Molecular detection and identification of hemoparasites in pampas deer (Ozotoceros bezoarticus Linnaeus, 1758) from the Pantanal Brazil

Ticks and Tick-borne Diseases 4 (2013) 341–345

Contents lists available at SciVerse ScienceDirect

Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis

Original article

Molecular detection and identification of hemoparasites in pampas deer (Ozotoceros bezoarticus Linnaeus, 1758) from the Pantanal Brazil Júlia A.G. Silveira a , Élida M.L. Rabelo a , Ana C.R. Lacerda b , Paulo A.L. Borges b , Walfrido M. Tomás b , Aiesca O. Pellegrin b , Renata G.P. Tomich b , Múcio F.B. Ribeiro a,∗ a b

Departamento de Parasitologia, ICB – UFMG, Minas Gerais, Brazil EMBRAPA-Pantanal (Brazilian Enterprise for Agricultural Research), Mato Grosso do Sul, Brazil

a r t i c l e

i n f o

Article history: Received 31 July 2012 Received in revised form 21 January 2013 Accepted 21 January 2013 Available online 6 April 2013 Keywords: Hemoparasites Brazilian deer Ozotoceros bezoarticus Molecular detection

a b s t r a c t Hemoparasites were surveyed in 60 free-living pampas deer Ozotoceros bezoarticus from the central area of the Pantanal, known as Nhecolândia, State of Mato Grosso do Sul, Brazil, through the analysis of nested PCR assays and nucleotide sequencing. Blood samples were tested for Babesia/Theileria, Anaplasma spp., and Trypanosoma spp. using nPCR assays and sequencing of the 18S rRNA, msp4, ITS, and cathepsin L genes. The identity of each sequence was confirmed by comparison with sequences from GenBank using BLAST software. Forty-six (77%) pampas deer were positive for at least one hemoparasite, according to PCR assays. Co-infection occurred in 13 (22%) animals. Based on the sequencing results, 29 (48%) tested positive for A. marginale. Babesia/Theileria were detected in 23 (38%) samples, and according to the sequencing results 52% (12/23) of the samples were similar to T. cervi, 13% (3/23) were similar to Babesia bovis, and 9% (2/23) were similar to B. bigemina. No samples were amplified with the primers for T. vivax, while 11 (18%) were amplified with the ITS primers for T. evansi. The results showed pampas deer to be co-infected with several hemoparasites, including species that may cause serious disease in cattle. Pampas deer is an endangered species in Brazil, and the consequences of these infections to their health are poorly understood. © 2013 Elsevier GmbH. All rights reserved.

Introduction Natural habitats of cervids have been significantly transformed through intense deforestation driven by the needs of farmers and cattle breeders. As a consequence, many cervids have begun living in proximity to domestic animals and humans. Some diseases are associated with spill-over from domestic animals to nearby wildlife populations (Daszak et al., 2000). The emergence of tickborne diseases is associated with interactions of pathogens in a zoonotic relationship with wildlife, domestic animals, and human populations (Daszak et al., 2000; Munderloh and Kurtti, 2010). Hemoparasites are a serious problem in domestic ruminants living close to wild animals, particularly deer, in South America (Duarte, 1997). The pampas deer, Ozotoceros bezoarticus, is on the list of endangered species in Brazil (IUCN, 2012). It characteristically lives in open habitats and primarily occupies the central areas of the Pantanal wetlands where grasslands and open savanna dominate. Within this area, Nhecolândia supports the highest population

