Molecular epidemiology and associated risk factors of Anaplasma marginale and Theileria annulata in cattle from North-western Pakistan

Journal Pre-proof Molecular epidemiology and associated risk factors of Anaplasma marginale and Theileria annulata in cattle from North-western Pakistan Jehan Zeb, Sumaira Shams, Israr Ud Din, Sultan Ayaz, Adil Khan, Nasreen Adil, Hamidullah Amin, Munsif Ali Khan, Haytham Senbill

PII:

S0304-4017(20)30024-8

DOI:

https://doi.org/10.1016/j.vetpar.2020.109044

Reference:

VETPAR 109044

To appear in:

Veterinary Parasitology

Received Date:

23 September 2019

Revised Date:

29 January 2020

Accepted Date:

31 January 2020

Please cite this article as: Zeb J, Shams S, Din IU, Ayaz S, Khan A, Adil N, Amin H, Khan MA, Senbill H, Molecular epidemiology and associated risk factors of Anaplasma marginale and Theileria annulata in cattle from North-western Pakistan, Veterinary Parasitology (2020), doi: https://doi.org/10.1016/j.vetpar.2020.109044

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

Molecular epidemiology and associated risk factors of Anaplasma marginale and Theileria annulata in cattle from North-western Pakistan. Jehan Zeba, Sumaira Shamsa, Israr Ud Dinb, Sultan Ayazc, Adil Khana, Nasreen Adila, Hamidullah Aminc, Munsif Ali Khana, Haytham Senbill d,e,* a

Department of Zoology, Abdul Wali Khan University, Mardan-23200, Pakistan.

of

b

Institute of Biotechnology and Genetic Engineering, The University of Agriculture, Peshawar, 25130, Pakistan

ro

c

College of Animal Husbandry & Veterinary Sciences, Abdul Wali Khan University, Mardan, 23200, Pakistan.

-p

d

Department of Entomology, Faculty of Agriculture, Assam Agricultural University, Jorhat, 785013, India. e

lP

Corresponding author.

re

Department of Applied Entomology & Zoology, Faculty of Agriculture, Alexandria University, Alexandria, 21545, Egypt.

ur na

E-mail addresses: [email protected] (Jehan Zeb), [email protected] (Sumaira Shams), [email protected] (Israr Ud Din), [email protected] (Sultan Ayaz), [email protected] (Adil Khan), [email protected]

Jo

(Nasreen Adil), [email protected] (Hamidullah Amin), [email protected] (Munsif Ali Khan), [email protected] (Haytham Senbill).

    

Highlights

30% of cattle positive to T. annulata and 16.3% are positive to A. marginale. Dir Upper district had the highest infection and Chitral district was the lowest. Different determinants are significant for T. annulata, especially acaricides. Breed and acaricides are effective risk factors for A. marginale. Pakistani and other Asian isolates are phylogenetically close.

ABSTRACT Ticks and tick-borne pathogens are one of the major threats to livestock production worldwide. The aim of present study is to specify the molecular epidemiology and its associated risk factors of two well-distributed tick-borne pathogens Anaplasma marginale and Theileria annulata in cattle population from North-western Pakistan. Blood samples were Collected from 60 (32.6%) local breed cattle, 101 (54.9%) from crossbreed, and 24 (13.0%) from exotic breed with total of 184 blood samples. Species-specific PCR assays were performed to detect the presence of A. marginale and T. annulata based on 16S rRNA and 18S rRNA genetic makers respectively. PCR results

of

showed that A. marginale was 16.3% prevalent and T. annulata was 29.9% prevalent in the study area with a total prevalence rate of 46.2 % (85/184) of the tested blood samples. District wise

ro

analysis revealed that both pathogens were highly prevalent in district Dir Upper (13.6%) and least prevalent in district Chitral (10.3%). Univariable analysis of risk factors showed that only breed

-p

and acaricidal treatment were significant determinants (P < 0.05) for A. marginale infection, however, in case of T. annulata infection; breed, age, gender, grazing practice, and acaricidal

re

treatment were potential determinants (P < 0.05). Multivariable analysis specified that breed and acaricidal treatment were considered as significant risk factors for A. marginale infection (P < 0.05)

lP

whereas acaricidal treatment was found to be a significant determinant for T. annulata infection (P < 0.05). Phylogenetic analysis indicated that A. marginale 16S rRNA and T. annulata 18S rRNA isolates showed similarities and shared phylogeny with same isolates reported from Asia. This is

ur na

the first molecular report on the epidemiology and risk factors analysis of A. marginale and T. annulata infections in cattle population from NW Pakistan. Further large scale study is required to investigate molecular, epidemiological and genotypic aspects as well as potential risk factors analysis from the country to facilitate designing strategies to control tick-borne pathogen and

Jo

reduce losses to cattle industry.

Abbreviations: TBDs: Tick-borne diseases; FATA: Federally Administrated Tribal Areas; CI: Confidence interval; OR: Odd ratio; NW: North-west; NJ: Neighborjoining.

