Molecular detection of Yersinia pestis isolates of Indian origin by using Pla specific monoclonal antibodies

Comparative Immunology, Microbiology & Infectious Diseases 28 (2005) 131–144 www.elsevier.com/locate/cimid

Molecular detection of Yersinia pestis isolates of Indian origin by using Pla specific monoclonal antibodies S. Mahesh1, J. Shukla, U. Tuteja, H.V. Batra* Division of Microbiology, Defence R&D Establishment, Jhansi Road, Gwalior 474002, Madhya Pradesh, India Accepted 20 August 2004

Abstract Monoclonal antibodies (MAbs) were generated against the recombinant plasminogen activator (Pla) protein of Yersinia pestis. These MAbs detected Pla in all the 18 isolates of Y. pestis obtained from the sputum of pneumonic plague patients and from the liver and spleen of rodents from plagueaffected areas of India during 1994–1995 as well as in seven of the eight isolates obtained from rodents in the surveillance regions of Hosur and Palmner in India during 1998 by simple dot-ELISA. In immunoblotting, the MAbs reacted with the Pla antigen only in Y. pestis isolates at 37 and 35 kDa region. These monoclonal antibodies, being strictly specific, can be used for detecting Y. pestis isolates that are Fraction 1 antigen-negative. Also, the radiolabelled pla fragment hybridized specifically to the representative DNA samples of Y. pestis isolates. q 2004 Elsevier Ltd. All rights reserved. Keywords: Plasminogen activator; Recombinant protein; Monoclonal antibody; Indian isolates of Yersinia pestis; DNA probe

Re´sume´ Des anticorps monoclonaux (MAbs) ont e´te´ produits contre la prote´ine recombinante activatrice du plasminoge`ne (Pla) de Yersinia pestis. Ces MAbs de´tectent la Pla de l’ensemble des dix-huit

* Corresponding author. Tel.: C91 751 2233491; fax: C91 751 2341148. E-mail address: [email protected] (S. Mahesh). 1 Present address: Division of Microbiology, Defence Food Research Laboratory, Siddarthanagar, Mysore 570011, Karnataka, India. Tel.: C91 821 2473671; fax: C91 821 2473468. 0147-9571/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.cimid.2004.08.002

132

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

isolats de Y. pestis obtenus a` partir de crachat de patients atteints de peste pulmonaire et a` partir de foie et de rate de rongeur provenant de zones d’lnde affecte´es par la peste durant les anne´es 1994–1995, aussi bien que des sept des huit isolats obtenus de rongeurs dans les re´gions de surveillance d’Hosur et Palmner en Inde en 1998 par simple dot-ELISA. Par immunoblotting, les MAbs re´agissent avec l’antige`ne de Pla seulement pour les isolats de Y. pestis au niveau des re´gions de 37 et 35 kDa. Ces anticorps monoclonaux, tout en e´tant strictement spe´cifique, peuvent eˆtre utilise´s pour la de´tection d’isolats de Y. pestis qui sont ne´gatifs pour l’antige`ne de la Fraction 1. De plus, le fragment radiomarque´ de Pla s’hybridait spe´cifiquement aux e´chantillons d’ADN repre´sentatifs d’isolats de Y. pestis. q 2004 Elsevier Ltd. All rights reserved. Mots Clefs: Activatrice de plasminoge`ne; Prote´ine recombinante; Anticorps monoclonal; Isolates indien de Yersinia pestis; Sonde ADN

