- Email: [email protected]
Molecular diagnostic for detecting the acetylcholinesterase mutations in insecticide-resistant populations of Colorado potato beetle, Leptinotarsa decemlineata (Say)
Pesticide Biochemistry and Physiology 104 (2012) 150–156
Contents lists available at SciVerse ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Molecular diagnostic for detecting the acetylcholinesterase mutations in insecticide-resistant populations of Colorado potato beetle, Leptinotarsa decemlineata (Say) M. Malekmohammadi a,⇑, M.J. Hejazi b, M.S. Mossadegh c, H. Galehdari d, M. Khanjani a, M.T. Goodarzi e a
Department of Plant Protection, Faculty of Agriculture, Bu Ali Sina University, Hamedan, Iran Department of Plant Protection, Faculty of Agriculture, University of Tabriz, Tabriz, Iran Department of Plant Protection, Faculty of Agriculture, Shahid Chamran University, Ahwaz, Iran d Department of Genetics, Faculty of Science, Shahid Chamran University, Ahwaz, Iran e Research Center for Molecular Medicine, Hamedan University of Medical Sciences, Hamedan, Iran b c
a r t i c l e
i n f o
Article history: Available online 7 July 2012 Keywords: Colorado potato beetle AChE gene PCR–RFLP PCR–SSCP
a b s t r a c t Insecticide-resistant populations of Colorado potato beetle (CPB), with insensitive acetylcholinesterase (AChE) have recently been reported from commercial potato fields of Hamedan province in west of Iran. The objective of this study was to clarify the molecular mechanism of this insensitivity. The serine to glycine change at position 291 (S291G) in the AChE gene was found previously in an azinphosmethyl-resistant strain of CPB (AZ-R). PCR–RFLP assays were used to monitor the frequency of the S291G resistance mutation in resistant field populations of CPB, Aliabad, Bahar, Dehpiaz, and Yengijeh. The S291G mutation was detected in 66.6, 73.3, 53.3 and 26.6% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively. Moreover, only 25% of samples from the resistant field populations were homozygous for S291G mutation. There was no significant correlation between the mutation frequencies and resistance levels in the resistant populations, indicating that other mutations may contribute to this variation. PCR– SSCP method was used to find sequence variation in the AChE gene. Based on the published nucleotide sequence information on AChE gene (GenBank L41180.1), five primer pairs were designed to amplify specific PCR products of 306 bp (first fragment: codons 24–142), 370 bp (second fragment: codons 141–261), 403 bp (third fragment: codons 248–381), 335 bp (fourth fragment: codons 376–486), and 335 bp (fifth fragment: codons 488–598). No specific PCR product of desirable size for either the fourth and fifth fragments could be obtained. The DNA amplification products were subjected to SSCP analysis to identify the DNA sequence variations between the susceptible strain and resistant populations. Ninety-five beetles of susceptible strain (15 beetles) and four field populations (20 of each) were screened. Allelic differences were detected by distinctive electrophoretic patterns of each single strand. Nucleotide sequence variations in the different SSCP patterns were verified by direct DNA sequencing. Alignment of the AChE gene sequences with the sequencing results revealed 16 point mutations (V44G, E128D, R140G, I143F, T248S, F250S, G251C, I261M, S265I, S291G, G353R, L356R, E366K, S378E, S378R, E382D) from the field populations of CPB, which may contribute to the AChE insensitivity. Further analysis on the RNA level is necessary for clarification and validation of this contention. Ó 2012 Elsevier Inc. All rights reserved.
Abbreviations: AChE, acetylcholinesterase; ATC, acetylthiocholine iodide; AZ-R, azinphosmethyl-resistant CPB strain; bi-PASA, bi-directional PCR amplification of specific allele; BTC, butyrylthiocholine iodide; CB, carbamates; CPB, Colorado potato beetle; DEF, S,S,S-tributylphosphorotrithioate; DEM, diethyl maleate; OP, organophosphate insecticide; PBO, piperonyl butoxide; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; SNP, single nucleotide polymorphisms; SS, susceptible strain; SSCP, single strand conformation polymorphism. ⇑ Corresponding author. Fax: +98 8118251013. E-mail addresses: [email protected] (M. Malekmohammadi), [email protected] (M.J. Hejazi), [email protected] (M.S. Mossadegh), [email protected] (H. Galehdari), [email protected] (M. Khanjani), [email protected] (M.T. Goodarzi). 0048-3575/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pestbp.2012.06.004
Introduction Prevalence of resistance to insecticides as a genetic evolutionary phenomenon is of crucial importance in the continued effective use of these chemical agents [1]. Studies on resistance revealed that apart from arthropods, at least 200 species of plant pathogens, 273 species of weeds, and several species of nematodes and rodents are also resistant to one or more pesticides [2]. Colorado potato beetle (CPB, Leptinotarsa decemlineata Say), is the major pest of potatoes in Iran and many other parts of the world. Injury is
151
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
caused when adults and larvae feed on foliage and stems of potato plants resulting in poor yields and/or death of the plants. Adults can also vector plants diseases. The need to control these beetles has involved the use of different insecticides. Presently, the beetle is resistant to nearly all classes of insecticides and remains a serious pest in many parts of the world [2]. All resistance mechanisms reported in insects have been demonstrated in CPB [3,4]. There are many reports demonstrating elevated efficiency or quantity of cytochrome P450 monooxygenases, esterases, and glutathione-S-transferases in insecticide-resistant CPBs [3,5,6]. However, alteration of acetylcholinesterase (AChE; EC 3.1.1.7) to an insensitive form associated with increased AChE activity has been proven as an important mechanism for resistance to organophosphates (OPs) and/or carbamates (CBs) in some insect species [7– 10]. Previous studies have determined OPs and CBs resistance in CPB [4,11–21]. The high level of resistance to azinphosmethyl (136-fold) in a nearly isogenic CPB strain (AZ-R) was due to multiple resistance mechanisms, including reduced penetration, enhanced xenobiotic metabolism, and target site-insensitivity [17,22]. Continuous use of organophosphorous (OP) insecticides over a period of many years, as the major means of control of CPB in Iran has led to a growing concern that development of resistance is occurring. In these circumstances, it is important that populations under insecticide selection pressure are monitored. To date, very little background information is available concerning either the level of resistance to OPs, or of the mechanisms that may be involved. The first study aimed at investigating the presence and distribution of insecticide resistance in Iranian populations started in 2004. Mohammadi Sharif et al. [23] reported resistance to endosulfan, ranging from 18- to 220-fold, in field populations of CPB from East Azarbaijan province. Two synergists, piperonyl butoxide (PBO) and S,S,S-tributylphosphorotrithioate (DEF), decreased resistance 2.3 and 3.5 times in the resistant strain, respectively, indicating that metabolic detoxification has a minor contribution to resistance. Results from the biochemical assays also indicate that there is no significant difference in glutathione-S-transferase activity between the susceptible and resistant strains [23]. Mohammadi Sharif et al. [24], have also identified a point mutation resulting in the replacement of an alanine by a serine in the Rdl gene of Colorado potato beetle that confers resistance to endosulfan. Phosalone (OP) was one of the most common insecticides used for CPB control in Hamedan, Iran. There is anecdotal evidence from local farmers of a reduction in the efficacy of control of CPB by phosalone, probably due to reduced susceptibility to the insecticide. Insecticide resistant populations of CPB with insensitive acetylcholinesterase (AChE) have recently been reported from commercial potato fields of Hamedan province in west of Iran [25]. Bioassays involving topical application of phosalone to fourth instars revealed up to 252-fold resistance in field populations compared with the susceptible strain (SS). Synergism studies showed that although esterase and/or glutathione-S-transferase metabolic pathways were present and active against phosalone, they were not selected for and did not have a major role in resistance. The aims of the current study were: (1) To determine relative frequency of the S291G mutation in OP-resistant field populations of Colorado potato beetle using PCR–RFLP method: (2) To investigate the possibility of new mutations that may play a role in insecticide resistance. Additional knowledge of phosalone resistance mechanisms will increase our understanding of the evolution of insecticide resistance, and could provide new clues for the management of insecticide-resistant populations.