Keywords: Anaplasma marginale; Theileria annulata; Cattle, Pakistan; Epidemiology; Ticks & TBDs

INTRODUCTION: Tick-borne diseases (TBDs) are considered to be one of the main threat to the ruminants’ health in both tropical and sub-tropical regions of the world, representing a serious obstacle to livestock farming. It has been reported that TBDs including bovine anaplasmosis and theileriosis result in severe economic losses associated with high mortality rate and decreased production output of livestock industry (Atif et al., 2013; Lew–Tabor et al., 2016). Bovine anaplasmosis was firstly noticed by Sir Arnold Theiler when he had described the etiological agent of this diseases;

of

Anaplasma marginale in the erythrocytes of South African cattle (Theiler, 1910) and same findings were later confirmed by several studies (Uilenberg, 1995; Dumler et al., 2001; Merino et al., 2011).

ro

The major symptoms associated with bovine anaplasmosis are highly variable, ranging from subclinical persistent infections to fatal cases accompanied with a noticeable hemolytic anemia,

-p

abortions, fever, production losses, and mortalities (Kocan et al., 2008). Bovine anaplasmosis resulted from A. marginale is occurring at endemic levels in tropical and sub-tropical areas all over the world (Kocan et al., 2010; Aubry and Geale, 2011). This rickettsial agent is transmitted by ticks

vectors of A. marginale

re

to the host animals and it has been experimentally reported that 20 tick species are the competent (Kocan et al., 2008). In Pakistan R. microplus, R. annulatus and

lP

Hyalomma tick species are the possible reported vectors transmitting A. marginale to cattle and buffalos (Jabbar et al., 2015; Ali et al., 2019; Rehman et al., 2019) but vector competence of these ticks’ species for A. marginale is still remained to be addressed. The etiologic agent of bovine

ur na

anaplasmosis (A. marginale) is reported by a number of studies from different geographic regions of the Pakistan (Sajid et al., 2014; Farooqi et al., 2018). The estimated mean prevalence rate reported across the country in cattle based on traditional diagnostic practice is 13.2 ± 3.7 % (4.3– 60.0 %) (Jabbar et al., 2015; Farooqi et al., 2018). Bovine theileriosis is caused by the members of the genus Theileria, acting as obligatory intercellular parasites and attacking both erythrocytes and

Jo

leukocytes of the hosts by their sporozoites and stage

to

an uncontrolled

proliferative

state,

reversible transformation by the schizont causing

anemia,

fever,

leucopenia,

and

lymphoproliferative disease. Tropical theileriosis (Mediterranean theileriosis) is a result of existence of the causative agent Theileria annulata which infects host monocytes/macrophages and B lymphocytes (Brown, 2008). Tropical theileriosis are widespread in Asia, North Africa, the Middle East, and Southern Europe (Bishop et al., 2009; Bilgic et al., 2010). This pathogen is transmitted by ticks of genus Hyalomma, such as H. anatolicum, H. detritum, H. dromedarii, and H. lusitanicum (Bishop et al., 2009). In Pakistan members of genus Hyalomma have been reported by

several studies acting as main vectors of T. annulata in disease endemic regions (Rehman et al., 2017; Ali et al., 2019; Zeb et al., 2019). Theileriosis in Pakistan is the most investigated TBDs so far confirmed by numerous studies conducted across the country (Jabbar et al., 2015). Estimated mean prevalence rate of theileriosis in cattle is 2.65 ± 0.9 % (0.6–5.0 %) based on conventional diagnosis and molecular studies have reported up to 38.7 ± 9.9 % (19.0-66.1 %) (Jabbar et al., 2015). Although plenty of published literature has established the epidemiology along with significant risk factors analysis of TBDs including bovine anaplasmosis and theileriosis from Pakistan but these findings have some limitations affecting prevalence of TBDs; regarding study design and

of

applicable diagnostic methods; as one are more important parameters were not considered i.e. agroecological zone, bovine population age structure, breed, acaricidal application, and grazing practice

ro

etc. In most findings there is a lack of practice of molecular techniques which ensure accurate genetic and genotypic profile of the tick-borne pathogens (TBPs) (Jabbar et al., 2015; Karim et al.,

-p

2017). There is a paucity of knowledge about the epidemiology of TBPs from NW Pakistan and present endeavor has focused on the prevalence of two important TBPs viz. A. marginale and T.

re

annulata and their associated risk factors analysis to bridge the available epidemiological gape in

Jo

ur na

lP

NW Pakistan.