1. Introduction Yersinia pestis, the causative agent of plague, is one of 11 species in the genus Yersinia, three of which are pathogenic to man (Y. pestis, Y. pseudotuberculosis and Y. enterocolitica). Plague occurs predominantly in three forms, bubonic, pneumonic and septicemic. Y. pestis triggered an epidemic in the states of Maharashtra and Gujarat between August and October 1994. The isolated cultures from the sputum of pneumonic patients in the affected areas and from the liver and the spleen of the rodents between 1994 and 1995 were bacteriologically characterized and showed the presence of all plasmids viz; 9.5, 70 and 110 kb [1,2]. All the 18 isolates of Y. pestis were found positive for the plasminogen activator (pla) and fraction 1 (f1) genes located on the unique plasmids—9.5 and 110 kb plasmids, respectively, and the presence of Fraction 1 (F1) antigen was confirmed by immunoblotting [2]. On subsequent surveillance in the endemic plague foci of Southern India in the regions of Palmner and Hosur, eight isolates of Y. pestis were obtained from rodents during the year 1998. These were confirmed as Y. pestis by different bacteriological and biochemical methods (Urmil et al., unpublished observation) (Table 1). Table 1 Bacteriological and biochemical characteristics of the rodent isolates obtained from Hosur and Palamner Bacteriological/biochemical tests Wayson staining (bipolar safety pin appearance). Fermentation of glucose, mannitol, maltose, arabinose, xylose, salicin. Indole production, oxidase reaction, citrate utilization, hydrogen sulphide gas production, urea hydrolysis, decarboxylation of lysine and ornithine, hydrolysis of arginine. Fermentation of lactose, sucrose, rhamnose, adonitol, dulcitol, cellobiose.

Y. pestis rodent isolates 2H

3H

12H

18H

24H

25H

9R

10R

C

C

C

C

C

C

C

C

C

C

C

C

C

C

C

C

K

K

K

K

K

K

K

K

K

K

K

K

K

K

K

K

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

133

Y. pestis possesses fibrinolytic (plasminogen activator) and coagulase activities that play a significant role in the pathogenesis of plague. These are the bifunctional activities of the same protein coded by the pla gene located on unique 9.5 kb plasmid which is absent in the closely related Yersinia species [3]. This is a unique marker and can be used for diagnosis of Y. pestis along with the classically used F1 antigen. Earlier work [2] determined the expression of the Fl antigen in the Indian isolates but the expression of important virulent marker plasminogen activator (Pla) has not been studied in these isolates. This is of importance because the presence or absence of this antigen is known to play a significant role in virulence and pathogenesis [3]. The current work was undertaken with an aim to determine the expression of Pla in all these Indian isolates and study its antigenicity. It is also known that expression of Fl antigen is maximally expressed at 37 8C and cannot be used for identification of F1-antigen negative strains or for detection of strains of Y. pestis which are grown at 28 8C [3]. We, therefore, generated monoclonal antibodies (MAbs) against recombinant Pla and used it to detect Y. pestis strains of Indian origin that offers an alternative system of detection against the conventionally used F1 antigen detection method.

2. Materials and methods 2.1. Bacterial strains The standard strain of Y. pestis A1122 and that of Y. pseudotuberculosis 1A were procured from WHO Collaborating Centre at CDC, Fort Collins, USA. Y. enterocolitica strain 0:8, Y. kristensenii, Y. frederiksenii and Y. intermedia were received from Norway. During investigation of 1994 plague outbreak in the Beed district of Maharashtra and Surat city of Gujarat, 18 isolates of Y. pestis were recovered and 11 of these isolates were from pneumonic patients and the rest from rodent species [1]. Eight more Y. pestis isolates were recovered from surveillance region of Palmner and Hosur regions during 1998 in the states of Andhra Pradesh and Tamil Nadu (Urmil et al., unpublished observation) (Table 2). Klebsiella pneumoniae, Escherichia coli, Salmonella typhi, Salmonella abortus equi and Staphylococcus aureus were obtained from DRDE Gwalior. All these strains were maintained in trypticase soya agar (TSA) slants and utilized for present study. E. coli DH5a and E. coli SG13009 (Qiagen, USA) were obtained from Jawaharlal Nehru Table 2 Yersinia pestis isolates recovered from different regions Y. pestis (Source: pneumonic patients)a 4, 8, 9, 101, 102, 103, 104, 105, 106, 107, 108 Y. pestis (Source: rodents)a 111, 112, 113, 114, 115, 116, 117 Y. pestis (Source: rodents)b 2H, 3H, 12H, 18H, 24H, 25H, 9R, 10R

a b

Ref. [1]. Urmil et al., unpublished observation.

