References Armitage, J.O., 1998. Emerging applications of recombinant human granulocyte– macrophage colony-stimulating factor. Blood 92 (12), 4491–4508. Bayne, L.J., Beatty, G.L., Jhala, N., Clark, C.E., Rhim, A.D., Stanger, B.Z., Vonderheide, R.H., 2012. Tumor-derived granulocyte–macrophage colony-stimulating factor regulates myeloid inflammation and T cell immunity in pancreatic cancer. Cancer Cell 21 (6), 822–835. Burgess, A.W., Metcalf, D., 1980. The nature and action of granulocyte–macrophage colony stimulating factors. Blood 56, 947–958. Butt, T.R., Edavettal, S.C., Hall, J.P., Mattern, M.R., 2005. SUMO fusion technology for difficult-to-express proteins. Protein Expr. Purif. 43, 1–9. Chaturvedi, U., Kalim, S., Kumar, R., Sawant, P., Tiwari, S., Khurana, S.K., Sahoo, A.P., Palia, S., Tiwari, A.K., 2010. Cloning and expression of chicken granulocyte– macrophage colony stimulating factor (GMCSF) gene. Indian J. Exp. Biol. 48 (12), 1175–1180. Codarri, L., Gyülvészi, G., Tosevski, V., Hesske, L., Fontana, A., Magnenat, L., Suter, T., Becher, B., 2011. RORct drives production of the cytokine GM-CSF in helper T cells, which is essential for the effector phase of autoimmune neuroinflammation. Nat. Immunol. 12 (6), 560–567. Conti, L., Gessani, S., 2008. GM-CSF in the generation of dendritic cells from human blood monocyte precursors: recent advances. Immunobiology 213 (9–10), 859– 870. Cornish, A.L., Campbell, I.K., McKenzie, B.S., Chatfield, S., Wicks, I.P., 2009. G-CSF and GM-CSF as therapeutic targets in rheumatoid arthritis. Nat. Rev. Rheumatol. 5 (10), 554–559. Das, K.M., Banerjee, S., Shekhar, N., Damodaran, K., Nair, R., Somani, S., Raiker, V.P., Jain, S., Padmanabhan, S., 2011. Cloning, soluble expression and purification of high yield recombinant hGMCSF in Escherichia coli. Int. J. Mol. Sci. 12 (3), 2064– 2076. Dolcetti, L., Peranzoni, E., Ugel, S., Marigo, I., Fernandez Gomez, A., Mesa, C., Geilich, M., Winkels, G., Traggiai, E., Casati, A., Grassi, F., Bronte, V., 2010. Hierarchy of immunosuppressive strength among myeloid-derived suppressor cell subsets is determined by GM-CSF. Eur. J. Immunol. 40 (1), 22–35. Dunham, S.P., Bruce, J., 2004. Isolation, expression and bioactivity of feline granulocyte–macrophage colony-stimulating factor. Gene 332, 97–106. El-Behi, M., Ciric, B., Dai, H., Yan, Y., Cullimore, M., Safavi, F., Zhang, G.X., Dittel, B.N., Rostami, A., 2011. The encephalitogenicity of Th17 cells is dependent on IL-1and IL-23-induced production of the cytokine GM-CSF. Nat. Immunol. 12 (6), 568–575. Eubank, T.D., Roberts, R.D., Khan, M., Curry, J.M., Nuovo, G.J., Kuppusamy, P., Marsh, C.B., 2009. Granulocyte macrophage colony-stimulating factor inhibits breast cancer growth and metastasis by invoking an anti-angiogenic program in tumor-educated macrophages. Cancer Res. 69 (5), 2133–2140. Gasmi, N., Lassoued, R., Ayed, A., Tréton, B., Chevret, D., Nicaud, J.M., Kallel, H., 2012. Production and characterization of human granulocyte–macrophage colonystimulating factor (hGM-CSF) expressed in the oleaginous yeast Yarrowia lipolytica. Appl. Microbiol. Biotechnol. 96 (1), 89–101.