MATERIALS AND METHODS: Study Area, Host and Blood Sampling: Present study was focused on cattle population from four geographic regions of NW Pakistan viz. Chitral (34.7865° N; 71.5249° E), Dir Lower (34.9161° N; 71.8097° E), Dir Upper (35.3356° N; 72.0468° E), and Malakand (34.5030° N; 71.9046° E) (Fig. 1). The study area represents the subtropical dry mixed deciduous scrub forest and dry sub-tropical temperate semi-evergreen scrub

of

forest (Roberts, 1997) with a temperature range of 15℃–30℃ and an average relative humidity of 65%. All the districts are bordered by Afghanistan (Fig. 1), except district Malakand which lies

ro

closely to district Swat on the eastern side. The study area encompassed four districts and in each district 10 union councils (included villages with at least on livestock farm) were chosen where

-p

cattle farms were available with a sum total of 40 cattle farms composed of 400 cattle ( 10 cattle farms from each district). Among them 12 farms were composed of local Pakistani breed, 17 farms

re

were of cross-breed and 11 farms were of exotic breed cattle. Cattle of the concerned districts were grouped as yearling (≤1 year), young (2-3 years), and Adult (> 3 years), followed by checking for

lP

tick infestations and recording information about the status of acaricides application, grazing practice and cattle breed. A total of 184 (n=184 of N=400 cattle) blood samples were collected from cattle including 142 females and 42 males (who were symptomatically correlated with anaplasmosis

ur na

and theileriosis, additionally they had high tick burden and weak physical health) with respect to their age and gender. Fifty-four blood samples were collected from district Chitral, 41 samples from district Lower Dir, 39 samples from district Upper Dir and 50 samples from district Malakand. Blood samples were properly stored in an anticoagulant EDTA tubes (ThermoscientificTM, USA)

Jo

and preserved at -20℃ until further assessment.

DNA Extraction and PCR based Amplification: DNA was extracted from the preserved blood samples with the help of QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Briefly, 200 μl of blood was

mixed well with 20 μl of Qiagen protease and 200 μl of buffer AL, followed by incubation at 56℃ in water bath. Approximately 200 μl of absolute ethanol was added to the mixture and mixed well, followed by transferring the mixture into QIAamp mini spin column and centrifuged at 6,000 x g for 2 minutes. Five hundred μl of wash buffer AW1 was added, and followed by addition of buffer AW2, and centrifugation at 12,000 x g for 3 minutes. Two hundred μl of elusion buffer was finally added and then centrifuged at 6,000 x g for 1 minute. Purified DNA samples were quantified by NanoDrop™ 1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, USA) based on 260/280 ratios, and deep frozen at - 80℃ for future analysis. Species-specific sets of primers were

of

used to amplify 16S rRNA/18S rRNA fragments of A. marginale/ T. annulata, respectively (de la Fuente et al., 2001; da Silveira et al., 2011) (Table 1). Each aliquot of 1.5 μl template DNA was

ro

added to 12.5 μl of DreamTaq Green PCR Master Mix (2X) (ThermoscientificTM, USA), 1 μl of each primer, and 9 μl of PCR grade water (Top-Bio Prague, Czech Republic) in a total volume of 25

-p

μl of PCR reaction mixture. The thermocycling conditions for 16S rRNA and 18S rRNA were optimized and standard thermocylic parameters for reactions were; an initial heating of 94℃ for 5

re

minutes, followed by 35 cycles of denaturation temperature of 95℃ for 30 seconds, annealing temperature of 60℃ /59℃ for 16S rRNA/ 18S rRNA primers of A. marginale and T. annulata,

lP

respectively for 30 seconds, extension temperature of 72℃ for 30 seconds, and final extension stage of 72℃ for 10 minutes along with inclusion of negative control for each run of thermocycling reaction for validation. All PCR products were confirmed by running amplicons on 1.5% agarose gel

USA).

ur na

stained with 2% ethidium bromide and visualized under UV light (Bio-Rad laboratories, California,

DNA Purification, Sequencing and Analysis: The amplified products were purified with QIAquick PCR Purification Kit (Qiagen) following

Jo

manufacturer standard protocol. Twenty samples (10 from each) of purified PCR products were sent to biotechnology company (Macrogen, Inc., Seoul, South Korea) for unidirectional sequencing of 16S rRNA and 18S rRNA genes of A. marginale and T. annulata. The obtained sequences were then analyzed using NCBI BLASTn. Available relevant library sequences of A. marginale and T. annulata and their closely related species in NCBI database were downloaded and saved for phylogenetic trees construction. The sequences were screened, redundant sequences were removed, trimmed to remove any unnecessary nucleotide, and assembled using MEGA software version 7

(Kumar et al., 2016). Sequences divergence analysis of A. marginale and T. annulata isolates was carried out to check the level of nucleotides substitution among the query and reference sequences. Nucleotide sequences (9 sequences) were deposited to the NCBI GenBank including four 16S rRNA sequences with accession numbers MK680804-MK680807 and five 18S rRNA sequences with accession numbers KM681849-KM681853. Phylogenetic Analysis: All the obtained trimmed sequences were aligned using MEGA v. 7. The molecular phylogenies of A. marginale and T. annulata were established by multi locus analysis of 16S rRNA and 18S rRNA

of

isolates respectively using Neighbor joining method with rapid bootstrapping (1000 replication) in MEGA v. 7.

ro

Statistical Analysis:

-p

All statistical analyses for the present study were carried out using R software version 3.5.1 (R Development Core Team). Univariable and multivariable regression model (Generalized linear model univariable/ Mix multivariable model) were used to determine the statistical

re

significance and association between the pathogen prevalence and other independent variables. A 95% Confidence Interval on the estimated pathogen prevalence was also assessed and P <

lP

0.05 was considered statistically significant. RESULTS:

ur na

Demographic Characteristics of the Host Population: Gender-based sampling included a majority of female cattle 142 (77.2%) in comparison with males 42 (22.8%). Most of the blood sampled cattle were crossbreed 100 (54.9%), followed by indigenous breeds 60 (32.6%), whereas exotic breeds were the least one 24 (13.0%). Out of the total number of

Jo

sampled cattle, 80 (43.5%) were adult cattle, followed by 75 (40.8%) young, and 29 (15.8%) calve cattle respectively. With respect to grazing practice, 33 (17.9%) cattle were free grazing, 82 (44.6%) were semi-grazing and 69 (37.5%) were no grazing. Based on acaricides application analysis, 62 (33.7%) sampled cattle were treated regularly, 49 (26.6%) were treated irregularly and 73 (39.7%) were without acaricidal treatment (Table 2).

Total and Species-wise Prevalence Per study Area: The examined cattle were found infected either with A. marginale or T. annulata from all the sampling sites except 9 cattle that were found co-infected by both pathogens. The overall prevalence was 46.2 % whereas the prevalence rate of A. marginale was 16.3% across the study area and T. annulata was 29.9% (Table 3).

of

District and Species-wise Prevalence: District-wise analysis of prevalence rates of both pathogens showed that their total prevalence was

ro

high in district Dir upper, followed by district Malakand, district Dir Lower, and district Chitral (Table 3). Pathogen-wise prevalence revealed that T. annulata was highly prevalent than A.

-p

marginale in all sampling sites. Highest prevalence rate of T. annulata was observed in district Dir Upper, followed by district Malakand, district Dir Lower, and was least in district Chitral. Likewise, A. marginale was detected highly prevalent in district Dir upper, followed by district Malakand,

re

district Dir lower, and district Chitral (Table 3). A. marginale and T. annulata co-infections (4.9%) were also found in two female cattle (one was exotic breed, free grazing, with no acaricidal

lP

treatment and other was cross breed, free grazing, with no acaricidal application) from district Malakand; one female cattle (cross breed, free grazing, with no acaricidal treatment) from district Dir Upper; five female cattle (All were cross breed, free grazing, one with irregular and four were

ur na

with no acaricidal treatment ) from district Dir Lower and in one male cattle (cross breed, free razing, with no acaricidal use) from district Chitral.

Jo

Prevalence rate with respect to Bovine Different Age Groups, Breed, Gender, Grazing System and Acaricides Application: Different age groups analysis showed that pathogens’ prevalence was high in adult cattle, and lower in the calves. Crossbreed cattle were found highly infected by both pathogens and followed by indigenous breed and exotic breed cattle respectively. Based on grazing system analysis, pathogens prevalence was high in Semi-grazing cattle, in comparison with freely grazing and no grazing cattle. Acaricides treatment revealed that highest prevalence was observed in the cattle with no acaricides application, whereas the lowest was in cattle with regular acaricide treatment. Female cattle were found highly infected by the pathogens as compared to male cattle (Table 4).

Univariable analysis of Rick Factors: Risk factors with significant effects included animal age, gender, breed, grazing system, and acaricides application. Based on univariable analysis of all risk factor, crossbreed cattle were found more likely to be infected more than either indigenous or exotic breed cattle and more likely prone to the infection by A. marginale (2.25 times on average, CI= 0.98-5.21, P< 0.05). However, age, gender and grazing practice were not found statistically significant (p>0.05). Whereas variables that were found statistically significant with respect to their OR, CI and p-values for T. annulata

of

infection were Breed (OR= 0.48 CI=0.33-0.97, P= 0.04), Gender (OR= 0.18 CI= 0.05-0.50, P= 0.02), Age (OR= 0.43 CI= 0.25-0.71, P= 0.001), Grazing practice (OR= 34.74 CI=12.61-144.72, P= 0.001)

ro

and acaricides application (OR= 0.41 CI= 0.26-0.62 P= 0.001) (Table 5).

-p

Multivariable Analysis of Risk Factors:

The potential disease determinants for A. marginale infection, identified and found significant (p< 0.05) in this study based on multivariable regression analysis were breed and acaricides treatment

re

with OR of 6.51 and 0.47 whereas in case of T. annulata infection only grazing system with OR of

lP

50 (p< 0.05) (Table 6). Sequencing and Phylogenetic Analysis:

Sequencing of amplified products of the genetic markers of both the pathogens showed that 16S

ur na

rRNA partial amplicons of A. marginale and 18S rRNA partial amplicon of T. annulata were 620 bp and 346 bp respectively. Online BLAST analysis of A. marginale 16S rRNA gene partial nucleotide sequences shared 99.51% similarities with the same published sequences from China (KX987330), Japan (FJ226454), Thailand (KT264188) and Australia (AF414874) while online BLAST analysis of 18S rRNA partial gene sequences of T. annulata showed 100% similarities with the same

