- Email: [email protected]
Molecular differentiation of Angiostrongylus taxa (Nematoda: Angiostrongylidae) by cytochrome c oxidase subunit I (COI) gene sequences
Acta Tropica 116 (2010) 152–156
Contents lists available at ScienceDirect
Acta Tropica journal homepage: www.elsevier.com/locate/actatropica
Molecular differentiation of Angiostrongylus taxa (Nematoda: Angiostrongylidae) by cytochrome c oxidase subunit I (COI) gene sequences Praphathip Eamsobhana a,∗ , Phaik Eem Lim b,c , Gabriela Solano d , Hongman Zhang e , Xiaoxian Gan f , Hoi Sen Yong c a
Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand Institute of Ocean and Earth Science, University of Malaya, 50603 Kuala Lumpur, Malaysia Institute of Biological Sciences, University of Malaya, 50603 Kuala Lumpur, Malaysia d Facultad de Microbiologia, Universidad de Costa Rica, San Jose, Apartado 2060, Costa Rica e Guangxi Zhuang Autonomous Region Center for Disease Control and Prevention, Nanning 530028, PR China f Institute of Parasitic Diseases, Zhejiang Academy of Medical Sciences, Hangzhou 310013, PR China b c
a r t i c l e
i n f o
Article history: Received 25 May 2010 Received in revised form 29 June 2010 Accepted 14 July 2010 Available online 21 July 2010 Keywords: Angiostrongylus cantonensis Angiostrongylus costaricensis Angiostrongylus malaysiensis Angiostrongylus vasorum Parastrongylus Molecular phylogeny Phylogeography
a b s t r a c t Nematodes of the genus Angiostrongylus are parasites of rodents and carnivores. They reside in the pulmonary or mesenteric arteries of their hosts. Two species are pathogenic in humans – Angiostrongylus cantonensis causes eosinophilic meningitis or meningoencephalitis, and Angiostrongylus costaricensis produces abdominal angiostrongyliasis. In addition Angiostrongylus malaysiensis may have the potential of being pathogenic in humans. The mitochondrial gene cytochrome c oxidase subunit I (COI) of these Angiostrongylus species and three geographical isolates (China, Hawaii and Thailand) of A. cantonensis were studied by polymerase chain reaction amplification and DNA sequencing. COI sequences of A. cantonensis, A. costaricensis and Angiostrongylus vasorum in the GenBank were included for comparison. Phylogenetic analysis by maximum-likelihood (ML), maximum-parsimony (MP), neighbour-joining (NJ) and Bayesian inference (BI) produced similar tree topology except variation in the bootstrap support values. There were two major clades – (1) A. cantonensis and A. malaysiensis, and (2) A. costaricensis and A. vasorum. The three geographical isolates of A. cantonensis formed a clade with low to high bootstrap values, and consisted of two subclades: (a) China and Hawaii isolates, and (b) monophyletic Thailand isolate. The individuals of each isolate formed a distinct cluster. In the second major clade, the Europe isolates of A. vasorum were distinctly different from the Brazil isolates. For A. costaricensis, the Costa Rica isolate was distinct from the Brazil isolate with an uncorrected (p) distance of 11.39%, indicating the possible occurrence of cryptic species. The present results indicate that COI sequences might be a useful marker for differentiating geographical isolates of A. cantonensis and in uncovering cryptic species. Efforts are being made to carry out an extensive collaborative study to cover a wide range of Angiostrongylus species and geographical isolates. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Nematodes of the genus Angiostrongylus Kamensky, 1905 are parasites of rodents and carnivores (Anderson, 2000). Under this classification, the component species are grouped into two subgenera, i.e. Angiostrongylus and Parastrongylus (Drozdz, 1970; Anderson, 1978). These two subgenera however have been elevated by some authors (Chabaud, 1972; Ubelaker, 1986) as full genera, but this taxonomic treatment has not been generally accepted. Currently, 13 species are from rodent hosts and two from carnivore hosts (Ubelaker, 1986; Costa et al., 2003; del Rosario Robles
∗ Corresponding author. Tel.: +66 (0) 24196468. E-mail address: [email protected] (P. Eamsobhana). 0001-706X/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.actatropica.2010.07.005
et al., 2008). These nematodes reside in the pulmonary arteries of their hosts, except Angiostrongylus costaricensis Morera and Céspedes, 1971 and A. siamensis Ohbayahi, Kamiya and Bhaibulaya, 1979 which are found in the mesenteric arteries. Of the 15 Angiostrongylus species, only two are of public health importance, causing human angiostrongyliasis. Angiostrongylus cantonensis (Chen, 1935) is a primary cause of human eosinophilic meningitis or eosinophilic meningoencephalitis in Asia and the Pacific Islands (Eamsobhana and Tungtrongchitr, 2005; Eamsobhana, 2006). Its occurrence has now been reported in many countries worldwide (Eamsobhana, 2006; Cross and Chen, 2007; Foronda et al., 2010). Furthermore, the parasites of different geographical locality show different infectivity, severity and pathogenicity in experimental hosts (Cross, 1979). The other species, A. costaricensis produces abdominal angiostrongylia-
P. Eamsobhana et al. / Acta Tropica 116 (2010) 152–156
sis and occurs throughout the Americas, from southern United States to northern Argentina in South America (Morera, 1985; Graeff-Teixeira et al., 2009; Graeff-Teixeira, 2010). In addition to A. cantonensis and A. costaricensis, two other species (A. mackerrasae Bhaibulaya, 1968 in Australia and Angiostrongylus malaysiensis Bhaibulaya and Cross, 1971 in Malaysia) may have the potential of being pathogenic in humans (Prociv et al., 2000). When first documented both species were referred to as A. cantonensis (Bhaibulaya, 1968; Bhaibulaya and Cross, 1971). Of the two Angiostrongylus species that are pathogenic in humans, A. cantonensis has received greater attention in both laboratory and clinical studies (Eamsobhana, 2006; Cross and Chen, 2007; Graeff-Teixeira et al., 2009). Immunological diagnosis in particular has been extensively explored (Eamsobhana and Yong, 2009). Molecular differentiation of A. cantonensis, A. costaricensis and Angiostrongylus vasorum (Baillet, 1866) has been achieved with polymerase chain reaction-restriction fragment length polymorphism (Caldeira et al., 2003). The partial DNA sequences of a 66-kDa protein gene could unequivocally differentiate A. cantonensis, A. costaricensis and A. malaysiensis, and indicated that A. cantonensis and A. malaysiensis were closer related than to A. costaricensis (Eamsobhana et al., 2010a). The small subunit (SSU) ribosomal DNA sequences have been used for constructing phylogenetic tree of five species of Angiostrongylus—A. cantonensis, A. costaricensis, A. dujardini Drozdz and Doby, 1970, A. malaysiensis and A. vasorum (Fontanilla and Wade, 2008; Van Megan et al., 2009). Phylogenetic tree has also been constructed with internal transcribed spacer 2 (ITS-2) for A. cantonensis, A. costaricensis and A. vasorum (Jefferies et al., 2009) as well as A. dujardini (Foronda et al., 2010). The nucleotide sequences of cytochrome c oxidase subunit I (COI) have been reported for A. cantonensis from China (GenBank accession number GQ398121 – complete mitochondrial genome), and A. costaricensis from Brazil (GenBank accession numbers GQ398122, NC013067 – complete mitochondrial genome). COI sequences have been briefly reported to clearly differentiate A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum (Eamsobhana et al., 2010a) and geographical isolates of A. cantonensis (Eamsobhana et al., 2010a; He et al., 2010). In contrast COI has been extensively studied in A. vasorum from Europe and South America (Jefferies et al., 2009, 2010). The present study was undertaken to determine the usefulness and suitability of the COI gene for differentiating closely related species (e.g. A. cantonensis and A. malaysiensis) and geographical isolates of A. cantonensis, as well as to determine the phylogenetic relationship of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum.
