- Email: [email protected]
Molecular cloning, sequence characteristics, and tissue expression analysis of ECE1 gene in Tibetan pig
Gene 571 (2015) 237–244
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Molecular cloning, sequence characteristics, and tissue expression analysis of ECE1 gene in Tibetan pig Yan-dong Wang a, Jian Zhang b, Chuan-hao Li a, Hai-peng Xu a, Wei Chen a, Yong-qing Zeng a,⁎, Hui Wang a,⁎ a b
College of Animal Science and Technology, Shandong Agricultural University, Tai'an, Shandong 271000, PR China Station of Animal Science and Veterinary, Gongbo'gyamda County, Linzhi, Tibet 860200, PR China
a r t i c l e
i n f o
Article history: Received 5 April 2015 Received in revised form 17 June 2015 Accepted 22 June 2015 Available online 24 June 2015 Keywords: Tibetan pig ECE1 Anti-hypoxia cDNA clone Sequence analysis Expression
a b s t r a c t Low air pressure and low oxygen partial pressure at high altitude seriously affect the survival and development of human beings and animals. ECE1 is a recently discovered gene that is involved in anti-hypoxia, but the full-length cDNA sequence has not been obtained. For a better understanding of the structure and function of the ECE1 gene and to study its effect in Tibetan pig, the cDNA of the ECE1 gene from the muscle of Tibetan pig was cloned, sequenced and characterized. The ECE1 full-length cDNA sequence consists of 2262 bp coding sequence (CDS) that encodes 753 amino acids with a molecular mass of 85,449 kD, 2 bp 5′UTR and 1507 bp 3′UTR. In addition, the phylogenetic tree analysis revealed that the Tibetan pig ECE1 has a closer genetic relationship and evolution distance with the land mammals ECE1. Furthermore, analysis by qPCR showed that the ECE1 transcript is constitutively expressed in the 10 tissues tested: the liver, subcutaneous fat, kidney, muscle, stomach, heart, brain, spleen, pancreas, and lung. These results serve as a foundation for further insight into the Tibetan pig ECE1 gene. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Nowadays, low air pressure at high altitude and low oxygen partial pressure seriously affect the survival and development of human beings and animals (Chaillou et al., 2013; Kon et al., 2014). It is vary in different animals whose abilities of adapting to high altitude hypoxia. Hypoxic adaptation is a complex trait that is influenced by many factors (Gou et al., 2014). When constantly suffering hypoxia, mammals' cells have a variety of mechanisms to deal with stress and survive, in order to adapt to the inevitable cases (Ball et al., 2012). In addition to the activation and stabilization of some transcription factors, there are some mechanisms of gene epigenetic regulation as well (Chaillou et al., 2013). However, the mechanisms of adapting to the low oxygen in plateau native mammals, which have the ability of plateau adaptation in nature, have not been fully understood yet. As a unique breed in Tibet, Tibetan pig is the original small local pig (Dong et al., 2014; Xiong et al., 2015). With its long life in high altitude hypoxic environment, Tibetan pig has a higher adaptive capacity in the tissue, cellular and molecular levels than other land mammal species, Abbreviations: AA, amino acid; CDS, coding sequence; ECE1, endothelin converting enzyme 1; ET, endothelin; NCBI, National Center for Biotechnology Information; ORF, open reading frame; pI, isoelectric point; qPCR, quantitative polymerase chain reaction; RT-PCR, real-time polymerase chain reaction; UTR, untranslated region. ⁎ Corresponding authors at: College of Animal Science and Technology, Shandong Agricultural University, 61 Daizong Street, Tai'an 271000, PR China. E-mail addresses: [email protected] (Y. Zeng), [email protected] (H. Wang).
http://dx.doi.org/10.1016/j.gene.2015.06.054 0378-1119/© 2015 Elsevier B.V. All rights reserved.
and it also has a unique and stable adaptation mechanism (Xiong et al., 2015). Through studying of molecular genetic mechanisms of hypoxia adaptation in Tibetan pig, there will be lots of important implications for the prevention and treatment of diseases in plateau, the development of plateau animal husbandry, and the protection of animal resources. The endothelin converting enzyme 1 (ECE1) gene has recently been discovered and reported to play an important role in resisting to hypoxia in newborn mouse (Koscica et al., 2004; Kon et al., 2014). Endothelin (ET) is a 21 amino-acid vasoconstrictive peptide isolated from the supernatant of cultured porcine aortic endothelial cells (Shimada et al., 1995a, 1995b). The ET consists of a family of three isopeptides, termed ET-1 (Whyteside et al., 2014), ET-2 and ET-3, which are derived from distinct genes (Weissberg et al., 1990; Xu et al., 1994). Of the three ETs, ET-1 is the most abundant to mediate their various effects and first produced in the cells as a large precursor, prepro-ET-1 (Lorenzo et al., 2001; Whyteside et al., 2014). ECE is a key enzyme to generate ET-1; it can reduce the concentration of endothelin, thus promoting the diastolic blood vessels, and increasing blood output, in order to provide the body more oxygen demand (Yanagisawa et al., 1998). As a member of ECE, ECE1 has a broad distribution in tissues, which has a higher expression than ECE2, and it is the most important factor in generating ET-1 (M et al., 1988; Lorenzo et al., 2001). ECE1 exists as four isoforms, ECE1-a, ECE1-b, ECE1-c and ECE1-d, which are generated from a single gene by the use of alternative promoters (Whyteside et al., 2014). The isoforms differ only in their N-terminal regions; the majority of exons and the 3′UTR are common to all four isoforms (Valdenaire et al.,
238
Y. Wang et al. / Gene 571 (2015) 237–244
1999). The isoforms exhibit similar catalytic activities but differ in their subcellular localizations (Schweizer et al., 1997). Since ECE1 is a novel gene related to hypoxia resistance, it is necessary to get the sequence of full-length ECE1 cDNA in Tibetan pigs. However, until now, the ECE1 full-length cDNA sequences still have not been submitted in National Center for Biotechnology Information (NCBI). In this study, we isolated the full-length cDNA of the ECE1 gene, analyzed its primary structure, and investigated its expression in different tissues. The results of the study will provide a foundation for understanding the function of the Tibetan pig ECE1 gene. 2. Materials and methods 2.1. Animals and sample collection Six Tibetan pigs were obtained from the region of Tibet. Various tissues, including the liver, subcutaneous fat, kidney, muscle, stomach, heart, brain, spleen, pancreas, and lung were immediately dissected from each pig, frozen in liquid nitrogen, transported to the laboratory in liquid nitrogen, and stored at −80 °C until RNA extraction. Animal care and use were approved by the Shandong Agricultural University Animal Care and Use Committee.
Table 2 List of the ECE1 sequences used in the analyses. Organism
GenBank ID
Nucleotide identity (%)
Amino acid identity (%)
Sus scrofa Bos taurus Vicugna pacos Bubalus bubalis Homo sapiens Camelus ferus Papio anubis Chlorocebus sabaeus Mus musculus Pan troglodytes Cavia porcellus Equus caballus Ursus maritimus Tupaia chinensis Canis lupus familiaris Myotis brandtii Felis catus Loxodonta africana Odobenus rosmarus Lipotes vexillifer Trichechus manatus
NM_181009.2 XM_006196735.1 XM_006042139.1 NM_001113348.1 XM_006188298.1 XM_009201173.1 XM_007980149.1 NM_199307.2 XM_003814395.2 XM_003471350.2 XM_001501569.4 XM_008694647.1 XM_006145180.1 XM_005617844.1 XM_005859677.1 XM_003989631.2 XM_010593028.1 XM_004411706.1 XM_007459217.1 XM_004377159.1
90 88 90 91 92 91 91 92 91 88 87 91 89 90 89 89 88 90 93 92
97 98 98 96 98 96 96 96 96 96 97 97 96 98 96 97 97 98 97 98
2.2. RNA isolation, cDNA synthesis About 100 mg of the tissue sample was taken out randomly from the liquid nitrogen jar and triturated in liquid nitrogen. Total RNA was extracted from the triturated sample using Trizol total RNA extraction reagent according to the manufacturer's instructions (TaKaRa, Dalian, China). The integrity of the RNA was detected by 1% agarose gel electrophoresis. The RNA was dissolved in RNase-free water at a concentration of 1 μg/μL and preserved in a −80 °C refrigerator. First strand cDNA was synthesized using 2 μg of purified total RNA in a real-time reverse transcription (RT-PCR) system (TaKaRa, Dalian, China) according to the manufacturer's protocol. The first strand cDNA was obtained and preserved at −20 °C. 2.3. 5′RACE The 5′RACE first-strand cDNA was synthesized using gene specific primer Oligo-d(T)18, also using RT-PCR system (TaKaRa, Dalian, China). Then, the above-obtained 5′RACE of first strand cDNA were homopolymeric tailing. The 12 μL reaction system of the homopolymer was as follows: 2.5 μL of 5× TdT buffer, 9.0 μL of cDNA, and 0.5 μL of 10 mmol/L dCTP (TaKaRa, Dalian, China). The program of homopolymeric tailing reaction was: 98 °C 1 min; ice bath 5 min; add 0.5 μL TdT, 37 °C 10 min; 70 °C 10 min; add water to 200 μL, preserved at −20 °C. Two 5′RACE procedures were performed, which were known as the nested PCR. Each PCR program was composed of an ECE1 specific primer (ECE1-5P2 and ECE1-5P4 shown in Table 1) and the primer complementary to the 3-blocked oligonucleotide (5P1 and 5P3 shown in Table 1).