Jo

sequences reported from Pakistan (JQ743633, MG599093), India (MK849885, MF287952, MF287945), China (MG599086), Iran (KF429800, HM628582), Iraq (MK737519) and Turkey (MG569892, KU714607). Neighbor-joining trees were inferred from the 16S rRNA and 18S rRNA partial sequences of A. marginale and T. annulata for the establishment of their phylogenies from NW Pakistan. Neighbor-joining analysis revealed that A. marginale isolates from study area were clustered together with same isolates from Asian countries (China, Japan, Philippines and Thailand) and Australia with nodal support of 63(Fig. 2). A. marginale isolates formed a separate subgroup on

the same branch with 72 nodal support, placing a possibility of genetic variability of A. marginale samples from different districts of NW Pakistan (Fig. 2). However sequence nucleotide analysis and genetic divergence of both pathogens’ isolates have not supported such results (Fig. 4 & Fig. 5). Similarly, NJ tree of T. annulata indicated that all of the sequences from study area were grouped on the same branch with identical species reported from Asia (China, India, Iran, Iraq and Tajikistan) and Europe (Spain and Turkey) with 57 nodal support (Fig. 3). DISCUSSION:

of

According to the estimates of Food and Agriculture Organization, approximately 50% of animal production losses in developing countries is due to the fatality and adverse effects resulting from

ro

TBPs and their associated diseases, particularly anaplasmosis and theileriosis (Jonsson et al., 2008; Akhter et al., 2010). The incidence of TBDs had confirmed by a number of studies from eastern and

-p

southern parts of the country (Jabbar et al., 2015; Karim et al., 2017; Rehman et al., 2019). The present study provides first insight into the epidemiology, phylogeny, and risk factors analysis of bovine anaplasmosis and theileriosis from NW Pakistan. This work has confirmed the etiologic

re

agents of bovine anaplasmosis and theileriosis in cattle population from NW Pakistan. These results are parallel with the findings previously published on tick-borne pathogens from other parts of the

lP

Pakistan and elsewhere (Liu et al., 2005; Durrani et al., 2008; Bhuttu et al., 2014; Kundave et al., 2014; Ola–Fadunsin et al., 2018). The overall prevalence of both TBPs was 46.2% in cattle population. A. marginale was 16.3% prevalent in cattle population from the study area and was in

ur na

accordance with the expected value range (9-22%) for endemic regions (Jabbar et al., 2015). Similar results (18.33%) were reported by Farooqi et al., (2018) from other districts of Pakistan and elsewhere by Rajput et al., (2005). However T. annulata prevalence rate was 29.9% and consistent with reports ranging T. annulata prevalence between 19-66.1% from other parts of the country (Durrani et al., 2008; Khattak et al., 2012; Khan et al., 2013). Co-infections of A. marginale and T.

Jo

annulata were also found and was 4.9 % in host population. No evident information is available suggesting co-infections of aforementioned pathogens in cattle from Pakistan however our results support similar findings published from Russia (Bursakov et al., 2019). Bovine anaplasmosis and theileriosis endemicity to NW Pakistan was further supported by the availability of their vectors in the endemic region (Ali et al., 2019; Zeb et al., 2019). District based and species-wise prevalence analysis revealed significantly high prevalence rate of T. annulata than A. marginale. These findings were linked to high prevalence of H. anatolicum in comparison to R. microplus in arid ecological

zones respectively, transmitting T. annulata preferably than A. marginale to bovine population (Rehman et al., 2017; Zeb et al., 2019). Prevalence rate was evaluated to find out relationship among various risk determinants and pathogens’ incidence. Univariable regression analysis of risk factors for A. marginale infection showed that only cross-breed cattle with no acaricides treatment were highly infected whereas multivariate analysis revealed cattle breed and acaricides treatment as potential risk factors for bovine anaplasmosis. All these results are in accordance with literature reported from south-eastern parts of Pakistan (Sajid et al., 2014; Farooqi et al., 2018). In case of T. annulata infection univariabe analysis showed that prevalence rate was higher in cross-breed,

of

females, young, free grazing with no acaricides treatment cattle while multivariate analysis supported only freely grazing practice to be significant risk factor for pathogen’s incidence. Our

ro

findings corroborates reported studies elsewhere (Jabbar et al., 2015; Moumouni et al., 2017). The molecular phylogenies of A. marginale and T. annulata were successfully presented from NW

-p

Pakistan. Genetic marker 16S rRNA amplification has successfully identified and established the molecular phylogeny A. marginale from study area. The sequences obtained during present work

re

shared 99.50% identity with each other and also with published isolates across the globe present in NCBI GenBank. NJ-Phylogenetic tree revealed that A. marginale prevalent in cattle from NW

lP

Pakistan grouped together with similar isolates published from Asia and Australia (Fig. 3). These discoveries are in agreement with published data focused on molecular Phylogeny of A. marginale based on 16S rRNA genetic marker from Pakistan and Turkey (Farooqi et al., 2018; Rehman et al.,

ur na

2019; Zhou et al., 2016). T. annulata 18S rRNA query sequences shared 100% similarities with each other and with available isolates in GenBank and clustered in NJ tree with isolates notably from Asia and certain part of Europe (Fig. 2). These findings support literature that has cloned and sequenced successfully 18S rRNA gene of T. annulata as preferred method for identification and presented its molecular phylogeny from other agro-ecological zones of Pakistan (Khan et al., 2013;

Jo

Hassan et al., 2018).