2. Materials and methods 2.1. Angiostrongylus worms The Thailand isolate of A. cantonensis was maintained in the Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, with passages through albino rats as definitive rodent host and Biomphalaria glabrata as intermediate snail host. The Hawaii isolate of A. cantonensis was kindly provided by Dr. Akira Ishih of Hamamatsu University, Japan and maintained in the Department of Parasitology, Mahidol University. Both the Thailand and Hawaii adult worm samples have been kept in absolute ethanol since August 2008. The China specimens of A. cantonensis were obtained from rodents caught in Guangxi Province, PR China in September 2009. Individual worm homogenate was applied and dried onto the FTA card before shipment to Bangkok for DNA preparations. A. malaysiensis male and female worms were obtained from the pulmonary arteries of wild caught Rattus tioman-
153
icus on 26 June 2008 in Pahang, Peninsular Malaysia and stored in absolute ethanol until DNA was extracted. A. costaricensis adult specimens preserved in RNAlater (RNA stabilization solution) were a gift from Dr. Elizabeth Abrahams, Department of Parasitology, University of Costa Rica. 2.2. DNA extraction The FTA card method (Whatman BioScience) which is more rapid and convenient to perform than the commercial DNA extraction kits was employed for DNA preparation in the present study. Genomic DNA extraction from individual adult female and male worms of A. cantonensis (Thailand, Hawaii and China isolates), A. costaricensis and A. malaysiensis, was carried out using FTA technology (Whatman BioScience) following the manufacturer’s instruction. In brief, individual worm was homogenized in 100–150 L of sterilized PBS, pH 7.4. The homogenate was applied and dried onto the FTA card according to the Whatman FTA tissue protocol. A sample disc was taken using a 2.0 mm diameter Harris micro punch, washed with FTA purification reagent, and used in PCR for DNA analysis. 2.3. PCR amplification and DNA sequencing The DNA amplification by polymerase chain reaction was conducted using the previously described primers COI F 5 TAAAGAAAGAACATAATGAAAATG 3 and COI R 5 TTTTTTGGGCATCCTGAGGTTTAT 3 for a partial region of the COI gene (Bowles et al., 1993; Hu et al., 2002; Jefferies et al., 2009). The reaction mixture was prepared in a total volume of 25 L containing 2.5 L of 10× PCR buffer (TrisCl, KCl, (NH4 )2 SO4 , 15 mM MgCl2 , pH 8.7 (QIAGEN), 0.5 L of dNTP mix (10 mM each), 0.5 L of each primer (12.5 ng/L), 0.1 L of Taq DNA polymerase (5 Units/L), 21.4 L of dH2 O and a 2.0 mm DNA punched disc (FTA card) that contained extracted DNA from individual worm samples in a DNA thermal cycler (PerkinElmer Cetus). The thermocycler was programmed to incubate the samples for 5 min at 94 ◦ C, followed by 40 cycles, each at 94 ◦ C for 30 s, at 55 ◦ C for 30 s, at 72 ◦ C for 1 min, and final extension at 72 ◦ C for 5 min. The reaction products were separated by electrophoresis on 1.5% (w/v) agarose gel, stained with ethidium bromide, and visualized under ultraviolet light. Amplified products were purified using a QIAquick PCR Purification Kit (QIAGEN). Sequencing reactions were performed using an ABI PrismDyeTerminator Cycle Sequencing Core kit (Applied Biosystems, USA). 2.4. COI sequences from GenBank COI sequences were obtained from the GenBank as follows: (1) A. cantonensis of China – GQ398121; (2) A. costaricensis of Brazil – GQ398122, and NC013067; and (3) A. vasorum of Europe – EU493161 to EU493167. The sequences for A. vasorum isolates Brazil 5421, Brazil 5641 and Brazil 5642 were constructed from published data on their variable nucleotide positions (Jefferies et al., 2009). Sequences of Ancylostoma duodenale (GenBank accession number AJ417718) and Ancylostoma tubaeforme (GenBank accession number AJ407940) were used as outgroup. 2.5. Sequence alignment and phylogenetic analysis Sequences from this study were preliminarily aligned using the CLUSTAL X program (Thompson et al., 1997) and subsequently manually aligned. The aligned sequences were subjected to maximum-likelihood (ML), maximum-parsimony (MP) and neighbour-joining (NJ) analyses using PAUP* 4.0b10 (Swofford, 2002). ML analyses of the COI data were performed using PAUP* and a best-fitting evolution model. The model of sequence evolution
154
P. Eamsobhana et al. / Acta Tropica 116 (2010) 152–156
Table 1 Uncorrected ‘p’ distance (%) between selected representative samples of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum. Sample
1
2
3
4
5
6
7
8
1. A. cantonensis AC C M2, China 2. A. cantonensis AC H M1, Hawaii 3. A. cantonensis AC T F2, Thailand 4. A. costaricensis ACOS M1, Costa Rica 5. A. costaricensis GQ398122, Brazil 6. A. malaysiensis AM F1, Malaysia 7. A. vasorum Brazil 5642 8. A. vasorum EU493167, Germany 9. A. vasorum EU493161, Portugal
0.83 3.61 12.22 15.00 11.11 12.78 12.22 11.94
3.61 11.67 14.67 11.11 13.06 12.50 12.22
13.33 15.00 11.67 11.94 11.94 11.67
11.39 13.89 15.00 13.94 13.61
16.11 14.44 13.61 13.33
17.50 15.28 15.56
8.06 7.78
0.28
was chosen based on results from the successive approximation method (Sullivan et al., 2005). Tree likelihoods were estimated using a heuristic search with 100 random-addition-sequence replicates, tree bisection reconnection (TBR) branch swapping, and unordered and unweighted characters. Bootstrap percentage (BP) was computed with 1000 replications. NJ bootstrap values were estimated using 1000 replicates with Kimura’s two-parameter model of substitution (K2P distance) evolution model. Bayesian analysis was performed using MrBayes 3.1.1 (Huelsenbeck and Ronquist, 2001), using GTR model with gamma distribution. The program was set to start with a random starting tree, analysis using four chains of Markov chain Monte Carlo iterations simultaneously for 2,000,000 generations and sampling the data every 100 generations. The likelihood scores stabilized after 200,000 generations, hence for these analyses a ‘burn-in’ of 200,000 generations was used. To assess the level of variation in the COI among the selected samples of different taxa, uncorrected (p) pairwise genetic distances were estimated using PAUP* 4.0b10 software (Swofford, 2002). 3. Results The aligned COI sequences consisted of 360 sites, of which 261 characters were constant, 94 were parsimony informative and five were parsimony uninformative. The phylogenetic trees constructed using the four methods had similar topology except variation in the bootstrap support values (Fig. 1). The Angiostrongylus taxa were grouped into two major clades (Fig. 1) – (1) A. cantonensis and A. malaysiensis supported with bootstrap values of 66%/73%/59%/59% for ML/MP/NJ/Bayesian inference analyses respectively, and (2) A. costaricensis and A. vasorum supported with bootstrap value of 56% for MP, 50% for NJ and 85% for Bayesian Inference (BI). The three geographical isolates of A. cantonensis formed a clade with low to high bootstrap values of 73% for MP, 100% for NJ and 59% for BI. This clade consisted of two sub-clades: (a) China and Hawaii isolates with bootstrap support of MP = 70% and NJ = 100%; and (b) monophyletic Thailand isolate with a high to moderate bootstrap support values of 99% for MP, 100% for NJ and 78% for BI. The Hawaii and China isolates were separated clearly with bootstrap values of (i) MP = 76%, and NJ = 91% for the Hawaii isolate, and (ii) ML = 72%, MP = 71%, NJ = 96% and BI = 93% for the China isolate. In the second major clade, the Europe isolates of A. vasorum were distinctly separated from the Brazil isolate, with bootstrap values of MP = 76%, NJ = 98% and BI = 91%. For the Europe isolates the Portugal isolate was separated from the rest with bootstrap values of ML = 60%, MP = 100%, NJ = 100% and BI = 95%. The Europe isolates were distinctly isolated from the Brazil isolates with bootstrap values of MP = 76%, NJ = 98% and BI = 91%. The Brazil isolates had bootstrap support values of 76/100/100/98% for ML/MP/NJ/BI respectively. For A. costaricensis, the Costa Rica isolate was distinct from the Brazil isolate with bootstrap values of ML = 72%, MP= 54%, NJ = 77% and BI = 78%.