∗ Corresponding author. Tel.: +55 31 34092842; fax: +55 31 34092970. E-mail address: [email protected] (M.F.B. Ribeiro). 1877-959X/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.ttbdis.2013.01.008

density of pampas deer (Tomás, 1995; Merino et al., 1997; Mourão et al., 2000). Anaplasma, Babesia, and Trypanosoma are the major hemoparasites reported in domestic ruminants in Brazil (Madruga, 2004; Barros et al., 2005). Hard ticks are vectors of anaplasmosis and babesiosis, and hematophagus Diptera are vectors of trypanosomiasis and anaplasmosis (Gardiner, 1989; Cohn, 2003; Madruga, 2004; Barros et al., 2005). Cervids can be infected with these hemoparasites, suggesting an interchange of pathogens between wild and domestic animals (Duarte, 2007). Although the impact of such parasites on wild cervids is not known, clinical manifestations have been reported in a single immunosuppressed individual (Perry et al., 1985). Investigations of the infection of cervids with hemoparasites in Brazil are scarce. Anaplasmataceae agents have been detected in wild ruminants (Machado et al., 2006; Picoloto et al., 2010; Sacchi et al., 2012; Silveira et al., 2012). Machado and Müller (1996) reported the prevalence of B. bovis and B. bigemina in pampas deer from the State of Goiás, and a high prevalence of Theileria spp. was detected in Minas Gerais (Silveira et al., 2011). Herrera et al. (2010) recorded T. evansi in pampas deer on the Pantanal. The aim of the present study was to survey hemoparasites in free-living pampas deer from Nhecolândia in the Pantanal, State

342

J.A.G. Silveira et al. / Ticks and Tick-borne Diseases 4 (2013) 341–345

Fig. 1. Map showing the location of the study area in Brazilian Pantanal subregions (the dot in the region 6 corresponds to the area from where deer were captured).

of Mato Grosso do Sul, Brazil, through nested PCR assays and nucleotide sequencing.

Blood-sampling

Materials and methods

Samples of blood collected by puncture of the jugular vein were transferred immediately to vials without anticoagulant. After centrifugation, aliquots of erythrocyte layers were frozen and stored for subsequent DNA extraction.

The research was approved by the Ethical Committee on Animal Experimentation (CETEA/UFMG, Belo Horizonte, MG, Brazil) under protocol no. 142/08, and by the Brazilian Institute for Environment and Natural Renewable Resources (IBAMA, 032/2005, 0214.0022008/05-00).

DNA extraction and PCR amplification

Pampas deer samples Sixty pampas deer were captured in a livestock farm from Nhecolândia a Brazilian Pantanal sub region (18◦ 59 115 S 56◦ 37 63 N), in 2006 where the main economic activity is based on extensive breeding on natural pastures (Fig. 1). The animals were restrained by anesthetic dart (Distinject, model 35 or blowpipe, Zootech). Chemical anesthesia with tiletamine/zolazepam (1.0 mg/kg), xylazine (0.1 mg/kg), and atropine (0.01 mg/kg) was administered to animals, and intravenous injection of yohimbine was used to reverse anesthesia. Data regarding age and sex were recorded during clinical examination.

DNA was extracted from 300 ␮l of erythrocyte layers using a Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) following the manufacturer’s instructions for isolation of genomic DNA from whole blood. Prior to DNA extraction, samples were incubated with 15 ␮l of 5% saponin at 37 ◦ C for 10 min and washed 6 times with 900 ␮l cell lysis solution. The PCR was performed in 2 stages by nested PCR. An aliquot of the first amplified PCR product was used for a second PCR with a second set of primers. These were chosen to amplify the target sequence of the first PCR, thereby increasing sensitivity. Sets of primers were used to detect hemoparasite species (Table 1). Twice-distilled water was used as the negative control (no DNA). For the positive control, DNA was extracted from 300 ␮l of whole blood of host species of each target parasite. A calf experimentally infected with A. marginale and another experimentally

J.A.G. Silveira et al. / Ticks and Tick-borne Diseases 4 (2013) 341–345

343

Table 1 Specific primers used for the detection of hemoparasites. Specificity

Primer sequence (5 –3 )

Target

Name

Product size (pb)