1994 Surat plague outbreak (Gujarat) 1994 Plague outbreaks (Dist. Beed, Maharashtra and Surat, Gujarat) 1998 Surveillance regions (Hosur, Tamil Nadu and Palmner, Andhra Pradesh)

134

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

University (JNU) New Delhi. Plasmid vectors pUC 18 and pQE 30 (Qiagen, USA) were also obtained from JNU, New Delhi and maintained in E. coli DH5a host cells. 2.2. DNA extraction Plasmid and chromosomal DNA of different bacterial cultures of Y. pestis were extracted according to the standard protocol [4]. Plasmid DNA of the vectors and the recombinant clones were purified using the Qiagen purification kit. 2.3. PCR amplification PCR amplification of Y. pestis 8 and Y. pestis A1122 DNA were performed using the following pla primers: forward primer 5 0 GAGCTGCAGGGTGTCTAATGAAGAA3 0 and reverse primer 5 0 AGTGAAAAGCTTGATATGATCTGTA3 0 (Genset Oligos, Japan). Y. enterocolitica O:8, Y. pseudotuberculosis 1A, E. coli DNA were used as the negative controls. The conditions for PCR amplification were: initial denaturation at 94 8C for 5 min with a three step process of denaturation at 94 8C for 1 min, annealing at 45 8C for 1 min 30 s and extension at 72 8C for 2 min for first 15 cycles followed by denaturation at 94 8C for 1 min, annealing at 50 8C for 1 min 30 s, extension at 72 8C for 1 min for second 15 cycles and final extension for 5 min at 72 8C in a thermalcycler (Perkin Elmer, USA). 2.4. Cloning of pla gene The amplified product of pla, 985 bp in length, was purified by Qia quick PCR purification kit. The amplified product and pUC 18 vector were digested with Pstl and HindIII, ligated and transformed into CaCl2 treated E. coli DH5a host cells as per the standard protocol [4]. The transformants were screened by blue white selection on Luria Bertani (LB) agar plate containing ampicillin (100 mg mlK1), 5-bromo-4-chloro-3indolyl-b-D-galactopyranoside (X-gal) (50 mg mlK1) and isopropyl-b-D-thiogalactopyranoside (IPTG, 50 mg m1K1) (Sigma). Mini prep was performed and recombinant clone was checked for the presence of the insert by restriction analysis and PCR. 2.5. Sequencing of pla gene Sequencing reaction of pla gene was performed as described [5] using USB sequenase version 2.0 DNA sequencing kit (Amersham Pharmacia, UK). a35S dATP was used in internal labelling. 2.6. Subcloning in expression vector The vector DNA of pQE 30 was prepared using QIAGEN plasmid purification kit. PCR amplicon of the pla from recombinant pUC 18 clone was obtained and purified by QIA quick purification kit. Both vector and amplicon were digested with PstI and HindIII, ligated and transformed into E. coli SG13009 cells and plated on LB agar plate containing ampicillin (100 mg mlK1) and kanamycin (25 mg mlK1). Transformants were selected

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

135

based on antibiotic resistance and their mini prep performed. The recombinant clone was tested for the presence of the insert by restriction analysis. Further confirmation of clone was done by PCR. 2.7. Expression and purification of the recombinant protein Overnight grown culture of recombinant clone was inoculated in LB broth tube containing ampicillin (100 mg mlK1) and kanamycin (25 mg mlK1). When the growth reached OD600 value of 0.7–0.9, the culture was induced with different concentrations of IPTG (0.5, 1, 1.5, 2 and 2.5 mM) and checked every 1 h for a period of 5 h for expression at 37 8C. Uninduced recombinant clone and E. coli SG13009 host cells were kept as controls. The cells were pelleted and boiled in lysis buffer for 5 min and run on 10% SDSPAGE. For obtaining the purified protein, 1% of the overnight grown culture of recombinant E. coli was added to 250 ml LB media containing ampicillin (100 mg mlK1) and kanamycin (25 mg mlK1). The culture was pelleted, suspended in 4 ml of lysis buffer and sonicated. The lysate was centrifuged to remove the cellular debris. The supernatant was added to 1 ml of 50% Ni-NTA slurry and stirred gently on magnetic stirrer at 4 8C for 1 h and the recombinant protein was purified by Ni-NTA column chromatography as per the manufacturers protocol (Qiagen, USA). Protein was estimated by Lowry’s method [6]. 2.8. Coagulase reaction Coagulase reaction was performed using citrated rabbit plasma [7]. The test was performed on purified Pla protein, IPTG-induced recombinant E. coli SG13009, Y. pestis 24H, standard Y. pestis A1122 strain as the positive control, E. coli SG13009 and rabbit plasma in normal saline as the negative control. Tubes were incubated at 28 8C for 24 h and periodically checked at regular intervals for coagulation. 2.9. Hyperimmune sera Rabbits and BALB/c mice were used for raising sera against the recombinant protein. Rabbits and mice were immunized at weekly intervals with 100 and 50 mg of recombinant Pla protein, respectively. The titre was checked by dot-ELISA using nitrocellulose (NC) strips coated with purified Pla and using rabbit or mice polyclonal serum as the primary antibody and anti-rabbit or anti-mouse horse radish peroxidase (HRP) conjugate (DAKO A/S Denmark) as the secondary antibody. 3,3 0 -Diaminobenzidine tetrahydrochloride (DAB) (Sigma) was used as the chromogen. 2.10. Testing of polyclonal antibody on Y. pestis isolates The cell lysates of standard Y. pestis A1122, E. coli SG13009 and IPTG-induced recombinant E. coli SG13009 were run on 10% SDS-PAGE and transferred onto nitrocellulose membranes for initial testing as per the recommended protocol [8]. Further, the whole cell lysates of Y. pestis isolates numbers 8, 9 recovered from the Surat pneumonic patients; numbers 112, 115 from the rodent species of outbreak regions;

