Molecular detection of the blood meal source of sand flies (Diptera: Psychodidae) in a transmission area of American cutaneous leishmaniasis, Paraná State, Brazil

Acta Tropica 143 (2015) 8–12

Contents lists available at ScienceDirect

Acta Tropica journal homepage: www.elsevier.com/locate/actatropica

Molecular detection of the blood meal source of sand flies (Diptera: Psychodidae) in a transmission area of American cutaneous leishmaniasis, Paraná State, Brazil Maurício Baum a , Edilene Alcântara de Castro a , Mara Cristina Pinto b , Thais Marchi Goulart c , Walter Baura a , Débora do Rocio Klisiowicz a , Magda Clara Vieira da Costa-Ribeiro a,∗ a

Federal University of Paraná, Biological Sciences Sector, Basic Pathology Department, Polytechnic Center, Curitiba, Paraná, Brazil State University Paulista Júlio de Mesquita Filho, Faculty of Pharmaceutical Sciences of Araraquara, Biological Sciences Department, Araraquara, São Paulo, Brazil c State University of Campinas, Institute of Biology, Department of Animal Biology, Campinas, São Paulo, Brazil b

a r t i c l e

i n f o

Article history: Received 20 June 2014 Received in revised form 28 October 2014 Accepted 7 November 2014 Available online 18 December 2014 Keywords: American cutaneous leishmaniasis Sand flies Prepronociceptin (PNOC) Host Reservoir

a b s t r a c t The feeding behavior of sand flies provides valuable information about the vector/host interactions and elucidates the epidemiological patterns of American cutaneous leishmaniasis (ACL) transmission. The aim of this study was to identify the blood meal sources of sand flies in endemic areas of leishmaniasis in Paraná State through polymerase chain reaction (PCR) amplification of a prepronociceptin (PNOC) gene fragment and its subsequent DNA sequencing. Moreover, molecular assays were conducted to evaluate the sensitivity and reproducibility of the PNOC gene amplification. Besides that, a time-course digestion test of the blood using sand flies that fed artificially on BALB/c mice was performed. Of 1263 female sand flies collected in the field, 93 (3.6%) specimens were engorged and 27 allowed efficient amplification of the PNOC gene. These flies had fed on equine (Equus caballus), porcine (Sus scrofa) and canine (Canis lupus familiaris) species. The results also showed that the identification of the blood meal sources of the sand flies using the molecular method was directly linked to the level of digestion of the blood (time-course) and not to the amount of blood that had been ingested or to the presence of inhibitors in the blood. © 2014 Elsevier B.V. All rights reserved.

1. Introduction American cutaneous leishmaniasis (ACL) is a non-contagious infectious disease caused by protozoa of the genus Leishmania that have a digenetic life cycle of alternating between a mammalian host and a vector insect, the sand fly (Reithinger et al., 2007). This parasite affects the skin and mucous membranes, and it has a worldwide distribution, being found in almost all American countries from the southern United States to northern Argentina, with the exception of Uruguay and Chile (Ministério da Saúde, 2007). In Brazil, several epidemiological patterns of ACL have been observed, which vary

∗ Corresponding author at: Federal University of Paraná, Biological Sciences Sector, Basic Pathology Department, Polytechnic Center, CEP 81530-900, Laboratory of Molecular Parasitology, Av. Cel. Francisco H. dos Santos s/n, 81531-980 Jardim das Américas, Curitiba, Paraná, Brazil. Tel.: +55 41 3361 1701. E-mail addresses: [email protected], [email protected] (M.C. Vieira da Costa-Ribeiro). http://dx.doi.org/10.1016/j.actatropica.2014.11.006 0001-706X/© 2014 Elsevier B.V. All rights reserved.