Reference

A. marginale/A. ovis 1st reaction 2nd reaction

GGGAGCTCCTATGAATTACAGAGAATTGTTTAC CCGGATCCTTAGCTGAACAGGAATCTTGC CGCCAGCAAACTTTTCCAAA ATATGGGGACACAGGCAAAT

msp4

MSP45 MSP43 AnapF AnapR

872

de la Fuente et al., 2008

294

Silveira et al., 2011

Babesia/Theileria 1st reaction

18S rRNA 18S rRNA

RIB-19 RIB-20 BAB-rumF BAB-rumR

1700

Zahler et al., 2000

430

Silveira et al., 2011

2nd reaction

CGGGATCCAACCTGGTTGATCCTGC CCGAATTCCTTGTTACGACTTCTC ACCTCACCAGGTCCAGACAG GTACAAAGGGCAGGGACGTA

T. evansi 1st reaction 2nd reaction

GCACAGTATGCAACCAAAAA GTGGTCAACAGGGAGAAAAT CATGTATGTGTTTCTATATG

ITS

280

a

ITS

Te1F Te1R Te2F

219

a

T. vivax

GCCATCGCCAAGTACCTCGCGA TTAGAATTCCCAGGAGTTCTTGATGATCCAGTA

Cathepsin L

Tvi2 DTO156

177

Bezerra et al., 2008

a

msp4

Trypanosoma evansi ITS fragment identified by aligning sequences from T. evansi available at GenBank (http://www.ncbi.nlm.nih.gov).

infected with B. bovis and B. bigemina were used for the amplification of the msp4 gene of A. marginale and the 18S rRNA region of Babesia and Theileria species, respectively. Mice experimentally infected with T. evansi were used for amplification of the ITS region, and a cow naturally infected with T. vivax, diagnosed by blood smear, nPCR, and nucleotide sequencing was used for the amplification of the catalytic domain of cathepsin L of T. vivax. The first reaction mixture comprised 1.2 ␮l dNTPs (2.5 mM), 0.15 ␮l Taq polymerase (Phoneutria, Belo Horizonte, MG, Brazil) (0.05 U), 1.5 ␮l reaction buffer IB (1×), 0.6 ␮l of a solution containing the mixed primers (10 mM), and 10.05 ␮l sterile ultra-pure water. A 1.5 ␮l aliquot of the DNA template was added to the reaction mixture to give a final volume of 15 ␮l. The second reaction mixture comprised 2.0 ␮l dNTPs (2.5 mM), 0.25 ␮l Taq polymerase (0.05 U), 2.5 ␮l reaction buffer IB (1×), and 1.0 ␮l of a solution containing the mixed primers (10 mM) and 16.75 ␮l sterile ultra-pure water. An aliquot (2.5 ␮l) of amplicon obtained in the first reaction was added to the reaction mixture to give a final volume of 25 ␮l. Amplification was performed using an Eppendorf Mastercycler thermocycler (Eppendorf, São Paulo, SP, Brazil). The program used for amplification was 94 ◦ C for 5 min (initial denaturation step), 30 cycles of 92 ◦ C for 1 min (denaturation), 54 ◦ C (to amplify A. marginale/A. ovis and Babesia/Theileria) and 56 ◦ C (to amplify T. vivax and T. evansi) for 1 min (annealing), 72 ◦ C for 2 min, and a final extension step at 72 ◦ C for 8 min. Following amplification, reaction mixtures were maintained at 12 ◦ C. PCR amplicons were separated by electrophoresis on 1% agarose gel (40 min, 100 V), stained with GelRedTM (Biotium) and visualized under ultraviolet light. The positive PCR products were subsequently purified with QIAquick PCR Purification Kit (Qiagen Biotecnologia Brasil, São Paulo, Brasil) following the manufacturer’s instructions. Sequencing of the purified amplicons was performed on a MegaBACE 1000 DNA Analysis System (GE Healthcare, Waukesha, WI, USA) using second reaction primers. Sequences were aligned, edited, and analyzed at URL http://asparagin.cenargen.embrapa.br/phph/ and using MEGA 5.0 software (Tamura et al., 2011). The identity of each sequence was confirmed by comparison with sequences available from GenBank using BLAST software.