The uncorrected ‘p’ distances for selected representative samples of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum are summarized in Table 1. 4. Discussion Mitochondrial DNA is considered to be effective in uncovering potential cryptic species when sequence data of small sample sizes are used (Blouin, 2002). Cytochrome c oxidase subunit I (COI) is one of the most commonly sequenced mitochondrial loci of nematodes. Recently, A. vasorum from Europe and South America have been shown to represent distinct lineages on the basis of the COI gene, as well as ITS-2 and nicotinamide adenine dinucleotide dehydrogenase 3 (NADH3) (Jefferies et al., 2009, 2010). The two major clades based on COI sequences – (1) A. cantonensis and A. malaysiensis, and (2) A. costaricensis and A. vasorum – in the present study supports the findings based on partial ITS-2 sequences that A. costaricensis, A. dujardini and A. vasorum form a clade distinct from A. cantonensis (Foronda et al., 2010), and A. costaricensis is closer to A. vasorum compared to A. cantonensis (Jefferies et al., 2009). The clustering of A. cantonensis and A. malaysiensis to form a distinct clade concurs with the finding based on SSU sequences with two individuals each of A. costaricensis, A. dujardini and A. vasorum (Van Megan et al., 2009) compared to that based on a single individual resulting in A. costaricensis being closer related to A. malaysiensis and A. cantonensis (Fontanilla and Wade, 2008). The clustering of A. costaricensis with A. vasorum to form a major clade, instead of grouping with A. cantonensis and A. malaysiensis, raises the question of the taxonomic treatment at the generic and subgeneric level. To-date, all the phylogenetic analyses do not support the assignment of the component species to two genera or subgenera, i.e. Angiostrongylus and Parastrongylus. Of the Angiostrongylus species, the COI sequences of many A. vasorum geographical isolates have been studied (Jefferies et al., 2009, 2010). The COI sequences did not differentiate the various geographical isolates (Jefferies et al., 2009). Likewise, the partial ITS-2 sequences also did not differentiate the various geographical isolates of A. vasorum forming the Nearctic/Palaearctic clade (Jefferies et al., 2010). In A. cantonensis, the partial nucleotide sequences of a 66-kDa protein gene could not differentiate unequivocally the Thailand, China, Japan and Hawaii isolates (Eamsobhana et al., 2010b). This study investigated three geographical isolates (China, Hawaii and Thailand) of A. cantonensis. The individuals of each isolate formed a distinct cluster (Fig. 1); the Hawaii isolate grouped with the China isolate while the Thailand isolate was monophyletic. Similar finding has been observed for A. cantonensis isolates from five provinces in South China (He et al., 2010). COI sequences therefore could possibly be used for differentiating geographical isolates and phylogeography study of A. cantonensis. However, more extensive study is needed to confirm this. In the present study, the Costa Rica isolate of A. costaricensis was quite different from the Brazil isolate, with an uncorrected
P. Eamsobhana et al. / Acta Tropica 116 (2010) 152–156
155
Fig. 1. Maximum likelihood phylogeny tree of Angiostrongylus taxa based on COI sequences, estimated using the data under the GTR + + I model [−ln L = 1426.83396; substitution rate matrix RAC = 8.36802, RAG = 27.17287, RAT = 1.72640, RCG = 6.41709, RCT = 46.53510, RGT = 1.00000; base frequencies A = 0.224858, C = 0.047428, G = 0.257435, T = 0.470279; shape parameter (˛) = 1.188672; proportion of invariable site (I) = 0.669714]. The bootstrap values (ML/MP/NJ/Bayesian Inference) are shown above the branches.
p-distance of 11.39% (Table 1). Similar differentiation has been reported for ITS-2 gene (Jefferies et al., 2009). The COI and ITS-2 results are indicative of the possibility of the Costa Rica and Brazil isolates being cryptic species. The possibility of the Europe and South America isolates of A. vasorum to represent cryptic species has also been suggested (Jefferies et al., 2009). The present analysis indicates a p-distance of 7.78–8.06% between the Europe and South America isolates of A. vasorum (Table 1). The p-distance between two closely related species A. cantonensis and A. malaysiensis was 11.11–11.67%. Pair-wise comparison of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum indicated a p-distance greater than 11% (range 11.11–17.50%). The three geographical isolates of A. cantonensis had a p-distance of 0.83–3.61% and the two representative Europe isolates (Germany and Portugal) of A. vasorum had a p-distance of 0.28% (Table 1). In sum, we studied for the first time the phylogeny of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum based on COI DNA sequences. A. cantonensis was closer related to A. malaysien-
sis while A. costaricensis was closer related to A. vasorum. The results indicated the possible occurrence of cryptic species for the A. costaricensis isolates. The COI gene appears to be a good marker for differentiating closely related Angiostrongylus species as well as geographical isolates of A. cantonensis. Efforts are being made to carry out an extensive collaborative study to cover a wide range of Angiostrongylus species and geographical isolates. Acknowledgements The authors would like to thank Paibulaya Punthuprapasa, Adisak Yoolek and Jeeranan Pinnak for their excellent technical assistance. We also thank the Mahidol University and University of Malaya for support and facilities. This work received financial support from a grant for research on infectious diseases from the Department of Disease Control, Ministry of Public Health, Thailand; and a special research grant (5620009 to H. S. Yong) from the University of Malaya. The comments and suggestions by the reviewers
156
P. Eamsobhana et al. / Acta Tropica 116 (2010) 152–156