Materials and methods Insects After preliminary screening, diagnostic dose bioassay, four field populations of CPB collected from commercial potato fields of Hamedan province in west of Iran (Aliabad, Bahar, Dehpiaz, and Yengijeh) with the least mortality to phosalone treatments were used for the resistant allele monitoring study. These populations were part of a larger sampling study performed from 2005 to 2008 to survey the resistance to phosalone in CPB populations from different commercial potato fields in Hamedan province [25]. An insecticide susceptible CPB, originally supplied by M. S. Goettel, Agriculture and Agri-Food Canada Research Center, Lethbridge was used as the reference laboratory-reared strain. Resistance mutation diagnostic Restriction fragment length polymorphism (RFLP) analysis Genomic DNA was extracted from individual insects using total DNA extraction kit (DNeasy Blood and Tissue Kit, Qiagen Gmbh) following the manufacturer’s instructions. Primers for the diagnostic tests were designed directly from the L. decemlineata ace cDNA sequence (GenBank Accession No. L41180.1). The serine to glycine substitution at position 291 (S291G) in the AChE gene was found previously in an azinphosmethyl-resistant strain of CPB [26]. The diagnostic assay for the detection of the S291G mutation was based on the PCR amplification of a 164 bp fragment (codons 267–320) within exon 1, using the primers LdaceF and LdaceR (Table 1) and subsequent restriction digestion with MspI. The S291G mutation resulting from an A to G substitution creates a site for the restriction enzyme MspI (Fig. 1). The amplified fragment of the resistant allele contains a restriction site for MspI, and digestion yields two fragments of 72 and 92 bp. PCR was initiated by one preliminary denaturation step at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s and 72 °C for 30 s, with a final extension step of 5 min at 72 °C. Five milliliters of the amplification products were incubated at 37 °C for 12 h in manufacturer’s reaction buffer (10 Buffer Tango) with 1 ml of enzyme (MSPI). Digestion products were electrophoresed on 12% acrylamide gel in TBE buffer and stained with the silver staining method. Single strand conformation polymorphism (SSCP) analysis Based on the published nucleotide sequence information on AChE gene (GenBank L41180.1), five primer pairs were designed to amplify specific PCR products of 306 bp (first fragment: codons 24–142), 370 bp (second fragment: codons 141–261), 403 bp (third fragment: codons 248–381), 335 bp (fourth fragment:
Table 1 Primers used in PCR amplification and DNA sequencing experiments. 0
0
Primers
Sequences (5 –3 )
Product size (bp)
Codons
LdaceF LdaceR Ldace1F Ldace1R Ldace2F Ldace2R Ldace3F Ldace3R Ldace4F Ldace4R Ldace5F Ldace5R
tgtcacaaaagggctcgttc ccatcaccttacgcggacta ctctagtcgtcgaaacaaccagtg tacgcaaccgctggggaacc ggttgcgtatcagacatcacgctg agatggatgctaatcgatcctcc acgctctttggtgaatctgcagga catcgtgattactccccagcagaa ctggggagtaatcacgatgaagga aacgacgtgctcgtcctatgg tttcacccataggacgagca acgtgttgacacaaggagcttcc
164
267–320
306
42–142
370
141–261
403
248–381
335
376–486
335
488–598
F: forward primer; R: reverse primer.
152
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
Ldace-F
T GTC ACA AAA GGG CTC GTT CGC AGG GGT ATC ATG CAA TCG GGC ACC ATG AAC GCT V T K G L V R R G I M Q S G T M N A
MSPI site in resistant 291 (G) GGT CCG TGG AGC TAC ATG TCC AGT GAA CGC GCA GAA CAA ATC GGT AAA ATT CTC ATA P W S Y M S S E R A E Q I G K I L I
ace-R ace-S
Ldace-R
CAG GAC TGT GGC TGC AAC GTT TCT CTT TTG GAA AAT AGT CCG CGT AAG GTG ATG G Q D C G C N V S L L E N S P R K V M Fig. 1. Diagrammatic representation of the primer locations and mutation-associated restriction site variations in L. decemlineata AChE gene amplification products.
codons 376–486), and 335 bp (fifth fragment: codons 488–598) (Table 1). The reaction conditions were as follows: an initial denaturation at 94 °C for 3 min followed by 40 cycles of 94 °C for 15 s, 58 °C for 2 min, and 72 °C for 45 s followed by a final extension at 72 °C for 5 min for first fragment, 94 °C for 3 min followed by 40 cycles of 94 °C for 15 s, 61 °C for 1 min, and 72 °C for 1 min and a final extension at 72 °C for 5 min for second fragment, 94 °C for 2 min followed by 40 cycles of 94 °C for 15 s, 61 °C for 1 min, and 72 °C for 1 min and a final extension at 72 °C for 5 min for third fragment. We could not optimize the PCR conditions for fourth and fifth fragments. The DNA amplification products were subjected to SSCP analysis to identify the DNA sequence variations between the susceptible strain and resistant populations. Screened were 95 beetles of susceptible strain (15 beetles) and four field populations (20 of each). The single-strand conformation polymorphism (SSCP) analysis was carried out with the mini-electrophoresis apparatus using 1 TBE buffer. Each PCR product was diluted in denaturing buffer (95% formamide, 10 mM NaOH, 10 mM xylene cyanol, and 10 mM bromophenol blue), heated at 95 °C for 10 min, cooled in ice for 10 min and analyzed by polyacrylamide gel electrophoresis. Several factors were tested for each fragment in order to optimize SSCP conditions such as the amount of PCR product, denaturing solution, acrylamide concentration, percentage cross linking, glycerol, voltage, and running time. The best electrophoresis conditions are summarized in Table 2. Denatured and nondenatured samples were separated on polyacylamide gel at 200–350 V for about 8– 15 h at room temperature. Genomic DNA polymorphisms from resistant populations of CPB were detected by silver staining [27].
Results PCR–RFLP diagnostic test for detection of S291G point mutation PCR–RFLP assays were used to monitor the frequency of the S291G resistance mutation in resistant field populations of CPB (Fig. 2). The S291G mutation was detected in 66.6, 73.3, 53.3 and 26.6% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively (Table 3). Moreover, only twenty- five percent of samples from the resistant field populations were homozygous for S291G mutation. There was no significant correlation between the mutation frequencies and resistance levels in the resistant populations, indicating that other mutations may contribute to this variation. SSCP analysis Polymorphism in the partial L. decemlineata AChE gene of four field populations was investigated using PCR and SSCP. Several factors were tested for each fragment in order to optimize SSCP con-
1
2
3
4
5
200 bp
Data analysis
150 bp
About 20 ll of PCR products from both diagnostic tests were directly sequenced in both directions. The DNA sequences were analyzed by the BLAST program of the NCBI. Alignment to the sequence of the susceptible cDNA confirmed the synonymous and nonsynonymous mutations.
100 bp
50 bp
Table 2 The best SSCP electrophoresis conditions for first, second and third fragments of L. decemlineata AChE gene. Fragment 1 2 3
Acrylamid (%)
PCR product (ll)
Denaturing solution (ll)
Running time (h)
33.3 28.5 33.3
6 4 7
10 10 8
8 11 15
Fig. 2. PCR–RFLP analysis to detect the presence of the S291G mutation in individual beetles representing various susceptible and resistant genotypes. The lane on the extreme right contains a size marker (multiples of 50 bp fragments); lanes contain the MSPI digest products from individuals either homozygous for the wild-type ‘‘susceptible’’ allele (SS, lanes 2, and 5), homozygous for the S291G ‘‘resistance’’ allele (RR, lanes 3, and 4) or heterozygous (RS, lane 1).
153
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156 Table 3 Frequencies of resistance alleles in L. decemlineata from susceptible strain vs. resistant populations by PCR–RFLP analysis. Population/ strain
Sample size
S291G allelic frequencies (heterozygote/homozygote)
Susceptible Bahar Dehpiaz Aliabad Yengijeh
10 15 15 15 15
– 66.6 73.3 53.3 26.6
(5/5) (4/7) (6/2) (3/1)
ditions. The best electrophoresis conditions are summarized in Table 2. The variation was clearly shown by the number of bands and their position in the gel. The SSCP profiles for the first, second, and third fragments of AChE gene from field populations of L. decemlineata were denominated from ‘‘A’’ to ‘‘F’’ (Figs. 3–5) (Table 4). No specific PCR product of desirable size for both fourth and fifth fragments could be obtained. Putative structure of the gene encoding AChE in the L. decemlineata regarding to the sequence analysis in the present study is shown in Fig. 6.
Fig. 5. SSCP patterns of third fragment of AChE gene from a susceptible strain (SS) and field, populations of L. decemlineata, 5 profiles (labelled A–E).
DNA sequence analysis
Discussion
Nucleotide sequence variations in the different SSCP patterns were verified by direct DNA sequencing. Alignment of the AChE gene sequences with the sequencing results revealed sixteen point mutations (V44G, E128D, R140G, I143F, T248S, F250S, G251C, I261M, S265I, S291G, G353R, L356R, E366K, S378E, S378R, E382D) from the field populations of CPB, that likely contribute to the AChE insensitivity (Tables 5 and 6). Further gene expression analysis on the RNA level needed for a more complete evaluation.
PCR–RFLP diagnostic tests for detection of S291G point mutation
Fig. 3. SSCP patterns of first fragment of AChE gene from a susceptible strain (SS) and field populations of L. decemlineata, 6 profiles (labelled A–F).