The 25 μL reaction system contained 12.5 μL of 2 × Taq Master Mix (TaKaRa, Dalian, China), 1.0 μL of cDNA, 1.0 μL of each primer, and 9.5 μL of ddH2O. The first PCR program was 94 °C, 5 min; 94 °C, 30 s, 60 °C, 30 s, 72 °C, 1 min, 35 cycles; 72 °C, 5 min. Then the production was diluted 50–100 times as a template, followed by the second PCR program, which was the same as the first PCR program. 2.4. 3′RACE A gene specific primer 3P2 (Table 1) was used to synthesize the 3′ RACE first-strand cDNA, also using RT-PCR system (TaKaRa, Dalian, China). 3′RACE procedure still needs a two-step nested PCR. But the difference with the 5′RACE is that a touchdown PCR was used in the first PCR program, with the primers ECE1-3P1 and 3P2 (Table 1). The 25 μL reaction system was the same to the above-system. Procedure is as follows: 94 °C, 5 min; 94 °C, 30 s, 62 °C, 30 s, 72 °C, 1 min, 4 cycles; 94 °C, 30 s, 60 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 58 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 56 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 54 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 52 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 50 °C, 30 s, 72 °C, 1 min, 4 cycles; then 72 °C extension for 10 min, finally 4 °C to terminate the reaction. Then the production was diluted 50–100 times as a template, followed by the second PCR program using the primers ECE1-3P3 and 3P4 (Table 1). The program started with a 94 °C denaturation for 5 min, followed by 30 cycles of 94 °C, 30 s; 57.6 °C, 30 s; 72 °C, 1 min, then 72 °C extension for 10 min, finally 4 °C to terminate the reaction. Table 3 Primer sequence For qPCR.
Table 1 Primer sequence for RACE.
Gene Primer sequence (5′–3′) symbol
Amplicon length Literature (bp) 293
This work
100
Mcbryan et al.
120
Mcbryan et al.
168
Mcbryan et al.
178
Mcbryan et al.
122
Nygard et al.
Primer names
Primer sequence (5′–3′)
Amplification target
ECE1
5P1 5P3 ECE1-5P2 ECE1-5P4 3P2 3P4 ECE1-3P1 ECE1-3P3 ECE1-F ECE1-R
GGCCACGCGTCGACTAGTACGGGGGGGGGGGGGGG GGCCACGCGTCGACTAGTACG CTTTCTGCCTCGCTCACAC TTAGGCACACAGAGGGGGT GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTTT GACTCGAGTCGACATCGAT TCTTCAGGGAAATAATG TTTCCACCCGCTTCTTCTG GTGAGCGAGGCAGAAAG GGTGGGCAGTGGAAGTG
For 5′RACE
GAPDH ACTB
For 3′ RACE
TBP B2M
For middle partial of ECE1
RPL4
F: GGACTGGTGGCTTGCTT R: CCTTTCTGCCTCGCTCA F: ACTCACTCTTCTACCTTTGATGCT R: TGTTGCTGTAGCCAAATTCA F: AAGGAGAAGCTGTGCTACGTCGCC R: GTTGCCGATGGTGATGACCTGG F: TTAATGGTGGTGTTGTGGACGGC R: CCAAATAGCAGCACAGTACGAGCAA F: AAACGGAAAGCCAAATTACC R: ATCCACAGCGTTAGGAGTGA F: CAAGAGTAACTACAACCTTC R: GAACTCTACGATGAATCTTC
Y. Wang et al. / Gene 571 (2015) 237–244
2.5. Cloning of unknown middle sequence A pair of primers (ECE1-F and ECE1-R shown in Table 1) was designed with the Primer Premier 5 software according to the NCBI reference sequence of the pig ECE1 (GenBank: XM_005665089.1) gene sequences. With the primers, a cDNA fragment was amplified by RTPCR using the first strand cDNAs as templates. The 25 μL reaction system was as above. The PCR started with pre-denaturation at 94 °C for 5 min, followed by 38 cycles of 94 °C, 30 s; 60.8 °C, 30 s; 72 °C, 2 min, and ended with a final extension at 72 °C for 10 min. All the PCR products (including 5′RACE, 3′RACE and middle fragment PCR product) were detected by agarose gel electrophoresis, and
239
recovered using an Agarose Gel DNA Purification Kit (TIANGEN, China). The products were cloned by pMD18-T vector (TaKaRa, Dalian, China) and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. 2.6. Bioinformatic sequence analysis Sequence analysis of Tibetan pig ECE1 gene was performed using BLAST in NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi), ExPaSy (http:// www.expasy.org). The open reading frame prediction was using the NCBI/ORF Finder program (http://www.ncbi.nlm.nih.gov/gorf/gorf. html). The protein prediction and analysis were performed using the Conserved Domain Architecture Retrieval Tool of BLAST at the NCBI
Fig. 1. A BLAST search of NCBI's nucleotide sequence database. (A) Distribution of 150 Blast Hits on the Query Sequence (not shown all blast hits). (B) Sequence alignment of the blue arrow marked blast hit. The marked sequence is: PREDICTED: Sus scrofa endothelin converting enzyme 1 (ECE1), transcript variant X3, mRNA, sequence ID: XM_005665089.1.
240
Y. Wang et al. / Gene 571 (2015) 237–244
server (http://www.ncbi.nlm.nih.gov/BLAST) and the ClustalW software (http://align.genome.jp/). The molecular weight and pI were calculated by Compute pI/Mw (http://us.expasy.org/tools/pi_tool. html). Signal peptides were predicted using the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/). PSort II (http://psort. hgc.jp/) was used to predict protein sorting signals and intracellular localization. The SWISS-MODEL server (http://www.expasy.org/ swissmod/SWISSMODEL.html) was used to model the protein 3D conformation. Secondary structures of deduced amino acid sequences were predicted by SOPMA (http://npsa-pbil.ibcp.fr/). 2.7. Phylogenetic analysis A phylogenetic tree was generated based on ECE1 protein sequences by applying the neighbor-joining methods in the CLUSTALW2 program, which subsequently subjects to be edited manually. Table 2 showed the GenBank accession numbers of different animal ECE1 sequences. Statistical significance of groups within phylogenetic trees was evaluated using the bootstrap method with 1000 replications. 2.8. qPCR for tissue expression profile analysis The expression levels of ECE1 gene were measured using qPCR. Primers for amplification of Tibetan pig ECE1 gene were designed by Primer Premier 5 software. The five genes (GAPDH, ACTB, TBP, B2M and RPL4) were amplified as endogenous control genes (Nygard et al., 2007; Mcbryan et al., 2010). The primers used for qPCR are shown in Table 3 and all primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The amplifications were performed in a 25 μL reaction volume containing 12.5 μL of 2× SYBR Premix ExTaq (TaKaRa, Dalian, China), 0.5 μL of each primer, 2 μL of diluted cDNA, 0.5 μL of Dye II, and finally add sterile water to volume 25 μL. The PCR amplification was carried out as follows: 95 °C for 10 s, then 40 cycles of 95 °C for 5 s, 59 °C for 10 s and 72 °C for 15 s. PCR amplification efficiencies for each gene evaluated by the standard curve and only quantification cycle (Cq) values of b 35 were used to calculate the relative quantification. The Cq values were generated with the Stratagene Mx3000P system software. To exclude between-run variations, all samples were amplified in triplicates and the mean was used for further analysis. The stability of the candidate reference genes was evaluated with the freely available geNorm (version 3.5 available online at http:// medgen.ugent.be/~jvdesomp/genorm/). geNorm calculates a gene expression stability measure (M) as the standard deviation of the log2transformed expression ratios of each reference gene with all other tested candidate reference genes throughout a given sample panel (Vandesompele et al., 2002). Standard curves were generated using pooled cDNA from the samples being assayed, and the ΔCq method was used to quantify the mRNA expression levels of Tibetan pig ECE1 gene. 3. Results 3.1. cDNA cloning and sequence analysis of the ECE1 gene The full-length cDNA of ECE1 was the first reported in this study (GenBank accession number KP411748). A 3771 bp full-length sequence of ECE1 was obtained by cloning and splicing using the cDNA from the muscle of Tibetan pig as the template, and it consisted of 2262 bp coding sequence (CDS), 2 bp 5′ terminal untranslated region (UTR) and 1507 bp 3′ terminal UTR. A BLAST search of NCBI's nucleotide sequence database revealed that the Tibetan pig ECE1 fragment was significantly similar to the predicted ECE1 gene sequences (GenBank: XM_005665089.1) (Fig. 1). The Tibetan pig ECE1 nucleotide sequence and deduced amino acid sequence are shown in Fig. 2. The application of the program NCBI/ORF Finder found a complete encoding frame
Fig. 2. Nucleotide and predicted amino acid sequences of Tibetan pig ECE1. The start (ATG) codon is colored in black and the stop codon (TAG) is indicated with an asterisk and highlighted in red.