77

Greenhill, S.R., Kotton, D.N., 2009. Pulmonary alveolar proteinosis: a bench-tobedside story of granulocyte–macrophage colony-stimulating factor dysfunction. Chest 136 (2), 571–577. Griffin, J.D., Cannistra, S.A., Sullivan, R., Demetri, G.D., Ernst, T.J., Kanakura, Y., 1990. The biology of GM-CSF: regulation of production and interaction with its receptor. Int. J. Cell Cloning 8 (Suppl. 1), 35–44, discussion 44-5. Gurion, R., Belnik-Plitman, Y., Gafter-Gvili, A., Paul, M., Vidal, L., Ben-Bassat, I., Shpilberg, O., Raanani, P., 2012. Colony-stimulating factors for prevention and treatment of infectious complications in patients with acute myelogenous leukemia. Cochrane Database Syst. Rev. 6, CD008238. Gutschalk, C.M., Herold-Mende, C.C., Fusenig, N.E., Mueller, M.M., 2006. Granulocyte colony-stimulating factor and granulocyte–macrophage colony-stimulating factor promote malignant growth of cells from head and neck squamous cell carcinomas in vivo. Cancer Res. 66 (16), 8026–8036. Hercus, T.R., Broughton, S.E., Ekert, P.G., Ramshaw, H.S., Perugini, M., Grimbaldeston, M., Woodcock, J.M., Thomas, D., Pitson, S., Hughes, T., D’Andrea, R.J., Parker, M.W., Lopez, A.F., 2012. The GM-CSF receptor family: mechanism of activation and implications for disease. Growth Factors 30 (2), 63–75. Heslet, L., Bay, C., Nepper-Christensen, S., 2012. The immunomodulatory effect of inhaled granulocyte–macrophage colony-stimulating factor in cystic fibrosis. A new treatment paradigm. J. Inflamm. Res. 5, 19–27. Jia, D., Yang, H., Wan, L., Cheng, J., Lu, X., 2012. Production of bioactive, SUMOmodified, and native-like TNF-a of the rhesus monkey, Macaca mulatta in Escherichia coli. Appl. Microbiol. Biotechnol. 93 (6), 2345–2355. King, I.L., Kroenke, M.A., Segal, B.M., 2010. GM-CSF-dependent, CD103+ dermal dendritic cells play a critical role in Th effector cell differentiation after subcutaneous immunization. J. Exp. Med. 207 (5), 953–961. Kokkonen, H., Söderström, I., Rocklöv, J., Hallmans, G., Lejon, K., RantapääDahlqvist, S., 2010. Up-regulation of cytokines and chemokines predates the onset of rheumatoid arthritis. Arthritis Rheum. 62 (2), 383–391. Kwak, S.S., Cheong, S.A., Jeon, Y., Hyun, S.H., 2012. Porcine granulocyte–macrophage colony-stimulating factor improves the in vitro development of cloned porcine embryos. J. Vet. Med. Sci. 74 (9), 1095–1102. Laemmli, U.K., 1970. Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227, 680–685. Leong, S.R., Flaggs, G.M., Lawman, M.J., Gray, P.W., 1989. Cloning and expression of the cDNA for bovine granulocyte–macrophage colony-stimulating factor. Vet. Immunol. Immunopathol. 21 (3–4), 261–278. McGeachy, M.J., 2011. GM-CSF: the secret weapon in the T(H)17 arsenal. Nat. Immunol. 12 (6), 521–522. Morales, J.K., Kmieciak, M., Knutson, K.L., Bear, H.D., Manjili, M.H., 2010. GM-CSF is one of the main breast tumor-derived soluble factors involved in the differentiation of CD11b-Gr1-bone marrow progenitor cells into myeloidderived suppressor cells. Breast Cancer Res. Treat. 123 (1), 39–49. Nash, R.A., Schuening, F., Appelbaum, F., Hammond, W.P., Boone, T., Morris, C.F., Slichter, S.J., Storb, R., 1991. Molecular cloning and in vivo evaluation of canine granulocyte–macrophage colony-stimulating factor. Blood 78 (4), 930–937. Oaks, M.K., Penwell, R.T., Suh, C.H., Tector, A.J., 1995. Polymerase chain reaction cloning and expression of the rat granulocyte–macrophage colony-stimulating factor. J. Interferon Cytokine Res. 15 (12), 1095–1102. Ohashi, K., Sato, A., Takada, T., Arai, T., Nei, T., Kasahara, Y., et al., 2012. Direct evidence that GM-CSF inhalation improves lung clearance in pulmonary alveolar proteinosis. Respir. Med. 106 (2), 284–293. Onuora, S., 2012. Pain: granulocyte–macrophage colony-stimulating factor required for inflammatory and arthritic pain. Nat. Rev. Rheumatol. 8 (9), 499. Raines, M.A., Liu, L., Quan, S.G., Joe, V., DiPersio, J.F., Golde, D.W., 1991. Identification and molecular cloning of a soluble human granulocyte–macrophage colonystimulating factor receptor. Proc. Natl. Acad. Sci. USA 88 (18), 8203–8207. Revoltella, R.P., Menicagli, M., Campani, D., 2012. Granulocyte–macrophage colonystimulating factor as an autocrine survival-growth factor in human gliomas. Cytokine 57 (3), 347–359. Roda, J.M., Sumner, L.A., Evans, R., Phillips, G.S., Marsh, C.B., Eubank, T.D., 2011. Hypoxia-inducible factor-2a regulates GM-CSF-derived soluble vascular endothelial growth factor receptor 1 production from macrophages and inhibits tumor growth and angiogenesis. J. Immunol. 187 (4), 1970–1976. Shi, Y., Liu, C.H., Roberts, A.I., Das, J., Xu, G., Ren, G., Zhang, Y., Zhang, L., Yuan, Z.R., Tan, H.S., Das, G., Devadas, S., 2006. Granulocyte–macrophage colonystimulating factor (GM-CSF) and T-cell responses: what we do and don’t know. Cell Res. 16 (2), 126–133. Ulich, T.R., del Castillo, J., McNiece, I., Watson, L., Yin, S.M., Andresen, J., 1990. Hematologic effects of recombinant murine granulocyte–macrophage colonystimulating factor on the peripheral blood and bone marrow. Am. J. Pathol. 137 (2), 369–376. Vierboom, M.P., Jonker, M., Tak, P.P., ’t Hart, B.A., 2007. Preclinical models of arthritic disease in non-human primates. Drug Discov. Today 12 (7–8), 327– 335. Williams, P., Galipeau, J., 2011. GM-CSF-based fusion cytokines as ligands for immune modulation. J. Immunol. 186 (10), 5527–5532. Zhu, S., Liu, S., Wan, L., Yang, G., Yang, H., Cheng, J., Lu, X., 2011. Molecular cloning, expression and characterization of the functional domain of CTLA4 from the rhesus monkey, Macaca mulatta. Dev. Comp. Immunol. 35 (7), 736–744.