136

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

numbers 2H, 3H, 12H and 24H from the rodent species of the surveillance regions and other Yersiniaspecies viz; Y. pseduotuberculosis 1A, Y. enterocolitica, Y. kristensenii, Y. frederiksenii, Y. intermedia were blotted onto NC membrane. The membrane was treated with mouse anti-Pla antibodies and developed with rabbit anti-mouse HRP conjugate (DAKO A/S, Denmark) using DAB as the chromogen. 2.11. Monoclonal antibodies Immunized mice were sensitized by three successive intraperitoneal injections and the sensitized spleen cells were fused with a mouse myeloma cell line Sp2/0-Ag 14 according to the standard protocol [9]. 2.12. Characterization of monoclonal antibodies Immunoglobulin heavy chain class (IgG, IgM and IgA) and light chain type (lamda and kappa) of MAbs were determined by dot-ELISA using HRP-labelled rabbit anti-mouse IgG, IgM and IgA conjugates (Mouse typer sub-isotyping kit, Bio-Rad). The preparative SDS-PAGE of standard Y. pestis strain A1122 was blotted onto NC membrane. The membrane was cut into 10 strips. One strip was tested with mouse hyperimmune sera and the remaining nine strips were tested with each of the nine MAbs. The strips were developed with rabbit anti-mouse HRP conjugate and DAB as the chromogen. 2.13. Specificity testing of monoclonal antibodies Specificity of MAbs were checked by dot-ELISA using sonicated antigen preparations of the standard strain of Y. pestis A1122 and other species, viz; Y. pseudotuberculosis 1A, Y. enterocolitica strain 0:8, Y. kristensenii, Y. frederiksenii, Y. intermedia, E. coli, S. typhi, S. aureus, S. abortus and K. pneumoniae. For this, bacterial cells harvested from brain heart infusion agar plates, were washed thrice with sterile phosphate buffered saline (PBS) and were suspended in sterile PBS containing PMSF (20 mg mlK1). It was sonicated using Microson Sonicator (Misonix Ltd, USA). The protein content was estimated and coated on NC strips. The strips were probed with all the nine MAbs as the primary antibody and antimouse HRP conjugate as the secondary antibody. DAB was used as the chromogen. 2.14. Testing of monoclonal antibodies on Y. pestis isolates 2.14.1. Dot-ELISA All the 26 isolates of Y. pestis alongwith the standard strain Y. pestis A1122 and other Yersinia species were tested by dot-ELISA. The sonicated fractions of different strains were coated on NC strips and probed with each of the nine MAb soups. The secondary antibody used was anti-mouse HRP conjugate and DAB as the chromogen. 2.14.2. Western blot The whole cell lysates of Y. pestis (8, 9, 112, 115, 2H, 3H, 12H, 24H) alongwith Y. pseudotuberculosis as the negative control and Y. pestis A1122 as the positive control were