according to the species of sand fly involved in its transmission, the susceptibility of the human population and its level of exposure, as well as the diversity and competence of the hosts (Brito et al., 2012). Until recently, Brazil and Peru had respectively the first and second highest incidence of ACL in Latin America (Bern et al., 2008). However, with over 15,000 ACL cases reported in 2005 and 2006, Colombia ranks second after Brazil (30,000 per year) (Bern et al., 2008; Reithinger et al., 2007; Desjeux, 2004). In Brazil, there were 587,962 cases of ACL during the period of 1990–2011. Of these, 13,161 of the people affected by ACL lived in southern Brazil, with 12,495 of them living in Paraná State, representing 94.9% of the total number (Ministério da Saúde, 2013). The primary reservoirs of Leishmania are wild animals, and in the Americas, more than 40 species of mammals can harbor Leishmania, prominently those from the following groups: Edentata, Carnivora, Rodentia, Primata, Marsupialia and Perissodactyla. With the increase of Leishmania transmission, domestic and synanthropic animals have played an important role in the transmission

M. Baum et al. / Acta Tropica 143 (2015) 8–12

areas. However, only a few of these animals act as reservoirs and are important for maintaining this parasite as a source of infection of sand flies and thus contribute to the establishment of Leishmania in these areas (Quaresma et al., 2011; Dantas-Torres, 2007; Ashford and Richard, 1996). Investigations of the blood source of sand flies have great ecological and epidemiological significance because they enable the correct identification of the mammalian reservoirs and vectorfeeding preferences. Moreover, such studies contribute to the elucidation of the natural transmission cycle in a given area and allow the development of strategies for disease control (Quaresma et al., 2012; Afonso et al., 2012; Abbasi et al., 2009; Fonteles et al., 2009). Different methods have been used to identify feeding sources of arthropod vectors to properly evaluate their hematophagic preference. The technique of mass spectrometry uses hemoglobin from vertebrate hosts as the raw material (Silva, 2006). Among the serological methods utilized, the first and the most widely used methods are based on tests such as antigen-antibody precipitin. The precipitin test has been frequently used as a tool for identifying the blood meal sources of arthropod vectors (Baum et al., 2013; Souza et al., 2011; Oliveira-Pereira et al., 2008; Lorosa et al., 1998). The enzyme-linked immunosorbent assay (ELISA) is also a commonly used serological method for detecting blood sources (Marassá et al., 2013; Afonso et al., 2012). Recently, molecular approaches with a high degree of sensitivity and specificity for identifying blood meal sources have been developed, such as those based on the PCR (polymerase chain reaction) (Paiva-Cavalcanti et al., 2010). There are various molecular methods, among which are the following: PCR-RFLP (restriction fragment length polymorphism), amplification and sequencing of the cytochrome b gene (Quaresma et al., 2012; Sant’Anna et al., 2008; Kent and Norris, 2005), heteroduplex mobility assays (Abbasi et al., 2009) and multiplex PCR (Sant’Anna et al., 2008). Abbasi et al. (2009) identified the blood meal sources of sand flies via the cytochrome b gene PCR followed by reverse line blot (RLB) analysis. The prepronociceptin (PNOC) gene, which was largely used in phylogenetic studies of mammals (Murphy et al., 2001) was tested in Phlebotomus duboscqi (Haouas et al., 2007). The aim of the present study was to identify the blood meal sources of Lutzomyia (Nyssomyia) intermedia s.l. in an area of endemic ACL in Paraná State in southern Brazil through the amplification and sequencing of the prepronociceptin (PNOC) gene. Despite the importance of Paraná State a setting of ACL, this is the first study to determine the sand fly’s blood meal sources using this method.

2. Methods 2.1. Study area and sand fly collection The insects were collected in the municipality of Adrianópolis, in the rural locality of Epitácio Pessoa (24◦ 47 31 S and 48◦ 59 28 W) approximately 280 m above sea level. This municipality is located in the northeast of Paraná State, on the border of São Paulo State, and occupies an area of 1349 km2 with a population comprising 6376 inhabitants and a population density of 4.7 inhabitants per km2 . The vegetation consists of the Atlantic forest, and the area has a warm tropical climate with high temperatures in the summer and mild temperatures in the autumn and winter and high rainfall (IBGE, 2013). Sand fly collections were conducted during three consecutive weeks in January 2013. CDC light traps and Shannon-type traps were installed in the period from 7:00 pm to 6:00 am in different ecotypes (peridomicile, household and forest). The insects were

9

transported to the Laboratory of Molecular Parasitology, Federal University of Paraná, packed in a styrofoam box that contained dry ice to interrupt their digestive process via low temperature (Abbasi et al., 2009; Sant’Anna et al., 2008). The last abdominal segment of the female sand flies was maintained for morphological identification according to Young and Duncan (1994), and the remainder of the body was placed in tubes containing 70% ethanol and stored at −20 ◦ C.