and editor have greatly improved the paper and are gratefully acknowledged. References Anderson, R.C., 1978. Keys to genera of the superfamily Metastrongyloidea. In: Anderson, R.C., Chabaud, A.G., Willmott, S. (Eds.), CIH Keys to the Nematode Parasites of Vertebrates. Commonwealth Agriculture Bureau, Farnham Royal, Bucks, UK, pp. 1–40. Anderson, R.C., 2000. Nematode Parasites of Vertebrates: Their Development and Transmission, 2nd ed. CABI Publishing/CAB International, Wallingford, United Kingdom. Bhaibulaya, M., 1968. A new species of Angiostrongylus in an Australian rat, Rattus fuscipes. Parasitology 58, 789–799. Bhaibulaya, M., Cross, J.H., 1971. Angiostrongylus malaysiensis (Nematoda: Metastrongylidae), a new species of rat lungworm from Malaysia. Southeast Asian J. Trop. Med. Public Health 2, 527–533. Blouin, M.S., 2002. Molecular prospecting for cryptic species of nematodes: mitochondrial DNA versus internal transcribed spacer. Int. J. Parsitol. 32, 527–531. Bowles, J., Hope, M., Tiu, W.U., Liu, X., McManus, D.P., 1993. Nuclear and mitochondrial genetic markers highly conserved between Chinese and Philippine Schistosoma japonicum. Acta Trop. 55, 217–229. Caldeira, R.L., Carvalho, O.S., Mendonca, C.L.F.G., Graeff-Teixeira, C., Silva, M.C.F., Ben, R., Maurer, R., Lima, W.S., Lenzi, H.L., 2003. Molecular differentiation of Angiostrongylus costaricensis. A. cantonensis and A. vasorum by polymerase chain reaction-restriction fragment length polymorphism. Mem. Inst. Oswaldo Cruz 98, 1039–1043. Chabaud, A.G., 1972. Description de Stefanskostrongylus dubosti n.sp. Parasite du Potamogale et essai de classification des Nématodes Angiostrongylidae. Ann. Parasit. Hum. Comp. 47, 735–744. Costa, J.O., de Araujo Costa, H.M., Guimaraes, M.P., 2003. Redescription of Angiostrongylus vasorum (Baillet, 1866), and systematic revision of species assigned to the genera Angiostrongylus Kamensky, 1905 and Angiocaulus Schulz, 1951. Rev. Med. Vet. 154, 9–16. Cross, J.H., 1979. Experimental studies on Angiostrongylus species in monkeys and laboratory animals. In: Cross, J.H. (Ed.), Studies on angiostrongyliasis in Eastern Asia and Australia. NAMRU-2-SP-44. U.S. Naval Medical Research Unit No. 2, Taipei, Taiwan, pp. 118–137. Cross, J.H., Chen, E.R., 2007. Angiostrongyliasis. In: Murrel, K.D., Fried, B. (Eds.), Food Borne Parasitic Zoonoses. Springer, New York, pp. 263–290. del Rosario Robles, M., Navone, G.T., Kinsella, J.M., 2008. A new angiostrongylid (Nematoda) species from the pulmonary arteries of Akodon azarae (Rodentia: Cricetidae) in Argentina. J. Parasitol. 94, 515–519. Drozdz, J., 1970. Révision de le systématique du genre Angiostrongylus Kamensky, 1905 (Nematoda: Metastrongyloidea). Ann. Parasitol. (Paris) 45, 597–603. Eamsobhana, P., 2006. The Rat Lungworm Parastrongylus (=Angiostrongylus) cantonensis: Parasitology, Immunology, Eosinophilic Meningitis, Epidemiology and Laboratory Diagnosis. Wankaew (IQ) Book Center Co. Ltd., Bangkok, 156 pp. Eamsobhana, P., Tungtrongchitr, A., 2005. Angiostrongyliasis in Thailand. In: Arizono, N., Chai, J.Y., Nawa, Y., Takahashi, T. (Eds.), Food-borne Helminthiasis in Asia. The Federation of Asian Parasitologists, Chiba, Japan, pp. 32–47. Eamsobhana, P., Yong, H.S., 2009. Immunological diagnosis of human angiostrongyliasis due to Angiostrongylus cantonensis (Nematoda: Angiostrongylidae). Int. J. Infect. Dis. 13, 425–431.
Eamsobhana, P., Lim, P.E., Yong, H.S., 2010a. Genetics of Angiostrongylus cantonensis and allied species (Nematoda: Angiostrongylidae). In: International Symposium on Angiostrongylus and angiostrongyliasis–Bangkok 2010, Thailand, p. 21 (abstract). Eamsobhana, P., Lim, P.E., Zhang, H., Gan, X., Yong, H.S., 2010b. Molecular differentiation and phylogenetic relationships of three Angiostrongylus species and Angiostrongylus cantonensis geographical isolates based on a 66-kDa protein gene of A. cantonensis (Nematoda: Angiostrongylidae). Exp. Parasitol., doi:10:1016/j.expara.2010.06.001. Fontanilla, I.K.C., Wade, C.M., 2008. The small subunit (SSU) ribosomal (r) RNA as a genetic marker for identifying infective 3rd juvenile stage Angiostrongylus cantonensis. Acta Trop. 105, 181–186. Foronda, P., López-González, M., Miquel, J., Torres, J., Segovia, M., Abreu-Acosta, N., Casanova, J.C., Valladares, B., Mas-Coma, S., Bargues, M.D., Feliu, C., 2010. Finding of Parastrongylus cantonensis (Chen, 1935) in Rattus rattus in Tenerife, Canary Islands (Spain). Acta Trop. 114, 123–127. Graeff-Teixeira, C., 2010. Current status of the diagnosis of abdominal angiostrongyliasis. In: International Symposium on Angiostrongylus and angiostrongyliasis–Bangkok 2010, Thailand, p. 14 (abstract). Graeff-Teixeira, C., da Silva, A.C.A., Yoshimura, K., 2009. Update on eosinophilic meningoencephalitis and its clinical relevance. Clin. Microbiol. Rev. 22, 322–348. He, H., Lv, Z., Li, Z., Wu, Z., 2010. Hereditary polymorphism analysis of Angiostrongylus cantonensis from South China. In: International Symposium on Angiostrongylus and Angiostrongyliasis–Bangkok 2010, Thailand, p. 22 (abstract). Hu, M., Chilton, N.B., Gasser, R.B., 2002. Long PCR-based amplification of the entire mitochondrial genome from single parasitic nematodes. Mol. Cell. Probes 16, 261–267. Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Jefferies, R., Shaw, S.E., Viney, M.E., Morgan, E.R., 2009. Angiostrongylus vasorum from South America and Europe represent distinct lineages. Parasitology 136, 107–115. Jefferies, R., Shaw, S.E., Willesen, J., Viney, M.E., Morgan, E.R., 2010. Elucidating the spread of the emerging canid nematode Angiostrongylus vasorum between Palaearctic and Nearctic ecozones. Infect. Genet. Evol. 10, 561–568. Morera, P., 1985. Abdominal angiostrongyliasis: a problem of public health. Parasitol. Today 6, 173–175. Prociv, P., Spratt, D.M., Carlisle, M.S., 2000. Neuro-angiostrongyliasis: unresolved issues. Int. J. Parasitol. 30, 1295–1303. Sullivan, J., Abdo, Z., Joyce, P., Swofford, D.L., 2005. Evaluating the performance of a successive-approximations approach to parameter optimization in maximumlikelihood phylogeny estimation. Mol. Biol. Evol. 22, 1386–1392. Swofford, D.L., 2002. PAUP* Phylogenetic Analysis using Parsimony (*and other methods) Version 4. Sinauer Associates, Sunderland, MA. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Ubelaker, J.E., 1986. Systematics of species referred to the genus Angiostrongylus. J. Parasitol. 72, 48–56. Van Megan, H., van den Elsen, S., Holerman, M., Karssen, G., Mooyman, P., Bongers, T., Holovachov, O., Bakker, J., Helder, J., 2009. A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences. Nematology 11, 927–950.