Although bioassays are essential to validate the presence of resistance in populations and to quantify the levels of resistance associated with particular mechanisms, biochemical and molecular monitoring techniques enable very accurate assessments of resistance gene frequency to be made. AChEs from the field populations in our previous study [25] had relatively greater hydrolysis activities using substrates with larger alkyl substitutions (e.g., butyrylthiocholine iodide vs acetylthiocholine iodide) and were also less sensitive to inhibition by methoxy substituted insecticides (e.g., methyl paraoxon) as compared to the susceptible form. Thus, AChEs elicited structure–activity relationships similar to those previously reported for the native form of AChE [17], in which the less bulky substrates and inhibitors interacted more efficiently with the native AChE from the susceptible strain and the more bulky substrates and inhibitors interacted more efficiently with the native AChE from the resistant populations. These results are indicative of a typical negative cross–insensitivity of AChE to different organophosphorus inhibitors. Subsequent molecular analysis has identified the A ? G point mutation, which causes a S291G substitution in azinphosmethylresistant AChE [26]. Results of the study on the three-dimensional
Table 4 Frequency of six SSCP patterns (genotypes) in the partial DNA fragments of L. decemlineata AChE gene. Fragment
Fig. 4. SSCP patterns of second fragment of AChE gene from a susceptible strain (SS) and field populations of L. decemlineata, 4 profiles (labelled A–D).
Population
Genotypes A
B
C
D
E
F
1
Bahar Dehpiaz Aliabad Yengijeh
3 4 6 3
7 5 2 3
2 4 3 3
1 3 4 4
4 2 3 4
3 2 2 3
2
Bahar Dehpiaz Aliabad Yengijeh
3 7 9 3
4 3 3 4
8 5 5 6
5 5 3 7
– – – –
– – – –
3
Bahar Dehpiaz Aliabad Yengijeh
2 6 5 4
4 4 3 3
8 4 3 4
3 3 4 5
3 3 5 4
– – – –
154
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
Fig. 6. Putative structure of the gene encoding AChE in the L. decemlineata regarding to the sequence analysis in the present study.
Table 5 Number of nucleotide differences and amino acid substitutions found in the L. decemlineat AChE gene. Strain/ population
Fragment 1 Nucleotide differences (silent mutation)
Point mutation
Nucleotide differences (silent mutation)
Fragment 2 Point mutation
Nucleotide differences (silent mutation)
Fragment 3 Point mutation
Susceptible Bahar
– 12(11)
– 4 (3)
– F250S
– 4 (1)
– S291G E382D G353R
Dehpiaz
15 (14)
– V44G, R140G R140G
7 (5)
16 (6)
Aliabad Yengijeh
5 (4) 26 (24)
E128D V44D, R140G
3 (2) 3 (3)
I143F, T248S T248S –
G251C I261M S265I S291G L356R E366K S378E S378R S291G S378R S291G
2 (–) 4 (3)
Table 6 Current study AChE mutations among the resistant populations of L. decemlineata. This study LdAChE
Zhu and Clark (1995)
Zhu et al. (1996)
Kim et al. (2007)
R30K V44G, E128D, R140G, I143F M221T T248S, F250S, G251C, I261M, S265I, S291G,
S291G
D308K F345S
G353R, L356R, E366K, S378R, E382D
structure of AChE from Torpedo [28] revealed S291G could alter the position of the a–E0 1 helix and lead to conformational changes in both catalytic and peripheral anionic binding site [11]. These findings supported the assumption that S291G altered the positioning of the a–E0 1 helix and increased the size of the esteratic subsite within the catalytic center of AChE [12]. With respect to the above findings, we used PCR–RFLP method to determine relative frequency of the S291G mutation in resistant field populations of CPB. Sequence analysis revealed that the SerGly (AGT to GGT) mutation known to be associated with the azinphosmethyl resistance was present in all populations tested at a relatively low frequency. The relative frequency of the S291G mutation in field populations of Colorado potato beetle predicted by the PCR–RFLP method (66.6, 73.3, 53.3 and 26.6% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively) agreed well with that determined by individual genotyping (61.7, 71.4, 54.2, and 24.2%, respectively), demonstrating the reliability and accuracy of PCR–RFLP method in predicting resistance allele frequency. The PCR–RFLP method is technically simpler than other techniques, can be used in most laboratories and is not very expensive. This approach has proved successful in many genome screening projects [29–33]. SSCP analysis There was no significant correlation between the S291G mutation frequencies and resistance levels in the field collected populations (up to 252-fold resistance), indicating that other mutations may contribute to this variation. PCR–SSCP method was used to find sequence variation in the AChE gene. Success of SSCP method depends heavily upon the optimization of electrophoretic conditions to maximise differential migration
I392T
among DNA fragments. Several factors were assayed to improve the efficiency of the PCR–SSCP method. We found that low crosslinking ratio of acrylamide and bisacrylamide (49:1) is useful for increasing the detection efficiency of SSCP. The addition of 5% glycerol into the polyacrylamide gel improved the SSCP sensitivity. This is possibly due to the property of glycerol in keeping the conformation and making a charge difference of single stranded DNA [34]. Within the Colorado potato field populations, four to six SSCP patterns were observed (Table 4). The presence of susceptible alleles was clearly distinguishable from the banding pattern produced by resistant alleles. Although, the mutation detection rate may decrease for sequences longer than 200 bp, but under our running conditions, we detected 88–96% of point mutations by SSCP. Mutations in the first fragment, which is 306 bp long, were detected at much higher frequency. Nucleotide sequence variations in the different SSCP patterns were verified by direct DNA sequencing. Alignment of the AChE gene sequences with the sequencing results revealed numerous single nucleotide polymorphisms (SNP). 101 SNPs were identified in the partial AChE gene from four field populations, in which 33 substitutions are transversion (purine base replaces a pyrimidine base and the reverse) and 68 are transition (purine base exchanges another purine base or pyrimidine base exchanges another pyrimidine base). 76 substitutions in protein coding regions (CDS) were synonymous (silent substitution) (Table 5). Sixteen amino acid replacements were observed. The most frequently occurring mutations were R140G, S291G, and S378E. One consistent nonsilent SNP occurred in all resistant populations, was a substitution of serine for glycine at position 291 (S291G). This study has demonstrated that the SSCPs method is an effective and efficient method for assaying molecular genetic variation in CPB populations.
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
Two DNA-based genotyping techniques, bidirectional PCR amplification of specific allele (bi-PASA) and single stranded conformational polymorphism (SSCP), have been previously developed for detection of kdr-like pyrethroid resistance in field populations of Colorado potato beetle [29,35]. Kim et al. [36] evaluated the reliability and accuracy of these two genotyping techniques to monitor resistant and susceptible allele frequencies in CPB populations. Zhang et al. [18] developed a SSCP protocol and a minisequencing reaction to validate the S291G mutation associated with acetylcholinesterase sensitivity to azinphosmethyl in Colorado potato beetle. SSCP analysis as an easy, rapid, cheap, and rugged DNA-based diagnostic method, is able to detect resistance-associated mutations [18,37]. Conclusion Although bioassays are definitely essential to validate the presence of resistance in populations and to quantify the levels of resistance associated with particular mechanisms, biochemical and molecular monitoring techniques enable very accurate assessments of resistance gene frequency to be made. To establish a successful resistance management program, it is essential to develop more sensitive tools for the precise estimation of both frequency and genotype of resistance alleles. Various DNA-based genotyping techniques, such as restriction fragment length polymorphism (RFLP) [29–33], bi-directional PCR amplification of specific allele (bi-PASA) [29,38,39], single stranded conformational polymorphism (SSCP) [37] have been used for the detection of insecticide resistance-associated mutations including the A302S mutation (rdl) of GABA receptor channel in the cyclodiene-resistant insect species [37], L1014F mutation (kdr) of sodium channel in Colorado potato beetle [35] and S291G mutation of acetylcholinesterase in the azinphosmethyl-resistant Colorado potato beetle [36,38]. Indeed bioassay results revealed a 225-fold decrease in susceptibility to phosalone in the field populations studied, and as compared to the susceptible strain [25]. Our previous study has provided some basic information concerning variation of AChE activity in different populations of CPB. The biochemical analysis results showed that the sensitivity of AChE from the resistant populations was different, which means some inconsistent mutations in individual strains may also contribute to AChE insensitivity. In this study, considerable SNPs and deduced amino-acid replacements were also identified in insensitive AChE genes from resistant field populations of CPB, probably reflecting the different nature of insecticide pressures and the fitness cost associated with resistance genes. Unfortunately, historical data concerning the type and extent of insecticides used against CPB are difficult to obtain. However, whether a mutation that occurs in insensitive AChE is associated with insecticide resistance or not, needs to be further confirmed with site-directed mutagenesis and functional expression experiments. Acknowledgements The authors would like to acknowledge Drs. J.M. Clark, and A. Zamani for technical assistance. We are grateful to the members of the Genetic Lab. and PND center, Shafa Hospital for the laboratory facilities and support. We appreciate Drs. Peighan and Firoozi for their continued support. We also thank anonymous reviewers for critical review of the manuscript. References [1] R.L. Metcalf, H.W. Luckman, Introduction to Insect Pest Management, third ed., John Willey and Sons Inc., New York, 1994. pp. 250.