2.2. DNA extraction and PCR assay For the extraction of total DNA, it was used 100 ␮L 5% Chelex (Loxdale and Lushai, 1998) in rabbit (Oryctolagus cuniculus) blood and sand flies. The samples were homogenized by vortexing for 15 s, after which they were centrifuged at 19,500 × g for 20 s and incubated in a water bath at 80 ◦ C for 30 min. After this period, the samples were homogenized by vortexing and again centrifuged at 19,500 × g for 20 s. Subsequently, the supernatant was removed, transferred to 0.6 mL microtubes, and stored at −20 ◦ C. The PCR primers used to amplify the prepronociceptin (PNOC) gene, PNOCF (5 GCATCCTTGAGTGTGAAGAGAA3 ) and PNOCR (5 TGCCTCATAAACTCACTGAACC3 ) (Jaouadi et al., 2013; Ninio et al., 2011; Haouas et al., 2007). The PCR mixture included 0.3 ␮L of primers [10 pmol], 2.5 ␮L of a PCR reagent [10×], 0.25 ␮L of dNTPs (dATP, dCTP, dGTP and dTTP) [10 mM] buffer, 1 ␮L of magnesium chloride [50 mM], 0.3 ␮L of platinum Taq DNA polymerase [5 U/␮L], 4 ␮L of total DNA and ultrapure water to bring the final volume to 25 ␮L. The thermal cycling protocol used was as follows: an initial denaturation step at 95 ◦ C for 5 min, 35 cycles of denaturation at 95 ◦ C for 30 s, annealing at 55 ◦ C for 30 s and extension at 72 ◦ C for 45 s, and then a final extension of 72 ◦ C for 5 min. The 100bp molecular weight markers were used. The DNA from a male sand fly was used as the negative control. The DNA from rabbit blood (O. cuniculus) was used as the positive control. The amplified PCR products were separated by electrophoresis on a 1.6% agarose gel, stained with ethidium bromide and visualized under ultraviolet light using a GIBCO BRL TFX 35 M UV transiluminator and a photo-documentation system.

2.3. Tests of sensitivity and reproducibility and evaluation of PCR inhibitors To test the sensitivity and reproducibility of the prepronociceptin (PNOC) gene amplification, PCR was performed using different volumes (0.1, 0.2, 0.3, 0.4, 0.5, 1.0, 1.5 or 2.0 ␮L) of DNA from rabbit blood. To verify possible inhibitory components affecting the reproducibility of PNOC gene amplification a serial dilution of rabbit blood was performed in volumes of 0.1, 0.2, 0.3, 0.4, 0.5, 1.0, 1.5, 2.0 ␮L plus a male sand fly in each sample. Electrophoresis was conducted to verify if amplification occurred.

2.4. Evaluation of the time-course of blood meal digestion using PNOC-gene detection To evaluate the time-course of blood digestion through PNOCgene detection, an analysis was performed using Lutzomyia neivai (F1 generation) females that were reared in the laboratory. Fourday-old females were allowed to feed on BALB/c mice and at different times after consuming the blood meal: 0, 12, 24, 48, 72 and 96 h, they were individually stored in 70% ethanol at −20 ◦ C for DNA extraction and PCR analysis. Ten females were individually evaluated for each time point after feeding.

10

M. Baum et al. / Acta Tropica 143 (2015) 8–12

Fig. 1. Time-course of DNA detection in sand fly blood meals by PNOC gene amplification. MWM: molecular weight marker (100 bp DNA ladder); C+: positive control; C− negative control.