Contents lists available at ScienceDirect
Acta Tropica journal homepage: www.elsevier.com/locate/actatropica
Molecular differentiation of Angiostrongylus taxa (Nematoda: Angiostrongylidae) by cytochrome c oxidase subunit I (COI) gene sequences Praphathip Eamsobhana a,∗ , Phaik Eem Lim b,c , Gabriela Solano d , Hongman Zhang e , Xiaoxian Gan f , Hoi Sen Yong c a
Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand Institute of Ocean and Earth Science, University of Malaya, 50603 Kuala Lumpur, Malaysia Institute of Biological Sciences, University of Malaya, 50603 Kuala Lumpur, Malaysia d Facultad de Microbiologia, Universidad de Costa Rica, San Jose, Apartado 2060, Costa Rica e Guangxi Zhuang Autonomous Region Center for Disease Control and Prevention, Nanning 530028, PR China f Institute of Parasitic Diseases, Zhejiang Academy of Medical Sciences, Hangzhou 310013, PR China b c
a r t i c l e
i n f o
Article history: Received 25 May 2010 Received in revised form 29 June 2010 Accepted 14 July 2010 Available online 21 July 2010 Keywords: Angiostrongylus cantonensis Angiostrongylus costaricensis Angiostrongylus malaysiensis Angiostrongylus vasorum Parastrongylus Molecular phylogeny Phylogeography
a b s t r a c t Nematodes of the genus Angiostrongylus are parasites of rodents and carnivores. They reside in the pulmonary or mesenteric arteries of their hosts. Two species are pathogenic in humans – Angiostrongylus cantonensis causes eosinophilic meningitis or meningoencephalitis, and Angiostrongylus costaricensis produces abdominal angiostrongyliasis. In addition Angiostrongylus malaysiensis may have the potential of being pathogenic in humans. The mitochondrial gene cytochrome c oxidase subunit I (COI) of these Angiostrongylus species and three geographical isolates (China, Hawaii and Thailand) of A. cantonensis were studied by polymerase chain reaction amplification and DNA sequencing. COI sequences of A. cantonensis, A. costaricensis and Angiostrongylus vasorum in the GenBank were included for comparison. Phylogenetic analysis by maximum-likelihood (ML), maximum-parsimony (MP), neighbour-joining (NJ) and Bayesian inference (BI) produced similar tree topology except variation in the bootstrap support values. There were two major clades – (1) A. cantonensis and A. malaysiensis, and (2) A. costaricensis and A. vasorum. The three geographical isolates of A. cantonensis formed a clade with low to high bootstrap values, and consisted of two subclades: (a) China and Hawaii isolates, and (b) monophyletic Thailand isolate. The individuals of each isolate formed a distinct cluster. In the second major clade, the Europe isolates of A. vasorum were distinctly different from the Brazil isolates. For A. costaricensis, the Costa Rica isolate was distinct from the Brazil isolate with an uncorrected (p) distance of 11.39%, indicating the possible occurrence of cryptic species. The present results indicate that COI sequences might be a useful marker for differentiating geographical isolates of A. cantonensis and in uncovering cryptic species. Efforts are being made to carry out an extensive collaborative study to cover a wide range of Angiostrongylus species and geographical isolates. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Nematodes of the genus Angiostrongylus Kamensky, 1905 are parasites of rodents and carnivores (Anderson, 2000). Under this classification, the component species are grouped into two subgenera, i.e. Angiostrongylus and Parastrongylus (Drozdz, 1970; Anderson, 1978). These two subgenera however have been elevated by some authors (Chabaud, 1972; Ubelaker, 1986) as full genera, but this taxonomic treatment has not been generally accepted. Currently, 13 species are from rodent hosts and two from carnivore hosts (Ubelaker, 1986; Costa et al., 2003; del Rosario Robles
∗ Corresponding author. Tel.: +66 (0) 24196468. E-mail address: [email protected] (P. Eamsobhana). 0001-706X/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.actatropica.2010.07.005
et al., 2008). These nematodes reside in the pulmonary arteries of their hosts, except Angiostrongylus costaricensis Morera and Céspedes, 1971 and A. siamensis Ohbayahi, Kamiya and Bhaibulaya, 1979 which are found in the mesenteric arteries. Of the 15 Angiostrongylus species, only two are of public health importance, causing human angiostrongyliasis. Angiostrongylus cantonensis (Chen, 1935) is a primary cause of human eosinophilic meningitis or eosinophilic meningoencephalitis in Asia and the Pacific Islands (Eamsobhana and Tungtrongchitr, 2005; Eamsobhana, 2006). Its occurrence has now been reported in many countries worldwide (Eamsobhana, 2006; Cross and Chen, 2007; Foronda et al., 2010). Furthermore, the parasites of different geographical locality show different infectivity, severity and pathogenicity in experimental hosts (Cross, 1979). The other species, A. costaricensis produces abdominal angiostrongylia-
P. Eamsobhana et al. / Acta Tropica 116 (2010) 152–156
sis and occurs throughout the Americas, from southern United States to northern Argentina in South America (Morera, 1985; Graeff-Teixeira et al., 2009; Graeff-Teixeira, 2010). In addition to A. cantonensis and A. costaricensis, two other species (A. mackerrasae Bhaibulaya, 1968 in Australia and Angiostrongylus malaysiensis Bhaibulaya and Cross, 1971 in Malaysia) may have the potential of being pathogenic in humans (Prociv et al., 2000). When first documented both species were referred to as A. cantonensis (Bhaibulaya, 1968; Bhaibulaya and Cross, 1971). Of the two Angiostrongylus species that are pathogenic in humans, A. cantonensis has received greater attention in both laboratory and clinical studies (Eamsobhana, 2006; Cross and Chen, 2007; Graeff-Teixeira et al., 2009). Immunological diagnosis in particular has been extensively explored (Eamsobhana and Yong, 2009). Molecular differentiation of A. cantonensis, A. costaricensis and Angiostrongylus vasorum (Baillet, 1866) has been achieved with polymerase chain reaction-restriction fragment length polymorphism (Caldeira et al., 2003). The partial DNA sequences of a 66-kDa protein gene could unequivocally differentiate A. cantonensis, A. costaricensis and A. malaysiensis, and indicated that A. cantonensis and A. malaysiensis were closer related than to A. costaricensis (Eamsobhana et al., 2010a). The small subunit (SSU) ribosomal DNA sequences have been used for constructing phylogenetic tree of five species of Angiostrongylus—A. cantonensis, A. costaricensis, A. dujardini Drozdz and Doby, 1970, A. malaysiensis and A. vasorum (Fontanilla and Wade, 2008; Van Megan et al., 2009). Phylogenetic tree has also been constructed with internal transcribed spacer 2 (ITS-2) for A. cantonensis, A. costaricensis and A. vasorum (Jefferies et al., 2009) as well as A. dujardini (Foronda et al., 2010). The nucleotide sequences of cytochrome c oxidase subunit I (COI) have been reported for A. cantonensis from China (GenBank accession number GQ398121 – complete mitochondrial genome), and A. costaricensis from Brazil (GenBank accession numbers GQ398122, NC013067 – complete mitochondrial genome). COI sequences have been briefly reported to clearly differentiate A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum (Eamsobhana et al., 2010a) and geographical isolates of A. cantonensis (Eamsobhana et al., 2010a; He et al., 2010). In contrast COI has been extensively studied in A. vasorum from Europe and South America (Jefferies et al., 2009, 2010). The present study was undertaken to determine the usefulness and suitability of the COI gene for differentiating closely related species (e.g. A. cantonensis and A. malaysiensis) and geographical isolates of A. cantonensis, as well as to determine the phylogenetic relationship of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum.