Conclusion: The present work had established for the first time the molecular phylogenies of two well-known TBPs circulating in bovine population of NW Pakistan. Both pathogens shared phylogenies with similar isolates reported from Asia, Australia and certain parts of Europe. Additionally molecular epidemiology of these pathogens revealed that their prevalence rates appeared with in the expected range for endemic regions. Risk factor analysis showed that cattle breed, age, gender and acaricides treatment were potential determinants for pathogens’ infection. This study provides baseline for forthcoming research

and will help to design effective control strategies to minimize or eradicate TBDs in order to enhance the production of livestock farming in Pakistan.

Conflict of interest statement: The authors declare that they have no competing conflict of interest. Author Contributions: JZ designed the research and SA acquired the budget. JZ, SA, SS, MAK, AK, NA, HA and ID helped

of

in samples collection. JZ conducted the experiments. JZ performed statistical analysis and drafted the manuscript. JZ, MAK and HS revised the manuscript. All authors read and approved the final

ro

manuscript.

-p

Declaration of interests

Acknowledgments:

lP

re

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

ur na

We acknowledge Higher Education Commission of Pakistan for funding support for the study. The

Jo

funding agency had no role in study design, samples collection, data analysis and interpretation.

References:

Ali, A., Khan, M.A., Zahid, H., Yaseen, P.M., Qayash Khan, M., Nawab, J., Ur Rehman, Z., Ateeq, M., Khan, S., Ibrahim, M., 2019. Seasonal dynamics, record of ticks infesting humans, wild and domestic animals and molecular phylogeny of Rhipicephalus microplus in Khyber Pakhtunkhwa Pakistan. Front. Physiol. 10, 793-808. https://doi.org/10.3389/fphys.2019.00793.

Akhter, N., Chamon, L., Gadahi, J.A., Mirbahar, K.B., Memon, M.I., 2010. Efficacy of various antiprotozoal drugs on bovine babesiosis, anaplasmosis and thileriosis. Vet. World. 3 (10), 272–274. Aubry, P., Geale, D.W., 2011. A review of bovine anaplasmosis. Transbound. Emerg. Dis. 58, 1–30. https://doi.org/10.1111/j.1865-1682.2010.01173.x Bhutta, M.S., Siddique, R.M., Khan, S.A., Iqbal, Z., and Khan, M.N., 2014. Prevalence and risk factors of anaplasmosis in cattle and buffalo populations of district Khanewal, Punjab, Pakistan. Glob. Vet. 12(1), 146–153.

ro

of

Bilgic, H.B., Karagenç, T., Shiels, B., Tait, A., Eren, H., Weir, W., 2010. Evaluation of cytochrome b as a sensitive target for PCR based detection of T. annulata carrier animals. Vet. Parasitol. 174(3– 4), 341–347. https://doi.org/10.1016/j.vetpar.2010.08.025

-p

Bishop, R.P., Odongo, D.O., Mann, D.J., Pearson, T.W., Sugimoto, C., Haines, L.R., Glass, E., Jensen, K., Seitzer, U., Ahmed, J.S., Graham, S.P., De Villiers, E.P., 2009. Theileria. In: Nene, V., Kole, C. (Eds.), Genome Mapping and Genomics in Animal–Associated Microbes. Springer–Verlag Berlin Heidelberg, Berlin, pp. 191–231.

re

Brown, C., 2008. Tropical theileriosis. In: Brown, C., and Torres, A. (Eds.), Foreign Animal Diseases, 7th ed. Boca Publications, Florida, USA, pp. 401–404.

lP

Bursakov, S. A., & Kovalchuk, S. N., 2019. Co-infection with tick-borne disease agents in cattle in Russia. Ticks tick-borne dis. 10(3), 709-713.

ur na

da Silveira, J.A.G., Rabelo, É.M.L., Ribeiro, M.F.B., 2011. Detection of Theileria and Babesia in brown brocket deer (Mazama gouazoubira) and marsh deer (Blastocerus dichotomus) in the state of Minas Gerais, Brazil. Vet. Parasitol. 177, 61–66. https://doi.org/10.1016/j.vetpar.2010.10.044 de La Fuente, J., Van den Bussche, R., Kocan, K.M., 2001. Molecular phylogeny and biogeography of North American isolates of Anaplasma marginale (Rickettsiaceae: Ehrlichieae). Vet. Parasitol. 97, 65–76. https://doi.org/10.1016/S0304-4017(01)00378-8

Jo

Dumler , J.S., Barbet, A.F., Bekker, C.P., Dasch, G.A., Palmer, G.H., Ray, S.C., Rikihisa, Y.,Rurangirwa, F.R., 2001. Reorganization of genera

in

the

families

Rickettsiaceae

and

Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia

phagocytophila.

Int.

J.

https://doi.org/10.1099/00207713-51-6-2145

Syst.

Evol.

Microbiol.

51(6),

2145–2165.