2.5. Sequencing and analysis The PCR products were purified using the enzyme ExoSAP-IT (USB® ) according to the manufacturer’s instructions. Afterward, the sequencing reaction mixtures were prepared using a Big Dye Terminator Kit v3.1 (Applied Biosystems® ), as follows: 3.0 ␮L of buffer [10×], 1 ␮L of Big Dye v3.1, 0.5 ␮L of primers PNOC [10 pmol], 3 ␮L of PCR product and 2.5 ␮L of ultra-pure water, for a total volume of 10 ␮L. Then, the samples were subjected to the following protocol: 1 cycle of 96 ◦ C for 1 min, followed by 25 cycles of 96 ◦ C for 15 s, 55 ◦ C for 5 s and 60 ◦ C for 4 min. The sequencing reaction products were purified using Sephadex G-10 according to the manufacturer’s instructions and then were sequenced using an Applied Biosystems® 3500 automated sequencer. The sequences of both strands were edited using the BioEdit (Hall, 1999) and MEGA 5.0 (Molecular Evolutionary Genetics Analysis) (Tamura et al., 2011) programs, which produced a consensus strand for each sample. These sequences were compared with those available in GenBank using the Basic Local Alignment Search Tool algorithm (BLAST) to determine their identities. 3. Results In the test of the sensitivity and reproducibility of prepronociceptin (PNOC) gene amplification, all of the samples (0.1, 0.2, 0.3, 0.4, 0.5, 1.0, 1.5 and 2.0 ␮L) were shown to be positive for the expected band with a size corresponding to 330 base pairs (data not shown), validating the DNA-extraction process and showing the sensitivity and reproducibility of PNOC gene amplification using the minimum and maximum blood volumes (0.1 and 2.0 ␮L, respectively). With respect to the test for potential inhibitors, all of the samples (0.1, 0.2, 0.3, 0.4, 0.5, 1.0, 1.5 and 2.0 ␮L plus a male sand fly) yielded the expected band with a size corresponding to 330 base pairs (data not shown), validating the DNA extraction process and discarding probable PCR inhibitors. The data related to the time-course of the blood digestion in L. neivai that artificially fed on BALB/c mice showed that up to 24 h after feeding, the PNOC gene was detectable in all of the specimens. No amplification was observed at 48, 72 or 96 h after the blood meal (Fig. 1). To identify the blood meal source using DNA sequencing, 2851 sand flies were collected during the study period, of which 1263 females were L. intermedia s.l. A total of 1002 females (79.4%) were

Table 1 Identification of the blood source in sand flies by the PNOC gene amplification collected in Epitácio Pessoa, Adrianópolis municipality, Paraná State, Brazil. Blood meal source

Ecotope

Total

Peridomicile

Forest

No.

%

No.

%

No.

%

Sus scrofa Canis lupus familiaris Equus caballus

13 9 1

48.2 33.3 3.7

3 1 –

11.1 3.7 –

16 10 1

59.3 37.0 3.7

Total

23

85.2

4

14.8

27

100.0

captured in peridomicile regions, followed by 104 (8.2%) captured in households and 157 (12.4%) captured in the forest. Of these, 93 (3.26%) were engorged with intestinal contents suggestive of blood. It was possible to identify the blood source through PNOC gene sequencing in 27 (29%) of those engorged with blood (Table 1). All of the samples of the PNOC gene that were amplified by PCR were sequenced and compared with the sequences published in the GenBank database and were successfully identified at the species level with 99–100% similarity. The chromatograms showed no overlapping peaks, suggesting that our sand fly samples did not contain mixed blood meals. Of the 27 sequenced samples, 1 (3.7%) had fed on a horse (Equus caballus), 16 (59.3%) on pigs (Sus scrofa) and 10 (37%) on dogs (Canis lupus familiaris) (Table 1). 4. Discussion The control of ACL in endemic areas requires thorough knowledge of the ecology of the vectors and the reservoirs and their interaction with the protozoan Leishmania. It is very difficult to determine the reservoirs of this parasite in several areas in which it occurs. Therefore, identifying the blood-feeding insect vectors is critical to understand their feeding habits, their sectorial capacity, the ecological aspects related to the transmission of ACL and expand the knowledge about the epidemiology of the disease in a given endemic area. The sand flies collected in the locality of Epitácio Pessoa, Adrianópolis municipality, Paraná State, had 100% of the collected specimens belonging to the species L. intermedia s.l., which was found in all of the ecotypes studied, as follows: 1002 (79.4%) were found in peridomicile, followed by 104 (8.2%) found in households and 157 (12.4%) found in the forest. We adopted the terminology L.