2. Materials and methods 2.1. Angiostrongylus worms The Thailand isolate of A. cantonensis was maintained in the Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, with passages through albino rats as definitive rodent host and Biomphalaria glabrata as intermediate snail host. The Hawaii isolate of A. cantonensis was kindly provided by Dr. Akira Ishih of Hamamatsu University, Japan and maintained in the Department of Parasitology, Mahidol University. Both the Thailand and Hawaii adult worm samples have been kept in absolute ethanol since August 2008. The China specimens of A. cantonensis were obtained from rodents caught in Guangxi Province, PR China in September 2009. Individual worm homogenate was applied and dried onto the FTA card before shipment to Bangkok for DNA preparations. A. malaysiensis male and female worms were obtained from the pulmonary arteries of wild caught Rattus tioman-
153
icus on 26 June 2008 in Pahang, Peninsular Malaysia and stored in absolute ethanol until DNA was extracted. A. costaricensis adult specimens preserved in RNAlater (RNA stabilization solution) were a gift from Dr. Elizabeth Abrahams, Department of Parasitology, University of Costa Rica. 2.2. DNA extraction The FTA card method (Whatman BioScience) which is more rapid and convenient to perform than the commercial DNA extraction kits was employed for DNA preparation in the present study. Genomic DNA extraction from individual adult female and male worms of A. cantonensis (Thailand, Hawaii and China isolates), A. costaricensis and A. malaysiensis, was carried out using FTA technology (Whatman BioScience) following the manufacturer’s instruction. In brief, individual worm was homogenized in 100–150 L of sterilized PBS, pH 7.4. The homogenate was applied and dried onto the FTA card according to the Whatman FTA tissue protocol. A sample disc was taken using a 2.0 mm diameter Harris micro punch, washed with FTA purification reagent, and used in PCR for DNA analysis. 2.3. PCR amplification and DNA sequencing The DNA amplification by polymerase chain reaction was conducted using the previously described primers COI F 5 TAAAGAAAGAACATAATGAAAATG 3 and COI R 5 TTTTTTGGGCATCCTGAGGTTTAT 3 for a partial region of the COI gene (Bowles et al., 1993; Hu et al., 2002; Jefferies et al., 2009). The reaction mixture was prepared in a total volume of 25 L containing 2.5 L of 10× PCR buffer (TrisCl, KCl, (NH4 )2 SO4 , 15 mM MgCl2 , pH 8.7 (QIAGEN), 0.5 L of dNTP mix (10 mM each), 0.5 L of each primer (12.5 ng/L), 0.1 L of Taq DNA polymerase (5 Units/L), 21.4 L of dH2 O and a 2.0 mm DNA punched disc (FTA card) that contained extracted DNA from individual worm samples in a DNA thermal cycler (PerkinElmer Cetus). The thermocycler was programmed to incubate the samples for 5 min at 94 ◦ C, followed by 40 cycles, each at 94 ◦ C for 30 s, at 55 ◦ C for 30 s, at 72 ◦ C for 1 min, and final extension at 72 ◦ C for 5 min. The reaction products were separated by electrophoresis on 1.5% (w/v) agarose gel, stained with ethidium bromide, and visualized under ultraviolet light. Amplified products were purified using a QIAquick PCR Purification Kit (QIAGEN). Sequencing reactions were performed using an ABI PrismDyeTerminator Cycle Sequencing Core kit (Applied Biosystems, USA). 2.4. COI sequences from GenBank COI sequences were obtained from the GenBank as follows: (1) A. cantonensis of China – GQ398121; (2) A. costaricensis of Brazil – GQ398122, and NC013067; and (3) A. vasorum of Europe – EU493161 to EU493167. The sequences for A. vasorum isolates Brazil 5421, Brazil 5641 and Brazil 5642 were constructed from published data on their variable nucleotide positions (Jefferies et al., 2009). Sequences of Ancylostoma duodenale (GenBank accession number AJ417718) and Ancylostoma tubaeforme (GenBank accession number AJ407940) were used as outgroup. 2.5. Sequence alignment and phylogenetic analysis Sequences from this study were preliminarily aligned using the CLUSTAL X program (Thompson et al., 1997) and subsequently manually aligned. The aligned sequences were subjected to maximum-likelihood (ML), maximum-parsimony (MP) and neighbour-joining (NJ) analyses using PAUP* 4.0b10 (Swofford, 2002). ML analyses of the COI data were performed using PAUP* and a best-fitting evolution model. The model of sequence evolution
154
P. Eamsobhana et al. / Acta Tropica 116 (2010) 152–156
Table 1 Uncorrected ‘p’ distance (%) between selected representative samples of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum. Sample
1
2
3
4
5
6
7
8
1. A. cantonensis AC C M2, China 2. A. cantonensis AC H M1, Hawaii 3. A. cantonensis AC T F2, Thailand 4. A. costaricensis ACOS M1, Costa Rica 5. A. costaricensis GQ398122, Brazil 6. A. malaysiensis AM F1, Malaysia 7. A. vasorum Brazil 5642 8. A. vasorum EU493167, Germany 9. A. vasorum EU493161, Portugal
0.83 3.61 12.22 15.00 11.11 12.78 12.22 11.94
3.61 11.67 14.67 11.11 13.06 12.50 12.22
13.33 15.00 11.67 11.94 11.94 11.67
11.39 13.89 15.00 13.94 13.61
16.11 14.44 13.61 13.33
17.50 15.28 15.56
8.06 7.78
0.28
was chosen based on results from the successive approximation method (Sullivan et al., 2005). Tree likelihoods were estimated using a heuristic search with 100 random-addition-sequence replicates, tree bisection reconnection (TBR) branch swapping, and unordered and unweighted characters. Bootstrap percentage (BP) was computed with 1000 replications. NJ bootstrap values were estimated using 1000 replicates with Kimura’s two-parameter model of substitution (K2P distance) evolution model. Bayesian analysis was performed using MrBayes 3.1.1 (Huelsenbeck and Ronquist, 2001), using GTR model with gamma distribution. The program was set to start with a random starting tree, analysis using four chains of Markov chain Monte Carlo iterations simultaneously for 2,000,000 generations and sampling the data every 100 generations. The likelihood scores stabilized after 200,000 generations, hence for these analyses a ‘burn-in’ of 200,000 generations was used. To assess the level of variation in the COI among the selected samples of different taxa, uncorrected (p) pairwise genetic distances were estimated using PAUP* 4.0b10 software (Swofford, 2002). 3. Results The aligned COI sequences consisted of 360 sites, of which 261 characters were constant, 94 were parsimony informative and five were parsimony uninformative. The phylogenetic trees constructed using the four methods had similar topology except variation in the bootstrap support values (Fig. 1). The Angiostrongylus taxa were grouped into two major clades (Fig. 1) – (1) A. cantonensis and A. malaysiensis supported with bootstrap values of 66%/73%/59%/59% for ML/MP/NJ/Bayesian inference analyses respectively, and (2) A. costaricensis and A. vasorum supported with bootstrap value of 56% for MP, 50% for NJ and 85% for Bayesian Inference (BI). The three geographical isolates of A. cantonensis formed a clade with low to high bootstrap values of 73% for MP, 100% for NJ and 59% for BI. This clade consisted of two sub-clades: (a) China and Hawaii isolates with bootstrap support of MP = 70% and NJ = 100%; and (b) monophyletic Thailand isolate with a high to moderate bootstrap support values of 99% for MP, 100% for NJ and 78% for BI. The Hawaii and China isolates were separated clearly with bootstrap values of (i) MP = 76%, and NJ = 91% for the Hawaii isolate, and (ii) ML = 72%, MP = 71%, NJ = 96% and BI = 93% for the China isolate. In the second major clade, the Europe isolates of A. vasorum were distinctly separated from the Brazil isolate, with bootstrap values of MP = 76%, NJ = 98% and BI = 91%. For the Europe isolates the Portugal isolate was separated from the rest with bootstrap values of ML = 60%, MP = 100%, NJ = 100% and BI = 95%. The Europe isolates were distinctly isolated from the Brazil isolates with bootstrap values of MP = 76%, NJ = 98% and BI = 91%. The Brazil isolates had bootstrap support values of 76/100/100/98% for ML/MP/NJ/BI respectively. For A. costaricensis, the Costa Rica isolate was distinct from the Brazil isolate with bootstrap values of ML = 72%, MP= 54%, NJ = 77% and BI = 78%.