Y. Wang et al. / Gene 571 (2015) 237–244
241
Fig. 3. ORF finder.
(ORF) meeting the Kozak rule in the sequence −1 phase, between 3– 2264 nucleotides encoding a protein 753 amino acids long (Fig. 3). 3.2. Analysis of the amino acid sequence of ECE1 The deduced amino acid sequence has a molecular weight of 85,449 kDa and an isoelectric point (pI) of 5.49. No N-terminal signal peptide was identified by the PSORT II software. A subcellular localization analysis of the ECE1 amino acid sequence predicted that 33.3% of the sequence may exist in the endoplasmic reticulum, 33.3% may exist in the mitochondrial, 22.2% may be in the cytoplasmic, and 11.1% could be in the nuclear. The secondary structure of the protein was predicted to be mainly α-helix, separated by extended strand (β-fold) and random coil (Fig. 4). The TMHMM result indicated that the protein had obvious transmembrane domain (1 to 51 were inside, 52 to 74 were TM helix, 75 to 753 were outside), suggesting that ECE1 is an epimembranous accepter and it can be located in the membrane. The results of SMART (http:// smart.embl-heidelberg.de/) also indicated that ECE1 has a transmembrane region. The region starts at position 52 and ends at position 74 and its E-value is Not Applicable (N/A).
The program ProtScale of ExPASy calculated the hydrophobicity profiles of pig ECE1 (Fig. 5). Ordinate represents the hydrophobic score, the higher the score, the more hydrophobic; the lower the score, the lower the hydrophobicity. The abscissa represents the position of the amino acids. As shown in Fig. 5, the amino acids near position 53 have the highly hydrophobic. The ECE1 protein does not contain significant hydrophobic region; hydrophilic amino acids are evenly distributed throughout the peptide chain, and have a large amount than hydrophobic amino acids.
3.3. Predicted 3D structural model of ECE1 The fully automatic procedure on the SWISS-MODEL server was used to construct a 3D structural model of a segment of the Tibetan pig ECE1 sequence (between amino acids (AA) 84–753). The homology modeling revealed that this segment was similar to that of the human 3dwb.1.A in the Protein Data Bank (PDB: P42892: 101–770 AA) (Fig. 6). The three dimensional structure analysis may lay the foundation for studying the relationship between structure and function of the Tibetan pig ECE1 protein.
Fig. 4. The predicted secondary structure of the ECE1 amino acid sequence. The Hnn secondary structure prediction method was used. The blue line represents α-helix, the red line represents extended strand, and the purple line represents random coil.
242
Y. Wang et al. / Gene 571 (2015) 237–244
Fig. 5. The hydrophobicity profile of porcine ECE1 analyzed by ProtScale program.
3.4. Characteristics of the deduced protein and phylogenetic analysis of ECE1
3.5. Expression stability of reference genes and ECE1 mRNA expression levels of different tissues
The deduced amino acid sequence of Tibetan pig ECE1 was compared to the ECE1 sequences from nine other mammals using CLUSTALW2. The coding sequence of the pig ECE1 gene was 90% identical to cattle ECE1, and 91%, 92%, 92%, 91%, 91%, 89%, 90% and 89% identical to human, Mus musculus, Camelus, Papio, Troglodytes, Myotis, Canis and Felis, respectively. The amino acid sequences were 97%, 96%, 96%, 98%, 96%, 96%, 96%, 98% and 97% identical to cattle, human, M. musculus, Camelus, Papio, Troglodytes, Myotis, Canis and Felis, respectively (Fig. 7A). The phylogenetic tree was constructed from the deduced Tibetan pig ECE1 and the ECE1 sequences from other mammals with the software MEGA6.06 Neighbor Joining (NJ) method (Fig. 7B). The results showed that Tibetan pig ECE1 clustered with the ECE1 from other mammals; the highest homology was with Vicugna, the lowest homology was with Myotis.
We used the geNorm software to analyze the expression stability. The ranking of the gene expression stability values (M) of the reference genes was as follows: TBP N B2M N RPL4 N GAPDH and ACTB (Fig. 8A). This order indicates that GAPDH and ACTB are the most stable reference genes. In addition, geNorm also calculated the optimal number of reference genes by assessing the pairwise variations (Vn/n + 1) between each combination of sequential normalization factors. As shown in Fig. 8B, the V2/3 value was 0.026, which was below the cut-off value (0.15), thus the combination of GAPDH and ACTB was suitable for normalizing gene expression data. So we used the expression of GAPDH and ACTB to normalize the ECE1 mRNA expression. qPCR was used to analyze the ECE1 mRNA transcription levels in different tissues (including the liver, subcutaneous fat, kidney, muscle, stomach, heart, brain, spleen, pancreas, and lung) from Tibetan pigs. The ECE1 mRNA was detected in all the tissues tested. The expression level did not vary obviously among tissues. However, significant difference was observed in mRNA expression of the ECE1 gene between the heart and the pancreas (p b 0.05) (Fig. 9). Through Fig. 9, high expression levels of ECE1 were detected in the lung, heart, and liver; low expression levels were seen in the brain, stomach, and pancreas. As there still have lots of functions and protein levels we did not study, there might be many reasons for differential expression of the ECE1 gene.
4. Discussions
Fig. 6. The three dimensional structure of Tibetan pig ECE1 (84–753 AA) based on homology modeling using SWISS-MODEL.
ECE1 is a recently discovered gene that is involved in anti-hypoxia, and it is also upregulated in a variety of cancers (Smollich et al., 2007; Lee et al., 2009). This work will provide molecular basis for associate analysis DNA and amino acid sequence of the Tibetan pig ECE1 gene. In this study, the full-length cDNA sequence of ECE1 gene was cloned from the Tibetan pig, containing 2262 bp coding sequence (CDS) that encodes 753 amino acids, 2 bp 5′ terminal UTR and 1507 bp 3′ terminal UTR. The pig ECE1 protein, consistent with other animals' ECE1 proteins,
Y. Wang et al. / Gene 571 (2015) 237–244
243
Fig. 8. Ranking of gene stability and combination of genes for normalization factor calculation evaluated by geNorm. Results are presented according to the output file of the geNorm program. (A) Average expression stability values (M, y-axis) of 5 reference genes and the associated ranking from least to most stable expression (x-axis) as assessed by geNorm. Lower M value of average expression stability indicates more stable expression. (B) Determination of the optimal number of reference genes for normalization depending on a pairwise variation (V) analyses.
Fig. 7. Phylogenetic tree and alignment of the ECE1 amino acid sequences from Tibetan pig and other species. The GenBank accession numbers of the ECE1 sequences are listed in Table 2. (A) Amino acid sequence alignment of Tibetan pig ECE1 with the predicted ECE1 sequences from eight other mammals. The sequence alignments were performed using CLUSTALW2. (B) Phylogenetic tree of the amino acid sequences of ECE1 from pig and other mammals. The tree was constructed using the Neighbor Joining method in the MEGA 6.06 software.
has no signal peptide, but contains an obvious transmembrane domain. It is possible that pig ECE1 protein may play functions through these domains.
Fig. 9. Tissue distribution of Tibetan pig ECE1 gene expression by qPCR analysis. The GAPDH and ACTB are served as internal controls. Asterisks indicate differences that are statistically significant (*p b 0.05).