Results Forty-six (77%) pampas deer were positive for hemoparasites according to PCR assays. Based on the sequencing results of the msp4 gene fragment, 29 (48%) of the deer tested were positive for A. marginale. These comprised 31% adult males, 31% adult females, 14% young males, 17% young females, and 7% with no identification. BLAST analysis of the amplicon sequences showed high identity (95–100%) with A. marginale strains deposited in GenBank and 100% identity with Brazilian cervid strains (JN022574.1, JN022572.1, JN022571.1, JN022570.1, JN022564.1, JN022563.1, JN022560.1, JN022557.1, JN022556.1). Babesia and Theileria were detected in 23 (38%) of the deer, but 6 samples were not sequenced successfully. BLAST analysis of the amplicon sequences showed identity with samples deposited in GenBank, with 12 of the 23 (52%) samples showing 90–100% similarity to T. cervi (accession number gbHQ184412.1) and 3 samples 100% identical to the MGI12 sample (accession number HM466922) from Brazilian Mazama gouazoubira; 3 samples (13%) with B. bovis (87–100% identity to samples from white-tailed deer Odocoileus virginianus isolates HQ264127.1 and GU938850.1); and 2 samples (9%) with B. bigemina (99–100% maximum identity with bovine B. bigemina isolates EF458206.1 and EF458205.1). Deer positive for T. cervi comprised 6 (50%) adult males, 2 (17%) adult females, 2 (17%) young females, one (8%) young male, and one (8%) not identified. One adult female, one adult male, and one young male were positive for B. bovis. Finally, one adult male and one adult female were positive for B. bigemina. No amplification was obtained with the primers specific for T. vivax. Eleven animals (18%), had the ITS region amplified for T. evansi, although only 2 samples were successfully sequenced (87 and 94% identity with accession numbers HQ593643.1 and AY912276.1). Of the 11 positive animals, 3 were adult males (27%), 3 were adult females (27%), 2 were young males (18%), 2 were young females (18%), and one was not identified (9%). Pampas deer were co-infected with combinations of 2 pathogens: A. marginale/T. cervi, A. marginale/T. evansi, T. evansi/T. cervi, T. evansi/B. bovis, and T. evansi/B. bigemina. Co-infection occurred in 13 (22%) deer, 9 of which were adult (54%) and 4 immature animals (31%) (Table 2).

Discussion Nucleotide sequence accession numbers The msp4, 18S rRNA, and ITS gene sequences have been deposited in GenBank under accession numbers JX274262–JX274294.

The identification of infectious agents in wild deer is not only crucial for species protection, but also for providing valuable information regarding the epidemiological links to disease. The results of this study and other studies of the same research group showed

344

J.A.G. Silveira et al. / Ticks and Tick-borne Diseases 4 (2013) 341–345

Table 2 Pampas deer co-infected with hemoparasites according to pathogen, sex, and age. Co-infection

A. marginale/T. cervi A. marginale/T. evansi T. evansi/T. cervi T. evansi/B. bovis T. evansi/B. bigemina

Total (n = 60)

7% (4) 7% (4) 2% (1) 5% (3) 2% (1)

Female

Male

Adult

Young

Adult

Young

2% (1) 0 2% (1) 2% (1) 2% (1)