The uncorrected ‘p’ distances for selected representative samples of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum are summarized in Table 1. 4. Discussion Mitochondrial DNA is considered to be effective in uncovering potential cryptic species when sequence data of small sample sizes are used (Blouin, 2002). Cytochrome c oxidase subunit I (COI) is one of the most commonly sequenced mitochondrial loci of nematodes. Recently, A. vasorum from Europe and South America have been shown to represent distinct lineages on the basis of the COI gene, as well as ITS-2 and nicotinamide adenine dinucleotide dehydrogenase 3 (NADH3) (Jefferies et al., 2009, 2010). The two major clades based on COI sequences – (1) A. cantonensis and A. malaysiensis, and (2) A. costaricensis and A. vasorum – in the present study supports the findings based on partial ITS-2 sequences that A. costaricensis, A. dujardini and A. vasorum form a clade distinct from A. cantonensis (Foronda et al., 2010), and A. costaricensis is closer to A. vasorum compared to A. cantonensis (Jefferies et al., 2009). The clustering of A. cantonensis and A. malaysiensis to form a distinct clade concurs with the finding based on SSU sequences with two individuals each of A. costaricensis, A. dujardini and A. vasorum (Van Megan et al., 2009) compared to that based on a single individual resulting in A. costaricensis being closer related to A. malaysiensis and A. cantonensis (Fontanilla and Wade, 2008). The clustering of A. costaricensis with A. vasorum to form a major clade, instead of grouping with A. cantonensis and A. malaysiensis, raises the question of the taxonomic treatment at the generic and subgeneric level. To-date, all the phylogenetic analyses do not support the assignment of the component species to two genera or subgenera, i.e. Angiostrongylus and Parastrongylus. Of the Angiostrongylus species, the COI sequences of many A. vasorum geographical isolates have been studied (Jefferies et al., 2009, 2010). The COI sequences did not differentiate the various geographical isolates (Jefferies et al., 2009). Likewise, the partial ITS-2 sequences also did not differentiate the various geographical isolates of A. vasorum forming the Nearctic/Palaearctic clade (Jefferies et al., 2010). In A. cantonensis, the partial nucleotide sequences of a 66-kDa protein gene could not differentiate unequivocally the Thailand, China, Japan and Hawaii isolates (Eamsobhana et al., 2010b). This study investigated three geographical isolates (China, Hawaii and Thailand) of A. cantonensis. The individuals of each isolate formed a distinct cluster (Fig. 1); the Hawaii isolate grouped with the China isolate while the Thailand isolate was monophyletic. Similar finding has been observed for A. cantonensis isolates from five provinces in South China (He et al., 2010). COI sequences therefore could possibly be used for differentiating geographical isolates and phylogeography study of A. cantonensis. However, more extensive study is needed to confirm this. In the present study, the Costa Rica isolate of A. costaricensis was quite different from the Brazil isolate, with an uncorrected
P. Eamsobhana et al. / Acta Tropica 116 (2010) 152–156
155
Fig. 1. Maximum likelihood phylogeny tree of Angiostrongylus taxa based on COI sequences, estimated using the data under the GTR + + I model [−ln L = 1426.83396; substitution rate matrix RAC = 8.36802, RAG = 27.17287, RAT = 1.72640, RCG = 6.41709, RCT = 46.53510, RGT = 1.00000; base frequencies A = 0.224858, C = 0.047428, G = 0.257435, T = 0.470279; shape parameter (˛) = 1.188672; proportion of invariable site (I) = 0.669714]. The bootstrap values (ML/MP/NJ/Bayesian Inference) are shown above the branches.
p-distance of 11.39% (Table 1). Similar differentiation has been reported for ITS-2 gene (Jefferies et al., 2009). The COI and ITS-2 results are indicative of the possibility of the Costa Rica and Brazil isolates being cryptic species. The possibility of the Europe and South America isolates of A. vasorum to represent cryptic species has also been suggested (Jefferies et al., 2009). The present analysis indicates a p-distance of 7.78–8.06% between the Europe and South America isolates of A. vasorum (Table 1). The p-distance between two closely related species A. cantonensis and A. malaysiensis was 11.11–11.67%. Pair-wise comparison of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum indicated a p-distance greater than 11% (range 11.11–17.50%). The three geographical isolates of A. cantonensis had a p-distance of 0.83–3.61% and the two representative Europe isolates (Germany and Portugal) of A. vasorum had a p-distance of 0.28% (Table 1). In sum, we studied for the first time the phylogeny of A. cantonensis, A. costaricensis, A. malaysiensis and A. vasorum based on COI DNA sequences. A. cantonensis was closer related to A. malaysien-
sis while A. costaricensis was closer related to A. vasorum. The results indicated the possible occurrence of cryptic species for the A. costaricensis isolates. The COI gene appears to be a good marker for differentiating closely related Angiostrongylus species as well as geographical isolates of A. cantonensis. Efforts are being made to carry out an extensive collaborative study to cover a wide range of Angiostrongylus species and geographical isolates. Acknowledgements The authors would like to thank Paibulaya Punthuprapasa, Adisak Yoolek and Jeeranan Pinnak for their excellent technical assistance. We also thank the Mahidol University and University of Malaya for support and facilities. This work received financial support from a grant for research on infectious diseases from the Department of Disease Control, Ministry of Public Health, Thailand; and a special research grant (5620009 to H. S. Yong) from the University of Malaya. The comments and suggestions by the reviewers
156
P. Eamsobhana et al. / Acta Tropica 116 (2010) 152–156