244
Y. Wang et al. / Gene 571 (2015) 237–244
The phylogenetic tree analysis revealed that the translated Tibetan pig ECE1 amino acid sequence had a close genetic relationship with ECE1 sequences from other mammals. These implied that Tibetan pig should also be a better model animal to study the ECE1 gene functions. In this study, we identified a 3771 bp full-length cDNA product. Through using BLAST searching, we determined that the product corresponded to ECE1, but the 3′ terminal UTR is about 800 bp less than the predicted sequence of NCBI (GenBank: XM_005665089.1). Until now, ECE1 has been noted and well studied in human (Schmidt et al., 1994; Kotani et al., 2013), mouse (Lindenau et al., 2006; Hartopo et al., 2013) and so on. In our study, we know that the pig ECE1 is 3771 bp in length, and the coding region of porcine size is 2262 bp encoding 753 amino acid residues. The derived amino acid sequence of ECE1 is well conserved compared with ECE1 of various species, and it has a higher degree of sequence similarity with other mammalian (96%–98%). From the NCBI, we know that many species ECE1 sequences were just predicted sequences, and most sequences are vacant, especially pigs. ECE1 full-length cDNA sequence cloning has been completed in human beings (Shimada et al., 1995a, 1995b; Kotani et al., 2013). Human ECE is a kind of membrane bound peptide enzyme in metal, and belongs to the neutral endopeptidase (NEP) family (Whyteside et al., 2014). According to the report, human ECE was composed of 758 amino acid residues and its molecular structure consisted of a short N-terminal cytoplasmic tail, a transmembrane hydrophobic region, and a large extracellular region (Comuzzie et al., 2012; Li et al., 2012). This was very similar to our research in Tibetan pigs. It also showed that pig ECE1 protein has highly homology with humans. The qPCR results showed that the Tibetan pig ECE1 mRNA expression levels were similar in most of the tested tissues. However, compared to its expression in the other tissues, ECE1 was more highly expressed in the heart and lung of the pigs. In humans (Schmidt et al., 1994) and mice (Lindenau et al., 2006), ECE1 was primarily expressed in the lung and adrenal gland compared with other organs (Birse et al., 1993; Maas et al., 1995). The heart and lung seem to be important organs for resisting hypoxia. The expression level of ECE-1α mRNA was higher than that of ECE-1β in various rat cells and tissues, suggesting that the physiologically important isoform is ECE-1α (Shimada et al., 1995a, 1995b). As we still did not study the differences of the four isoforms, there might be many reasons for differential expression of the four isoforms. Our results show that the ECE1 expression levels in the lung and heart have a high level than other tissues. However, the heart and lung are important parts to the cardiopulmonary function, which seriously affect the ability to resisting hypoxia, so this result further confirmed ECE1 as a candidate gene for anti-hypoxia. In conclusion, we isolated the Tibetan pig ECE1 gene and used various bioinformatics tools to analyze the gene and the predicted protein sequences. We predicted the molecular structure of the ECE1 protein and analyzed the temporal and spatial mRNA expression differences in ten tissues of Tibetan pig. The information that was obtained provides an important basis for conducting future studies on the functions and regulatory mechanisms underlying the role of ECE1 in resisting hypoxia, and provides an important theoretical basis for further research in molecular-assisted selection during animal breeding. Acknowledgment This study was supported by the National Animal Breed Resource Preserve Project of China (No. 2130135), the National Project for Breeding Transgenic Pigs of China (No. 2013ZX08006-002), Shandong Province Modern Pig Technology and Industry System Project (No. SDAIT-06022-03) and Shandong Province Agricultural Animal Breeding Project of China (No. 2013LZ02-015).
References Ball, K.A., Nelson, A.W., Foster, D.G., Poyton, R.O., 2012. Nitric oxide produced by cytochrome c oxidase helps stabilize HIF-1α in hypoxic mammalian cells. Biochem. Biophys. Res. Commun. 420, 727–732. Birse, C.E., Irwin, M.Y., Fonzi, W.A., S. PS, 1993. Cloning and characterization of ECE1, a gene expressed in association with cell elongation of the dimorphic pathogen Candida albicans. Infect. Immun. 61, 3648–3655. Chaillou, T., et al., 2013. Effect of hypoxia exposure on the phenotypic adaptation in remodelling skeletal muscle submitted to functional overload. Acta Physiol. 209, 272–282. Comuzzie, A.G., et al., 2012. Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. PLoS One 7, e51954. Dong, K.-z, et al., 2014. Genetic variation of EPAS1 gene in Tibetan pigs and three lowaltitude pig breeds in China. J. Integr. Agric. 13, 1990–1998. Gou, W., et al., 2014. Expression pattern of heme oxygenase 1 gene and hypoxic adaptation in chicken embryos. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 174, 23–28. Hartopo, A.B., et al., 2013. Endothelin-converting enzyme-1 gene ablation attenuates pulmonary fibrosis via CGRP-cAMP/EPAC1 pathway. Am. J. Respir. Cell Mol. Biol. 48, 465–476. Kon, M., et al., 2014. Effects of systemic hypoxia on human muscular adaptations to resistance exercise training. Physiol Rep. 2 (6). Koscica, K.L., Sylvestre, G., R. SE, 2004. The effect of phosphoramidon on inflammationmediated preterm delivery in a mouse model. Am. J. Obstet. Gynecol. 190, 528–531. Kotani, T., et al., 2013. Altered expression of enzymes regulating the activity of endothelin-1 in the lower segment of the human amnion during labor. Biol. Reprod. 89, 52. Lee, S., Carter, P.R., Watts, M.N., Bao, J.R., Harris, N.R., 2009. Effects of the endothelinconverting enzyme inhibitor SM-19712 in a mouse model of dextran sodium sulfate-induced colitis. Inflamm. Bowel Dis. 15, 1007–1013. Li, Y., et al., 2012. A polymorphic microsatellite repeat within the ECE-1c promoter is involved in transcriptional start site determination, human evolution, and Alzheimer's disease. J. Neurosci. 32, 16807–16820. Lindenau, S., von Langsdorff, C., Saxena, A., Paul, M., Orzechowski, H.-D., 2006. Genomic organisation of the mouse gene encoding endothelin-converting enzyme-1 (ECE-1) and mRNA expression of ECE-1 isoforms in murine tissues. Gene 373, 109–115. Lorenzo, M.-N., et al., 2001. Human endothelin converting enzyme-2 (ECE2): characterization of mRNA species and chromosomal localization. Biochim. Biophys. Acta (BBA) Gene Struct. Expression 1522, 46–52. M, Y., et al., 1988. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature 332, 411–415. Maas, J., D'Orléans-Juste, P., Yano, M., Rae, G.A., 1995. Evidence for atypical endothelin receptors and for presence of endothelin-converting enzyme activity in the mouse isolated vas deferens. Eur. J. Pharmacol. 276, 113–121. McBryan, J., Hamill, R.M., Davey, G., Lawlor, P., Mullen, A.M., 2010. Identification of suitable reference genes for gene expression analysis of pork meat quality and analysis of candidate genes associated with the trait drip loss. Meat Sci. 86 (2), 436–439. Nygard, A.B., Jørgensen, C.B., Cirera, S., Fredholm, M., 2007. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol. Biol. http://dx.doi.org/10.1186/1471-2199-8-67. Schmidt, M., et al., 1994. Molecular characterization of human and bovine endothelin converting enzyme (ECE-1). FEBS Lett. 356, 238–243. Schweizer, A., Valdenaire, O., Nelbock, P., Deuschle, U., Dumas Milne Edwards, J.B., et al., 1997. Human endothelin-converting enzyme (ECE-1): three isoforms with distinct subcellular localizations. Biochem. J. 328, 871–877. Shimada, K., et al., 1995a. Cloning and functional expression of human endothelinconverting enzyme cDNA. Biochem. Biophys. Res. Commun. 207, 807–812. Shimada, K., Takahashi, M., Ikeda, M., Tanzawa, K., 1995b. Identification and characterization of two isoforms of an endothelin-converting enzyme-1. FEBS Lett. 371, 140–144. Smollich, M., et al., 2007. On the role of endothelin-converting enzyme-1 (ECE-1) and neprilysin in human breast cancer. Breast Cancer Res. Treat. 106, 361–369. Valdenaire, O., Lepailleur-Enouf, D., Egidy, G., Thouard, A., Barret, A., 1999. A fourth isoform of endothelin-converting enzyme (ECE-1) is generated from an additional promoter molecular cloning and characterization. Eur. J. Biochem. 341–349. Vandesompele, J., Preter, K.D., Pattyn, F., Poppe, B., Roy, N.V., Paepe, A.D., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (7) (research 0034.1– research 0034.11). Weissberg, P.L., Witchell, C., Davenport, A.P., Hesketh, T.R., Metcalfe, J.C., 1990. The endothelin peptides ET-1, ET-2, ET-3 and sarafotoxin S6b are co-mitogenic with platelet-derived growth factor for vascular smooth muscle cells. Atherosclerosis 85, 257–262. Whyteside, A.R., Turner, A.J., L. DW, 2014. Endothelin-converting enzyme-1 (ECE-1) is post-transcriptionally regulated by alternative polyadenylation. PLoS One 9, e83260. Xiong, H.-t., Gao, Y.-h., Liu, D., Wang, Y.-z., Du, H.-h., 2015. High level of hepcidin mRNA expression is associated with high production of immune factors in Tibetan pigs. Livest. Sci. 171, 73–77. Xu, D., et al., 1994. ECE-1: a membrane-bound metalloprotease that catalyzes the proteolytic activation of big endothelin-1. Cell 78, 473–485. Yanagisawa, H., et al., 1998. Dual genetic pathways of endothelin-mediated intercellular signaling revealed by targeted disruption of endothelin converting enzyme-1 gene. Development 125, 825–836.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Molecular cloning, sequence characteristics, and tissue expression analysis of ECE1 gene in Tibetan pig Yan-dong Wang a, Jian Zhang b, Chuan-hao Li a, Hai-peng Xu a, Wei Chen a, Yong-qing Zeng a,⁎, Hui Wang a,⁎ a b