2% (1) 3% (2) 0 0 0

3% (2) 3% (2) 0 2% (1) 0

0 0 0 2% (1) 0

3 species of Brazilian deer (O. bezoarticus from Mato Grosso do Sul state, M. gouazoubira, and Blastocerus dichotomus from Minas Gerais state) co-infected with several hemoparasites, including phylogenetically related species and those infective to humans and domestic animals (Silveira et al., 2011, 2012). Prevalence of A. marginale infection reported here was higher than described by Picoloto et al. (2010) (16.3%) from other populations of pampas deer in the Pantanal, but is lower than values reported for other cervids such as brown brocket deer and marsh deer from Minas Gerais (78.6%) (Silveira et al., 2012). The msp4 gene and protein sequences have been used for phylogenetic studies on members of the Anaplasmataceae and for the genetic characterization of Anaplasma spp. (reviewed by de la Fuente et al., 2005). The nucleotide sequences of the msp4 gene aligned on the MEGA 5.0 (Tamura et al., 2011) were identical to sequences obtained for A. marginale in M. gouazoubira and B. dichotomus from Minas Gerais (Silveira et al., 2012). This reinforces the value of the msp4 gene in studies of geographic distribution of this pathogen, without apparent changes related to host origin (de la Fuente et al., 2001). Babesia and Theileria were detected in 38% of the pampas deer, a smaller proportion than was detected in brown brocket deer and marsh deer from Minas Gerais (71.4%) (Silveira et al., 2011). Molecular and serological tests in pampas deer from the same region demonstrated a high prevalence of Babesia sp. (Villas-Boas, 2007). Machado and Müller (1996) found 8.3% and 29.7% of the pampas deer from Parque Nacional das Emas, Goiás, Brazil, positive for B. bovis and B. bigemina, respectively. B. bovis samples in the present study showed close similarity with B. bovis-like infections from white-tailed deer in south Texas (USA) (Ramos et al., 2010) which, according to the authors, probably do not infect bovines, because bovine babesiosis is not common in the region. This is important, since wild ruminants are a reservoir of several infectious agents that, despite being closely related to bovine parasites, do not infect cattle. Trypanosomiasis is common on the Pantanal, because the climatic conditions are favorable for the development of the vectors (Herrera et al., 2004, 2005). Thus, more animals positive to Trypanosoma spp. were expected than were observed in the present study. Herrera et al. (2010) found 68.9% of pampas deer sampled from the same region to be positive for T. evansi and 21.6% positive to T. vivax. This difference may be related to the methodology used. In this study, we used erythrocytes, and most Trypanosoma specimens may have been removed along with the buffy coat and plasma, decreasing the number of trypanosomes in the samples (Woo, 1970). Co-infection of 2 pathogens was detected in 22% of animals. Coinfection was most common in older animals (69%) that had been in long-term contact with the vectors and could remain carriers, at least for Babesia and Theileria. Conclusion The consequences of co-infection with several hemoparasites for deer health are poorly understood, although when stressed, the