155
[2] L.P. Pedigo, Entomology and pest management, Fourth ed., Prentice –Hall of Indian Private Limited, New Delhi- 110001, 2004, pp. 193, 563–566. [3] B.A. Bishop, E.J. Grafius, Insecticide resistance in the Colorado potato beetle, pp. 355–377. In P.H.A. Jolivet and M. L. Cox [eds.], Chrysomelidae biology, vol. 1: the classification, phylogeny and genetics. SPB Academic Publishing, Amsterdam, The Netherlands. 1996. [4] J.H. Tolman, S.A. Hilton, J.W. Whistlecraft, D.C. MacArthur, Survey of susceptibility of representative Canadian populations of Colorado potato beetle, Leptinotarsa decemlineata (Say) to selected insecticides: Admire 240F (imidacloprid), Matador 120EC (lambda-cyhalothrin) and Success 480SC (spinosad). Annual Research Report (FY 2002–2003) to Ontario potato Board (AAFC M.I.I. Project No.A03027). 2002. [5] L. Zhao, B.A. Bishop, E.J. Grafius, Inheritance and synergism of resistance to imidacloprid in the Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 93 (2000) 1508–1514. [6] G.C. Cutler, J.H. Tolman, C.D. Scott-Dupree, C.R. Harris, Resistance potential of Colorado potato beetle (Coleoptera: Chrysomelidae) to novaluron, J. Econ. Entomol. 98 (2005) 1685–1693. [7] D. Fournier, J.M. Bride, F. Hoffman, F. Karch, Acetylcholinesterase: two types of modifications confer resistance to insecticide, J. Biol. Chem. 267 (1992) 14270– 14274. [8] F.W. Plapp Jr., R.K. Tripathi, Biochemical genetics of altered acetylcholinesterase resistance to insecticides in the housefly, Biochem. Genet. 16 (1978) 1–12. [9] H. Hama, T. Iwata, T. Miyata, T. Saito, Some properties of acetylcholinesterase partially purified from susceptible and resistant green rice leafhoppers, Nephotetix cincticeps Uhler (Hemiptera: Deltocephalidae), Appl. Entomol. Zool. 15 (1980) 249–261. [10] K.Y. Zhu, J.R. Gao, Increased activity associated with reduced sensitivity of acetylcholinesterase in organophosphate-resistant green bug, Schizaphis graminum (Homoptera: Aphididae), Pestic. Sci. 55 (1999) 11–17. [11] K.Y. Zhu, J.M. Clark, Validation of a point mutation of acetylcholinesterase in Colorado potato beetle by polymerase chain reaction coupled to enzyme inhibition assay, Pestic. Biochem. Physiol. 57 (1997) 28–35. [12] H.J. Kim, K.S. Yoon, J.M. Clark, Functional analysis of mutations in expressed acetylcholinesterase that result in azinphosmethyl and carbofuran resistance in Colorado potato beetle, Pestic. Biochem. Physiol. 88 (2007) 181–190. [13] J.M. Clark, Insecticides as tools in probing vital receptors and enzymes in excitable membranes, Pestic. Biochem. Physiol. 57 (1997) 235–254. [14] J.A. Argentine, J.M. Clark, D.N. Ferro, Relative fitness of insecticide-resistant Colorado potato beetle strains (Coleoptera, Chrysomelidae), Environ. Entomol. 18 (1989) 705–710. [15] J.A. Argentine, K.Y. Zhu, S.H. Lee, J.M. Clark, Biochemical mechanisms of azinphosmethyl resistance in isogenic strains of Colorado potato beetle, Pestic. Biochem. Physiol. 48 (1994) 63–78. [16] J.A. Argentine, S.H. Lee, M.A. Sos, S.R. Barry, J.M. Clark, Permethrin resistance in a near isogenic strain of Colorado potato beetle, Pestic. Biochem. Physiol. 53 (1995) 97–115. [17] K.Y. Zhu, K.Y. Clark, Comparison of kinetic properties of acetylcholinesterase purified from azinphosmethyl-susceptible and resistant strains of Colorado potato beetle, Pestic. Biochem. Physiol. 51 (1995) 57–67. [18] A. Zhang, J.B. Dunn, J.M. Clark, An efficient strategy for validation of a point mutation associated with acetylcholinesterase sensitivity to azinphosmethyl in Colorado potato beetle, Leptinotarsa decemlineata (Say), Pestic. Biochem. Physiol. 65 (1999) 25–35. [19] H.J. Kim, J.B. Dunn, K.S. Yoon, J.M. Clark, Target site insensitivity and mutational analysis of acetylcholinesterase from a carbofuran-resistant population of Colorado potato beetle, Leptinotarsa decemlineata (Say), Pestic. Biochem. Physiol. 84 (2006) 165–179. [20] J.M. Wierenga, R.M. Hollingworth, Inhibition of altered acetylcholinesterase from insecticide-resistant Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 86 (1993) 673. [21] J.A. Argentine, J.M. Clark, D.N. Ferro, Genetics and synergism of resistance to azinphosmethyl and permethrin in the Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 82 (1989) 698–705. [22] K.Y. Zhu, J.M. Clark, Purification and characterization of acetylcholinesterase from the Colorado potato beetle, Leptinotarsa decemlineata (Say), Insect. Biochem. Mol. Biol. 24 (1994) 453–461. [23] M. Mohammadi Sharif, M.J. Hejazi, A. Mohammadi, M.R. Rashidi, Inheritance and synergism of resistance to imidacloprid in the Colorado potato beetle (Coleoptera: Chrysomelidae), J. Insect Science. 7 (2007) 1–7. [24] M. Mohammadi Sharif, M.J. Hejazi, A. Mohammadi, M.R. Rashidi, Identification the molecular basis of resistance to endosulfan in resistant populations of Colorado potato beetle, Proceeding of 18th Iranian Plant Protection Congress. (2008) 147. [25] M. Malekmohammadi, M.S. Mossadegh, M.J. Hejazi, M.T. Goodarzi, M. Khanjani, H. Galehdari, Synergism of resistance to phosalone and comparison of kinetic properties of acetylcholinesterase from four field populations and a susceptible strain of Colorado potato beetle, Pestic. Biochem. Physiol. 98 (2010) 254–262. [26] K.Y. Zhu, S.H. Lee, J.M. Clark, A point mutation of acetylcholinesterase associated with azinphosmethyl resistance and reduced fitness in Colorado potato beetle, Pestic. Biochem. Physiol. 55 (1996) 100–108. [27] R.C. Switzer, C.R. Merril, S. Shifrin, A highly sensitive silver stain for detecting proteins and peptides in polyacrylamide gels, Anal. Biochem. 98 (1979) 231– 237.
156
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
[28] J.L. Sussman, M. Harel, F. Frolow, C. Oefner, A. Goldman, L. Toker, I. Silman, Atomic structure of acetylcholinesterase from Torpedo californica: a prototypic acetylcholine-binding protein, Science 253 (1991) 872–879. [29] S.H. Lee, J.B. Dunn, J.M. Clark, D.M. Soderlund, Molecular analysis of kdr-like resistance in a permethrin resistant strain of Colorado potato beetle, Pestic. Biochem. Physiol. 63 (1999) 63–75. [30] S. Cassanelli, M. Reyes, M. Rault, G.C. Manicardi, B. Sauphanor, Acetylcholinesterase mutation in an insecticide-resistant population of the codling moth Cydia pomonella (L.), Insect Biochem. Mol. Biol. 36 (2006) 642–653. [31] E.G. Kakani, I.M. Ioannides, J.T. Margaritopoulos, N.A. Seraphides, P.J. Skouras, J.A. Tsitsipis, K.D. Mathiopoulos, A small deletion in the olive fly acetylcholinesterase gene associated with high levels of organophosphate resistance, Insect Biochem. Mol. Biol. 38 (2008) 781–787. [32] H. Alout, P. Labbé, N. Pasteur, M. Weill, High incidence of ace-1 duplicated haplotypes in resistant Culex pipiens mosquitoes from Algeria, Insect Biochem. Mol. Biol. 41 (2011) 29–35. [33] L. Yuan, S. Wang, J. Zhou, Y. Du, Y. Zhang, J. Wang, Status of insecticide resistance and associated mutations in Q-biotype of whitefly, Bemisia tabaci, from eastern China, Crop Prot. 31 (2012) 67–71.
[34] K. Hayashi, D.W. Yandell, How sensitive is PCR–SSCP?, Hum Mutat. 2 (1993) 338–346. [35] J.M. Clark, S.H. Lee, H.J. Kim, K.S. Yoon, A. Zhang, DNA-based genotyping techniques for the detection of point mutations associated with insecticide resistance in Colorado potato beetle Leptinotarsa decemlineata, Pest Manag. Sci. 57 (2001) 968–974. [36] J.H. Kim, D.J. Hawthorne, T. Peters, G.P. Dively, J.M. Clark, Application of DNAbased genotyping for the detection of kdr-like pyrethroid resistance in field populations of Colorado potato beetle, Pestic. Biochem. Physiol. 81 (2005) 85– 96. [37] C. Coustau, R.H. Ffrench-Constant, Detection of cyclodiene insecticide resistance-associated mutations by single stranded conformation polymorphism analysis, Pestic. Sci. 43 (1995) 267–271. [38] J.M. Clark, S.H. Lee, H.J. Kim, K.S. Yoon, J.R. Gao, S.B. Symington, D.J. Hawthorne, Molecular detection of knockdown resistant mutations in insects, in: 10th International Congress of Pesticide Chemistry, Basel Switzerland, 8/4-9, 2002, Abst. No. 3C.41.