College of Animal Science and Technology, Shandong Agricultural University, Tai'an, Shandong 271000, PR China Station of Animal Science and Veterinary, Gongbo'gyamda County, Linzhi, Tibet 860200, PR China
a r t i c l e
i n f o
Article history: Received 5 April 2015 Received in revised form 17 June 2015 Accepted 22 June 2015 Available online 24 June 2015 Keywords: Tibetan pig ECE1 Anti-hypoxia cDNA clone Sequence analysis Expression
a b s t r a c t Low air pressure and low oxygen partial pressure at high altitude seriously affect the survival and development of human beings and animals. ECE1 is a recently discovered gene that is involved in anti-hypoxia, but the full-length cDNA sequence has not been obtained. For a better understanding of the structure and function of the ECE1 gene and to study its effect in Tibetan pig, the cDNA of the ECE1 gene from the muscle of Tibetan pig was cloned, sequenced and characterized. The ECE1 full-length cDNA sequence consists of 2262 bp coding sequence (CDS) that encodes 753 amino acids with a molecular mass of 85,449 kD, 2 bp 5′UTR and 1507 bp 3′UTR. In addition, the phylogenetic tree analysis revealed that the Tibetan pig ECE1 has a closer genetic relationship and evolution distance with the land mammals ECE1. Furthermore, analysis by qPCR showed that the ECE1 transcript is constitutively expressed in the 10 tissues tested: the liver, subcutaneous fat, kidney, muscle, stomach, heart, brain, spleen, pancreas, and lung. These results serve as a foundation for further insight into the Tibetan pig ECE1 gene. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Nowadays, low air pressure at high altitude and low oxygen partial pressure seriously affect the survival and development of human beings and animals (Chaillou et al., 2013; Kon et al., 2014). It is vary in different animals whose abilities of adapting to high altitude hypoxia. Hypoxic adaptation is a complex trait that is influenced by many factors (Gou et al., 2014). When constantly suffering hypoxia, mammals' cells have a variety of mechanisms to deal with stress and survive, in order to adapt to the inevitable cases (Ball et al., 2012). In addition to the activation and stabilization of some transcription factors, there are some mechanisms of gene epigenetic regulation as well (Chaillou et al., 2013). However, the mechanisms of adapting to the low oxygen in plateau native mammals, which have the ability of plateau adaptation in nature, have not been fully understood yet. As a unique breed in Tibet, Tibetan pig is the original small local pig (Dong et al., 2014; Xiong et al., 2015). With its long life in high altitude hypoxic environment, Tibetan pig has a higher adaptive capacity in the tissue, cellular and molecular levels than other land mammal species, Abbreviations: AA, amino acid; CDS, coding sequence; ECE1, endothelin converting enzyme 1; ET, endothelin; NCBI, National Center for Biotechnology Information; ORF, open reading frame; pI, isoelectric point; qPCR, quantitative polymerase chain reaction; RT-PCR, real-time polymerase chain reaction; UTR, untranslated region. ⁎ Corresponding authors at: College of Animal Science and Technology, Shandong Agricultural University, 61 Daizong Street, Tai'an 271000, PR China. E-mail addresses: [email protected] (Y. Zeng), [email protected] (H. Wang).
http://dx.doi.org/10.1016/j.gene.2015.06.054 0378-1119/© 2015 Elsevier B.V. All rights reserved.
and it also has a unique and stable adaptation mechanism (Xiong et al., 2015). Through studying of molecular genetic mechanisms of hypoxia adaptation in Tibetan pig, there will be lots of important implications for the prevention and treatment of diseases in plateau, the development of plateau animal husbandry, and the protection of animal resources. The endothelin converting enzyme 1 (ECE1) gene has recently been discovered and reported to play an important role in resisting to hypoxia in newborn mouse (Koscica et al., 2004; Kon et al., 2014). Endothelin (ET) is a 21 amino-acid vasoconstrictive peptide isolated from the supernatant of cultured porcine aortic endothelial cells (Shimada et al., 1995a, 1995b). The ET consists of a family of three isopeptides, termed ET-1 (Whyteside et al., 2014), ET-2 and ET-3, which are derived from distinct genes (Weissberg et al., 1990; Xu et al., 1994). Of the three ETs, ET-1 is the most abundant to mediate their various effects and first produced in the cells as a large precursor, prepro-ET-1 (Lorenzo et al., 2001; Whyteside et al., 2014). ECE is a key enzyme to generate ET-1; it can reduce the concentration of endothelin, thus promoting the diastolic blood vessels, and increasing blood output, in order to provide the body more oxygen demand (Yanagisawa et al., 1998). As a member of ECE, ECE1 has a broad distribution in tissues, which has a higher expression than ECE2, and it is the most important factor in generating ET-1 (M et al., 1988; Lorenzo et al., 2001). ECE1 exists as four isoforms, ECE1-a, ECE1-b, ECE1-c and ECE1-d, which are generated from a single gene by the use of alternative promoters (Whyteside et al., 2014). The isoforms differ only in their N-terminal regions; the majority of exons and the 3′UTR are common to all four isoforms (Valdenaire et al.,
238
Y. Wang et al. / Gene 571 (2015) 237–244
1999). The isoforms exhibit similar catalytic activities but differ in their subcellular localizations (Schweizer et al., 1997). Since ECE1 is a novel gene related to hypoxia resistance, it is necessary to get the sequence of full-length ECE1 cDNA in Tibetan pigs. However, until now, the ECE1 full-length cDNA sequences still have not been submitted in National Center for Biotechnology Information (NCBI). In this study, we isolated the full-length cDNA of the ECE1 gene, analyzed its primary structure, and investigated its expression in different tissues. The results of the study will provide a foundation for understanding the function of the Tibetan pig ECE1 gene. 2. Materials and methods 2.1. Animals and sample collection Six Tibetan pigs were obtained from the region of Tibet. Various tissues, including the liver, subcutaneous fat, kidney, muscle, stomach, heart, brain, spleen, pancreas, and lung were immediately dissected from each pig, frozen in liquid nitrogen, transported to the laboratory in liquid nitrogen, and stored at −80 °C until RNA extraction. Animal care and use were approved by the Shandong Agricultural University Animal Care and Use Committee.
Table 2 List of the ECE1 sequences used in the analyses. Organism
GenBank ID
Nucleotide identity (%)
Amino acid identity (%)
Sus scrofa Bos taurus Vicugna pacos Bubalus bubalis Homo sapiens Camelus ferus Papio anubis Chlorocebus sabaeus Mus musculus Pan troglodytes Cavia porcellus Equus caballus Ursus maritimus Tupaia chinensis Canis lupus familiaris Myotis brandtii Felis catus Loxodonta africana Odobenus rosmarus Lipotes vexillifer Trichechus manatus
NM_181009.2 XM_006196735.1 XM_006042139.1 NM_001113348.1 XM_006188298.1 XM_009201173.1 XM_007980149.1 NM_199307.2 XM_003814395.2 XM_003471350.2 XM_001501569.4 XM_008694647.1 XM_006145180.1 XM_005617844.1 XM_005859677.1 XM_003989631.2 XM_010593028.1 XM_004411706.1 XM_007459217.1 XM_004377159.1
90 88 90 91 92 91 91 92 91 88 87 91 89 90 89 89 88 90 93 92
97 98 98 96 98 96 96 96 96 96 97 97 96 98 96 97 97 98 97 98
2.2. RNA isolation, cDNA synthesis About 100 mg of the tissue sample was taken out randomly from the liquid nitrogen jar and triturated in liquid nitrogen. Total RNA was extracted from the triturated sample using Trizol total RNA extraction reagent according to the manufacturer's instructions (TaKaRa, Dalian, China). The integrity of the RNA was detected by 1% agarose gel electrophoresis. The RNA was dissolved in RNase-free water at a concentration of 1 μg/μL and preserved in a −80 °C refrigerator. First strand cDNA was synthesized using 2 μg of purified total RNA in a real-time reverse transcription (RT-PCR) system (TaKaRa, Dalian, China) according to the manufacturer's protocol. The first strand cDNA was obtained and preserved at −20 °C. 2.3. 5′RACE The 5′RACE first-strand cDNA was synthesized using gene specific primer Oligo-d(T)18, also using RT-PCR system (TaKaRa, Dalian, China). Then, the above-obtained 5′RACE of first strand cDNA were homopolymeric tailing. The 12 μL reaction system of the homopolymer was as follows: 2.5 μL of 5× TdT buffer, 9.0 μL of cDNA, and 0.5 μL of 10 mmol/L dCTP (TaKaRa, Dalian, China). The program of homopolymeric tailing reaction was: 98 °C 1 min; ice bath 5 min; add 0.5 μL TdT, 37 °C 10 min; 70 °C 10 min; add water to 200 μL, preserved at −20 °C. Two 5′RACE procedures were performed, which were known as the nested PCR. Each PCR program was composed of an ECE1 specific primer (ECE1-5P2 and ECE1-5P4 shown in Table 1) and the primer complementary to the 3-blocked oligonucleotide (5P1 and 5P3 shown in Table 1).
