- Email: [email protected]
Molecular detection of prokaryote and protozoan parasites in the commercial bivalve Ruditapes decussatus from southern Portugal
Aquaculture 370–371 (2012) 61–67
Contents lists available at SciVerse ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Molecular detection of prokaryote and protozoan parasites in the commercial bivalve Ruditapes decussatus from southern Portugal Pedro M. Costa ⁎, Sara Carreira, Jorge Lobo, Maria H. Costa IMAR — Instituto do Mar, Departamento de Ciências e Engenharia do Ambiente, Faculdade de Ciências e Tecnologia da Universidade Nova de Lisboa, 2829-0516 Caparica, Portugal
a r t i c l e
i n f o
Article history: Received 21 September 2012 Received in revised form 2 October 2012 Accepted 3 October 2012 Available online 7 October 2012 Keywords: Grooved carpet shell clam Infectious agents Bacteria Protista Histology PCR
a b s t r a c t A parasite screening combining histological and molecular techniques was performed on healthy grooved carpet shell clams collected from a commercial shellfish bed in Southern Portugal. The study included the first attempt to develop molecular techniques to detect and identify Rickettsia/Chlamydia-like bacteria and gill ciliates infecting this high-value bivalve. Although the animals failed to reveal significant pathologies relatable to infectious agents, both techniques detected low-moderate levels of infection by bacteria and protozoans, the latter including the apicomplexan Perkinsus olseni, the ciliate Boveria subcylindrica and a yet unclassified haplosporidian. Infections by P. olseni and bacteria were the most frequent and most disseminated within the two surveyed organs, gills and digestive glands. Gill and digestive gland bacteria belonged to distinct groups, the former more related to Rickettsiales and the latter to Chlamydiales. However, while gill bacteria could be clearly allocated within the Spongiobacter/Endocoizomonas group, thus likely belonging to Oceanospirillales, no evident taxonomic position could be attributed to digestive gland bacteria, most possibly consisting of a new species of parasite. In face of the current findings, symbiotic or commensal relationships between these bacteria and the bivalve should not be excluded. The results showed that healthy clams act as a repository of multiple agents of infection, which is of particular importance to a species that is known to be particularly sensitive to parasitism. The PCR techniques developed for the detection of Boveria sp. and bacteria were proven efficient and were appended to the methods for Perkinsus sp. and haplosporidians described elsewhere. © 2012 Elsevier B.V. All rights reserved.
1. Introduction The grooved carpet shell clam Ruditapes decussatus (L.), Bivalvia: Veneridae (=Venerupis decussata), is one of the most valuable bivalves in SW Europe, especially in Portugal, where the species stands as one of the most important mariculture produces, with the Ria Formosa lagoon (Algarve, Southern Portugal), being the most important production area (refer, e.g., to Matias et al., 2009; Teixeira de Sousa et al., 2011, and references therein). This species has been found highly susceptible to environmental stressors such as marine pollution and, especially, parasites. Still, by contrast to other high-prized bivalves, like oysters, much research is still needed to screen the microbial communities affecting this species, to identify possible disease-causing agents and to develop rapid identification techniques. The most studied R. decussatus parasite is the apicomplexan protozoan Perkinsus olseni (=Perkinsus atlanticus). This parasite has been found responsible for massive clam mortalities in Portugal (Azevedo, 1989). The species affects R. decussatus populations throughout the Portuguese continental coast, apparently season-independently, although the levels of infections are fluctuating and likely modulated by anthropogenic stressors such as pollution (Leite et al., 2004). Still ⁎ Corresponding author. Tel.: +351 212 948 300x10103; fax: +351 212 948 554. E-mail address: [email protected] (P.M. Costa). 0044-8486/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.aquaculture.2012.10.006
regarding protistans, Azevedo (2001) identified a haplosporidian parasite in R. decussatus from Portuguese waters as being Minchinia tapetis, however, Robledo et al. (2002), described a haplosporidian infecting clams from NW Iberian Peninsula related to the genus Urosporidium. Previously, Navas et al. (1992) already described P. olseni and a haplosporidian identified as M. tapetis as the most significant parasites in R. decussatus and its invasive counterpart, Ruditapes philippinarum, in Southern Spanish waters. Although haplosporidians are known to cause severe mortalities in many valuable invertebrates, such as the parasite Bonamia spp. in oysters (see for instance Robert et al., 2009 and references therein), there is little knowledge on these parasites' background presence in R. decussatus. Vibrio tapetis remains the best studied bacterial parasite affecting clams, including R. decussatus, being the etiological agent of the “brown ring disease” (Borrego et al., 1996). Interestingly, V. tapetis has been found to modulate effects and responses to pollutants in bivalves (e.g. Paul-Pont et al., 2010), confirming the influence of bacteria (and likely other parasites) on the hosts' sensitivity/susceptibility towards environmental stressors and, therefore, yet another factor supporting the need to screen the bivalves' microbiota, since these organisms are widely employed in biomonitoring studies, including R. decussatus in Portugal (for instance Costa et al., in press; Cravo et al., 2012). In spite of the fair number of reports on Rickettsia/ Chlamydia-like bacterial infections in bivalves since the original
62
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
work by Harshbarger and Chang (1977), no true attempt, to date, has been performed to identify these organisms and to develop molecular tools that permit a rapid screening in the tissues of susceptible hosts, such as the PCR (polymerase chain reaction) protocols existing for many protistan parasites or even V. tapetis (see Balboa et al., 2011). Furthermore, the pathological impact of these organisms on their hosts is not entirely understood and data is occasionally conflicting. Elston (1986), for instance, reported no noticeable pathogenic effects of Rickettsia/Chlamydia-like bacteria in R. philippinarum, whereas Le Gall et al. (1988) related unidentified, gill-infecting, bacteria (presumably Rickettsia-like) to high mortalities in scallops. Mialhe et al. (1987), first described bacteria infecting R. decussatus from Portugal (Ria Formosa, Algarve), then classified as Rickettsia from histological observations but no formal classification or pathological studies were conducted. Overall, the lack of knowledge about these organisms deems the need to shed some light on their classification and to develop efficient screening methods for their detection if further studies, e.g., on their pathogenicity, are to be attempted. The present study primarily intends to detect and identify through molecular techniques, the most important parasites present in the gills and digestive glands of healthy clams from a natural commercial clam bed in Southern Portugal, with special emphasis on yet non-described ciliate and prokaryote Rickettsia/Chlamydia-like agents. 2. Methods and materials 2.1. Clam collection Clams (24–33 mm shell length) were collected from a seemingly healthy commercial shellfish bed located in an unpolluted area of the Ria Formosa coastal lagoon, Algarve, southern Portugal (Fig. 1), in November 2011. Approximately thirty randomly-selected animals were transported to the laboratory (≈ 2 h 30 min journey), alive, in a refrigerated container (≈ 10 °C) and processed immediately for species identification and gross health status confirmation. Following, digestive gland and gill samples were dissected for histological and molecular analyses. Clam parasites were not cultured during the present work.
Fig 1. Geographical location of the clam collection site (*), consisting of a commercial shellfish bed inside a coastal lagoon (Ria Formosa), in Algarve, Portugal.
2.2. Histology Parasites were identified histologically from gill and digestive gland samples fixed either in Bouin–Hollande's, Zenker's or Carnoy's solutions (formalin, mercury-chloride and ethanol based, respectively). All samples were fixed in the cold, for ≈36 h (in Bouin–Hollande's) or overnight (in Zenker's and Carnoy's). Samples were dehydrated in a progressive series of ethanol (70% to absolute), intermediately impregnated with xylenes and embedded in paraffin. Sections (3–5 μm thick) were stained with haematoxylin and eosin (HE), in the case of Bouinand Zenker-fixed samples or stained with the alcian blue + periodic acid/Schiff's + picric acid-based tetrachrome technique (TC) described by Costa and Costa (2012) in Carnoy-fixed specimens. All other techniques are described in further detail by Howard and Smith (1983). Slides were mounted with DPX resin. Observations were done with a DMLB model microscope equipped with a DFC480 digital camera (Leica Microsystems). 2.3. Molecular analyses Total DNA was extracted from gill and digestive gland samples using the E.Z.N.A. Mollusc DNA kit (Omega Bio-Tek), following the manufacturer's instructions. The quality and quantity of extracted DNA were assessed with a NanoDrop 1000 spectrophotometer (Thermo Scientific). Parasite sequences of ribosomal subunit RNA (rRNA) genes were amplified by PCR using an iCycler thermocycler (Bio-Rad) and a Taq DNA polymerase PCR kit (Invitrogen). The
molecular screening for protozoan parasites was achieved using previously published specific primer sets for known R. decussatus parasites, namely for P. olseni (de la Herrán et al., 2000) and haplosporidian-like organisms (Novoa et al., 2004). In absence of specific primers available in the literature, ciliates and Rickettsia/ Chlamydia-like bacteria required consensus primer design from the alignment of available sequences of similar organisms, with focus on marine species. It was primarily intended to obtain universal primers for marine ciliates and Rickettsia/Chlamydia-like bacteria. The sequences with the accessions U51554, U17354, U17355 and U17356 were aligned to design primers for ciliates and the sequences DQ118733, FJ154998, FM244838, JN392919, FJ532292 and AY114327 for bacteria. Table 1 summarizes the PCR primers used in the present study. Sequence isolation by PCR was achieved through 35–45 amplification cycles each comprising 45 s denaturation (94 °C), 40 s annealing (51 °C for all primer pairs) and 1 min 15 s extension (72 °C); after a 3 min initial denaturation period (94 °C) and followed by 10 min final extension period (72 °C). Sequencing was done from purified PCR products with an ABI 3730XL DNA analyser using the BigDye Terminator 3 kit (all from Applied Biosystems). Alignment and phylogenetic analyses were computed with MEGA5 (Tamura et al., 2011). Sequences were contrasted to available public-access non-redundant nucleotide databases (such as GenBank and EMBL) using the software BLAST (Altschul et al., 1990).