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

137

blotted onto NC membrane and probed with the primary antibody MAb (PLA 5) and rabbit anti-mouse HRP conjugate as the secondary antibody. DAB was used as the chromogen. 2.15. DNA hybridization and testing of DNA probe on Y. pestis isolates The amplified 985 bp fragment from the recombinant pQE 30 clone was used for preparation of probe. Labelling of DNA was carried out as per the standard protocol [10] using a32P dCTP and the nick-translation kit (Amersham Pharmacia, UK). Hybridization was standardized initially on the DNA samples of Y. pestis A1122, Y. pseudotuberculosis and recombinant E. coli SG13009 spotted on the nylon membrane as per the standard protocol [11]. The sensitivity of 985 bp pla gene probe was tested by spotting on the nylon membrane DNA extracted from a Y. pestis isolate ranging from 1 mg to 30.5 pg in doubling dilutions. The a32P dCTP-labelled pla probe was hybridized to the DNA extracted from Y. pestis isolates numbers 8, 9, 112, 115, 2H, 3H, 12H, 24H, Y. pseudotuberculosis 1A, Y. enterocolitica strain 0:8, Y. kristensenii, Y. fredenksenii, Y. intermedia, E. coli. Y. pestis A1122 and recombinant E. coli SG13009 were used as the positive controls.

3. Results and discussion The virulence enhancing property of 9.5 kb pPCP1 plasmid is encoded by pla gene and is essential for the invasiveness of the organism operating through plasminogen activation and anti-protease inactivation [12]. It was our interest to locate the expression of Pla in the Y. pestis strains of Indian origin and study its antigenicity. In the present study, the full gene of pla was amplified from Y. pestis 8 DNA and cloned in pUC 18 vector. Y. pestis A1122 showed PCR amplification of pla gene while

Fig. 1. Full length amplification of pla gene. Lane 1, Y. pestis A1122; Lane 2, Y. pestis 8; Lane 3, Y. pseudotuberculosis 1A; Lane 4, Y. enterocolitica O:8; Lane 5, E. coli; Lane 6, DNA marker (1 kb ladder).

138

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

Fig. 2. Restriction analysis of recombinant pUC 18 clone. Lane 1, plasmid DNA of recombinant pUC 18 clone digested with PstI and HindIII. The insert released corresponds to 1 kb marker; Lane 2, pUC 18 plasmid DNA digested with PstI and HindIII; Lane 3, marker (Gene Ruler 1 kb DNA ladder, MBI Fermentas).

Y. pseudotuberculosis 1A, Y. enterocolitica O:8, E. coli were negative for pla (Fig. 1). Restriction digestion of the recombinant pUC 18 clone with the enzymes PstI and HindIII showed two distinct bands at 985 bp and 2.9 kb, representing the pla gene insert and the vector pUC 18, respectively (Fig. 2). PCR amplification of the clone showed a 985 bp band. The clone was sequenced and over 100 bp were read from the 5 0 and 3 0 end of the insert, which matched with the genebank sequence (AF053945). The pla gene was subcloned in a His tagged expression vector pQE 30 using the host E. coli SG13009. The restriction analysis of this clone showed two bands at 3.4 kb and 985 bp, respectively (Fig. 3). The presence of the insert was also confirmed by PCR. The recombinant clone showed maximum protein expression after 4 h of induction with 2 mM IPTG at 37 kDa region on SDS-PAGE. The His tagged recombinant Pla was purified by Ni-NTA chromatography and was over 70% pure as seen on SDS-PAGE (Fig. 4). The yield of the protein was 25 mg lK1 of the culture. The presence of noticeably thick band at 37 kDa region might have shadowed the presence of another form of Pla at 35 kDa band below it that is not well resolved. Several workers have cloned the pla gene in pBR322 vector or its derivatives and expressed the protein but with lesser yields. Bulgakova [13] had cloned the 1.45 kb

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

139

Fig. 3. Restriction analysis of recombinant pQE 30 clone. Lane 1, plasmid DNA of recombinant pQE 30 clone digested with PstI and HindIII. The insert released corresponds to 1 kb marker; Lane 2, pQE 30 plasmid DNA digested with PstI and HindIII; Lane 3, marker (Gene Ruler 1 kb DNA ladder, MBI Fermentas).