The 25 μL reaction system contained 12.5 μL of 2 × Taq Master Mix (TaKaRa, Dalian, China), 1.0 μL of cDNA, 1.0 μL of each primer, and 9.5 μL of ddH2O. The first PCR program was 94 °C, 5 min; 94 °C, 30 s, 60 °C, 30 s, 72 °C, 1 min, 35 cycles; 72 °C, 5 min. Then the production was diluted 50–100 times as a template, followed by the second PCR program, which was the same as the first PCR program. 2.4. 3′RACE A gene specific primer 3P2 (Table 1) was used to synthesize the 3′ RACE first-strand cDNA, also using RT-PCR system (TaKaRa, Dalian, China). 3′RACE procedure still needs a two-step nested PCR. But the difference with the 5′RACE is that a touchdown PCR was used in the first PCR program, with the primers ECE1-3P1 and 3P2 (Table 1). The 25 μL reaction system was the same to the above-system. Procedure is as follows: 94 °C, 5 min; 94 °C, 30 s, 62 °C, 30 s, 72 °C, 1 min, 4 cycles; 94 °C, 30 s, 60 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 58 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 56 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 54 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 52 °C, 30 s, 72 °C, 1 min, 5 cycles; 94 °C, 30 s, 50 °C, 30 s, 72 °C, 1 min, 4 cycles; then 72 °C extension for 10 min, finally 4 °C to terminate the reaction. Then the production was diluted 50–100 times as a template, followed by the second PCR program using the primers ECE1-3P3 and 3P4 (Table 1). The program started with a 94 °C denaturation for 5 min, followed by 30 cycles of 94 °C, 30 s; 57.6 °C, 30 s; 72 °C, 1 min, then 72 °C extension for 10 min, finally 4 °C to terminate the reaction. Table 3 Primer sequence For qPCR.
Table 1 Primer sequence for RACE.
Gene Primer sequence (5′–3′) symbol
Amplicon length Literature (bp) 293
This work
100
Mcbryan et al.
120
Mcbryan et al.
168
Mcbryan et al.
178
Mcbryan et al.
122
Nygard et al.
Primer names
Primer sequence (5′–3′)
Amplification target
ECE1
5P1 5P3 ECE1-5P2 ECE1-5P4 3P2 3P4 ECE1-3P1 ECE1-3P3 ECE1-F ECE1-R
GGCCACGCGTCGACTAGTACGGGGGGGGGGGGGGG GGCCACGCGTCGACTAGTACG CTTTCTGCCTCGCTCACAC TTAGGCACACAGAGGGGGT GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTTT GACTCGAGTCGACATCGAT TCTTCAGGGAAATAATG TTTCCACCCGCTTCTTCTG GTGAGCGAGGCAGAAAG GGTGGGCAGTGGAAGTG
For 5′RACE
GAPDH ACTB
For 3′ RACE
TBP B2M
For middle partial of ECE1
RPL4
F: GGACTGGTGGCTTGCTT R: CCTTTCTGCCTCGCTCA F: ACTCACTCTTCTACCTTTGATGCT R: TGTTGCTGTAGCCAAATTCA F: AAGGAGAAGCTGTGCTACGTCGCC R: GTTGCCGATGGTGATGACCTGG F: TTAATGGTGGTGTTGTGGACGGC R: CCAAATAGCAGCACAGTACGAGCAA F: AAACGGAAAGCCAAATTACC R: ATCCACAGCGTTAGGAGTGA F: CAAGAGTAACTACAACCTTC R: GAACTCTACGATGAATCTTC
Y. Wang et al. / Gene 571 (2015) 237–244
2.5. Cloning of unknown middle sequence A pair of primers (ECE1-F and ECE1-R shown in Table 1) was designed with the Primer Premier 5 software according to the NCBI reference sequence of the pig ECE1 (GenBank: XM_005665089.1) gene sequences. With the primers, a cDNA fragment was amplified by RTPCR using the first strand cDNAs as templates. The 25 μL reaction system was as above. The PCR started with pre-denaturation at 94 °C for 5 min, followed by 38 cycles of 94 °C, 30 s; 60.8 °C, 30 s; 72 °C, 2 min, and ended with a final extension at 72 °C for 10 min. All the PCR products (including 5′RACE, 3′RACE and middle fragment PCR product) were detected by agarose gel electrophoresis, and
239
recovered using an Agarose Gel DNA Purification Kit (TIANGEN, China). The products were cloned by pMD18-T vector (TaKaRa, Dalian, China) and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. 2.6. Bioinformatic sequence analysis Sequence analysis of Tibetan pig ECE1 gene was performed using BLAST in NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi), ExPaSy (http:// www.expasy.org). The open reading frame prediction was using the NCBI/ORF Finder program (http://www.ncbi.nlm.nih.gov/gorf/gorf. html). The protein prediction and analysis were performed using the Conserved Domain Architecture Retrieval Tool of BLAST at the NCBI
Fig. 1. A BLAST search of NCBI's nucleotide sequence database. (A) Distribution of 150 Blast Hits on the Query Sequence (not shown all blast hits). (B) Sequence alignment of the blue arrow marked blast hit. The marked sequence is: PREDICTED: Sus scrofa endothelin converting enzyme 1 (ECE1), transcript variant X3, mRNA, sequence ID: XM_005665089.1.
240
Y. Wang et al. / Gene 571 (2015) 237–244
server (http://www.ncbi.nlm.nih.gov/BLAST) and the ClustalW software (http://align.genome.jp/). The molecular weight and pI were calculated by Compute pI/Mw (http://us.expasy.org/tools/pi_tool. html). Signal peptides were predicted using the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/). PSort II (http://psort. hgc.jp/) was used to predict protein sorting signals and intracellular localization. The SWISS-MODEL server (http://www.expasy.org/ swissmod/SWISSMODEL.html) was used to model the protein 3D conformation. Secondary structures of deduced amino acid sequences were predicted by SOPMA (http://npsa-pbil.ibcp.fr/). 2.7. Phylogenetic analysis A phylogenetic tree was generated based on ECE1 protein sequences by applying the neighbor-joining methods in the CLUSTALW2 program, which subsequently subjects to be edited manually. Table 2 showed the GenBank accession numbers of different animal ECE1 sequences. Statistical significance of groups within phylogenetic trees was evaluated using the bootstrap method with 1000 replications. 2.8. qPCR for tissue expression profile analysis The expression levels of ECE1 gene were measured using qPCR. Primers for amplification of Tibetan pig ECE1 gene were designed by Primer Premier 5 software. The five genes (GAPDH, ACTB, TBP, B2M and RPL4) were amplified as endogenous control genes (Nygard et al., 2007; Mcbryan et al., 2010). The primers used for qPCR are shown in Table 3 and all primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The amplifications were performed in a 25 μL reaction volume containing 12.5 μL of 2× SYBR Premix ExTaq (TaKaRa, Dalian, China), 0.5 μL of each primer, 2 μL of diluted cDNA, 0.5 μL of Dye II, and finally add sterile water to volume 25 μL. The PCR amplification was carried out as follows: 95 °C for 10 s, then 40 cycles of 95 °C for 5 s, 59 °C for 10 s and 72 °C for 15 s. PCR amplification efficiencies for each gene evaluated by the standard curve and only quantification cycle (Cq) values of b 35 were used to calculate the relative quantification. The Cq values were generated with the Stratagene Mx3000P system software. To exclude between-run variations, all samples were amplified in triplicates and the mean was used for further analysis. The stability of the candidate reference genes was evaluated with the freely available geNorm (version 3.5 available online at http:// medgen.ugent.be/~jvdesomp/genorm/). geNorm calculates a gene expression stability measure (M) as the standard deviation of the log2transformed expression ratios of each reference gene with all other tested candidate reference genes throughout a given sample panel (Vandesompele et al., 2002). Standard curves were generated using pooled cDNA from the samples being assayed, and the ΔCq method was used to quantify the mRNA expression levels of Tibetan pig ECE1 gene. 3. Results 3.1. cDNA cloning and sequence analysis of the ECE1 gene The full-length cDNA of ECE1 was the first reported in this study (GenBank accession number KP411748). A 3771 bp full-length sequence of ECE1 was obtained by cloning and splicing using the cDNA from the muscle of Tibetan pig as the template, and it consisted of 2262 bp coding sequence (CDS), 2 bp 5′ terminal untranslated region (UTR) and 1507 bp 3′ terminal UTR. A BLAST search of NCBI's nucleotide sequence database revealed that the Tibetan pig ECE1 fragment was significantly similar to the predicted ECE1 gene sequences (GenBank: XM_005665089.1) (Fig. 1). The Tibetan pig ECE1 nucleotide sequence and deduced amino acid sequence are shown in Fig. 2. The application of the program NCBI/ORF Finder found a complete encoding frame
Fig. 2. Nucleotide and predicted amino acid sequences of Tibetan pig ECE1. The start (ATG) codon is colored in black and the stop codon (TAG) is indicated with an asterisk and highlighted in red.