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
63
Table 1 Primers used in the present study and related information. Target parasite
Gene ID
Primer ID
Primer sequence (5′–3′)
Primer reference
Unknown haplosporidian
18S rRNA
Unknown ciliate
18S rRNA
Perkinsus olseni
5S–18S rRNA intergenic spacer
Rickettsia/Chlamydia-like bacteria
16S rRNA
Forward (127S) Reverse (230AS) Forward (CIF) Reverse (CIR) Forward (PK1) Reverse (PK2) Forward (RCF) Reverse (RCR)
ACTCTTTCGGGGGAAGAGAA TGCGATCCGAACAATTATCA GTTGGTGGAGTGATTTGTCTG ATCCCTAACACGACTGGTAT ACCAGTCACCACAGGGCGTAAT GTAGCGTGCTCTGATGATCACT GTTGGTGDGGTAAWGGC CCARTAAWTCCGATTAAYGC
Novoa et al. (2004) Novoa et al. (2004) This study This study de la Herrán et al. (2000) de la Herrán et al. (2000) This study This study
3. Results 3.1. Histological detection of parasites No obvious gross pathologies were observed in the shell and soft tissues of any of the surveyed animals. A preliminary histological appraisal also confirmed the overall good health status of sampled animals. The clams were sexually immature and thus gender and maturation status could not be assessed. Histologically, the level of infection of all surveyed parasites was globally low; however only in less than 10% of the clams no signs of parasites in either organ (gills and digestive glands) could be detected. Perkinsus sp. was the most recurrent protistan parasite affecting either surveyed organs, being observed in approximately 50% of the individuals. Of these, nearly half presented histological evidence of the parasite both in the gills (Fig. 2A) and digestive glands (Fig. 2B). However, the levels of infection were generally low-moderate. Perkinsus sp. trophozoites were often encapsulated within granulocytomas. The heavy infiltration of haemocytes (especially granulocytes) elicited by more severe infections, most prominent in the digestive gland, was usually accompanied by focal necrosis of surrounding digestive tubule epithelia and intertubular connective tissue. Ciliates were infrequent endoparasites (in ≈10% of clams) and were observed in gills only (Fig. 2C). These ciliates resembled organisms belonging to the genus Boveria, as described by Gao et al. (2010). In all cases, the animal was co-infected by Perkinsus sp., which rendered difficult to infer on the individual alterations caused by the parasite. However, unlike Perkinsus infections, in any case the parasites were engulfed by infiltrating haemocytes. Microorganisms that could be positively identified histologically as haplosporidian-like were rare and consisted of small plasmodia in the digestive glands' intertubular tissue only (Fig. 2D). The low levels of infection by these organisms were not observed to trigger any immunological response or elicit histopathological lesions. No spores were found, rendering impossible identification through spore ornamentation. Bacterial infections were recurrent in both organs, especially in the gills (over 60% of all clams). The bacterial infections of gills and digestive glands were distinct histologically, even though both bacteria were found to be Gram-negative (not shown) and Feulgen-positive through the Schiff's reaction for polysaccharides. Gill bacteria consisted of larger, more distinctively rod-shaped, basophilic cells that were often observed to form large extracellular colonies (Fig. 2E). Conversely, digestive gland microcolonies were intracellular (affecting tubule epithelial cells exclusively) and composed of small, likely pleomorphic, eosinophilic cells (Fig. 2F). Bacterial infections did not cause significant histopathological alterations in either organ, although, in the most severe cases, increased haemocytic infiltration occurred in the gills. 3.2. Molecular analyses Total DNA PCR using the primer pairs described in Table 1 yielded successful amplification of all parasite sequences, with negligible or null unspecific amplification (Fig. 3). The molecular weight of all bands was found within the expected range. The band corresponding
to the haplosporidian-like organism's 18S sequence was always dim, indicating low amounts of amplified DNA (and, therefore, of template), which is consistent with the very low prevalence of these organisms in the clams, as indicated histologically. Sequence contrasting to available data on public databases is summarized in Table 2. The haplosporidian-like parasite was matched to the yet unclassified species previously found by Novoa et al. (2004) infecting R. decussatus (100% matched ID). Although with minor sequence differences, the ciliate and Perkinsus sp. parasites were matched to B. subcylindrica (98%) and P. olseni (99%), respectively. Sequencing also revealed the differences between the bacteria infecting the gills and digestive glands. Fifty-five base pair dissimilarities were found between the two strains (corresponding to c.a. 17% of the DNA sequence). On the other hand, while gill bacteria were matched to a yet unclassified marine species (99% matched ID), found to infect a Mediterranean oyster (Zurel et al., 2011), the strain found in the digestive glands could not be unequivocally matched to any database-deposited 16S sequence. The closest match (87%) was retrieved from an uncultured marine bacterium from the Gulf of Mexico (Redmond and Valentine, in press). Since the protistan parasites' phylogeny is known and debated elsewhere (de la Herrán et al., 2000; Gao et al., 2010; Novoa et al., 2004), phylogenetic studies were performed on the two bacterial strains, after retrieving available 16S gene sequences of related species from GenBank and EMBL databases (Fig. 4). The analyses divided all sequences in two main clusters, one comprising Rickettsia-like bacteria, including the gill bacterium sequenced in this study, and the other including Chlamydia-like organisms, among which the digestive gland bacterium was allocated, however relatively distant from the sequences obtained from databases, making unclear its potential phylogenetic position. The gill bacterium was tightly clustered within the group that encompasses Spongiobacter- and Endocoizomonas-related species, which tend be parasites or commensals of marine invertebrates, including bivalves (e.g. Gram et al., 2010; Zurel et al., in press). 4. Discussion The present study revealed that healthy clams, i.e., devoid of gross or significant microscopic pathologies, collected from a commercial shellfish bed, are infected (in many cases, co-infected) by multiple microorganisms, either latent or yet within the range of effectiveness of the bivalves' immune system. The most important parasites were P. olseni, a well-known and high-risk agent for the clam population in Algarve, and bacteria. Two distinct strains of bacteria were found, one infecting the gills, most likely belonging to the genus Spongiobacter, and the other infecting the digestive gland, likely being a new species belonging to a distinct group of uncertain taxonomic position, more related to Chlamydiales. Ciliates identified as the scuticociliate Boveria sp. (most likely B. subcylindrica) and haplosporidian-like parasites were less frequent. Although the pathogenicity of Perkinsus spp. and haplosporidians to bivalves, R. decussatus in particular, is well known (e.g. Azevedo, 1989, 2001; Novoa et al., 2004), the significance of ciliate and bacterial infections in the species remains unclear. There are many species of ciliates known to infect marine organisms, including bivalves. Ciliates
64
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
Fig. 2. Example micrographs of R. decussatus parasites. A) Perkinsus sp. trophozoites (arrow) in the gills in the process of encapsulation by haemocytes (hm). Haemocytes often contained refractory vesicles of yellowish, lipofuscin-like material (lf). Gill lamellae (gl) are seemingly unaffected by the infection. cl) identifies ciliated cells of lamellae. Zenker, HE. B) Developing granulocytoma around several foci of Perkinsus sp. trophozoites in the intertubular space of a digestive gland (arrows). There is strong infiltration of haemocytes (hm). The surrounding digestive gland tubules (digestive diverticula) around the affected area (dt), sustained only moderate damage. Inset: detail of a trophozoite with its distinctive “signet ring” shape. Bouin–Hollande, HE. C) Gill ciliate. The arrow marks the distinctive paroral membranelle of Boveria. There are no signs of inflammation around the parasite or obvious histopathological lesions. Bouin–Hollande, HE. D) Few small plasmodia of an unidentified haplosporidian (arrows) infecting the intertubular space (is) of a digestive gland. The plasmodia on the left are apparently located inside a haemolymphatic sinus. There is no visible damage in digestive tubules (dt) and connective intertubular tissue. Inset: detail of a four-nuclei plasmodium of the parasite (arrowhead) within intertubular fibrocytes (stained blue). Carnoy, TC. E) Two large bacterial colonies in a clam's gills (arrows). Besides moderate haemocytic infiltration (hm) and congestion within adjacent sinuses (hs) there is no noticeable alteration or lesions in the gills' structure, including lamellae (gl). The colonies are extracellular and enclosed in a fibrous sheath (fs). Carnoy, TC. Inset: detail of gill bacteria, here stained with haematoxylin after fixation in Bouin– Hollandes's. F) A bacterial microcolony (arrow) inside an epithelial cell within an unaffected digestive tubule (dt). There are no signs of histopathological lesions or of an inflammatory response to infection. fm) branch of the foot retractor muscle. Compare the differences in shape, size and coloration of the bacterial colonies to those of the previous panel. Carnoy, TC. Scale bars: 25 μm.
belonging to the genus Boveria are reported to infect a wide range of marine invertebrates, possibly leading to true pathogenic effects (refer to Long et al., 2006, and references therein). B. subcylindrica, in particular, has long been reported to infect the gills of R. decussatus
(Raabe, 1970). Still, while other members of the class Scuticociliata, such as Philasterides spp., Anophryoides spp. and orchitophryid ciliates are acknowledged pathogens of farmed teleosts, crustaceans and oysters (e.g. Cawthorn et al., 1996; Elston et al., 1999; Ramos et al.,
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
Fig. 3. Representative agarose gel electrophoresis evidencing the PCR-amplified sequences of each parasite in the two organs of the surveyed clams (gills and digestive glands). The DNA standard on the left is the 100 bp ladder from Invitrogen.