HindIII-SmaI site of the pla fragment on the 9.5 kb plasmid in pBR322 using E. coli strain K802 to obtain Pla. Kutyrev et al. [14] also obtained biologically active a-Pla and b-Pla on extracting E. coli LE392 (pPCP1) with 1.0 M NaCl. The cloning strategy adapted in the present study employing His-tagged pQE 30 expression vector, produced an N-terminal 6!-histidine fusion Pla protein with appreciably high yields using a single step purification of metal affinity chromatography. The Pla has bifunctional activity-coagulase activity with rabbit plasma at 28 8C and fibrinolytic activity against fibrinogen at 37 8C [3]. The purified recombinant protein, IPTG-induced recombinant E. coli SG13009 cells and the standard Y. pestis A1122 exhibited coagulase reaction at 28 8C within 24 h (Fig. 5). Coagulation reaction of the recombinant E. coli SG13009 and the purified Pla protein confirmed the functional intactness of the recombinant Pla like the native protein. Introduction of His tag at the N terminal of the protein did not inhibit the enzymatic activity of this protein. A Y. pestis isolate 24H, E. coli SG13009 and rabbit plasma with normal saline did not show any coagulation reaction at 28 8C. Rabbit and mice immunized with recombinant Pla showed antibody titres of 1:2,56,000 and 1:64,000, respectively, by dot-ELISA. In Western blot, the mouse polyclonal antiserum

140

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

Fig. 4. SDS-PAGE showing the expressed and purified protein. Lane 1, Molecular weight marker (66 and 29 kDa band indicated); Lane 2, E. coli SG13009; Lane 3, recombinant E. coli SG13009 (uninduced); Lane 4, recombinant E. coli SG13009 (induced); Lane 5, purified recombinant Pla protein.

reacted prominently at 35–37 kDa region only in IPTG-induced recombinant E. coli and Y. pestis A1122 indicating that Pla is antigenic. Mouse polyclonal sera showed a characteristic band at 35–37 kDa in seven of the eight representative Y. pestis isolates (8, 9, 112, 115, 2H, 3H, 12H) tested by Western blot. Most of the Y. pestis isolates tested were positive for Pla. No reaction was observed with Y. pestis 24H and other Yersinia species. This work is also supported by the data earlier obtained wherein PCR using pla specific detection primers on all the Y. pestis isolates except the isolate 24H, revealed amplification at 478 bp region (Urmil et al., unpublished observation). It is quite likely that the pla gene in Y. pestis strain 24H is defective or absent, as it was not only the immunoreactivity of protein that was found missing, but also the PCR failed to amplify the specific sequences. Our studies showed that the polyclonal sera cross-reacted with some high molecular weight proteins in Y. pestis and other Yersinia species. Using hybridoma technology it is possible to obtain a panel of MAbs directed against distinct epitopes of any complicated antigen. We, therefore, raised MAbs against Pla to determine the reactivity at the epitope level. Nine specific MAbs were obtained against the recombinant Pla and were named PLA1–PLA9 for convenience. Isotyping results showed that PLA1 is of IgG2b heavy chain and l light chain, PLA2 and 3 are of IgM heavy chain and k light chain, PLA4 is of IgG1 heavy chain and l light chain, PLA 5 is of IgG2b heavy chain and k light chain, PLA6 is of lgG2a heavy chain and l light chain, PLA 7 and 8 are of IgG1 heavy chain and k light chain, PLA9 is of IgG3 heavy chain and k light chain.

Fig. 5. Coagulation reaction of the recombinant protein. Lane 1, Rabbit plasma; Lane 2, Y. pestis A1122; Lane 3, recombinant E. coli SG13009 (induced); Lane 4, purified recombinant Pla protein. Lane 5, Y. pestis 24H; Lane 6, E. coli SG13009.

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

141

Fig. 6. Identification of Pla in Y. pestis isolates using monoclonal antibodies to Pla by dot-ELISA. Lanes 1–10, Y. pestis isolates (4, 8, 9, 101–107); Lane 11, Y. intermedia; Lanes 12, 24 and 36, Standard Y. pestis A1122; Lanes 13–22, Y. pestis isolates (108, 111–117, 2H and 3H); Lane 23, Y. kristensenii; Lanes 25–30, Y. pestis isolates (12H, 18H, 24H, 25H, 9R and 10R); Lanes 31–34, Y. pseudotuberculosis isolates (A87, K174, Ps1122 and 12R); Lane 35, Y. frederiksenii.