Y. Wang et al. / Gene 571 (2015) 237–244
241
Fig. 3. ORF finder.
(ORF) meeting the Kozak rule in the sequence −1 phase, between 3– 2264 nucleotides encoding a protein 753 amino acids long (Fig. 3). 3.2. Analysis of the amino acid sequence of ECE1 The deduced amino acid sequence has a molecular weight of 85,449 kDa and an isoelectric point (pI) of 5.49. No N-terminal signal peptide was identified by the PSORT II software. A subcellular localization analysis of the ECE1 amino acid sequence predicted that 33.3% of the sequence may exist in the endoplasmic reticulum, 33.3% may exist in the mitochondrial, 22.2% may be in the cytoplasmic, and 11.1% could be in the nuclear. The secondary structure of the protein was predicted to be mainly α-helix, separated by extended strand (β-fold) and random coil (Fig. 4). The TMHMM result indicated that the protein had obvious transmembrane domain (1 to 51 were inside, 52 to 74 were TM helix, 75 to 753 were outside), suggesting that ECE1 is an epimembranous accepter and it can be located in the membrane. The results of SMART (http:// smart.embl-heidelberg.de/) also indicated that ECE1 has a transmembrane region. The region starts at position 52 and ends at position 74 and its E-value is Not Applicable (N/A).
The program ProtScale of ExPASy calculated the hydrophobicity profiles of pig ECE1 (Fig. 5). Ordinate represents the hydrophobic score, the higher the score, the more hydrophobic; the lower the score, the lower the hydrophobicity. The abscissa represents the position of the amino acids. As shown in Fig. 5, the amino acids near position 53 have the highly hydrophobic. The ECE1 protein does not contain significant hydrophobic region; hydrophilic amino acids are evenly distributed throughout the peptide chain, and have a large amount than hydrophobic amino acids.
3.3. Predicted 3D structural model of ECE1 The fully automatic procedure on the SWISS-MODEL server was used to construct a 3D structural model of a segment of the Tibetan pig ECE1 sequence (between amino acids (AA) 84–753). The homology modeling revealed that this segment was similar to that of the human 3dwb.1.A in the Protein Data Bank (PDB: P42892: 101–770 AA) (Fig. 6). The three dimensional structure analysis may lay the foundation for studying the relationship between structure and function of the Tibetan pig ECE1 protein.
Fig. 4. The predicted secondary structure of the ECE1 amino acid sequence. The Hnn secondary structure prediction method was used. The blue line represents α-helix, the red line represents extended strand, and the purple line represents random coil.
242
Y. Wang et al. / Gene 571 (2015) 237–244
Fig. 5. The hydrophobicity profile of porcine ECE1 analyzed by ProtScale program.
3.4. Characteristics of the deduced protein and phylogenetic analysis of ECE1
3.5. Expression stability of reference genes and ECE1 mRNA expression levels of different tissues
The deduced amino acid sequence of Tibetan pig ECE1 was compared to the ECE1 sequences from nine other mammals using CLUSTALW2. The coding sequence of the pig ECE1 gene was 90% identical to cattle ECE1, and 91%, 92%, 92%, 91%, 91%, 89%, 90% and 89% identical to human, Mus musculus, Camelus, Papio, Troglodytes, Myotis, Canis and Felis, respectively. The amino acid sequences were 97%, 96%, 96%, 98%, 96%, 96%, 96%, 98% and 97% identical to cattle, human, M. musculus, Camelus, Papio, Troglodytes, Myotis, Canis and Felis, respectively (Fig. 7A). The phylogenetic tree was constructed from the deduced Tibetan pig ECE1 and the ECE1 sequences from other mammals with the software MEGA6.06 Neighbor Joining (NJ) method (Fig. 7B). The results showed that Tibetan pig ECE1 clustered with the ECE1 from other mammals; the highest homology was with Vicugna, the lowest homology was with Myotis.
We used the geNorm software to analyze the expression stability. The ranking of the gene expression stability values (M) of the reference genes was as follows: TBP N B2M N RPL4 N GAPDH and ACTB (Fig. 8A). This order indicates that GAPDH and ACTB are the most stable reference genes. In addition, geNorm also calculated the optimal number of reference genes by assessing the pairwise variations (Vn/n + 1) between each combination of sequential normalization factors. As shown in Fig. 8B, the V2/3 value was 0.026, which was below the cut-off value (0.15), thus the combination of GAPDH and ACTB was suitable for normalizing gene expression data. So we used the expression of GAPDH and ACTB to normalize the ECE1 mRNA expression. qPCR was used to analyze the ECE1 mRNA transcription levels in different tissues (including the liver, subcutaneous fat, kidney, muscle, stomach, heart, brain, spleen, pancreas, and lung) from Tibetan pigs. The ECE1 mRNA was detected in all the tissues tested. The expression level did not vary obviously among tissues. However, significant difference was observed in mRNA expression of the ECE1 gene between the heart and the pancreas (p b 0.05) (Fig. 9). Through Fig. 9, high expression levels of ECE1 were detected in the lung, heart, and liver; low expression levels were seen in the brain, stomach, and pancreas. As there still have lots of functions and protein levels we did not study, there might be many reasons for differential expression of the ECE1 gene.
4. Discussions
Fig. 6. The three dimensional structure of Tibetan pig ECE1 (84–753 AA) based on homology modeling using SWISS-MODEL.
ECE1 is a recently discovered gene that is involved in anti-hypoxia, and it is also upregulated in a variety of cancers (Smollich et al., 2007; Lee et al., 2009). This work will provide molecular basis for associate analysis DNA and amino acid sequence of the Tibetan pig ECE1 gene. In this study, the full-length cDNA sequence of ECE1 gene was cloned from the Tibetan pig, containing 2262 bp coding sequence (CDS) that encodes 753 amino acids, 2 bp 5′ terminal UTR and 1507 bp 3′ terminal UTR. The pig ECE1 protein, consistent with other animals' ECE1 proteins,
Y. Wang et al. / Gene 571 (2015) 237–244
243
Fig. 8. Ranking of gene stability and combination of genes for normalization factor calculation evaluated by geNorm. Results are presented according to the output file of the geNorm program. (A) Average expression stability values (M, y-axis) of 5 reference genes and the associated ranking from least to most stable expression (x-axis) as assessed by geNorm. Lower M value of average expression stability indicates more stable expression. (B) Determination of the optimal number of reference genes for normalization depending on a pairwise variation (V) analyses.
Fig. 7. Phylogenetic tree and alignment of the ECE1 amino acid sequences from Tibetan pig and other species. The GenBank accession numbers of the ECE1 sequences are listed in Table 2. (A) Amino acid sequence alignment of Tibetan pig ECE1 with the predicted ECE1 sequences from eight other mammals. The sequence alignments were performed using CLUSTALW2. (B) Phylogenetic tree of the amino acid sequences of ECE1 from pig and other mammals. The tree was constructed using the Neighbor Joining method in the MEGA 6.06 software.
has no signal peptide, but contains an obvious transmembrane domain. It is possible that pig ECE1 protein may play functions through these domains.
Fig. 9. Tissue distribution of Tibetan pig ECE1 gene expression by qPCR analysis. The GAPDH and ACTB are served as internal controls. Asterisks indicate differences that are statistically significant (*p b 0.05).