2007), only scarce information was found regarding infections by these organisms in Ruditapes spp., with the exception of a description of trichodinid ciliates in R. philippinarum (Xu et al., 2000). Some authors presented data from which may be inferred that many ciliates are opportunistic scavengers and bacteriophages rather than primary pathogens, including Boveria (e.g. Mackinnon and Ray, 1931; Plunkett and Hidu, 1978). In either case, further research is needed to clarify these organisms' true impact on Ruditapes spp. The molecular approach confirmed that two different species of bacteria infected the gills and digestive glands of clams, without noticeable overlaps. While gill bacteria consisted of extracellular rods forming large, encysted, colonies, digestive gland bacteria were found to be small, pleomorphic, cells, forming dense microcolonies inside digestive epithelial cells. The molecular phylogenetic analyses confirmed the distinction between the two bacteria: the gill strain likely belonging to Spongiobacter and allocated within the Rickettsia-like bacteria; whereas the digestive gland strain appears to be more related to Chlamydia-like organisms. However, it must at this point be noticed that, in spite of the much research on the use of 16S rRNA gene to identify bacteria, the approach is far from fail-proof (see Janda and Abbott, 2007). On the other hand,
65
prokaryote taxonomy is far from consensual. For such reasons, the common designation “Rickettsia/Chlamydia-like bacteria” is here employed even though it is devoid of true taxonomic value. In fact, in taxonomic terms, Rickettsia (order Rickettsiales), and the Spongiobacter/Endocoizomonas cluster share only the phylum (Proteobacteria). Although the allocation of Spongiobacter within any order remains unclear to date, the current findings may indicate that, as Endocoizomonas, the genus may belong to Oceanospirillales (refer to Kurahashi and Yokota, 2007, for the first description of Endocoizomonas — interestingly, first isolated from another mollusc, the gastropod Elysia ornata). The order Chlamydiales, on the other hand, is allocated to a different phylum from Proteobacteria (Phylum Chlamydiae), which is in accordance with the phylogenetic analyses presented in Fig. 4. The current findings are in accordance with older studies reporting the existence of gill infections by Rickettsia-like bacteria in bivalves (including in Ruditapes sp.) albeit failing to trigger a clear immunological response of the host or even eliciting any noticeable damage to tissues (e.g. Elston, 1986). The colonies of Rickettsia-like bacteria found in the gills are structurally similar to those described by Carballal et al. (2001) in cockles from NW Spain. The present study also matched this bacterium (through the comparison of 16S gene sequences) to bacteria infecting the gills of oysters (Chama savignyi) from Eastern Mediterranean (Zurel et al., 2011). From the contrast to available 16S sequences, this bacterium has been identified for the first time as a most probable member of the genus Spongiobacter, so far described only from marine sponges. At the current stage of knowledge it is not possible to infer on the pathogenic potential of the gill bacteria found in R. decussatus, however, other interspecific relationships (symbiosis or commensalism) should not be disregarded since there is evidence, for instance, of anti-bacterial properties of Spongiobacter spp. (Flemer et al., 2012; Gram et al., 2010), from which could result an important benefit for the clam while explaining, at least in part, the few or null pathogenic effects reported here and by other authors regarding bacterial gill infections in bivalves. The taxonomy of digestive gland bacteria remains more elusive. A closer phylogenetic link to Chlamydia-like bacteria is apparent (Fig. 4); however there is no full disclosure of the parasites' taxonomic position, in great part due to the lack of genetic information on marine bacteria. The presence of Chlamydia-like parasites in bivalves is well documented (e.g. Meyers, 1979; Renault and Cochennec, 1995). Still, attempts to fully identify these organisms are virtually absent, since the surveys were usually based on microscopical analyses only. For such reason, researchers in the field frequently use the designation “Rickettsia/ Chlamydia-like” whenever referring to these organisms. As in the present study, other authors reported the infection of clam digestive tubule cells by a Chlamydia-like agent, although distant to known Chlamydiales (e.g. Meyers, 1979). The effect of the parasite on the host is not known and the information gathered from literature is inconclusive. The microcolonies observed in the present study (Fig. 2F) resemble the inclusion bodies of a Chlamydia-like organism from a
Table 2 Sequence matching scores using BLAST. Parasite
Sequence informationa
BLAST results
Size
Accession
Match
ID (%)
e-Value
Accession
Reference
Protozoa Unknown haplosporidian Unknown ciliate Perkinsus sp.
105 258 558
– JX416021 JX416022
Unidentified haplosporidian Boveria subcylindrica Perkinsus olseni
100 98 99
1 × 10−48 2 × 10−123 ~0
AY435093 FJ848878 AF509333
Novoa et al. (2004) Gao et al. (2010) Robledo et al. (2002)
Prokaryote Unknown gill bacterium Unknown digestive gland bacterium
317 318
JX416023 JX416024
Unidentified bacterium Unidentified bacterium
99 87
4 × 10−166 4 × 10−96
FR667032 JN018917
Zurel et al. (2011) Redmond and Valentine (in press)
a
Present study.
66
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
Fig. 4. Consensus phylogenetic tree showing the evolutionary position of the two bacterial sequences obtained from the gills and digestive glands of R. decussatus (boldface text) relatively to other 16S sequences of aquatic, parasitic or free-living, Rickettsia/Chlamydia-like bacteria. Rickettsia prowazekii (etiological agent of human epidemic typhus) was included as outgroup. The accession number of each sequence is indicated. The tree was built using the maximum likelihood method (Tamura and Nei, 1993), based on 5000 bootstrap replicates (internode bootstrap values below 50% are not shown). The scale bar indicates 2% sequence divergence.
marine bivalve's digestive gland described by Johnson and Le Pennec (1995), as an example, thought to be a symbiotic bacterium of unknown nature, rather than a pathogen. Altogether, parasitic bacteria in bivalves and other marine organisms should clearly benefit from further research. To summarize, the present study provided the first attempt to identify ciliate and bacterial parasites in the gills and digestive glands of R. decussatus collected from a natural shellfish bed in Southern Portugal, combining histological and molecular techniques. It must be noted at this point that the molecular approach provided more definite answers about the parasites' identity, even though the results are in general accordance with the histological analyses. The higher efficiency of molecular tools such as PCR-based diagnostics, to detect and identify parasites has already been debated elsewhere (e.g. Almeida et al., 1999); however, the present study reinforces the usefulness of combining both strategies. While gill ciliates and bacteria could be matched to the Boveria and Spongiobacter, respectively, digestive gland bacteria likely belong to a novel, yet unidentified species of intracellular prokaryotes. Bacteria and P. olseni were the most frequent and most disseminated parasites. It has also been shown that apparently healthy clams may act as an ecological reservoir of multiple species of parasites whose pathogenicity needs yet to be understood. Acknowledgments The present research was financed by FCT (Portuguese Science and Technology Foundation) and co-financed by the European Community FEDER through the Program COMPETE (Project Reference PTDC/ SAU-ESA/100107/2008), including the fellowship attributed to S. Carreira. P.M. Costa and J. Lobo were supported by the FCT grants SFRH/BPD/72564/2010 and SFRH/BD/69750/2010, respectively. The authors thank D. Matias and M. Martins (IPMA) for their assistance. References Almeida, M., Berthe, F., Thébault, A., Dinis, M.T., 1999. Whole clam culture as a quantitative diagnostic procedure of Perkinsus atlanticus (Apicomplexa, Perkinsea) in clams Ruditapes decussatus. Aquaculture 177, 325–332.