deer may become immunosuppressed, favoring the emergence of clinical signs of infection. Some of these pathogens can seriously affect cattle, and when cattle and pampas deer live in close proximity, as in Pantanal, the risk of cross contamination is greatly increased with consequences for animal husbandry and free-living deer. Acknowledgments The authors are grateful to CAPES (Coordenac¸ão de Aperfeic¸oamento de Pessoal de Nível Superior), to IBAMA (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis), and to EMBRAPA-Pantanal (Brazilian Enterprise for Agricultural Research). We thank Lucidus Consultancy for improving the English, and for all contributions that allowed us to execute the present study. References Barros, S.L., Madruga, C.R., Araújo, F.R., Menk, C.F., de Almeida, M.A., Melo, E.P., Kessler, R.H., 2005. Serological survey of Babesia bovis, Babesia bigemina, and Anaplasma marginale antibodies in cattle from the semi-arid region of the state of Bahia, Brazil, by enzyme-linked immunosorbent assays. Mem. Inst. Oswaldo Cruz 100, 613–617. Bezerra, F.S.B., Garcia, H.A., Alves, H.M., Oliveira, I.R.S., Silva, A.E., Teixeira, M.M.G., Batista, J.S., 2008. Trypanosoma vivax nos tecidos testicular e epididimário de ovinos experimentalmente infectados. Pesq. Vet. Bras. 28, 575–582. Cohn, L.A., 2003. Ehrlichiosis and related infections. Vet. Clin. Small Anim. Pract. 33, 863–884. Daszak, P., Cunningham, A.A., Hyatt, A.D., 2000. Emerging infectious diseases of wildlife-threats to biodiversity and human health. Sci. Compass 287, 443–449, Available: www.sciencemag.org de la Fuente, J., Van Den Bussche, R.A., Kocan, K.M., 2001. Molecular phylogeny and biogeography of North American isolates of Anaplasma marginale (Rickettsiaceae:Ehrlichieae). Vet. Parasitol. 97, 65–76. de la Fuente, J., Lew, A., Lutz, H., Meli, M.L., Hofmann-Lehmann, R., Shkap, V., Molad, T., Mangold, A.J., Almazan, C., Naranjo, V., Gortazar, C., Torina, A., Caracappa, S., Garcıa-Perez, A.L., Barral, M., Oporto, B., Ceci, L., Carelli, G., Blouin, E.F., Kocan, K.M., 2005. Genetic diversity of Anaplasma species major surface proteins and implications for anaplasmosis serodiagnosis and vaccine development. Anim. Health Res. Rev. 6, 75–89. de la Fuente, J., Ruiz-Fons, F., Naranjo, V., Torina, A., Rodríguez, O., Gortázar, C., 2008. Evidence of Anaplasma infections in European roe deer (Capreolus capreolus) from southern Spain. Res. Vet. Sci. 84, 382–386. Duarte, J.M.B. (Ed.), 1997. Biologia e conservac¸ão de cervídeos Sul-americanos: Blastocerus, Ozotocerus e Mazama. FUNEP, Jaboticabal, p. 238. Duarte, J.M.B., 2007. Aftosa and other diseases in wildlife. In: One World One Health: Healthy Ecosystems, Livestocks and Human Livelihoods: An innovative Public-private Partnership, Oral presentation. Available at: http://www.oneworldonehealthorg/oct2007/presentations/duarte.html Gardiner, P.R., 1989. Recent studies of the biology of Trypanosoma vivax. Adv. Parasitol. 28, 229–313. Herrera, H.M., Dávila, A.M.R., Norek, A., Abreu, U.G.P., Souza, S.S., D’andrea, O.S., Jansen, A.M., 2004. Enzootiology of Trypanosoma evansi in Pantanal. Brazil. Vet. Parasitol. 125, 263–275. Herrera, H.M., Norek, A., Freitas, T.P.T., Rademaker, V., Fernandes, O., Jansen, A.M., 2005. Domestic and wild mammals infection by Trypanosoma evansi in a pristine area of the Brazilian Pantanal region. Parasitol. Res. 96, 121–126. Herrera, H.M., Dávila, A.M.R., Souza, S.S., Parreira, D.R., Abreu, U.G.P., Borges, P.A.L., Lacerda, A.C.R., Zucco, C.A., Tomás, W.M., Mourão, G.M., 2010. Infecc¸ão por Trypanosoma evansi e Trypanosoma vivax em veado-campeiro (Ozotozeros bezoarticus, Cervidae, Perisodactyla) no pantanal da Nhecolândia, Mato Grosso do Sul, Brasil , Anais: XVI Congresso Brasileiro de Parasitologia Veterinária, Campo Grande, Mato Grosso do Sul, Brasil. IUCN-Red List of Threatened Species (Accessed: 28.01.12). Available: www.iucnredlist.org Machado, R.Z., Müller, E., 1996. Frequencia de anticorpos contra Babesia em Veadocampeiro (Ozotocerus bezoarticus) no Pantanal e no Parque das Emas. In: Duarte, J.M.B. (Ed.), Relatorio Final de Pesquisas do Projeto Veado-campeiro (Ozotocerus bezoarticus). FNMA, Brasilia, pp. 124–132 (cited by: Duarte, J.M.B., 2006. Artiodactyla – Cervidae (Veado – catingueiro, Veado-campeiro, Cervo - do - pantanal). In: Cubas, Z.S. (Ed.), Tratado de animais selvagens - Medicina Veterinária, São Paulo, Roca, pp. 641–664. Machado, R.Z., Duarte, J.M.B., Dagnone, A.S., Szabó, M.P.J., 2006. Detection of Ehrlichia chaffeensis in Brazilian marsh deer (Blastocerus dichotomus). Vet. Parasitol. 139, 262–266. Madruga, C., 2004. Diagnóstico e epidemiologia do Trypanosoma (Duttonella) vivax no Brasil. Rev. Bras. Parasitol. Vet. 13, 46–47.