Contents lists available at SciVerse ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Molecular diagnostic for detecting the acetylcholinesterase mutations in insecticide-resistant populations of Colorado potato beetle, Leptinotarsa decemlineata (Say) M. Malekmohammadi a,⇑, M.J. Hejazi b, M.S. Mossadegh c, H. Galehdari d, M. Khanjani a, M.T. Goodarzi e a
Department of Plant Protection, Faculty of Agriculture, Bu Ali Sina University, Hamedan, Iran Department of Plant Protection, Faculty of Agriculture, University of Tabriz, Tabriz, Iran Department of Plant Protection, Faculty of Agriculture, Shahid Chamran University, Ahwaz, Iran d Department of Genetics, Faculty of Science, Shahid Chamran University, Ahwaz, Iran e Research Center for Molecular Medicine, Hamedan University of Medical Sciences, Hamedan, Iran b c
a r t i c l e
i n f o
Article history: Available online 7 July 2012 Keywords: Colorado potato beetle AChE gene PCR–RFLP PCR–SSCP
a b s t r a c t Insecticide-resistant populations of Colorado potato beetle (CPB), with insensitive acetylcholinesterase (AChE) have recently been reported from commercial potato fields of Hamedan province in west of Iran. The objective of this study was to clarify the molecular mechanism of this insensitivity. The serine to glycine change at position 291 (S291G) in the AChE gene was found previously in an azinphosmethyl-resistant strain of CPB (AZ-R). PCR–RFLP assays were used to monitor the frequency of the S291G resistance mutation in resistant field populations of CPB, Aliabad, Bahar, Dehpiaz, and Yengijeh. The S291G mutation was detected in 66.6, 73.3, 53.3 and 26.6% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively. Moreover, only 25% of samples from the resistant field populations were homozygous for S291G mutation. There was no significant correlation between the mutation frequencies and resistance levels in the resistant populations, indicating that other mutations may contribute to this variation. PCR– SSCP method was used to find sequence variation in the AChE gene. Based on the published nucleotide sequence information on AChE gene (GenBank L41180.1), five primer pairs were designed to amplify specific PCR products of 306 bp (first fragment: codons 24–142), 370 bp (second fragment: codons 141–261), 403 bp (third fragment: codons 248–381), 335 bp (fourth fragment: codons 376–486), and 335 bp (fifth fragment: codons 488–598). No specific PCR product of desirable size for either the fourth and fifth fragments could be obtained. The DNA amplification products were subjected to SSCP analysis to identify the DNA sequence variations between the susceptible strain and resistant populations. Ninety-five beetles of susceptible strain (15 beetles) and four field populations (20 of each) were screened. Allelic differences were detected by distinctive electrophoretic patterns of each single strand. Nucleotide sequence variations in the different SSCP patterns were verified by direct DNA sequencing. Alignment of the AChE gene sequences with the sequencing results revealed 16 point mutations (V44G, E128D, R140G, I143F, T248S, F250S, G251C, I261M, S265I, S291G, G353R, L356R, E366K, S378E, S378R, E382D) from the field populations of CPB, which may contribute to the AChE insensitivity. Further analysis on the RNA level is necessary for clarification and validation of this contention. Ó 2012 Elsevier Inc. All rights reserved.
Abbreviations: AChE, acetylcholinesterase; ATC, acetylthiocholine iodide; AZ-R, azinphosmethyl-resistant CPB strain; bi-PASA, bi-directional PCR amplification of specific allele; BTC, butyrylthiocholine iodide; CB, carbamates; CPB, Colorado potato beetle; DEF, S,S,S-tributylphosphorotrithioate; DEM, diethyl maleate; OP, organophosphate insecticide; PBO, piperonyl butoxide; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; SNP, single nucleotide polymorphisms; SS, susceptible strain; SSCP, single strand conformation polymorphism. ⇑ Corresponding author. Fax: +98 8118251013. E-mail addresses: [email protected] (M. Malekmohammadi), [email protected] (M.J. Hejazi), [email protected] (M.S. Mossadegh), [email protected] (H. Galehdari), [email protected] (M. Khanjani), [email protected] (M.T. Goodarzi). 0048-3575/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pestbp.2012.06.004
Introduction Prevalence of resistance to insecticides as a genetic evolutionary phenomenon is of crucial importance in the continued effective use of these chemical agents [1]. Studies on resistance revealed that apart from arthropods, at least 200 species of plant pathogens, 273 species of weeds, and several species of nematodes and rodents are also resistant to one or more pesticides [2]. Colorado potato beetle (CPB, Leptinotarsa decemlineata Say), is the major pest of potatoes in Iran and many other parts of the world. Injury is
151
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
caused when adults and larvae feed on foliage and stems of potato plants resulting in poor yields and/or death of the plants. Adults can also vector plants diseases. The need to control these beetles has involved the use of different insecticides. Presently, the beetle is resistant to nearly all classes of insecticides and remains a serious pest in many parts of the world [2]. All resistance mechanisms reported in insects have been demonstrated in CPB [3,4]. There are many reports demonstrating elevated efficiency or quantity of cytochrome P450 monooxygenases, esterases, and glutathione-S-transferases in insecticide-resistant CPBs [3,5,6]. However, alteration of acetylcholinesterase (AChE; EC 3.1.1.7) to an insensitive form associated with increased AChE activity has been proven as an important mechanism for resistance to organophosphates (OPs) and/or carbamates (CBs) in some insect species [7– 10]. Previous studies have determined OPs and CBs resistance in CPB [4,11–21]. The high level of resistance to azinphosmethyl (136-fold) in a nearly isogenic CPB strain (AZ-R) was due to multiple resistance mechanisms, including reduced penetration, enhanced xenobiotic metabolism, and target site-insensitivity [17,22]. Continuous use of organophosphorous (OP) insecticides over a period of many years, as the major means of control of CPB in Iran has led to a growing concern that development of resistance is occurring. In these circumstances, it is important that populations under insecticide selection pressure are monitored. To date, very little background information is available concerning either the level of resistance to OPs, or of the mechanisms that may be involved. The first study aimed at investigating the presence and distribution of insecticide resistance in Iranian populations started in 2004. Mohammadi Sharif et al. [23] reported resistance to endosulfan, ranging from 18- to 220-fold, in field populations of CPB from East Azarbaijan province. Two synergists, piperonyl butoxide (PBO) and S,S,S-tributylphosphorotrithioate (DEF), decreased resistance 2.3 and 3.5 times in the resistant strain, respectively, indicating that metabolic detoxification has a minor contribution to resistance. Results from the biochemical assays also indicate that there is no significant difference in glutathione-S-transferase activity between the susceptible and resistant strains [23]. Mohammadi Sharif et al. [24], have also identified a point mutation resulting in the replacement of an alanine by a serine in the Rdl gene of Colorado potato beetle that confers resistance to endosulfan. Phosalone (OP) was one of the most common insecticides used for CPB control in Hamedan, Iran. There is anecdotal evidence from local farmers of a reduction in the efficacy of control of CPB by phosalone, probably due to reduced susceptibility to the insecticide. Insecticide resistant populations of CPB with insensitive acetylcholinesterase (AChE) have recently been reported from commercial potato fields of Hamedan province in west of Iran [25]. Bioassays involving topical application of phosalone to fourth instars revealed up to 252-fold resistance in field populations compared with the susceptible strain (SS). Synergism studies showed that although esterase and/or glutathione-S-transferase metabolic pathways were present and active against phosalone, they were not selected for and did not have a major role in resistance. The aims of the current study were: (1) To determine relative frequency of the S291G mutation in OP-resistant field populations of Colorado potato beetle using PCR–RFLP method: (2) To investigate the possibility of new mutations that may play a role in insecticide resistance. Additional knowledge of phosalone resistance mechanisms will increase our understanding of the evolution of insecticide resistance, and could provide new clues for the management of insecticide-resistant populations.