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. Journal of Molecular Biology 215, 403–410. Azevedo, C., 1989. Fine structure of Perkinsus atlanticus n. sp. (Apicomplexa, Perkinsea) parasite of the clam Ruditapes decussatus from Portugal. Journal of Parasitology 75, 627–635. Azevedo, C., 2001. Ultrastructural description of the spore maturation stages of the clam parasite Minchinia tapetis (Vilela, 1951) (Haplosporida: Haplosporidiidae). Systematic Parasitology 49, 189–194. Balboa, S., Doce, A., Diéguez, A.L., Romalde, J.L., 2011. Evaluation of different species-specific PCR protocols for the detection of Vibrio tapetis. Journal of Invertebrate Pathology 108, 85–91. Borrego, J.J., Castro, D., Luque, A., Paillard, C., Maes, P., Garcia, M.T., Ventosa, A., 1996. Vibrio tapetis sp. nov., the causative agent of the brown ring disease affecting cultured clams. International Journal of Systematic Bacteriology 46, 480–484. Carballal, M.J., Iglesias, D., Santamarina, J., Ferro–Soto, B., Villalba, A., 2001. Parasites and pathologic conditions of the cockle Cerastoderma edule populations of the coast of Galicia (NW Spain). Journal of Invertebrate Pathology 78, 87–97. Cawthorn, R., Lynn, D., Després, B., MacMillan, R., Maloney, R., Loughlin, M., Bayer, R., 1996. Description of Anophryoides haemophila n. sp. (Scuticociliatida: Orchitophryidae), a pathogen of American lobsters Homarus americanus. Diseases of Aquatic Organisms 24, 143–148. Costa, P.M., Costa, M.H., 2012. Development and application of a novel histological multichrome technique for clam histopathology. Journal of Invertebrate Pathology 110, 411–414. Costa, P.M., Carreira, S., Costa,M.H., Caeiro, S., in press. Development of histopathological indices in a commercial marine bivalve (Ruditapes decussatus) to determine environmental quality. Aquatic Toxicology. http://dx.doi.org/10.1016/j.aquatox. 2012.08.013. Cravo, A., Pereira, C., Gomes, T., Cardoso, C., Serafim, A., Almeida, C., Rocha, T., Lopes, B., Company, R., Norberto, R., Pereira, R., Araújo, O., Bebianno, M.J., 2012. A multibiomarker approach in the clam Ruditapes decussatus to assess the impact of pollution in the Ria Formosa lagoon, South Coast of Portugal. Marine Environmental Research 75, 23–34. de la Herrán, R., Garrido–Ramos, M.A., Navas, J.I., Ruiz Rejón, C., Ruiz Rejón, M., 2000. Molecular characterization of the ribosomal RNA gene region of Perkinsus atlanticus: its use in phylogenetic analysis and as a target for a molecular diagnosis. Parasitology 120, 345–353. Elston, R., 1986. Occurrence of branchial rickettsiales-like infections in two bivalve molluscs, Tapes japonica and Patinopecten yessoensis, with comments on their significance. Journal of Fish Diseases 9, 69–71. Elston, R.A., Cheney, D., Frelier, P., Lynn, D., 1999. Invasive orchitophryid ciliate infections in juvenile Pacific and Kumomoto oysters, Crassostrea gigas and Crassostrea sikamea. Aquaculture 174, 1–14. Flemer, B., Kennedy, J., Margassery, L.M., Morrissey, J.P., O'Gara, F., Dobson, A.D.W., 2012. Diversity and antimicrobial activities of microbes from two Irish marine sponges, Suberites carnosus and Leucosolenia sp. Journal of Applied Microbiology 112, 289–301. Gao, F., Fan, X., Yi, Z., Struder–Kypke, M., Song, W., 2010. Phylogenetic consideration of two scuticociliate genera, Philasterides and Boveria (Protozoa, Ciliophora) based on 18 S rRNA gene sequences. Parasitology International 59, 549–555.
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67 Gram, L., Melchiorsen, J., Bruhn, J.B., 2010. Antibacterial activity of marine culturable bacteria collected from a global sampling of ocean surface waters and surface swabs of marine organisms. Marine Biotechnology 12, 439–451. Harshbarger, J.C., Chang, S.C., 1977. Chlamydiae (with phages), mycoplasmas, and rickettsia in Chesapeake Bay bivalves. Science 196, 666–668. Howard, D.W., Smith, C.S., 1983. Histological techniques for marine bivalve mollusks. NOAA Technical Memorandum NMFS-F/NEC-25. National Oceanic and Atmospheric Administration. Woods Hole. Janda, J.M., Abbott, S.L., 2007. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: pluses, perils and pitfalls. Journal of Clinical Microbiology 45, 2761–2764. Johnson, M.A., Le Pennec, M., 1995. Association between the mollusc bivalve Loripes lucinalis and a Chlamydia-like organism, with comments on its pathogenic impact, life cycle and possible mode of transmission. Marine Biology 123, 523–530. Kurahashi, M., Yokota, A., 2007. Endozoicomonas elysicola gen. nov., sp. nov., a gammaproteobacterium isolated from the sea slug Elysia ornata. Systematic and Applied Microbiology 30, 202–206. Le Gall, G., Chagot, D., Mialhe, E., Grizel, H., 1988. Branchial Rickettsiales-like infection associated with a mass mortality of sea scallop Pecten maximus. Diseases of Aquatic Organisms 4, 229–232. Leite, R.B., Afonso, R., Cancela, M.L., 2004. Perkinsus sp. infestation in carpet-shell clams, Ruditapes decussatus (L.), along the Portuguese coast. Results from a 2–year survey. Aquaculture 240, 39–53. Long, H., Song, W., Chen, J., Gong, J., Ji, D., Hu, X., Ma, H., Zhu, M., Wang, M., 2006. Studies on an endoparasitic ciliate Boveria labialis (Protozoa: Ciliophora) from the sea cucumber, Apostichopus japonicus. Journal of the Marine Biological Association of the United Kingdom 86, 823–828. Mackinnon, D.L., Ray, H.N., 1931. Notes on the Ciliate Boveria stevensi Issel from Galeomma turtoni Sowerby at Plymouth. Journal of the Marine Biological Association of the United Kingdom 17, 577–582. Matias, D., Joaquim, S., Leitão, A., Massapina, C., 2009. Effect of geographic origin, temperature and timing of broodstock collection on conditioning, spawning success and larval viability of Ruditapes decussatus. Aquaculture International 17, 257–271. Meyers, T.R., 1979. Preliminary studies on a chlamydial agent in the digestive diverticular epithelium of hard clams Mercenaria mercenaria (L.) from Great South Bay, New York. Journal of Fish Diseases 2, 179–189. Mialhe, E., Chagot, D., Boulo, V., Comps, M., Ruano, F., Grizel, H., 1987. An infection of Ruditapes decussatus (Bivalvia) by Rickettsia. Aquatulture 67, 258–259. Navas, J.I., Castillo, M.C., Vera, P., Ruiz–Rico, M., 1992. Principal parasites observed in clams, Ruditapes decussatus (L.), Ruditapes philippinarum (Adam et Reeve), Venerupis pullastra (Montagu), and Venerupis aureus (Gmelin), from Huelva coast (S.W. Spain). Aquaculture 107, 193–199. Novoa, B., Balseiro, P., Figueras, A., 2004. Molecular detection of a haplosporidian parasite in carpet shell clam Ruditapes decussatus from Spain. Diseases of Aquatic Organisms 61, 89–93.
67
Paul–Pont, I., Gonzalez, P., Baudrimont, M., Jude, F., Raymond, N., Bourrasseau, L., Le Göic, N., Haynes, F., Legeay, A., Paillard, C., de Montaudouin, X., 2010. Interactive effects of metal contamination and pathogenic organisms on the marine bivalve Cerastoderma edule. Marine Pollution Bulletin 60, 515–525. Plunkett, L., Hidu, H., 1978. The role of Uronema marinum (Protozoa) in oyster hatchery production. Aquaculture 15, 219–235. Raabe, Z., 1970. Ordo Thigmotricha (Ciliata–Holotricha) II. Familia Hemispeiridae. Acta Protozoologica 7, 117–180. Ramos, M.F., Costa, A.R., Barandela, T., Saraiva, A., Rodrigues, P.N., 2007. Scuticociliate infection and pathology in cultured turbot Scophthalmus maximus. Diseases of Aquatic Organisms 74, 249–253. Redmond, M.C., Valentine, D.L., in press. Natural gas and temperature structured a microbial community response to the Deepwater Horizon oil spill. Proceedings of the National Academy of Sciences of the United States of America. http://dx.doi.org/10. 1073/pnas.1108756108. Renault, T., Cochennec, N., 1995. Chlamydia-like organisms in ctenidia and mantle cells of the Japanese oyster Crassostrea gigas from the French Atlantic coast. Diseases of Aquatic Organisms 23, 153–159. Robert, M., Garcia, C., Chollet, B., Lopez–Flores, I., Ferrand, S., François, C., Joly, J.-P., Arzul, I., 2009. Molecular detection and quantification of the protozoan Bonamia ostreae in the flat oyster, Ostrea edulis. Molecular and Cellular Probes 23, 264–271. Robledo, J.A.F., Nunes, P.A., Cancela, M.L., Vasta, G.R., 2002. Development of an in vitro clonal culture and characterization of the rRNA gene cluster of Perkinsus atlanticus, a protistan parasite of the clam Tapes decussatus. Journal of Eukaryotic Microbiology 49, 414–422. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular and Biological Evolution 10, 512–526. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular and Biological Evolution 28, 2731–2739. Teixeira de Sousa, J., Matias, D., Joaquim, S., Ben Hamadou, R., Leitão, A., 2011. Growth variation in bivalves: new insights into growth, physiology and somatic aneuploidy in the carpet shell Ruditapes decussatus. Journal of Experimental Marine Biology and Ecology 406, 46–53. Xu, K., Song, W., Warren, A., 2000. Observations on trichodinid ectoparasites (Ciliophora: Peritricha) from the gills of maricultured molluscs in China, with descriptions of three new species of Trichodina Ehrenberg, 1838. Systematic Parasitology 45, 17–24. Zurel, D., Benayahu, Y., Or, A., Kovacs, A., Gophna, U., 2011. Composition and dynamics of the gill microbiota of an invasive Indo-Pacific oyster in the eastern Mediterranean Sea. Environmental Microbiology 13, 1467–1476.