All the nine MAbs were specific to Y. pestis and did not cross-react with other Yersinia species and non-Yersinia species of family enterobacteriaceae as tested by dot-ELISA. The nine MAbs reacted only to Pla antigen at 37 and 35 kDa region on the standard Y. pestis lysate A1122 by Western blot. The strip probed with the mouse HIS showed a band at 35–37 kDa region. These MAbs are able to recognise the denatured form of Pla and appears to react to an epitope common to both the 37 and 35 kDa region. All the nine MAbs reacted with 25 of 26 isolates except isolate 24H of surveillance region and other Yersinia species in dot-ELISA (Fig. 6). The MAb (PLA 5) reacted to the Pla protein in the representative Y. pestis isolates numbers 8, 9, 112, 115, 2H, 3H, 12H and the standard A1122 at around 37 and 35 kDa region but did not react with Y. pestis 24H and the negative control in Western blot (Fig. 7). The presence of two bands at 37 and 35 kDa region by Western blot in the Y. pestis isolates are in accordance to the published literature on the existence of the two forms of Pla [15]. The specificity of these monoclonal antibodies makes it an ideal tool for detecting the presence of Y. pestis in the fleas and rodents. This will help in epidemiological monitoring of Y. pestis strains prevalent in the natural environment.

Fig. 7. Western blot analysis of Pla antigen with monoclonal antibody (PLA 5). Lane 1, Y. pestis 8; Lane 2, Y. pestis 9; Lane 3, Y. pestis 112; Lane 4, Y. pestis 115; Lane 5, Y. pestis 2H; Lane 6, Y. pestis 3H; Lane 7, Y. pestis 12H; Lane 8, Y. pestis A1122; Lane 9, Y. pestis 24H; Lane 10, Y. pseudotuberculosis.

142

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

Fig. 8. Sensitivity of DNA probe. Lane 1A–D (1 mg, 500, 250, 125 ng of Y. pestis DNA); Lane 2A–D (62.5, 31.2, 15.6, 7.8 ng of Y. pestis DNA); Lane 3A–D (3.9, 1.9 ng, 976, 488 pg of Y. pestis DNA); Lane 4A–D (244, 122, 61, 30.5 pg of Y. pestis DNA).

While utilizing the probe based on the unique plasmid of pathogenic microorganism, it is easy to develop test system to identify the strains of both typical (in plasmid profile, phenotypic properties, etc.) and atypical (in which the plasmid may have deletions or disturbances in expression of their individual determinants) organisms as well as obtain information on the presence of virulence determinants in strains. This also allows efficient detection of the strains defective in the production of Pla protein that are not diagnosable by immunological method [16]. During the initial standardization of dot blot hybridization, dot was observed with Y. pestis A1122 and recombinant E. coli SG13009 but not with negative control tested. The probe was able to detect around 1.9 ng of Y. pestis DNA (Fig. 8). The 985 bp pla gene probe specifically hybridized to seven of the eight representative Y. pestis isolates 8, 9, 112, 115, 2H, 3H, 12H and the positive controls Y. pestis A1122, recombinant E. coli SG13009. The probe did not react with Y. pestis isolate 24H, Y. pseudotuberculosis 1A,

Fig. 9. Identification of pla gene in Y. pestis isolates using DNA probe by dot blot hybridization. 1A, Y. pestis A1122; 1B, Y. pseudotuberculosis 1A; 1C, Y. enterocolitica O:8; 1D, Y. pestis 8; 2A, Y. pestis 9; 2B, Y. pestis 112; 2C, Y. kristensenii; 2D, Y. pestis 115; 3A, Y. pestis 2H; 3B, Y. pestis 3H; 3C, Y. intermedia; 3D, Y. frederiksenii; 4A, E. coli; 4B, Y. pestis 24H; 4C, Y. pestis 12H; 4D, recombinant E. coli SG13009.