244
Y. Wang et al. / Gene 571 (2015) 237–244
The phylogenetic tree analysis revealed that the translated Tibetan pig ECE1 amino acid sequence had a close genetic relationship with ECE1 sequences from other mammals. These implied that Tibetan pig should also be a better model animal to study the ECE1 gene functions. In this study, we identified a 3771 bp full-length cDNA product. Through using BLAST searching, we determined that the product corresponded to ECE1, but the 3′ terminal UTR is about 800 bp less than the predicted sequence of NCBI (GenBank: XM_005665089.1). Until now, ECE1 has been noted and well studied in human (Schmidt et al., 1994; Kotani et al., 2013), mouse (Lindenau et al., 2006; Hartopo et al., 2013) and so on. In our study, we know that the pig ECE1 is 3771 bp in length, and the coding region of porcine size is 2262 bp encoding 753 amino acid residues. The derived amino acid sequence of ECE1 is well conserved compared with ECE1 of various species, and it has a higher degree of sequence similarity with other mammalian (96%–98%). From the NCBI, we know that many species ECE1 sequences were just predicted sequences, and most sequences are vacant, especially pigs. ECE1 full-length cDNA sequence cloning has been completed in human beings (Shimada et al., 1995a, 1995b; Kotani et al., 2013). Human ECE is a kind of membrane bound peptide enzyme in metal, and belongs to the neutral endopeptidase (NEP) family (Whyteside et al., 2014). According to the report, human ECE was composed of 758 amino acid residues and its molecular structure consisted of a short N-terminal cytoplasmic tail, a transmembrane hydrophobic region, and a large extracellular region (Comuzzie et al., 2012; Li et al., 2012). This was very similar to our research in Tibetan pigs. It also showed that pig ECE1 protein has highly homology with humans. The qPCR results showed that the Tibetan pig ECE1 mRNA expression levels were similar in most of the tested tissues. However, compared to its expression in the other tissues, ECE1 was more highly expressed in the heart and lung of the pigs. In humans (Schmidt et al., 1994) and mice (Lindenau et al., 2006), ECE1 was primarily expressed in the lung and adrenal gland compared with other organs (Birse et al., 1993; Maas et al., 1995). The heart and lung seem to be important organs for resisting hypoxia. The expression level of ECE-1α mRNA was higher than that of ECE-1β in various rat cells and tissues, suggesting that the physiologically important isoform is ECE-1α (Shimada et al., 1995a, 1995b). As we still did not study the differences of the four isoforms, there might be many reasons for differential expression of the four isoforms. Our results show that the ECE1 expression levels in the lung and heart have a high level than other tissues. However, the heart and lung are important parts to the cardiopulmonary function, which seriously affect the ability to resisting hypoxia, so this result further confirmed ECE1 as a candidate gene for anti-hypoxia. In conclusion, we isolated the Tibetan pig ECE1 gene and used various bioinformatics tools to analyze the gene and the predicted protein sequences. We predicted the molecular structure of the ECE1 protein and analyzed the temporal and spatial mRNA expression differences in ten tissues of Tibetan pig. The information that was obtained provides an important basis for conducting future studies on the functions and regulatory mechanisms underlying the role of ECE1 in resisting hypoxia, and provides an important theoretical basis for further research in molecular-assisted selection during animal breeding. Acknowledgment This study was supported by the National Animal Breed Resource Preserve Project of China (No. 2130135), the National Project for Breeding Transgenic Pigs of China (No. 2013ZX08006-002), Shandong Province Modern Pig Technology and Industry System Project (No. SDAIT-06022-03) and Shandong Province Agricultural Animal Breeding Project of China (No. 2013LZ02-015).
References Ball, K.A., Nelson, A.W., Foster, D.G., Poyton, R.O., 2012. Nitric oxide produced by cytochrome c oxidase helps stabilize HIF-1α in hypoxic mammalian cells. Biochem. Biophys. Res. Commun. 420, 727–732. Birse, C.E., Irwin, M.Y., Fonzi, W.A., S. PS, 1993. Cloning and characterization of ECE1, a gene expressed in association with cell elongation of the dimorphic pathogen Candida albicans. Infect. Immun. 61, 3648–3655. Chaillou, T., et al., 2013. Effect of hypoxia exposure on the phenotypic adaptation in remodelling skeletal muscle submitted to functional overload. Acta Physiol. 209, 272–282. Comuzzie, A.G., et al., 2012. Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. PLoS One 7, e51954. Dong, K.-z, et al., 2014. Genetic variation of EPAS1 gene in Tibetan pigs and three lowaltitude pig breeds in China. J. Integr. Agric. 13, 1990–1998. Gou, W., et al., 2014. Expression pattern of heme oxygenase 1 gene and hypoxic adaptation in chicken embryos. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 174, 23–28. Hartopo, A.B., et al., 2013. Endothelin-converting enzyme-1 gene ablation attenuates pulmonary fibrosis via CGRP-cAMP/EPAC1 pathway. Am. J. Respir. Cell Mol. Biol. 48, 465–476. Kon, M., et al., 2014. Effects of systemic hypoxia on human muscular adaptations to resistance exercise training. Physiol Rep. 2 (6). Koscica, K.L., Sylvestre, G., R. SE, 2004. The effect of phosphoramidon on inflammationmediated preterm delivery in a mouse model. Am. J. Obstet. Gynecol. 190, 528–531. Kotani, T., et al., 2013. Altered expression of enzymes regulating the activity of endothelin-1 in the lower segment of the human amnion during labor. Biol. Reprod. 89, 52. Lee, S., Carter, P.R., Watts, M.N., Bao, J.R., Harris, N.R., 2009. Effects of the endothelinconverting enzyme inhibitor SM-19712 in a mouse model of dextran sodium sulfate-induced colitis. Inflamm. Bowel Dis. 15, 1007–1013. Li, Y., et al., 2012. A polymorphic microsatellite repeat within the ECE-1c promoter is involved in transcriptional start site determination, human evolution, and Alzheimer's disease. J. Neurosci. 32, 16807–16820. Lindenau, S., von Langsdorff, C., Saxena, A., Paul, M., Orzechowski, H.-D., 2006. Genomic organisation of the mouse gene encoding endothelin-converting enzyme-1 (ECE-1) and mRNA expression of ECE-1 isoforms in murine tissues. Gene 373, 109–115. Lorenzo, M.-N., et al., 2001. Human endothelin converting enzyme-2 (ECE2): characterization of mRNA species and chromosomal localization. Biochim. Biophys. Acta (BBA) Gene Struct. Expression 1522, 46–52. M, Y., et al., 1988. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature 332, 411–415. Maas, J., D'Orléans-Juste, P., Yano, M., Rae, G.A., 1995. Evidence for atypical endothelin receptors and for presence of endothelin-converting enzyme activity in the mouse isolated vas deferens. Eur. J. Pharmacol. 276, 113–121. McBryan, J., Hamill, R.M., Davey, G., Lawlor, P., Mullen, A.M., 2010. Identification of suitable reference genes for gene expression analysis of pork meat quality and analysis of candidate genes associated with the trait drip loss. Meat Sci. 86 (2), 436–439. Nygard, A.B., Jørgensen, C.B., Cirera, S., Fredholm, M., 2007. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol. Biol. http://dx.doi.org/10.1186/1471-2199-8-67. Schmidt, M., et al., 1994. Molecular characterization of human and bovine endothelin converting enzyme (ECE-1). FEBS Lett. 356, 238–243. Schweizer, A., Valdenaire, O., Nelbock, P., Deuschle, U., Dumas Milne Edwards, J.B., et al., 1997. Human endothelin-converting enzyme (ECE-1): three isoforms with distinct subcellular localizations. Biochem. J. 328, 871–877. Shimada, K., et al., 1995a. Cloning and functional expression of human endothelinconverting enzyme cDNA. Biochem. Biophys. Res. Commun. 207, 807–812. Shimada, K., Takahashi, M., Ikeda, M., Tanzawa, K., 1995b. Identification and characterization of two isoforms of an endothelin-converting enzyme-1. FEBS Lett. 371, 140–144. Smollich, M., et al., 2007. On the role of endothelin-converting enzyme-1 (ECE-1) and neprilysin in human breast cancer. Breast Cancer Res. Treat. 106, 361–369. Valdenaire, O., Lepailleur-Enouf, D., Egidy, G., Thouard, A., Barret, A., 1999. A fourth isoform of endothelin-converting enzyme (ECE-1) is generated from an additional promoter molecular cloning and characterization. Eur. J. Biochem. 341–349. Vandesompele, J., Preter, K.D., Pattyn, F., Poppe, B., Roy, N.V., Paepe, A.D., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (7) (research 0034.1– research 0034.11). Weissberg, P.L., Witchell, C., Davenport, A.P., Hesketh, T.R., Metcalfe, J.C., 1990. The endothelin peptides ET-1, ET-2, ET-3 and sarafotoxin S6b are co-mitogenic with platelet-derived growth factor for vascular smooth muscle cells. Atherosclerosis 85, 257–262. Whyteside, A.R., Turner, A.J., L. DW, 2014. Endothelin-converting enzyme-1 (ECE-1) is post-transcriptionally regulated by alternative polyadenylation. PLoS One 9, e83260. Xiong, H.-t., Gao, Y.-h., Liu, D., Wang, Y.-z., Du, H.-h., 2015. High level of hepcidin mRNA expression is associated with high production of immune factors in Tibetan pigs. Livest. Sci. 171, 73–77. Xu, D., et al., 1994. ECE-1: a membrane-bound metalloprotease that catalyzes the proteolytic activation of big endothelin-1. Cell 78, 473–485. Yanagisawa, H., et al., 1998. Dual genetic pathways of endothelin-mediated intercellular signaling revealed by targeted disruption of endothelin converting enzyme-1 gene. Development 125, 825–836.