Materials and methods Insects After preliminary screening, diagnostic dose bioassay, four field populations of CPB collected from commercial potato fields of Hamedan province in west of Iran (Aliabad, Bahar, Dehpiaz, and Yengijeh) with the least mortality to phosalone treatments were used for the resistant allele monitoring study. These populations were part of a larger sampling study performed from 2005 to 2008 to survey the resistance to phosalone in CPB populations from different commercial potato fields in Hamedan province [25]. An insecticide susceptible CPB, originally supplied by M. S. Goettel, Agriculture and Agri-Food Canada Research Center, Lethbridge was used as the reference laboratory-reared strain. Resistance mutation diagnostic Restriction fragment length polymorphism (RFLP) analysis Genomic DNA was extracted from individual insects using total DNA extraction kit (DNeasy Blood and Tissue Kit, Qiagen Gmbh) following the manufacturer’s instructions. Primers for the diagnostic tests were designed directly from the L. decemlineata ace cDNA sequence (GenBank Accession No. L41180.1). The serine to glycine substitution at position 291 (S291G) in the AChE gene was found previously in an azinphosmethyl-resistant strain of CPB [26]. The diagnostic assay for the detection of the S291G mutation was based on the PCR amplification of a 164 bp fragment (codons 267–320) within exon 1, using the primers LdaceF and LdaceR (Table 1) and subsequent restriction digestion with MspI. The S291G mutation resulting from an A to G substitution creates a site for the restriction enzyme MspI (Fig. 1). The amplified fragment of the resistant allele contains a restriction site for MspI, and digestion yields two fragments of 72 and 92 bp. PCR was initiated by one preliminary denaturation step at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s and 72 °C for 30 s, with a final extension step of 5 min at 72 °C. Five milliliters of the amplification products were incubated at 37 °C for 12 h in manufacturer’s reaction buffer (10 Buffer Tango) with 1 ml of enzyme (MSPI). Digestion products were electrophoresed on 12% acrylamide gel in TBE buffer and stained with the silver staining method. Single strand conformation polymorphism (SSCP) analysis Based on the published nucleotide sequence information on AChE gene (GenBank L41180.1), five primer pairs were designed to amplify specific PCR products of 306 bp (first fragment: codons 24–142), 370 bp (second fragment: codons 141–261), 403 bp (third fragment: codons 248–381), 335 bp (fourth fragment:
Table 1 Primers used in PCR amplification and DNA sequencing experiments. 0
0
Primers
Sequences (5 –3 )
Product size (bp)
Codons
LdaceF LdaceR Ldace1F Ldace1R Ldace2F Ldace2R Ldace3F Ldace3R Ldace4F Ldace4R Ldace5F Ldace5R
tgtcacaaaagggctcgttc ccatcaccttacgcggacta ctctagtcgtcgaaacaaccagtg tacgcaaccgctggggaacc ggttgcgtatcagacatcacgctg agatggatgctaatcgatcctcc acgctctttggtgaatctgcagga catcgtgattactccccagcagaa ctggggagtaatcacgatgaagga aacgacgtgctcgtcctatgg tttcacccataggacgagca acgtgttgacacaaggagcttcc
164
267–320
306
42–142
370
141–261
403
248–381
335
376–486
335
488–598
F: forward primer; R: reverse primer.
152
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
Ldace-F
T GTC ACA AAA GGG CTC GTT CGC AGG GGT ATC ATG CAA TCG GGC ACC ATG AAC GCT V T K G L V R R G I M Q S G T M N A
MSPI site in resistant 291 (G) GGT CCG TGG AGC TAC ATG TCC AGT GAA CGC GCA GAA CAA ATC GGT AAA ATT CTC ATA P W S Y M S S E R A E Q I G K I L I
ace-R ace-S
Ldace-R
CAG GAC TGT GGC TGC AAC GTT TCT CTT TTG GAA AAT AGT CCG CGT AAG GTG ATG G Q D C G C N V S L L E N S P R K V M Fig. 1. Diagrammatic representation of the primer locations and mutation-associated restriction site variations in L. decemlineata AChE gene amplification products.
codons 376–486), and 335 bp (fifth fragment: codons 488–598) (Table 1). The reaction conditions were as follows: an initial denaturation at 94 °C for 3 min followed by 40 cycles of 94 °C for 15 s, 58 °C for 2 min, and 72 °C for 45 s followed by a final extension at 72 °C for 5 min for first fragment, 94 °C for 3 min followed by 40 cycles of 94 °C for 15 s, 61 °C for 1 min, and 72 °C for 1 min and a final extension at 72 °C for 5 min for second fragment, 94 °C for 2 min followed by 40 cycles of 94 °C for 15 s, 61 °C for 1 min, and 72 °C for 1 min and a final extension at 72 °C for 5 min for third fragment. We could not optimize the PCR conditions for fourth and fifth fragments. The DNA amplification products were subjected to SSCP analysis to identify the DNA sequence variations between the susceptible strain and resistant populations. Screened were 95 beetles of susceptible strain (15 beetles) and four field populations (20 of each). The single-strand conformation polymorphism (SSCP) analysis was carried out with the mini-electrophoresis apparatus using 1 TBE buffer. Each PCR product was diluted in denaturing buffer (95% formamide, 10 mM NaOH, 10 mM xylene cyanol, and 10 mM bromophenol blue), heated at 95 °C for 10 min, cooled in ice for 10 min and analyzed by polyacrylamide gel electrophoresis. Several factors were tested for each fragment in order to optimize SSCP conditions such as the amount of PCR product, denaturing solution, acrylamide concentration, percentage cross linking, glycerol, voltage, and running time. The best electrophoresis conditions are summarized in Table 2. Denatured and nondenatured samples were separated on polyacylamide gel at 200–350 V for about 8– 15 h at room temperature. Genomic DNA polymorphisms from resistant populations of CPB were detected by silver staining [27].
Results PCR–RFLP diagnostic test for detection of S291G point mutation PCR–RFLP assays were used to monitor the frequency of the S291G resistance mutation in resistant field populations of CPB (Fig. 2). The S291G mutation was detected in 66.6, 73.3, 53.3 and 26.6% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively (Table 3). Moreover, only twenty- five percent of samples from the resistant field populations were homozygous for S291G mutation. There was no significant correlation between the mutation frequencies and resistance levels in the resistant populations, indicating that other mutations may contribute to this variation. SSCP analysis Polymorphism in the partial L. decemlineata AChE gene of four field populations was investigated using PCR and SSCP. Several factors were tested for each fragment in order to optimize SSCP con-
1
2
3
4
5
200 bp
Data analysis
150 bp
About 20 ll of PCR products from both diagnostic tests were directly sequenced in both directions. The DNA sequences were analyzed by the BLAST program of the NCBI. Alignment to the sequence of the susceptible cDNA confirmed the synonymous and nonsynonymous mutations.
100 bp
50 bp
Table 2 The best SSCP electrophoresis conditions for first, second and third fragments of L. decemlineata AChE gene. Fragment 1 2 3
Acrylamid (%)
PCR product (ll)
Denaturing solution (ll)
Running time (h)
33.3 28.5 33.3
6 4 7
10 10 8
8 11 15
Fig. 2. PCR–RFLP analysis to detect the presence of the S291G mutation in individual beetles representing various susceptible and resistant genotypes. The lane on the extreme right contains a size marker (multiples of 50 bp fragments); lanes contain the MSPI digest products from individuals either homozygous for the wild-type ‘‘susceptible’’ allele (SS, lanes 2, and 5), homozygous for the S291G ‘‘resistance’’ allele (RR, lanes 3, and 4) or heterozygous (RS, lane 1).
153
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156 Table 3 Frequencies of resistance alleles in L. decemlineata from susceptible strain vs. resistant populations by PCR–RFLP analysis. Population/ strain
Sample size
S291G allelic frequencies (heterozygote/homozygote)
Susceptible Bahar Dehpiaz Aliabad Yengijeh
10 15 15 15 15
– 66.6 73.3 53.3 26.6
(5/5) (4/7) (6/2) (3/1)
ditions. The best electrophoresis conditions are summarized in Table 2. The variation was clearly shown by the number of bands and their position in the gel. The SSCP profiles for the first, second, and third fragments of AChE gene from field populations of L. decemlineata were denominated from ‘‘A’’ to ‘‘F’’ (Figs. 3–5) (Table 4). No specific PCR product of desirable size for both fourth and fifth fragments could be obtained. Putative structure of the gene encoding AChE in the L. decemlineata regarding to the sequence analysis in the present study is shown in Fig. 6.
Fig. 5. SSCP patterns of third fragment of AChE gene from a susceptible strain (SS) and field, populations of L. decemlineata, 5 profiles (labelled A–E).
DNA sequence analysis
Discussion
Nucleotide sequence variations in the different SSCP patterns were verified by direct DNA sequencing. Alignment of the AChE gene sequences with the sequencing results revealed sixteen point mutations (V44G, E128D, R140G, I143F, T248S, F250S, G251C, I261M, S265I, S291G, G353R, L356R, E366K, S378E, S378R, E382D) from the field populations of CPB, that likely contribute to the AChE insensitivity (Tables 5 and 6). Further gene expression analysis on the RNA level needed for a more complete evaluation.
PCR–RFLP diagnostic tests for detection of S291G point mutation
Fig. 3. SSCP patterns of first fragment of AChE gene from a susceptible strain (SS) and field populations of L. decemlineata, 6 profiles (labelled A–F).
Although bioassays are essential to validate the presence of resistance in populations and to quantify the levels of resistance associated with particular mechanisms, biochemical and molecular monitoring techniques enable very accurate assessments of resistance gene frequency to be made. AChEs from the field populations in our previous study [25] had relatively greater hydrolysis activities using substrates with larger alkyl substitutions (e.g., butyrylthiocholine iodide vs acetylthiocholine iodide) and were also less sensitive to inhibition by methoxy substituted insecticides (e.g., methyl paraoxon) as compared to the susceptible form. Thus, AChEs elicited structure–activity relationships similar to those previously reported for the native form of AChE [17], in which the less bulky substrates and inhibitors interacted more efficiently with the native AChE from the susceptible strain and the more bulky substrates and inhibitors interacted more efficiently with the native AChE from the resistant populations. These results are indicative of a typical negative cross–insensitivity of AChE to different organophosphorus inhibitors. Subsequent molecular analysis has identified the A ? G point mutation, which causes a S291G substitution in azinphosmethylresistant AChE [26]. Results of the study on the three-dimensional
Table 4 Frequency of six SSCP patterns (genotypes) in the partial DNA fragments of L. decemlineata AChE gene. Fragment
Fig. 4. SSCP patterns of second fragment of AChE gene from a susceptible strain (SS) and field populations of L. decemlineata, 4 profiles (labelled A–D).