Durrani, A.Z., Ahmad, M., Ashraf, M., Khan, M.S, Khan JA, Kamal N, Mumtaz, N., 2008. Prevalence of theileriosis in buffaloes and detection through blood smear examination and polymerase chain reaction test in district Lahore. J. Anim. Plant. Sci. 18, 59–62. Farooqi, S.H., Ijaz, M., Rashid, M.I., Nabi, H., Islam, S., Aqib, A.I., Hussain, K., Khan, A., Rizvi, S.N.B., Mahmood, S., Mehmood, K., Zhang, H., 2018. Molecular epidemiology of bovine anaplasmosis in Khyber Pakhtunkhwa, Pakistan. Trop. Anim. Health Prod. 50, 1591–1598. https://doi.org/10.1007/s11250-018-1599-2

of

Hassan, M.A., Liu, J., Rashid, M., Iqbal, N., Guan, G., Yin, H., and Luo, J., 2018. Molecular survey of piroplasma species from selected areas of China and Pakistan. Parasit. Vectors. 11, 457. https://doi.org/10.1186/s13071-018-3035-x

ro

Jabbar, A., Abbas, T., Sandhu, Z.U., Saddiqi, H.A., Qamar, M.F., Gasser, R.B., 2015. Tick–borne diseases of bovines in Pakistan: major scope for future research and improved control. Parasit. Vectors. 8(1), 283. https://doi.org/10.1186/s13071-015-0894-2

re

-p

Jonsson, N.N., Bock, R.E., Jorgensen, W.K., 2008. Productivity and health effects of anaplasmosis and babesiosis on Bos indicus cattle and their crosses, and the effects of differing intensity of tick control in Australia. Vet. Parasitol. 155, 1–9. https://doi.org/10.1016/j.vetpar.2008.03.022 Khan, M.K., He, L., Hussain, A., Azam, S., Zhang, W.J., Wang, L.X., Zhang, Q.L., Hu, M., Zhou, Y.Q., Zhao, J. 2013. Molecular epidemiology of Theileria annulata and identification of 18S rRNA

Infect. Genet. Evol. 13, 124–32.

lP

gene and ITS regions sequences variants in apparently healthy buffaloes and cattle in Pakistan.

ur na

Khattak, R.M., Rabib, M., Khan, Z., Ishaq, M., Hameed, H., Taqddus, A, et al. 2012. A comparison of two different techniques for the detection of blood parasite, Theileria annulata, in cattle from two districts in Khyber Pukhtoonkhwa province (Pakistan). Parasite. 19, 91–5.

Jo

Kocan, K.M., de la Fuente, J., and Blouin, E. F., 2008. Characterization of the tick–pathogen–host interface of the tick–borne rickettsia Anaplasma marginale. In: Bowman, A.S., Nuttall, P.A. (Eds.), Ticks: Biology, Diseases and Control. Cambridge Univesity Press, Cambridge, UK, pp.325–343. Kocan, K.M., de la Fuente, J., Blouin, E.F., Coetzee, J.F., Ewing, S.A., 2010. The natural history of Anaplasma marginale. Vet. Parasitol. 167, 95–107. https://doi.org/10.1016/j.vetpar.2009.09.012

Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Boil. Evol. 33(7), 870-1874.

Kundave, V.R., Patel, A.K., Patel, P.V., Hasnani, J.J., Joshi, C.G., 2014. Qualitative and quantitative assessment of Theileria annulata in cattle and buffaloes by Polymerase chain reaction. Trop. Biomed. 31(4), 728–735. Lew–Tabor, A.E., Rodriguez–Valle, M., 2016. A review of reverse vaccinology approaches for the development of vaccines against ticks and tick-borne diseases. Ticks Tick-Borne Dis. 7, 573–585. https://doi.org/10.1016/j.ttbdis.2015.12.012

of

Liu, Z., Luo, J., Bai, Q., Ma, M., Guan, G., Yin, H., 2005. Amplification of 16S rRNA genes of Anaplasma species in China for phylogenetic analysis. Vet. Microbiol. 107(1–2), 145–148. https://doi.org/10.1016/j.vetmic.2005.01.007

-p

ro

Merino, O., Almazán, C., Canales, M., Villar, M., Moreno–Cid, J.A., Galindo, R.C., de la Fuente, J., 2011. Targeting the tick protective antigen subolesin reduces vector infestations and pathogen infection by Anaplasma marginale and Babesia bigemina. Vaccine. 29(47), 8575–8579. https://doi.org/10.1016/j.vaccine.2011.09.023 Moumouni, P.F.A., Aplogan, G.L., Katahira, H., Gao, Y., Guo, H., Efstratiou, A., Jirapattharasate,

re

C., Wang, G., Liu, M., Ringo, A.E., Umemiya-Shirafuji, R., 2018. Prevalence, risk factors, and genetic diversity of veterinary important tick-borne pathogens in cattle from Rhipicephalus

lP

microplus-invaded and non-invaded areas of Benin. Ticks tick-borne dis. 9(3), 450-464.