Contents lists available at SciVerse ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Molecular detection of prokaryote and protozoan parasites in the commercial bivalve Ruditapes decussatus from southern Portugal Pedro M. Costa ⁎, Sara Carreira, Jorge Lobo, Maria H. Costa IMAR — Instituto do Mar, Departamento de Ciências e Engenharia do Ambiente, Faculdade de Ciências e Tecnologia da Universidade Nova de Lisboa, 2829-0516 Caparica, Portugal
a r t i c l e
i n f o
Article history: Received 21 September 2012 Received in revised form 2 October 2012 Accepted 3 October 2012 Available online 7 October 2012 Keywords: Grooved carpet shell clam Infectious agents Bacteria Protista Histology PCR
a b s t r a c t A parasite screening combining histological and molecular techniques was performed on healthy grooved carpet shell clams collected from a commercial shellfish bed in Southern Portugal. The study included the first attempt to develop molecular techniques to detect and identify Rickettsia/Chlamydia-like bacteria and gill ciliates infecting this high-value bivalve. Although the animals failed to reveal significant pathologies relatable to infectious agents, both techniques detected low-moderate levels of infection by bacteria and protozoans, the latter including the apicomplexan Perkinsus olseni, the ciliate Boveria subcylindrica and a yet unclassified haplosporidian. Infections by P. olseni and bacteria were the most frequent and most disseminated within the two surveyed organs, gills and digestive glands. Gill and digestive gland bacteria belonged to distinct groups, the former more related to Rickettsiales and the latter to Chlamydiales. However, while gill bacteria could be clearly allocated within the Spongiobacter/Endocoizomonas group, thus likely belonging to Oceanospirillales, no evident taxonomic position could be attributed to digestive gland bacteria, most possibly consisting of a new species of parasite. In face of the current findings, symbiotic or commensal relationships between these bacteria and the bivalve should not be excluded. The results showed that healthy clams act as a repository of multiple agents of infection, which is of particular importance to a species that is known to be particularly sensitive to parasitism. The PCR techniques developed for the detection of Boveria sp. and bacteria were proven efficient and were appended to the methods for Perkinsus sp. and haplosporidians described elsewhere. © 2012 Elsevier B.V. All rights reserved.
1. Introduction The grooved carpet shell clam Ruditapes decussatus (L.), Bivalvia: Veneridae (=Venerupis decussata), is one of the most valuable bivalves in SW Europe, especially in Portugal, where the species stands as one of the most important mariculture produces, with the Ria Formosa lagoon (Algarve, Southern Portugal), being the most important production area (refer, e.g., to Matias et al., 2009; Teixeira de Sousa et al., 2011, and references therein). This species has been found highly susceptible to environmental stressors such as marine pollution and, especially, parasites. Still, by contrast to other high-prized bivalves, like oysters, much research is still needed to screen the microbial communities affecting this species, to identify possible disease-causing agents and to develop rapid identification techniques. The most studied R. decussatus parasite is the apicomplexan protozoan Perkinsus olseni (=Perkinsus atlanticus). This parasite has been found responsible for massive clam mortalities in Portugal (Azevedo, 1989). The species affects R. decussatus populations throughout the Portuguese continental coast, apparently season-independently, although the levels of infections are fluctuating and likely modulated by anthropogenic stressors such as pollution (Leite et al., 2004). Still ⁎ Corresponding author. Tel.: +351 212 948 300x10103; fax: +351 212 948 554. E-mail address: [email protected] (P.M. Costa). 0044-8486/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.aquaculture.2012.10.006
regarding protistans, Azevedo (2001) identified a haplosporidian parasite in R. decussatus from Portuguese waters as being Minchinia tapetis, however, Robledo et al. (2002), described a haplosporidian infecting clams from NW Iberian Peninsula related to the genus Urosporidium. Previously, Navas et al. (1992) already described P. olseni and a haplosporidian identified as M. tapetis as the most significant parasites in R. decussatus and its invasive counterpart, Ruditapes philippinarum, in Southern Spanish waters. Although haplosporidians are known to cause severe mortalities in many valuable invertebrates, such as the parasite Bonamia spp. in oysters (see for instance Robert et al., 2009 and references therein), there is little knowledge on these parasites' background presence in R. decussatus. Vibrio tapetis remains the best studied bacterial parasite affecting clams, including R. decussatus, being the etiological agent of the “brown ring disease” (Borrego et al., 1996). Interestingly, V. tapetis has been found to modulate effects and responses to pollutants in bivalves (e.g. Paul-Pont et al., 2010), confirming the influence of bacteria (and likely other parasites) on the hosts' sensitivity/susceptibility towards environmental stressors and, therefore, yet another factor supporting the need to screen the bivalves' microbiota, since these organisms are widely employed in biomonitoring studies, including R. decussatus in Portugal (for instance Costa et al., in press; Cravo et al., 2012). In spite of the fair number of reports on Rickettsia/ Chlamydia-like bacterial infections in bivalves since the original
62
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
work by Harshbarger and Chang (1977), no true attempt, to date, has been performed to identify these organisms and to develop molecular tools that permit a rapid screening in the tissues of susceptible hosts, such as the PCR (polymerase chain reaction) protocols existing for many protistan parasites or even V. tapetis (see Balboa et al., 2011). Furthermore, the pathological impact of these organisms on their hosts is not entirely understood and data is occasionally conflicting. Elston (1986), for instance, reported no noticeable pathogenic effects of Rickettsia/Chlamydia-like bacteria in R. philippinarum, whereas Le Gall et al. (1988) related unidentified, gill-infecting, bacteria (presumably Rickettsia-like) to high mortalities in scallops. Mialhe et al. (1987), first described bacteria infecting R. decussatus from Portugal (Ria Formosa, Algarve), then classified as Rickettsia from histological observations but no formal classification or pathological studies were conducted. Overall, the lack of knowledge about these organisms deems the need to shed some light on their classification and to develop efficient screening methods for their detection if further studies, e.g., on their pathogenicity, are to be attempted. The present study primarily intends to detect and identify through molecular techniques, the most important parasites present in the gills and digestive glands of healthy clams from a natural commercial clam bed in Southern Portugal, with special emphasis on yet non-described ciliate and prokaryote Rickettsia/Chlamydia-like agents. 2. Methods and materials 2.1. Clam collection Clams (24–33 mm shell length) were collected from a seemingly healthy commercial shellfish bed located in an unpolluted area of the Ria Formosa coastal lagoon, Algarve, southern Portugal (Fig. 1), in November 2011. Approximately thirty randomly-selected animals were transported to the laboratory (≈ 2 h 30 min journey), alive, in a refrigerated container (≈ 10 °C) and processed immediately for species identification and gross health status confirmation. Following, digestive gland and gill samples were dissected for histological and molecular analyses. Clam parasites were not cultured during the present work.
Fig 1. Geographical location of the clam collection site (*), consisting of a commercial shellfish bed inside a coastal lagoon (Ria Formosa), in Algarve, Portugal.
2.2. Histology Parasites were identified histologically from gill and digestive gland samples fixed either in Bouin–Hollande's, Zenker's or Carnoy's solutions (formalin, mercury-chloride and ethanol based, respectively). All samples were fixed in the cold, for ≈36 h (in Bouin–Hollande's) or overnight (in Zenker's and Carnoy's). Samples were dehydrated in a progressive series of ethanol (70% to absolute), intermediately impregnated with xylenes and embedded in paraffin. Sections (3–5 μm thick) were stained with haematoxylin and eosin (HE), in the case of Bouinand Zenker-fixed samples or stained with the alcian blue + periodic acid/Schiff's + picric acid-based tetrachrome technique (TC) described by Costa and Costa (2012) in Carnoy-fixed specimens. All other techniques are described in further detail by Howard and Smith (1983). Slides were mounted with DPX resin. Observations were done with a DMLB model microscope equipped with a DFC480 digital camera (Leica Microsystems). 2.3. Molecular analyses Total DNA was extracted from gill and digestive gland samples using the E.Z.N.A. Mollusc DNA kit (Omega Bio-Tek), following the manufacturer's instructions. The quality and quantity of extracted DNA were assessed with a NanoDrop 1000 spectrophotometer (Thermo Scientific). Parasite sequences of ribosomal subunit RNA (rRNA) genes were amplified by PCR using an iCycler thermocycler (Bio-Rad) and a Taq DNA polymerase PCR kit (Invitrogen). The
molecular screening for protozoan parasites was achieved using previously published specific primer sets for known R. decussatus parasites, namely for P. olseni (de la Herrán et al., 2000) and haplosporidian-like organisms (Novoa et al., 2004). In absence of specific primers available in the literature, ciliates and Rickettsia/ Chlamydia-like bacteria required consensus primer design from the alignment of available sequences of similar organisms, with focus on marine species. It was primarily intended to obtain universal primers for marine ciliates and Rickettsia/Chlamydia-like bacteria. The sequences with the accessions U51554, U17354, U17355 and U17356 were aligned to design primers for ciliates and the sequences DQ118733, FJ154998, FM244838, JN392919, FJ532292 and AY114327 for bacteria. Table 1 summarizes the PCR primers used in the present study. Sequence isolation by PCR was achieved through 35–45 amplification cycles each comprising 45 s denaturation (94 °C), 40 s annealing (51 °C for all primer pairs) and 1 min 15 s extension (72 °C); after a 3 min initial denaturation period (94 °C) and followed by 10 min final extension period (72 °C). Sequencing was done from purified PCR products with an ABI 3730XL DNA analyser using the BigDye Terminator 3 kit (all from Applied Biosystems). Alignment and phylogenetic analyses were computed with MEGA5 (Tamura et al., 2011). Sequences were contrasted to available public-access non-redundant nucleotide databases (such as GenBank and EMBL) using the software BLAST (Altschul et al., 1990).