M. Baum et al. / Acta Tropica 143 (2015) 8–12

intermedia s.l. for the insects collected in the field because we used the identification key of Young and Duncan (1994). However, it is noteworthy that, according to the literature, the species L. intermedia s.l. has been differentiated into two species, L. intermedia s.s. and L. neivai (Marcondes, 1996). Previous studies in the same municipality of Adrianópolis also reported L. intermedia s.l. as the most prevalent species collected (Baum et al., 2013; Castro et al., 2005; Silva and Gomes, 2001). To the best of our knowledge, this is the first study that used the PNOC gene to investigate the source of the blood meal of sand flies in Latin America. This technique was first applied to sand flies (Phlebotomus dubosqui) in Tunisia (Haouas et al., 2007). The tests of the sensitivity and reproducibility of the PNOC assay showed that it was effective for DNA detection via PCR. The successful amplification of a segment of the PNOC gene and the identification of the origin of blood meals being vertebrates also in culicoids (Ninio et al., 2011) suggests it may be possible to apply this method to other species of blood-sucking arthropods, particularly to the enzootic vectors of zoonoses or infections. Successful molecular blood meal identification depends on the amount of blood ingested and the period of blood digestion in the midgut of the insect (Kent and Norris, 2005). Sand flies display inter- and intraspecific variation in size, and the volume of blood that they ingested during blood feeding ranges from 0.1 to 1.0 ␮L (Abbasi et al., 2009; Daba et al., 2004). The PNOC gene primers used in this study were effective in detecting the presence of DNA using a minimum amount (0.1 ␮L) and a maximum amount (2.0 ␮L) of the tested blood. The digestion of blood in the intestines of the sand flies due to degradation by digestive proteases is a limiting factor for DNA detection using PCR because DNA degradation reduces the possibility of detection according to the post-ingestion period (Oshaghi et al., 2006). Our data showed that it is possible to detect the blood meal source using the PNOC gene up to 24 h after a blood meal. These data are consistent with those of a previous study (Haouas, et al., 2007). It has been reported that, depending on the species of sand fly, there is a peak of protease activity between 24 and 48 h after the blood meal (Dillon and Lane, 1993). Moreover, the erythrocytes of mammals do not contain a nucleus, a feature that contributes to the low amount of DNA present in their blood compared to that in the blood of birds (Abbasi et al., 2009; Daba et al., 2004). Only visually blood-engorged sand flies can be used for DNA analysis (Sant’Anna et al., 2008). Furthermore, the presence of Leishmania has also been shown to reduce the levels and activities of the proteases in the midgut of sand flies (Dillon and Lane, 1993). Another limiting factor of blood meal source identification using molecular methods is the PCR-inhibitory effect of substances in the tissues of insects, mostly those in their exoskeleton, head and thorax (Paiva et al., 2007) as well as those in blood, such as heme (Kent, 2009), which can decrease the efficiency of a PCR reaction. Because we used male sand flies to evaluate this matter, it was evident that the expected amplification of the PNOC gene fragment was not hampered by substances present in the blood or the insects that could have inhibited the PCR reaction, demonstrating that there were no false negative results in this study. The molecular identification of the blood meal source of sand flies collected in the field through amplifying a PNOC gene fragment was possible for 27 of 93 specimens that were visibly engorged. Many specimens of sand flies that were analyzed were negative and two possibilities can explain this result. Firstly, the time that their blood meals were subjected to digestive proteases was most likely more than 24 h, based on the blood digestion test described herein or secondly, the blood meal was taken from non-mammalian animals, such as birds. Precipitin tests conducted in the same area showed that 32.8% of L. intermedia s.l. fed on birds and that the remainder fed on dogs, horses, cattle, opossums, rodents, cats and