J.A.G. Silveira et al. / Ticks and Tick-borne Diseases 4 (2013) 341–345 Merino, M.L., Gonzales, S., Leeuwenberg, F., Rodrigues, F.H.G., Pinder, L., Tomas, W.M., 1997. Veado-campeiro (Ozotocerus bezoarticus). In: Duarte, J.M.B. (Ed.), Biologia e conservac¸ão de cervídeos Sul-americanos: Blastocerus, Ozotocerus e Mazama. FUNEP, Jaboticabal, pp. 42–58. Mourão, G., Coutinho, M., Mauro, R., Campos, Z., Tomas, W., Magnusson, W., 2000. Aerial surveys of caiman, marsh-deer and pampa-deer in the Pantanal Wetland of Brazil. Biol. Conserv. 92, 175–183. Munderloh, U.G., Kurtti, T.J., 2010. Emerging and re-emerging tick-borne diseases: new challenges at the interface of human and animal health. (Accessed: 08.11.12). Available at: http://www.iom.edu Perry, B.D., Nichols, D.K., Cullom, E.S., 1985. Babesia odocoilei (Emmerson and Wright, 1970), in white-tailed deer, Odocoileus virginianus in Virginia. J. Wildl. Dis. 21, 149–152. Picoloto, G., Ferreira de Lima, R., Olegário, L.A.O., Carvalho, C.M.E., Lacerda, A.C.R., Tomás, W.M., Borges, P.A.L., Pellegrin, A.O., Madruga, C.R., 2010. Real-time polymerase chain reaction to diagnose Anaplasma marginale in cattle and deer (Ozotoceros bezoarticus leucogaster) of the Brazilian Pantanal. Rev. Bras. Parasitol. Vet. 19, 186–188. Ramos, C.M., Cooper, S.M., Holman, P.J., 2010. Molecular and serologic evidence for Babesia bovis-like parasites in white-tailed deer (Odocoileus virginianus) in south Texas. Vet. Parasitol. 172, 214–220. Sacchi, A.B.V., Duarte, J.M.B., André, M.R., Machado, R.Z., 2012. Prevalence and molecular characterization of Anaplasmataceae agents in free-ranging Brazilian marsh deer (Blastocerus dichotomus). Comp. Immunol. Microb. 35, 325–334.

345

Silveira, J.A.G., Rabelo, E.M.L., Ribeiro, M.F.B., 2011. Detection of Theileria and Babesia in brown brocket deer (Mazama gouazoubira) and marsh deer (Blastocerus dichotomus) in the State of Minas Gerais. Brazil. Vet. Parasitol. 177, 61–66. Silveira, J.A.G., Rabelo, E.M.L., Ribeiro, M.F.B., 2012. Molecular detection of tickborne pathogens of the family Anaplasmataceae in Brazilian brown brocket deer (Mazama gouazoubira, Fischer, 1814) and marsh deer (Blastocerus dichotomus, Illiger, 1815). Transbound Emerg. Dis. 59, 353–360. Tomás, W.M., 1995. Seasonality of the antler cycle of Pampa deer (Ozotoceros bezoarticus leucogaster) from the Pantanal wetland, Brazil. Stud. Neotrop. Fauna Environ. 30, 221–227. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Villas-Boas, J.C., 2007. Survey of Babesia bovis and B. bigemina in Ozotoceros bezoarticus leucogaster deer in the Pantanal wetland, Nhecolandia, Brazil. In: Babesia World Summit 2, Palermo, Lombardo Editore, p. 109, Cited by: Canc¸ado, P.H.D., Zucco, C.A., Piranda, E.M., Faccini, J.L.H., Mourao, G.M., 2009. Rhipicephalus (Boophilus) microplus (Acari: Ixodidae) as a parasite of pampas deer (Ozotoceros bezoarticus) and cattle in Brazil’s Central Pantanal. Rev. Bras. Parasitol. Vet. 18, 42–46. Woo, P.T.K., 1970. The haematocrit centrifuge technique for the diagnosis of African trypanosomosis. Acta Trop. 27, 384–386. Zahler, M., Rinder, H., Schein, E., Gothe, R., 2000. Detection of a new pathogenic Babesia microti-like species in dogs. Vet. Parasitol. 89, 241–248.