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
63
Table 1 Primers used in the present study and related information. Target parasite
Gene ID
Primer ID
Primer sequence (5′–3′)
Primer reference
Unknown haplosporidian
18S rRNA
Unknown ciliate
18S rRNA
Perkinsus olseni
5S–18S rRNA intergenic spacer
Rickettsia/Chlamydia-like bacteria
16S rRNA
Forward (127S) Reverse (230AS) Forward (CIF) Reverse (CIR) Forward (PK1) Reverse (PK2) Forward (RCF) Reverse (RCR)
ACTCTTTCGGGGGAAGAGAA TGCGATCCGAACAATTATCA GTTGGTGGAGTGATTTGTCTG ATCCCTAACACGACTGGTAT ACCAGTCACCACAGGGCGTAAT GTAGCGTGCTCTGATGATCACT GTTGGTGDGGTAAWGGC CCARTAAWTCCGATTAAYGC
Novoa et al. (2004) Novoa et al. (2004) This study This study de la Herrán et al. (2000) de la Herrán et al. (2000) This study This study
3. Results 3.1. Histological detection of parasites No obvious gross pathologies were observed in the shell and soft tissues of any of the surveyed animals. A preliminary histological appraisal also confirmed the overall good health status of sampled animals. The clams were sexually immature and thus gender and maturation status could not be assessed. Histologically, the level of infection of all surveyed parasites was globally low; however only in less than 10% of the clams no signs of parasites in either organ (gills and digestive glands) could be detected. Perkinsus sp. was the most recurrent protistan parasite affecting either surveyed organs, being observed in approximately 50% of the individuals. Of these, nearly half presented histological evidence of the parasite both in the gills (Fig. 2A) and digestive glands (Fig. 2B). However, the levels of infection were generally low-moderate. Perkinsus sp. trophozoites were often encapsulated within granulocytomas. The heavy infiltration of haemocytes (especially granulocytes) elicited by more severe infections, most prominent in the digestive gland, was usually accompanied by focal necrosis of surrounding digestive tubule epithelia and intertubular connective tissue. Ciliates were infrequent endoparasites (in ≈10% of clams) and were observed in gills only (Fig. 2C). These ciliates resembled organisms belonging to the genus Boveria, as described by Gao et al. (2010). In all cases, the animal was co-infected by Perkinsus sp., which rendered difficult to infer on the individual alterations caused by the parasite. However, unlike Perkinsus infections, in any case the parasites were engulfed by infiltrating haemocytes. Microorganisms that could be positively identified histologically as haplosporidian-like were rare and consisted of small plasmodia in the digestive glands' intertubular tissue only (Fig. 2D). The low levels of infection by these organisms were not observed to trigger any immunological response or elicit histopathological lesions. No spores were found, rendering impossible identification through spore ornamentation. Bacterial infections were recurrent in both organs, especially in the gills (over 60% of all clams). The bacterial infections of gills and digestive glands were distinct histologically, even though both bacteria were found to be Gram-negative (not shown) and Feulgen-positive through the Schiff's reaction for polysaccharides. Gill bacteria consisted of larger, more distinctively rod-shaped, basophilic cells that were often observed to form large extracellular colonies (Fig. 2E). Conversely, digestive gland microcolonies were intracellular (affecting tubule epithelial cells exclusively) and composed of small, likely pleomorphic, eosinophilic cells (Fig. 2F). Bacterial infections did not cause significant histopathological alterations in either organ, although, in the most severe cases, increased haemocytic infiltration occurred in the gills. 3.2. Molecular analyses Total DNA PCR using the primer pairs described in Table 1 yielded successful amplification of all parasite sequences, with negligible or null unspecific amplification (Fig. 3). The molecular weight of all bands was found within the expected range. The band corresponding
to the haplosporidian-like organism's 18S sequence was always dim, indicating low amounts of amplified DNA (and, therefore, of template), which is consistent with the very low prevalence of these organisms in the clams, as indicated histologically. Sequence contrasting to available data on public databases is summarized in Table 2. The haplosporidian-like parasite was matched to the yet unclassified species previously found by Novoa et al. (2004) infecting R. decussatus (100% matched ID). Although with minor sequence differences, the ciliate and Perkinsus sp. parasites were matched to B. subcylindrica (98%) and P. olseni (99%), respectively. Sequencing also revealed the differences between the bacteria infecting the gills and digestive glands. Fifty-five base pair dissimilarities were found between the two strains (corresponding to c.a. 17% of the DNA sequence). On the other hand, while gill bacteria were matched to a yet unclassified marine species (99% matched ID), found to infect a Mediterranean oyster (Zurel et al., 2011), the strain found in the digestive glands could not be unequivocally matched to any database-deposited 16S sequence. The closest match (87%) was retrieved from an uncultured marine bacterium from the Gulf of Mexico (Redmond and Valentine, in press). Since the protistan parasites' phylogeny is known and debated elsewhere (de la Herrán et al., 2000; Gao et al., 2010; Novoa et al., 2004), phylogenetic studies were performed on the two bacterial strains, after retrieving available 16S gene sequences of related species from GenBank and EMBL databases (Fig. 4). The analyses divided all sequences in two main clusters, one comprising Rickettsia-like bacteria, including the gill bacterium sequenced in this study, and the other including Chlamydia-like organisms, among which the digestive gland bacterium was allocated, however relatively distant from the sequences obtained from databases, making unclear its potential phylogenetic position. The gill bacterium was tightly clustered within the group that encompasses Spongiobacter- and Endocoizomonas-related species, which tend be parasites or commensals of marine invertebrates, including bivalves (e.g. Gram et al., 2010; Zurel et al., in press). 4. Discussion The present study revealed that healthy clams, i.e., devoid of gross or significant microscopic pathologies, collected from a commercial shellfish bed, are infected (in many cases, co-infected) by multiple microorganisms, either latent or yet within the range of effectiveness of the bivalves' immune system. The most important parasites were P. olseni, a well-known and high-risk agent for the clam population in Algarve, and bacteria. Two distinct strains of bacteria were found, one infecting the gills, most likely belonging to the genus Spongiobacter, and the other infecting the digestive gland, likely being a new species belonging to a distinct group of uncertain taxonomic position, more related to Chlamydiales. Ciliates identified as the scuticociliate Boveria sp. (most likely B. subcylindrica) and haplosporidian-like parasites were less frequent. Although the pathogenicity of Perkinsus spp. and haplosporidians to bivalves, R. decussatus in particular, is well known (e.g. Azevedo, 1989, 2001; Novoa et al., 2004), the significance of ciliate and bacterial infections in the species remains unclear. There are many species of ciliates known to infect marine organisms, including bivalves. Ciliates
64
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
Fig. 2. Example micrographs of R. decussatus parasites. A) Perkinsus sp. trophozoites (arrow) in the gills in the process of encapsulation by haemocytes (hm). Haemocytes often contained refractory vesicles of yellowish, lipofuscin-like material (lf). Gill lamellae (gl) are seemingly unaffected by the infection. cl) identifies ciliated cells of lamellae. Zenker, HE. B) Developing granulocytoma around several foci of Perkinsus sp. trophozoites in the intertubular space of a digestive gland (arrows). There is strong infiltration of haemocytes (hm). The surrounding digestive gland tubules (digestive diverticula) around the affected area (dt), sustained only moderate damage. Inset: detail of a trophozoite with its distinctive “signet ring” shape. Bouin–Hollande, HE. C) Gill ciliate. The arrow marks the distinctive paroral membranelle of Boveria. There are no signs of inflammation around the parasite or obvious histopathological lesions. Bouin–Hollande, HE. D) Few small plasmodia of an unidentified haplosporidian (arrows) infecting the intertubular space (is) of a digestive gland. The plasmodia on the left are apparently located inside a haemolymphatic sinus. There is no visible damage in digestive tubules (dt) and connective intertubular tissue. Inset: detail of a four-nuclei plasmodium of the parasite (arrowhead) within intertubular fibrocytes (stained blue). Carnoy, TC. E) Two large bacterial colonies in a clam's gills (arrows). Besides moderate haemocytic infiltration (hm) and congestion within adjacent sinuses (hs) there is no noticeable alteration or lesions in the gills' structure, including lamellae (gl). The colonies are extracellular and enclosed in a fibrous sheath (fs). Carnoy, TC. Inset: detail of gill bacteria, here stained with haematoxylin after fixation in Bouin– Hollandes's. F) A bacterial microcolony (arrow) inside an epithelial cell within an unaffected digestive tubule (dt). There are no signs of histopathological lesions or of an inflammatory response to infection. fm) branch of the foot retractor muscle. Compare the differences in shape, size and coloration of the bacterial colonies to those of the previous panel. Carnoy, TC. Scale bars: 25 μm.
belonging to the genus Boveria are reported to infect a wide range of marine invertebrates, possibly leading to true pathogenic effects (refer to Long et al., 2006, and references therein). B. subcylindrica, in particular, has long been reported to infect the gills of R. decussatus
(Raabe, 1970). Still, while other members of the class Scuticociliata, such as Philasterides spp., Anophryoides spp. and orchitophryid ciliates are acknowledged pathogens of farmed teleosts, crustaceans and oysters (e.g. Cawthorn et al., 1996; Elston et al., 1999; Ramos et al.,
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
Fig. 3. Representative agarose gel electrophoresis evidencing the PCR-amplified sequences of each parasite in the two organs of the surveyed clams (gills and digestive glands). The DNA standard on the left is the 100 bp ladder from Invitrogen.