Population
Genotypes A
B
C
D
E
F
1
Bahar Dehpiaz Aliabad Yengijeh
3 4 6 3
7 5 2 3
2 4 3 3
1 3 4 4
4 2 3 4
3 2 2 3
2
Bahar Dehpiaz Aliabad Yengijeh
3 7 9 3
4 3 3 4
8 5 5 6
5 5 3 7
– – – –
– – – –
3
Bahar Dehpiaz Aliabad Yengijeh
2 6 5 4
4 4 3 3
8 4 3 4
3 3 4 5
3 3 5 4
– – – –
154
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
Fig. 6. Putative structure of the gene encoding AChE in the L. decemlineata regarding to the sequence analysis in the present study.
Table 5 Number of nucleotide differences and amino acid substitutions found in the L. decemlineat AChE gene. Strain/ population
Fragment 1 Nucleotide differences (silent mutation)
Point mutation
Nucleotide differences (silent mutation)
Fragment 2 Point mutation
Nucleotide differences (silent mutation)
Fragment 3 Point mutation
Susceptible Bahar
– 12(11)
– 4 (3)
– F250S
– 4 (1)
– S291G E382D G353R
Dehpiaz
15 (14)
– V44G, R140G R140G
7 (5)
16 (6)
Aliabad Yengijeh
5 (4) 26 (24)
E128D V44D, R140G
3 (2) 3 (3)
I143F, T248S T248S –
G251C I261M S265I S291G L356R E366K S378E S378R S291G S378R S291G
2 (–) 4 (3)
Table 6 Current study AChE mutations among the resistant populations of L. decemlineata. This study LdAChE
Zhu and Clark (1995)
Zhu et al. (1996)
Kim et al. (2007)
R30K V44G, E128D, R140G, I143F M221T T248S, F250S, G251C, I261M, S265I, S291G,
S291G
D308K F345S
G353R, L356R, E366K, S378R, E382D
structure of AChE from Torpedo [28] revealed S291G could alter the position of the a–E0 1 helix and lead to conformational changes in both catalytic and peripheral anionic binding site [11]. These findings supported the assumption that S291G altered the positioning of the a–E0 1 helix and increased the size of the esteratic subsite within the catalytic center of AChE [12]. With respect to the above findings, we used PCR–RFLP method to determine relative frequency of the S291G mutation in resistant field populations of CPB. Sequence analysis revealed that the SerGly (AGT to GGT) mutation known to be associated with the azinphosmethyl resistance was present in all populations tested at a relatively low frequency. The relative frequency of the S291G mutation in field populations of Colorado potato beetle predicted by the PCR–RFLP method (66.6, 73.3, 53.3 and 26.6% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively) agreed well with that determined by individual genotyping (61.7, 71.4, 54.2, and 24.2%, respectively), demonstrating the reliability and accuracy of PCR–RFLP method in predicting resistance allele frequency. The PCR–RFLP method is technically simpler than other techniques, can be used in most laboratories and is not very expensive. This approach has proved successful in many genome screening projects [29–33]. SSCP analysis There was no significant correlation between the S291G mutation frequencies and resistance levels in the field collected populations (up to 252-fold resistance), indicating that other mutations may contribute to this variation. PCR–SSCP method was used to find sequence variation in the AChE gene. Success of SSCP method depends heavily upon the optimization of electrophoretic conditions to maximise differential migration
I392T
among DNA fragments. Several factors were assayed to improve the efficiency of the PCR–SSCP method. We found that low crosslinking ratio of acrylamide and bisacrylamide (49:1) is useful for increasing the detection efficiency of SSCP. The addition of 5% glycerol into the polyacrylamide gel improved the SSCP sensitivity. This is possibly due to the property of glycerol in keeping the conformation and making a charge difference of single stranded DNA [34]. Within the Colorado potato field populations, four to six SSCP patterns were observed (Table 4). The presence of susceptible alleles was clearly distinguishable from the banding pattern produced by resistant alleles. Although, the mutation detection rate may decrease for sequences longer than 200 bp, but under our running conditions, we detected 88–96% of point mutations by SSCP. Mutations in the first fragment, which is 306 bp long, were detected at much higher frequency. Nucleotide sequence variations in the different SSCP patterns were verified by direct DNA sequencing. Alignment of the AChE gene sequences with the sequencing results revealed numerous single nucleotide polymorphisms (SNP). 101 SNPs were identified in the partial AChE gene from four field populations, in which 33 substitutions are transversion (purine base replaces a pyrimidine base and the reverse) and 68 are transition (purine base exchanges another purine base or pyrimidine base exchanges another pyrimidine base). 76 substitutions in protein coding regions (CDS) were synonymous (silent substitution) (Table 5). Sixteen amino acid replacements were observed. The most frequently occurring mutations were R140G, S291G, and S378E. One consistent nonsilent SNP occurred in all resistant populations, was a substitution of serine for glycine at position 291 (S291G). This study has demonstrated that the SSCPs method is an effective and efficient method for assaying molecular genetic variation in CPB populations.
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
Two DNA-based genotyping techniques, bidirectional PCR amplification of specific allele (bi-PASA) and single stranded conformational polymorphism (SSCP), have been previously developed for detection of kdr-like pyrethroid resistance in field populations of Colorado potato beetle [29,35]. Kim et al. [36] evaluated the reliability and accuracy of these two genotyping techniques to monitor resistant and susceptible allele frequencies in CPB populations. Zhang et al. [18] developed a SSCP protocol and a minisequencing reaction to validate the S291G mutation associated with acetylcholinesterase sensitivity to azinphosmethyl in Colorado potato beetle. SSCP analysis as an easy, rapid, cheap, and rugged DNA-based diagnostic method, is able to detect resistance-associated mutations [18,37]. Conclusion Although bioassays are definitely essential to validate the presence of resistance in populations and to quantify the levels of resistance associated with particular mechanisms, biochemical and molecular monitoring techniques enable very accurate assessments of resistance gene frequency to be made. To establish a successful resistance management program, it is essential to develop more sensitive tools for the precise estimation of both frequency and genotype of resistance alleles. Various DNA-based genotyping techniques, such as restriction fragment length polymorphism (RFLP) [29–33], bi-directional PCR amplification of specific allele (bi-PASA) [29,38,39], single stranded conformational polymorphism (SSCP) [37] have been used for the detection of insecticide resistance-associated mutations including the A302S mutation (rdl) of GABA receptor channel in the cyclodiene-resistant insect species [37], L1014F mutation (kdr) of sodium channel in Colorado potato beetle [35] and S291G mutation of acetylcholinesterase in the azinphosmethyl-resistant Colorado potato beetle [36,38]. Indeed bioassay results revealed a 225-fold decrease in susceptibility to phosalone in the field populations studied, and as compared to the susceptible strain [25]. Our previous study has provided some basic information concerning variation of AChE activity in different populations of CPB. The biochemical analysis results showed that the sensitivity of AChE from the resistant populations was different, which means some inconsistent mutations in individual strains may also contribute to AChE insensitivity. In this study, considerable SNPs and deduced amino-acid replacements were also identified in insensitive AChE genes from resistant field populations of CPB, probably reflecting the different nature of insecticide pressures and the fitness cost associated with resistance genes. Unfortunately, historical data concerning the type and extent of insecticides used against CPB are difficult to obtain. However, whether a mutation that occurs in insensitive AChE is associated with insecticide resistance or not, needs to be further confirmed with site-directed mutagenesis and functional expression experiments. Acknowledgements The authors would like to acknowledge Drs. J.M. Clark, and A. Zamani for technical assistance. We are grateful to the members of the Genetic Lab. and PND center, Shafa Hospital for the laboratory facilities and support. We appreciate Drs. Peighan and Firoozi for their continued support. We also thank anonymous reviewers for critical review of the manuscript. References [1] R.L. Metcalf, H.W. Luckman, Introduction to Insect Pest Management, third ed., John Willey and Sons Inc., New York, 1994. pp. 250.