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

143

Y. enterocolitica strain O:8, Y. kristensenii, Y. frederiksenii, Y. intermedia and E. coli (Fig. 9). The probe could identify the pla gene in majority of the Y. pestis isolates tested. Because of its high specificity and reliability the probe will aid in plague diagnosis. The results with polyclonal antibodies, monoclonal antibodies and DNA probe confirmed the presence of the pla gene and its protein in majority of the Y. pestis isolates of Indian origin both from the surveillance regions and the outbreak regions at the genetic and protein levels. These molecular tests indicate that the pla gene is stable in these isolates. This is also supported by the study where the 9.5 kb plasmid was present in majority of the 159 strains isolated from different geographical regions of China [17]. One isolate Y. pestis 24H was found to be defective for the pla gene. This could be a specific mutant of this strain occurring in the natural environment. The molecular tests like PCR, DNA probe and Western blotting are highly reliable and sensitive in identification of Pla positive Y. pestis strains but the dot-ELISA-based tests using Pla-specific MAbs are equally sensitive and dependable and have the merits of being simple and convenient to use besides being highly cost-effective. This is particularly relevant for the detection of naturally occurring Y. pestis strains which lack the F1 plasmid including the findings from our laboratory on the existence of F1 negative strains obtained from the rodents in the surveillance region (Urmil et al., unpublished data, [3]). These Pla-specific monoclonal antibodies can be used for detection of Y. pestis as an alternative to the conventionally used F1 diagnostic test.

Acknowledgements The authors are grateful to Director DRDE, Gwalior for the encouragement to conduct the study.

References [1] Batra HV, Tuteja U, Agarwal GS. Isolation and identification of Yersinia pestis responsible for the recent plague outbreaks in India. Curr Sci 1996;71(10):787–91. [2] Panda SK, Nanda SK, Ghosh A, et al. The 1994 plague epidemic of India. Molecular diagnosis and characterization of Yersinia pestis isolates from Surat and Beed. Curr Sci 1996;71(10):794–9. [3] Perry RD, Fetherston JD. Yersinia pestis—etiologic agent of plague. Clin Microb Rev 1997;10:35–66. [4] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning, a laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989. [5] Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 1977;74:5463–7. [6] Lowry’s OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the folin phenol reagent. J Biol Chem 1951;193:265–73. [7] Beesley ED, Brubaker RR, Janssen WA, Surgulla MJ. Pesticins.3. Expression of coagulase and mechanism of fibrinolysis. J Bacteriol 1967;94:19–26. [8] Towbin H, Staehelin T, Gordan J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedures and some applications. Proc Natl Acad Sci USA 1979;76:4350–4. [9] Kohler G, Milstein C. Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 1975;256:495–9.

144

S. Mahesh et al. / Comp. Immun. Microbiol. Infect. Dis. 28 (2005) 131–144

[10] Rigby PWJ, Dieckmann M, Rhodes C, Berg P. Labelling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J Mol Biol 1977;113:237–51. [11] Wetmur JG. Ribonucleic acid–deoxyribonucleic acid membrane filter hybridization. Biochemistry 1975;82: 1234–42. [12] Kukkonen M, Lahteenmaki K, Suomalainen M, et al. Protein regions important for plasminogen activation and inactivation of a2-antiplasmin in the surface protease Pla of Yersinia pestis. Mol Microbiol 2001;40: 1097–111. [13] Bulgakova EG. Functional mapping of Yersinia pestis pPst. PhD Thesis, Russia State Antiplague Research Institute. ‘Microbe’, Russia; 1991. [14] Kutyrev VV, Mehigh RJ, Motin VL, Pokrovskaya MS, Smirnov GB, Brubaker RR. Expression of the plague plasminogen activator in Yersinia pseudotuberculosis and Escherichia coli. Infect Immun 1999;67: 1359–67. [15] Sodeinde OA, Goguen JD. Genetic analysis of the 9.5-kilobase plasmid of Yersinia pestis. Infect Immun 1988;56(10):2743–8. [16] Popov YA, Bulgakova EG, Kulichenko N, et al. Detection of a test system for identification of plague based on genetic probes. Genetika 1992;27(12):2063–70. [17] Zao M, Ceng Z, Zang C, He Y, Thang G. The plasmid profile of Yersinia pestis strains in different natural foci of plague in the People’s Republic of China. Zh Mikrobiol Epidemiol Immunobiol 1993;Mar-Apr 2: 27–31.