and editor have greatly improved the paper and are gratefully acknowledged. References Anderson, R.C., 1978. Keys to genera of the superfamily Metastrongyloidea. In: Anderson, R.C., Chabaud, A.G., Willmott, S. (Eds.), CIH Keys to the Nematode Parasites of Vertebrates. Commonwealth Agriculture Bureau, Farnham Royal, Bucks, UK, pp. 1–40. Anderson, R.C., 2000. Nematode Parasites of Vertebrates: Their Development and Transmission, 2nd ed. CABI Publishing/CAB International, Wallingford, United Kingdom. Bhaibulaya, M., 1968. A new species of Angiostrongylus in an Australian rat, Rattus fuscipes. Parasitology 58, 789–799. Bhaibulaya, M., Cross, J.H., 1971. Angiostrongylus malaysiensis (Nematoda: Metastrongylidae), a new species of rat lungworm from Malaysia. Southeast Asian J. Trop. Med. Public Health 2, 527–533. Blouin, M.S., 2002. Molecular prospecting for cryptic species of nematodes: mitochondrial DNA versus internal transcribed spacer. Int. J. Parsitol. 32, 527–531. Bowles, J., Hope, M., Tiu, W.U., Liu, X., McManus, D.P., 1993. Nuclear and mitochondrial genetic markers highly conserved between Chinese and Philippine Schistosoma japonicum. Acta Trop. 55, 217–229. Caldeira, R.L., Carvalho, O.S., Mendonca, C.L.F.G., Graeff-Teixeira, C., Silva, M.C.F., Ben, R., Maurer, R., Lima, W.S., Lenzi, H.L., 2003. Molecular differentiation of Angiostrongylus costaricensis. A. cantonensis and A. vasorum by polymerase chain reaction-restriction fragment length polymorphism. Mem. Inst. Oswaldo Cruz 98, 1039–1043. Chabaud, A.G., 1972. Description de Stefanskostrongylus dubosti n.sp. Parasite du Potamogale et essai de classification des Nématodes Angiostrongylidae. Ann. Parasit. Hum. Comp. 47, 735–744. Costa, J.O., de Araujo Costa, H.M., Guimaraes, M.P., 2003. Redescription of Angiostrongylus vasorum (Baillet, 1866), and systematic revision of species assigned to the genera Angiostrongylus Kamensky, 1905 and Angiocaulus Schulz, 1951. Rev. Med. Vet. 154, 9–16. Cross, J.H., 1979. Experimental studies on Angiostrongylus species in monkeys and laboratory animals. In: Cross, J.H. (Ed.), Studies on angiostrongyliasis in Eastern Asia and Australia. NAMRU-2-SP-44. U.S. Naval Medical Research Unit No. 2, Taipei, Taiwan, pp. 118–137. Cross, J.H., Chen, E.R., 2007. Angiostrongyliasis. In: Murrel, K.D., Fried, B. (Eds.), Food Borne Parasitic Zoonoses. Springer, New York, pp. 263–290. del Rosario Robles, M., Navone, G.T., Kinsella, J.M., 2008. A new angiostrongylid (Nematoda) species from the pulmonary arteries of Akodon azarae (Rodentia: Cricetidae) in Argentina. J. Parasitol. 94, 515–519. Drozdz, J., 1970. Révision de le systématique du genre Angiostrongylus Kamensky, 1905 (Nematoda: Metastrongyloidea). Ann. Parasitol. (Paris) 45, 597–603. Eamsobhana, P., 2006. The Rat Lungworm Parastrongylus (=Angiostrongylus) cantonensis: Parasitology, Immunology, Eosinophilic Meningitis, Epidemiology and Laboratory Diagnosis. Wankaew (IQ) Book Center Co. Ltd., Bangkok, 156 pp. Eamsobhana, P., Tungtrongchitr, A., 2005. Angiostrongyliasis in Thailand. In: Arizono, N., Chai, J.Y., Nawa, Y., Takahashi, T. (Eds.), Food-borne Helminthiasis in Asia. The Federation of Asian Parasitologists, Chiba, Japan, pp. 32–47. Eamsobhana, P., Yong, H.S., 2009. Immunological diagnosis of human angiostrongyliasis due to Angiostrongylus cantonensis (Nematoda: Angiostrongylidae). Int. J. Infect. Dis. 13, 425–431.
Eamsobhana, P., Lim, P.E., Yong, H.S., 2010a. Genetics of Angiostrongylus cantonensis and allied species (Nematoda: Angiostrongylidae). In: International Symposium on Angiostrongylus and angiostrongyliasis–Bangkok 2010, Thailand, p. 21 (abstract). Eamsobhana, P., Lim, P.E., Zhang, H., Gan, X., Yong, H.S., 2010b. Molecular differentiation and phylogenetic relationships of three Angiostrongylus species and Angiostrongylus cantonensis geographical isolates based on a 66-kDa protein gene of A. cantonensis (Nematoda: Angiostrongylidae). Exp. Parasitol., doi:10:1016/j.expara.2010.06.001. Fontanilla, I.K.C., Wade, C.M., 2008. The small subunit (SSU) ribosomal (r) RNA as a genetic marker for identifying infective 3rd juvenile stage Angiostrongylus cantonensis. Acta Trop. 105, 181–186. Foronda, P., López-González, M., Miquel, J., Torres, J., Segovia, M., Abreu-Acosta, N., Casanova, J.C., Valladares, B., Mas-Coma, S., Bargues, M.D., Feliu, C., 2010. Finding of Parastrongylus cantonensis (Chen, 1935) in Rattus rattus in Tenerife, Canary Islands (Spain). Acta Trop. 114, 123–127. Graeff-Teixeira, C., 2010. Current status of the diagnosis of abdominal angiostrongyliasis. In: International Symposium on Angiostrongylus and angiostrongyliasis–Bangkok 2010, Thailand, p. 14 (abstract). Graeff-Teixeira, C., da Silva, A.C.A., Yoshimura, K., 2009. Update on eosinophilic meningoencephalitis and its clinical relevance. Clin. Microbiol. Rev. 22, 322–348. He, H., Lv, Z., Li, Z., Wu, Z., 2010. Hereditary polymorphism analysis of Angiostrongylus cantonensis from South China. In: International Symposium on Angiostrongylus and Angiostrongyliasis–Bangkok 2010, Thailand, p. 22 (abstract). Hu, M., Chilton, N.B., Gasser, R.B., 2002. Long PCR-based amplification of the entire mitochondrial genome from single parasitic nematodes. Mol. Cell. Probes 16, 261–267. Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Jefferies, R., Shaw, S.E., Viney, M.E., Morgan, E.R., 2009. Angiostrongylus vasorum from South America and Europe represent distinct lineages. Parasitology 136, 107–115. Jefferies, R., Shaw, S.E., Willesen, J., Viney, M.E., Morgan, E.R., 2010. Elucidating the spread of the emerging canid nematode Angiostrongylus vasorum between Palaearctic and Nearctic ecozones. Infect. Genet. Evol. 10, 561–568. Morera, P., 1985. Abdominal angiostrongyliasis: a problem of public health. Parasitol. Today 6, 173–175. Prociv, P., Spratt, D.M., Carlisle, M.S., 2000. Neuro-angiostrongyliasis: unresolved issues. Int. J. Parasitol. 30, 1295–1303. Sullivan, J., Abdo, Z., Joyce, P., Swofford, D.L., 2005. Evaluating the performance of a successive-approximations approach to parameter optimization in maximumlikelihood phylogeny estimation. Mol. Biol. Evol. 22, 1386–1392. Swofford, D.L., 2002. PAUP* Phylogenetic Analysis using Parsimony (*and other methods) Version 4. Sinauer Associates, Sunderland, MA. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Ubelaker, J.E., 1986. Systematics of species referred to the genus Angiostrongylus. J. Parasitol. 72, 48–56. Van Megan, H., van den Elsen, S., Holerman, M., Karssen, G., Mooyman, P., Bongers, T., Holovachov, O., Bakker, J., Helder, J., 2009. A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences. Nematology 11, 927–950.