2007), only scarce information was found regarding infections by these organisms in Ruditapes spp., with the exception of a description of trichodinid ciliates in R. philippinarum (Xu et al., 2000). Some authors presented data from which may be inferred that many ciliates are opportunistic scavengers and bacteriophages rather than primary pathogens, including Boveria (e.g. Mackinnon and Ray, 1931; Plunkett and Hidu, 1978). In either case, further research is needed to clarify these organisms' true impact on Ruditapes spp. The molecular approach confirmed that two different species of bacteria infected the gills and digestive glands of clams, without noticeable overlaps. While gill bacteria consisted of extracellular rods forming large, encysted, colonies, digestive gland bacteria were found to be small, pleomorphic, cells, forming dense microcolonies inside digestive epithelial cells. The molecular phylogenetic analyses confirmed the distinction between the two bacteria: the gill strain likely belonging to Spongiobacter and allocated within the Rickettsia-like bacteria; whereas the digestive gland strain appears to be more related to Chlamydia-like organisms. However, it must at this point be noticed that, in spite of the much research on the use of 16S rRNA gene to identify bacteria, the approach is far from fail-proof (see Janda and Abbott, 2007). On the other hand,
65
prokaryote taxonomy is far from consensual. For such reasons, the common designation “Rickettsia/Chlamydia-like bacteria” is here employed even though it is devoid of true taxonomic value. In fact, in taxonomic terms, Rickettsia (order Rickettsiales), and the Spongiobacter/Endocoizomonas cluster share only the phylum (Proteobacteria). Although the allocation of Spongiobacter within any order remains unclear to date, the current findings may indicate that, as Endocoizomonas, the genus may belong to Oceanospirillales (refer to Kurahashi and Yokota, 2007, for the first description of Endocoizomonas — interestingly, first isolated from another mollusc, the gastropod Elysia ornata). The order Chlamydiales, on the other hand, is allocated to a different phylum from Proteobacteria (Phylum Chlamydiae), which is in accordance with the phylogenetic analyses presented in Fig. 4. The current findings are in accordance with older studies reporting the existence of gill infections by Rickettsia-like bacteria in bivalves (including in Ruditapes sp.) albeit failing to trigger a clear immunological response of the host or even eliciting any noticeable damage to tissues (e.g. Elston, 1986). The colonies of Rickettsia-like bacteria found in the gills are structurally similar to those described by Carballal et al. (2001) in cockles from NW Spain. The present study also matched this bacterium (through the comparison of 16S gene sequences) to bacteria infecting the gills of oysters (Chama savignyi) from Eastern Mediterranean (Zurel et al., 2011). From the contrast to available 16S sequences, this bacterium has been identified for the first time as a most probable member of the genus Spongiobacter, so far described only from marine sponges. At the current stage of knowledge it is not possible to infer on the pathogenic potential of the gill bacteria found in R. decussatus, however, other interspecific relationships (symbiosis or commensalism) should not be disregarded since there is evidence, for instance, of anti-bacterial properties of Spongiobacter spp. (Flemer et al., 2012; Gram et al., 2010), from which could result an important benefit for the clam while explaining, at least in part, the few or null pathogenic effects reported here and by other authors regarding bacterial gill infections in bivalves. The taxonomy of digestive gland bacteria remains more elusive. A closer phylogenetic link to Chlamydia-like bacteria is apparent (Fig. 4); however there is no full disclosure of the parasites' taxonomic position, in great part due to the lack of genetic information on marine bacteria. The presence of Chlamydia-like parasites in bivalves is well documented (e.g. Meyers, 1979; Renault and Cochennec, 1995). Still, attempts to fully identify these organisms are virtually absent, since the surveys were usually based on microscopical analyses only. For such reason, researchers in the field frequently use the designation “Rickettsia/ Chlamydia-like” whenever referring to these organisms. As in the present study, other authors reported the infection of clam digestive tubule cells by a Chlamydia-like agent, although distant to known Chlamydiales (e.g. Meyers, 1979). The effect of the parasite on the host is not known and the information gathered from literature is inconclusive. The microcolonies observed in the present study (Fig. 2F) resemble the inclusion bodies of a Chlamydia-like organism from a
Table 2 Sequence matching scores using BLAST. Parasite
Sequence informationa
BLAST results
Size
Accession
Match
ID (%)
e-Value
Accession
Reference
Protozoa Unknown haplosporidian Unknown ciliate Perkinsus sp.
105 258 558
– JX416021 JX416022
Unidentified haplosporidian Boveria subcylindrica Perkinsus olseni
100 98 99
1 × 10−48 2 × 10−123 ~0
AY435093 FJ848878 AF509333
Novoa et al. (2004) Gao et al. (2010) Robledo et al. (2002)
Prokaryote Unknown gill bacterium Unknown digestive gland bacterium
317 318
JX416023 JX416024
Unidentified bacterium Unidentified bacterium
99 87
4 × 10−166 4 × 10−96
FR667032 JN018917
Zurel et al. (2011) Redmond and Valentine (in press)
a
Present study.
66
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67
Fig. 4. Consensus phylogenetic tree showing the evolutionary position of the two bacterial sequences obtained from the gills and digestive glands of R. decussatus (boldface text) relatively to other 16S sequences of aquatic, parasitic or free-living, Rickettsia/Chlamydia-like bacteria. Rickettsia prowazekii (etiological agent of human epidemic typhus) was included as outgroup. The accession number of each sequence is indicated. The tree was built using the maximum likelihood method (Tamura and Nei, 1993), based on 5000 bootstrap replicates (internode bootstrap values below 50% are not shown). The scale bar indicates 2% sequence divergence.
marine bivalve's digestive gland described by Johnson and Le Pennec (1995), as an example, thought to be a symbiotic bacterium of unknown nature, rather than a pathogen. Altogether, parasitic bacteria in bivalves and other marine organisms should clearly benefit from further research. To summarize, the present study provided the first attempt to identify ciliate and bacterial parasites in the gills and digestive glands of R. decussatus collected from a natural shellfish bed in Southern Portugal, combining histological and molecular techniques. It must be noted at this point that the molecular approach provided more definite answers about the parasites' identity, even though the results are in general accordance with the histological analyses. The higher efficiency of molecular tools such as PCR-based diagnostics, to detect and identify parasites has already been debated elsewhere (e.g. Almeida et al., 1999); however, the present study reinforces the usefulness of combining both strategies. While gill ciliates and bacteria could be matched to the Boveria and Spongiobacter, respectively, digestive gland bacteria likely belong to a novel, yet unidentified species of intracellular prokaryotes. Bacteria and P. olseni were the most frequent and most disseminated parasites. It has also been shown that apparently healthy clams may act as an ecological reservoir of multiple species of parasites whose pathogenicity needs yet to be understood. Acknowledgments The present research was financed by FCT (Portuguese Science and Technology Foundation) and co-financed by the European Community FEDER through the Program COMPETE (Project Reference PTDC/ SAU-ESA/100107/2008), including the fellowship attributed to S. Carreira. P.M. Costa and J. Lobo were supported by the FCT grants SFRH/BPD/72564/2010 and SFRH/BD/69750/2010, respectively. The authors thank D. Matias and M. Martins (IPMA) for their assistance. References Almeida, M., Berthe, F., Thébault, A., Dinis, M.T., 1999. Whole clam culture as a quantitative diagnostic procedure of Perkinsus atlanticus (Apicomplexa, Perkinsea) in clams Ruditapes decussatus. Aquaculture 177, 325–332.