11

human, which indicates an extremely eclectic feeding behavior (Baum et al., 2013). Marassá et al. (2013) identified the sources of the blood meals of Nyssomyia intermedia and Nyssomyia neivai in the Ribeira River Valley in the State of São Paulo, Brazil and found that the insects fed on one or more sources of blood, predominantly humans, pigs, chickens and dogs. The cycles of leishmaniasis transmission depend on the movement of their potential animal reservoirs from the forest to the households as well as from humans and domestic animals to the forest. On this way, the methodology based on PNOC gene amplification constitute an important tool for identifying the blood meals sources of female sand flies in endemic area of American cutaneous leishmaniasis.

Acknowledgments The authors thanks to Guilherme Augustto Costa Damasio for sand flies sampling, to the residents of the properties studied for allowing the collection of sand flies and to João Carlos Minozzo (Production and Research Centre of Immunobiological Products – CPPI) for technical assistance. We also thank to Coordenac¸ão de Aperfeic¸oamento de Pessoal de Nível Superior (Capes) and National Council for Scientifical and Technological Development Agency (CNPq) for financial support and Federal University of Parana for providing transportation.

References Abbasi, I., Cunio, R., Warburg, A., 2009. Identification of blood meals imbibed by phlebotomine sand flies using cytochrome b PCR and reverse line blotting. Vector-Borne Zoonotic Dis. 9, 79–86. Afonso, M.M.S., Miranda Chaves, S.A., Rangel, E.F., 2012. Evaluation of feeding habits of haematophagous insects, with emphasis on Phlebotominae (Diptera: Psychodidae), vectors of Leishmaniasis-review. Trends Entomol. 8, 125–136. Ashford, R.W., 1996. Leishmaniasis reservoirs and their significance in control. Clin. Dermatol. 14, 523–532. Baum, M., Ribeiro, M.C.V.D.C., Lorosa, E.S., Damasio, G.A.C., Castro, E.A.D., 2013. Eclectic feeding behavior of Lutzomyia (Nyssomyia) intermedia (Diptera, Psychodidae, Phlebotominae) in the transmission area of American cutaneous leishmaniasis, state of Paraná, Brazil. Revista Sociedade Brasileira Med. Trop. 46, 560–565. Bern, C., Maguire, J.H., Alvar, J., 2008. Complexities of assessing the disease burden attributable to leishmaniasis. PLoS Negl. Trop. Dis. 2, 1–8. Brito, M.E.F.D., Andrade, M.S., Dantas-Torres, F., Rodrigues, E.H.G., Cavalcanti, M.D.P., Almeida, A.M.P.D., Brandão-Filho, S.P., 2012. Cutaneous leishmaniasis in northeastern Brazil: a critical appraisal of studies conducted in state of Pernambuco. Revista Sociedade Brasileira Med. Trop. 45, 425–429. Castro, E.A., Luz, E., Telles, F.Q., Pandey, A., Biseto, A., Dinaiski, M., Sbalqueiro, I., Soccol, V.T., 2005. Eco-epidemiological survey of Leishmania (Viannia) braziliensis American cutaneous and mucocutaneous leishmaniasis in Ribeira Valley River, Paraná State, Brazil. Acta Trop. 93, 141–149. Daba, S., Daba, A., Shehata, M.G., El Sawaf, B.M., 2004. A simple micro-assay method for estimating blood meal size of the sand fly, Phlebotomus langeroni (Diptera: Psychodidae). J. Egypt. Soc. Parasitol. 34, 173–182. Dantas-Torres, F., 2007. The role of dogs as reservoirs of Leishmania parasites, with emphasis on Leishmania (Leishmania) infantum and Leishmania (Viannia) braziliensis. Vet. Parasitol. 149, 139–146. Desjeux, P., 2004. Leishmaniasis: current situation and new perspectives comparative immunology. Microbiol. Infect. Dis. 27, 305–318. Dillon, R.J., Lane, P., 1993. Bloodmeal digestion in the midgut of Phlebotomus papatasi and Phlebotomus langeroni. Med. Vet. Entomol. 7, 225–232. Fonteles, R.S., Vasconcelos, G.C., Azevêdo, P.C.B., Lopes, G.N., Moraes, J.L.P., Lorosa, E.S., Kuppinger, O., Rebêlo, J.M.M., 2009. Preferência alimentar sanguínea de Lutzomyia whitmani (Diptera, Psychodidae) em área de transmissão de leishmaniose cutânea americana, no Estado do Maranhão, Brasil. Revista Sociedade Brasileira Med. Trop. 42, 647–650. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Haouas, N., Pesson, B., Boudabous, R., Dedet, J.P., Babba, H., Ravel, C., 2007. Development of a molecular tool for the identification of Leishmania reservoir hosts by blood meal analysis in the insect vectors. Am. J. Trop. Med. Hyg. 77, 1054–1059. 2013. Instituto Brasileiro de Geografia e Estatística (IBGE). IBGE, Brasília, Available at: http://www.ibge.gov.br/cidadesat/painel/painel.phpp?codmun=410020 (cited 11.04.13). Jaouadi, K., Haouas, N., Chaara, D., Boudabous, R., Gorcii, M., Kidar, A., Depaquit, J., Pratlong, F., Dedet, J.P., Babba, H., 2013. Phlebotomine (Diptera Psychodidae) bloodmeal sources in Tunisian cutaneous leishmaniasis foci: could Sergentomyia