155
[2] L.P. Pedigo, Entomology and pest management, Fourth ed., Prentice –Hall of Indian Private Limited, New Delhi- 110001, 2004, pp. 193, 563–566. [3] B.A. Bishop, E.J. Grafius, Insecticide resistance in the Colorado potato beetle, pp. 355–377. In P.H.A. Jolivet and M. L. Cox [eds.], Chrysomelidae biology, vol. 1: the classification, phylogeny and genetics. SPB Academic Publishing, Amsterdam, The Netherlands. 1996. [4] J.H. Tolman, S.A. Hilton, J.W. Whistlecraft, D.C. MacArthur, Survey of susceptibility of representative Canadian populations of Colorado potato beetle, Leptinotarsa decemlineata (Say) to selected insecticides: Admire 240F (imidacloprid), Matador 120EC (lambda-cyhalothrin) and Success 480SC (spinosad). Annual Research Report (FY 2002–2003) to Ontario potato Board (AAFC M.I.I. Project No.A03027). 2002. [5] L. Zhao, B.A. Bishop, E.J. Grafius, Inheritance and synergism of resistance to imidacloprid in the Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 93 (2000) 1508–1514. [6] G.C. Cutler, J.H. Tolman, C.D. Scott-Dupree, C.R. Harris, Resistance potential of Colorado potato beetle (Coleoptera: Chrysomelidae) to novaluron, J. Econ. Entomol. 98 (2005) 1685–1693. [7] D. Fournier, J.M. Bride, F. Hoffman, F. Karch, Acetylcholinesterase: two types of modifications confer resistance to insecticide, J. Biol. Chem. 267 (1992) 14270– 14274. [8] F.W. Plapp Jr., R.K. Tripathi, Biochemical genetics of altered acetylcholinesterase resistance to insecticides in the housefly, Biochem. Genet. 16 (1978) 1–12. [9] H. Hama, T. Iwata, T. Miyata, T. Saito, Some properties of acetylcholinesterase partially purified from susceptible and resistant green rice leafhoppers, Nephotetix cincticeps Uhler (Hemiptera: Deltocephalidae), Appl. Entomol. Zool. 15 (1980) 249–261. [10] K.Y. Zhu, J.R. Gao, Increased activity associated with reduced sensitivity of acetylcholinesterase in organophosphate-resistant green bug, Schizaphis graminum (Homoptera: Aphididae), Pestic. Sci. 55 (1999) 11–17. [11] K.Y. Zhu, J.M. Clark, Validation of a point mutation of acetylcholinesterase in Colorado potato beetle by polymerase chain reaction coupled to enzyme inhibition assay, Pestic. Biochem. Physiol. 57 (1997) 28–35. [12] H.J. Kim, K.S. Yoon, J.M. Clark, Functional analysis of mutations in expressed acetylcholinesterase that result in azinphosmethyl and carbofuran resistance in Colorado potato beetle, Pestic. Biochem. Physiol. 88 (2007) 181–190. [13] J.M. Clark, Insecticides as tools in probing vital receptors and enzymes in excitable membranes, Pestic. Biochem. Physiol. 57 (1997) 235–254. [14] J.A. Argentine, J.M. Clark, D.N. Ferro, Relative fitness of insecticide-resistant Colorado potato beetle strains (Coleoptera, Chrysomelidae), Environ. Entomol. 18 (1989) 705–710. [15] J.A. Argentine, K.Y. Zhu, S.H. Lee, J.M. Clark, Biochemical mechanisms of azinphosmethyl resistance in isogenic strains of Colorado potato beetle, Pestic. Biochem. Physiol. 48 (1994) 63–78. [16] J.A. Argentine, S.H. Lee, M.A. Sos, S.R. Barry, J.M. Clark, Permethrin resistance in a near isogenic strain of Colorado potato beetle, Pestic. Biochem. Physiol. 53 (1995) 97–115. [17] K.Y. Zhu, K.Y. Clark, Comparison of kinetic properties of acetylcholinesterase purified from azinphosmethyl-susceptible and resistant strains of Colorado potato beetle, Pestic. Biochem. Physiol. 51 (1995) 57–67. [18] A. Zhang, J.B. Dunn, J.M. Clark, An efficient strategy for validation of a point mutation associated with acetylcholinesterase sensitivity to azinphosmethyl in Colorado potato beetle, Leptinotarsa decemlineata (Say), Pestic. Biochem. Physiol. 65 (1999) 25–35. [19] H.J. Kim, J.B. Dunn, K.S. Yoon, J.M. Clark, Target site insensitivity and mutational analysis of acetylcholinesterase from a carbofuran-resistant population of Colorado potato beetle, Leptinotarsa decemlineata (Say), Pestic. Biochem. Physiol. 84 (2006) 165–179. [20] J.M. Wierenga, R.M. Hollingworth, Inhibition of altered acetylcholinesterase from insecticide-resistant Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 86 (1993) 673. [21] J.A. Argentine, J.M. Clark, D.N. Ferro, Genetics and synergism of resistance to azinphosmethyl and permethrin in the Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 82 (1989) 698–705. [22] K.Y. Zhu, J.M. Clark, Purification and characterization of acetylcholinesterase from the Colorado potato beetle, Leptinotarsa decemlineata (Say), Insect. Biochem. Mol. Biol. 24 (1994) 453–461. [23] M. Mohammadi Sharif, M.J. Hejazi, A. Mohammadi, M.R. Rashidi, Inheritance and synergism of resistance to imidacloprid in the Colorado potato beetle (Coleoptera: Chrysomelidae), J. Insect Science. 7 (2007) 1–7. [24] M. Mohammadi Sharif, M.J. Hejazi, A. Mohammadi, M.R. Rashidi, Identification the molecular basis of resistance to endosulfan in resistant populations of Colorado potato beetle, Proceeding of 18th Iranian Plant Protection Congress. (2008) 147. [25] M. Malekmohammadi, M.S. Mossadegh, M.J. Hejazi, M.T. Goodarzi, M. Khanjani, H. Galehdari, Synergism of resistance to phosalone and comparison of kinetic properties of acetylcholinesterase from four field populations and a susceptible strain of Colorado potato beetle, Pestic. Biochem. Physiol. 98 (2010) 254–262. [26] K.Y. Zhu, S.H. Lee, J.M. Clark, A point mutation of acetylcholinesterase associated with azinphosmethyl resistance and reduced fitness in Colorado potato beetle, Pestic. Biochem. Physiol. 55 (1996) 100–108. [27] R.C. Switzer, C.R. Merril, S. Shifrin, A highly sensitive silver stain for detecting proteins and peptides in polyacrylamide gels, Anal. Biochem. 98 (1979) 231– 237.
156
M. Malekmohammadi et al. / Pesticide Biochemistry and Physiology 104 (2012) 150–156
[28] J.L. Sussman, M. Harel, F. Frolow, C. Oefner, A. Goldman, L. Toker, I. Silman, Atomic structure of acetylcholinesterase from Torpedo californica: a prototypic acetylcholine-binding protein, Science 253 (1991) 872–879. [29] S.H. Lee, J.B. Dunn, J.M. Clark, D.M. Soderlund, Molecular analysis of kdr-like resistance in a permethrin resistant strain of Colorado potato beetle, Pestic. Biochem. Physiol. 63 (1999) 63–75. [30] S. Cassanelli, M. Reyes, M. Rault, G.C. Manicardi, B. Sauphanor, Acetylcholinesterase mutation in an insecticide-resistant population of the codling moth Cydia pomonella (L.), Insect Biochem. Mol. Biol. 36 (2006) 642–653. [31] E.G. Kakani, I.M. Ioannides, J.T. Margaritopoulos, N.A. Seraphides, P.J. Skouras, J.A. Tsitsipis, K.D. Mathiopoulos, A small deletion in the olive fly acetylcholinesterase gene associated with high levels of organophosphate resistance, Insect Biochem. Mol. Biol. 38 (2008) 781–787. [32] H. Alout, P. Labbé, N. Pasteur, M. Weill, High incidence of ace-1 duplicated haplotypes in resistant Culex pipiens mosquitoes from Algeria, Insect Biochem. Mol. Biol. 41 (2011) 29–35. [33] L. Yuan, S. Wang, J. Zhou, Y. Du, Y. Zhang, J. Wang, Status of insecticide resistance and associated mutations in Q-biotype of whitefly, Bemisia tabaci, from eastern China, Crop Prot. 31 (2012) 67–71.
[34] K. Hayashi, D.W. Yandell, How sensitive is PCR–SSCP?, Hum Mutat. 2 (1993) 338–346. [35] J.M. Clark, S.H. Lee, H.J. Kim, K.S. Yoon, A. Zhang, DNA-based genotyping techniques for the detection of point mutations associated with insecticide resistance in Colorado potato beetle Leptinotarsa decemlineata, Pest Manag. Sci. 57 (2001) 968–974. [36] J.H. Kim, D.J. Hawthorne, T. Peters, G.P. Dively, J.M. Clark, Application of DNAbased genotyping for the detection of kdr-like pyrethroid resistance in field populations of Colorado potato beetle, Pestic. Biochem. Physiol. 81 (2005) 85– 96. [37] C. Coustau, R.H. Ffrench-Constant, Detection of cyclodiene insecticide resistance-associated mutations by single stranded conformation polymorphism analysis, Pestic. Sci. 43 (1995) 267–271. [38] J.M. Clark, S.H. Lee, H.J. Kim, K.S. Yoon, J.R. Gao, S.B. Symington, D.J. Hawthorne, Molecular detection of knockdown resistant mutations in insects, in: 10th International Congress of Pesticide Chemistry, Basel Switzerland, 8/4-9, 2002, Abst. No. 3C.41.