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. Journal of Molecular Biology 215, 403–410. Azevedo, C., 1989. Fine structure of Perkinsus atlanticus n. sp. (Apicomplexa, Perkinsea) parasite of the clam Ruditapes decussatus from Portugal. Journal of Parasitology 75, 627–635. Azevedo, C., 2001. Ultrastructural description of the spore maturation stages of the clam parasite Minchinia tapetis (Vilela, 1951) (Haplosporida: Haplosporidiidae). Systematic Parasitology 49, 189–194. Balboa, S., Doce, A., Diéguez, A.L., Romalde, J.L., 2011. Evaluation of different species-specific PCR protocols for the detection of Vibrio tapetis. Journal of Invertebrate Pathology 108, 85–91. Borrego, J.J., Castro, D., Luque, A., Paillard, C., Maes, P., Garcia, M.T., Ventosa, A., 1996. Vibrio tapetis sp. nov., the causative agent of the brown ring disease affecting cultured clams. International Journal of Systematic Bacteriology 46, 480–484. Carballal, M.J., Iglesias, D., Santamarina, J., Ferro–Soto, B., Villalba, A., 2001. Parasites and pathologic conditions of the cockle Cerastoderma edule populations of the coast of Galicia (NW Spain). Journal of Invertebrate Pathology 78, 87–97. Cawthorn, R., Lynn, D., Després, B., MacMillan, R., Maloney, R., Loughlin, M., Bayer, R., 1996. Description of Anophryoides haemophila n. sp. (Scuticociliatida: Orchitophryidae), a pathogen of American lobsters Homarus americanus. Diseases of Aquatic Organisms 24, 143–148. Costa, P.M., Costa, M.H., 2012. Development and application of a novel histological multichrome technique for clam histopathology. Journal of Invertebrate Pathology 110, 411–414. Costa, P.M., Carreira, S., Costa,M.H., Caeiro, S., in press. Development of histopathological indices in a commercial marine bivalve (Ruditapes decussatus) to determine environmental quality. Aquatic Toxicology. http://dx.doi.org/10.1016/j.aquatox. 2012.08.013. Cravo, A., Pereira, C., Gomes, T., Cardoso, C., Serafim, A., Almeida, C., Rocha, T., Lopes, B., Company, R., Norberto, R., Pereira, R., Araújo, O., Bebianno, M.J., 2012. A multibiomarker approach in the clam Ruditapes decussatus to assess the impact of pollution in the Ria Formosa lagoon, South Coast of Portugal. Marine Environmental Research 75, 23–34. de la Herrán, R., Garrido–Ramos, M.A., Navas, J.I., Ruiz Rejón, C., Ruiz Rejón, M., 2000. Molecular characterization of the ribosomal RNA gene region of Perkinsus atlanticus: its use in phylogenetic analysis and as a target for a molecular diagnosis. Parasitology 120, 345–353. Elston, R., 1986. Occurrence of branchial rickettsiales-like infections in two bivalve molluscs, Tapes japonica and Patinopecten yessoensis, with comments on their significance. Journal of Fish Diseases 9, 69–71. Elston, R.A., Cheney, D., Frelier, P., Lynn, D., 1999. Invasive orchitophryid ciliate infections in juvenile Pacific and Kumomoto oysters, Crassostrea gigas and Crassostrea sikamea. Aquaculture 174, 1–14. Flemer, B., Kennedy, J., Margassery, L.M., Morrissey, J.P., O'Gara, F., Dobson, A.D.W., 2012. Diversity and antimicrobial activities of microbes from two Irish marine sponges, Suberites carnosus and Leucosolenia sp. Journal of Applied Microbiology 112, 289–301. Gao, F., Fan, X., Yi, Z., Struder–Kypke, M., Song, W., 2010. Phylogenetic consideration of two scuticociliate genera, Philasterides and Boveria (Protozoa, Ciliophora) based on 18 S rRNA gene sequences. Parasitology International 59, 549–555.
P.M. Costa et al. / Aquaculture 370–371 (2012) 61–67 Gram, L., Melchiorsen, J., Bruhn, J.B., 2010. Antibacterial activity of marine culturable bacteria collected from a global sampling of ocean surface waters and surface swabs of marine organisms. Marine Biotechnology 12, 439–451. Harshbarger, J.C., Chang, S.C., 1977. Chlamydiae (with phages), mycoplasmas, and rickettsia in Chesapeake Bay bivalves. Science 196, 666–668. Howard, D.W., Smith, C.S., 1983. Histological techniques for marine bivalve mollusks. NOAA Technical Memorandum NMFS-F/NEC-25. National Oceanic and Atmospheric Administration. Woods Hole. Janda, J.M., Abbott, S.L., 2007. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: pluses, perils and pitfalls. Journal of Clinical Microbiology 45, 2761–2764. Johnson, M.A., Le Pennec, M., 1995. Association between the mollusc bivalve Loripes lucinalis and a Chlamydia-like organism, with comments on its pathogenic impact, life cycle and possible mode of transmission. Marine Biology 123, 523–530. Kurahashi, M., Yokota, A., 2007. Endozoicomonas elysicola gen. nov., sp. nov., a gammaproteobacterium isolated from the sea slug Elysia ornata. Systematic and Applied Microbiology 30, 202–206. Le Gall, G., Chagot, D., Mialhe, E., Grizel, H., 1988. Branchial Rickettsiales-like infection associated with a mass mortality of sea scallop Pecten maximus. Diseases of Aquatic Organisms 4, 229–232. Leite, R.B., Afonso, R., Cancela, M.L., 2004. Perkinsus sp. infestation in carpet-shell clams, Ruditapes decussatus (L.), along the Portuguese coast. Results from a 2–year survey. Aquaculture 240, 39–53. Long, H., Song, W., Chen, J., Gong, J., Ji, D., Hu, X., Ma, H., Zhu, M., Wang, M., 2006. Studies on an endoparasitic ciliate Boveria labialis (Protozoa: Ciliophora) from the sea cucumber, Apostichopus japonicus. Journal of the Marine Biological Association of the United Kingdom 86, 823–828. Mackinnon, D.L., Ray, H.N., 1931. Notes on the Ciliate Boveria stevensi Issel from Galeomma turtoni Sowerby at Plymouth. Journal of the Marine Biological Association of the United Kingdom 17, 577–582. Matias, D., Joaquim, S., Leitão, A., Massapina, C., 2009. Effect of geographic origin, temperature and timing of broodstock collection on conditioning, spawning success and larval viability of Ruditapes decussatus. Aquaculture International 17, 257–271. Meyers, T.R., 1979. Preliminary studies on a chlamydial agent in the digestive diverticular epithelium of hard clams Mercenaria mercenaria (L.) from Great South Bay, New York. Journal of Fish Diseases 2, 179–189. Mialhe, E., Chagot, D., Boulo, V., Comps, M., Ruano, F., Grizel, H., 1987. An infection of Ruditapes decussatus (Bivalvia) by Rickettsia. Aquatulture 67, 258–259. Navas, J.I., Castillo, M.C., Vera, P., Ruiz–Rico, M., 1992. Principal parasites observed in clams, Ruditapes decussatus (L.), Ruditapes philippinarum (Adam et Reeve), Venerupis pullastra (Montagu), and Venerupis aureus (Gmelin), from Huelva coast (S.W. Spain). Aquaculture 107, 193–199. Novoa, B., Balseiro, P., Figueras, A., 2004. Molecular detection of a haplosporidian parasite in carpet shell clam Ruditapes decussatus from Spain. Diseases of Aquatic Organisms 61, 89–93.
67
Paul–Pont, I., Gonzalez, P., Baudrimont, M., Jude, F., Raymond, N., Bourrasseau, L., Le Göic, N., Haynes, F., Legeay, A., Paillard, C., de Montaudouin, X., 2010. Interactive effects of metal contamination and pathogenic organisms on the marine bivalve Cerastoderma edule. Marine Pollution Bulletin 60, 515–525. Plunkett, L., Hidu, H., 1978. The role of Uronema marinum (Protozoa) in oyster hatchery production. Aquaculture 15, 219–235. Raabe, Z., 1970. Ordo Thigmotricha (Ciliata–Holotricha) II. Familia Hemispeiridae. Acta Protozoologica 7, 117–180. Ramos, M.F., Costa, A.R., Barandela, T., Saraiva, A., Rodrigues, P.N., 2007. Scuticociliate infection and pathology in cultured turbot Scophthalmus maximus. Diseases of Aquatic Organisms 74, 249–253. Redmond, M.C., Valentine, D.L., in press. Natural gas and temperature structured a microbial community response to the Deepwater Horizon oil spill. Proceedings of the National Academy of Sciences of the United States of America. http://dx.doi.org/10. 1073/pnas.1108756108. Renault, T., Cochennec, N., 1995. Chlamydia-like organisms in ctenidia and mantle cells of the Japanese oyster Crassostrea gigas from the French Atlantic coast. Diseases of Aquatic Organisms 23, 153–159. Robert, M., Garcia, C., Chollet, B., Lopez–Flores, I., Ferrand, S., François, C., Joly, J.-P., Arzul, I., 2009. Molecular detection and quantification of the protozoan Bonamia ostreae in the flat oyster, Ostrea edulis. Molecular and Cellular Probes 23, 264–271. Robledo, J.A.F., Nunes, P.A., Cancela, M.L., Vasta, G.R., 2002. Development of an in vitro clonal culture and characterization of the rRNA gene cluster of Perkinsus atlanticus, a protistan parasite of the clam Tapes decussatus. Journal of Eukaryotic Microbiology 49, 414–422. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular and Biological Evolution 10, 512–526. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular and Biological Evolution 28, 2731–2739. Teixeira de Sousa, J., Matias, D., Joaquim, S., Ben Hamadou, R., Leitão, A., 2011. Growth variation in bivalves: new insights into growth, physiology and somatic aneuploidy in the carpet shell Ruditapes decussatus. Journal of Experimental Marine Biology and Ecology 406, 46–53. Xu, K., Song, W., Warren, A., 2000. Observations on trichodinid ectoparasites (Ciliophora: Peritricha) from the gills of maricultured molluscs in China, with descriptions of three new species of Trichodina Ehrenberg, 1838. Systematic Parasitology 45, 17–24. Zurel, D., Benayahu, Y., Or, A., Kovacs, A., Gophna, U., 2011. Composition and dynamics of the gill microbiota of an invasive Indo-Pacific oyster in the eastern Mediterranean Sea. Environmental Microbiology 13, 1467–1476.