12

M. Baum et al. / Acta Tropica 143 (2015) 8–12

minuta, which is not an exclusive Herpetophilic species, be implicated in the transmission of pathogens? Ann. Entomol. Soc. Am. 106, 79–85. Kent, R.J., 2009. Molecular methods for arthropod bloodmeal identification and applications to ecological and vector-borne disease studies. Mol. Ecol. Res. 9, 4–18. Kent, R.J., Norris, D.E., 2005. Identification of mammalian blood meals in mosquitoes by a multiplexed polymerase chain reaction targeting cytochrome B. Am. J. Trop. Med. Hyg. 73, 336–342. Lorosa, E.S., de Andrade, R.E., dos Santos, S.M., Pereira, C.A., 1998. Estudo da infecc¸ão natural e da fonte alimentar do Triatoma sordida (STAL, 1859), (HemipteraReduviidae) na região norte de Minas Gerais, Brasil, através da reac¸ão de Precipitina. Entomol. Vectores 5, 13–22. Loxdale, H.D., Lushai, G., 1998. Molecular markers in entomology, 88. Bull. Entomol. Res. – Lond., pp. 577–600. Marassá, A.M., Galati, E.A.B., Bergamaschi, D.P., Consales, C.A., 2013. Blood feeding patterns of Nyssomyia intermedia and Nyssomyia neivai (Diptera, Psychodidae) in a cutaneous leishmaniasis endemic area of the Ribeira Valley, State of São Paulo Brazil. Revista Sociedade Brasileira Med. Trop. 46, 547–554. Marcondes, C.B., 1996. A redescription of Lutzomyia (Nyssomyia) intermedia (Lutz & Neiva, 1912), and resurrection of L. neivai (Pinto, 1926) (Diptera, Psychodidae, Phlebotominae). Memórias Instituto Oswaldo Cruz 91, 457–462. Ministério da Saúde, 2013. Casos de leishmaniose Tegumentar Americana, Brasil, Grandes Regiões e Unidades Federadas. 1990–2011. Ministério da Saúde, Brasília, Available at: http://portal.saude.gov.br/portal/ arquivos/pdf/lta casos08 09 11.pdf (cited 26.05.13). Ministério da Saúde, 2007. Secretaria de Vigilância em Saúde. Manual de vigilância da leishmaniose tegumentar americana, 2nd ed. Editora do Ministério da Saúde, Brasília. Murphy, W.J., Eizirik, E., Johnson, W.E., Zhang, Y.P., Ryder, O.A., O’Brien, S.J., 2001. Molecular phylogenetics and the origins of placental mammals. Nature 409, 614–618. Ninio, C., Augot, D., Delecolle, J.C., Dufour, B., Depaquit, J., 2011. Contribution to the knowledge of Culicoides (Diptera: Ceratopogonidae) host preferences in France. Parasitol. Res. 108, 657–663. Oliveira-Pereira, Y.N., Moraes, J.L.P., Lorosa, E.S., Rebêlo, J.M.M., 2008. Preferência alimentar sanguínea de flebotomíneos da Amazônia do Maranhão Brasil. Cadernos Saúde Pública 24, 2183–2186. Oshaghi, M.A., Chavshin, A.R., Vatandoost, H., Yaaghoobi, F., Mohtarami, F., Noorjah, N., 2006. Effects of post-ingestion and physical conditions on PCR amplification of host blood meal DNA in mosquitoes. Exp. Parasitol. 112, 232–236.

Paiva, B.R.D., Secundino, N.F.C., Pimenta, P.F.P., Galati, E.A.B., Andrade Junior, H.F., Malafronte, R.D.S., 2007. Padronizac¸ão de condic¸ões para detecc¸ão de DNA de Leishmania spp. em flebotomíneos (Diptera Psychodidae) pela reac¸ão em cadeia da polimerase. Cadernos Saúde Pública 23, 87–94. Paiva-Cavalcanti, M., Regis-da-Silva, C.G., Gomes, Y.M., 2010. Comparison of realtime PCR and conventional PCR for detection of Leishmania (Leishmania) infantum infection: a mini-review. J. Venom. Anim. Toxins Incl. Trop. Dis. 16, 537–542. Quaresma, P.F., Carvalho, G.M.D.L., Ramos, M.C.D.N.F., Andrade Filho, J.D., 2012. Natural Leishmania sp. reservoirs and Phlebotomine sand fly food source identification in Ibitipoca State Park, Minas Gerais, Brazil. Memórias Instituto Oswaldo Cruz 107, 480–485. Quaresma, P.F., Rêgo, F.D., Botelho, H.A., da Silva, S.R., Moura Júnior, A.J., Neto, R.G.T., Madeira, F.M., Carvalho, M.B., Paglia, A.P., Melo, M.N., Gontijo, C.M., 2011. Wild, synanthropic and domestic hosts of Leishmania in an endemic area of cutaneous leishmaniasis in Minas Gerais State, Brazil. Trans. R. Soc. Trop. Med. Hyg. 105, 579–585. Reithinger, R., Dujardin, J.C., Louzir, H., Pirmez, C., Alexander, B., Brooker, S., 2007. Cutaneous leishmaniasis. Lancet Infect. Dis. 7, 581–596. Sant’Anna, M.R., Jones, N.G., Hindley, J.A., Mendes-Sousa, A.F., Dillon, R.J., Cavalcante, R.R., Alexander, B., Bates, P.A., 2008. Blood meal identification and parasite detection in laboratory-fed and field-captured Lutzomyia longipalpis by PCR using FTA databasing paper. Acta Trop. 107, 230–237. Silva, A.C., Gomes, A.C., 2001. Study of the vectorial competence of Lutzomyia intermedia (Lutz & Neiva 1912) to Leishmania (Viannia) braziliensis, Vianna, 1911. Revista Sociedade Brasileira Med. Trop. 34, 187–191. Silva, V.C., 2006. Identificac¸ão de Reservatórios de Zoonoses em Insetos Vetores por Espectrometria de Massa. Tese de Doutorado – Universidade de Brasília, Brasília. Souza, R.D.C.M.D., Soares, A.C., Alves, C.L., Lorosa, E.S., Pereira, M.H., Diotaiuti, L., 2011. Feeding behavior of Triatoma vitticeps (Reduviidae: Triatominae) in the state of Minas Gerais Brazil. Memórias Instituto Oswaldo Cruz 106, 16–22. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731– 2739. Young, D.G., Duncan, M.A., 1994. Guide to the Identification and Geographic Distribution of Lutzomyia Sand Flies in Mexico, the West Indies, Central and South America (Diptera: Psychodidae). Walter Reed Army Inst. of Research, Washington, DC.