ur na

Ola–Fadunsin, S.D., Gimba, F.I., Abdullah, D.A., Sharma, R.S.K., Abdullah, F.J.F., Sani, R.A., 2018. Epidemiology and risk factors associated with Anaplasma marginale infection of cattle in Peninsular Malaysia. Parasitol. Int. 67, 659–665. https://doi.org/10.1016/j.parint.2018.06.013 Rehman, A., Conraths, F.J., Sauter‐Louis, C., Krücken, J. and Nijhof, A.M., 2019. Epidemiology of tick‐borne pathogens in the semi‐arid and the arid agro‐ecological zones of Punjab province,

Jo

Pakistan. Transbound. Emerg. dis. 66(1), 526-536. Roberts, T.J., 1997. The Mammals of Pakistan: Oxford University Press, Karachi, Pakistan, pp. 525. Sajid, M.S., Siddique, R.M., Khan, S.A., Zafar, I., Khan, M.N., 2014. Prevalence and risk factors of anaplasmosis in cattle and buffalo populations of district Khanewal, Punjab, Pakistan. Glob. Vet. 12(1), 146-153. Theiler, A., 1910. Anaplasma marginale (gen. and spec. nov.). The marginal points in the blood of cattle suffering from a specific disease. In: Theiler, A. (Ed.), Report of the government on veterinary bacteriology in transvaal. Department of Agriculture, South Africa, 1908–1909, 7–64.

Uilenberg, G., 1995. International collaborative research: significance of tick–borne hemoparasitic diseases to world animal health. Vet. Parasitol. 57, 19–41. https://doi.org/10.1016/03044017(94)03107-8 Zeb, J., Szekeres, S., Takács, N., Kontschán, J., Shams, S., Ayaz, S., Hornok, S., 2019. Genetic diversity, piroplasms and trypanosomes in Rhipicephalus microplus and Hyalomma anatolicum collected from cattle in northern Pakistan. Exp. Appl. Acarol. 79(2), 233-243.

of

Zhou, M., Cao, S., Sevinc, F., Sevinc, M., Ceylan, O., Moumouni, P.F.A., Jirapattharasate, C., Liu, M., Wang, G., Iguchi, A., Vudriko, P., Suzuki, H., Xuan, X., 2016. Molecular detection and

ro

genetiidentification of Babesia bigemina, Theileria annulata, Theileria orientalis and Anaplasma marginale in Turkey. Ticks Tick-borne Dis. 7(1), 126-134.

Jo

ur na

lP

re

-p

https://doi.org/10.1016/j.ttbdis.2015.09.008

Table Table 1. Species-specific primer sets designed for the detection of A. marginale and T. annulata. Primer sequence (5ʹ-3ʹ)

Name

Target

A. marginale

CTGGAACTGAGACACGGTCC

16AnamF

16S rRNA

Amplicon size 611 bp

T. annulata

CAACACAGAGGCAAAAGCCC ATACCCTGGTAGTCCACGT

16AnamR 18TheaF

18S rRNA

345 bp

GCAGTGTGTACAGACCCGA

18TheaR

Jo

ur na

lP

re

-p

ro

of

Specificity

Table Table 2. Demographic properties of the cattle population from NW Pakistan.

Grazing system

Dir (U)

Chitral

Total

Calf

15 (27.7%)

4 (8.0%)

7 (17.0%)

3 (7.7%)

29 (15.7%)

Young

19 (35.2%)

17 (58.0%) 19 (46.3%) 20 (51.8%) 75 (40.8%)

Adult

20 (37.0%)

29 (34.0%) 15 (36.5%) 16 (41.0%) 80 (43.5%)

Male

12 (22.3%)

10 (20.0%) 9 (21.9%)

Female

42 (77.7%)

40 (80.0%) 32 (78.1%) 28 (71.8%) 142 (78.0%)

Indigenous

17 (31.5%)

20 (40.0%) 12 (29.3%) 11 (28.2%) 60 (32.6%)

Cross

29 (53.7%)

20 (40.0%) 26 (63.4%) 26 (66.7%) 101 (54.9%)

Exotic

8 (14.8%)

10 (20.0%)

4 (7.3%)

Free

11 (22.3%)

7 (14.0%)

7 (17.1%)

Semi

26 (48.1%)

20 (40.0%) 19 (46.3%) 17 (43.6%) 82 (44.5%)

Zero

17 (31.5%)

22 (44.0%) 15 (36.6%) 15 (38.5%) 69 (37.5%)

19 (35.2%)

17 (34.0%) 17 (41.5%)

9 (23.1%)

62 (33.7%)

11 (20.4%)

18 (36.0%) 15 (36.5%)

5 (12.8%)

49 (26.6%)

24 (44.4%)

6 (12.0%)

Regular Acaricides application Irregular

Jo

of

ur na

No Use

11 (28.2%) 42 (22.0%)

ro

Breed

Dir (L)

2 (5.1%)

24 (13.0%)

8 (20.5%)

33 (18.0%)

-p

Gender

Malakand

re

Age

Categories

18 (43.9%) 25 (64.1%) 73 (39.7%)

lP

Variables

Table Table 3: Total, district-wise and species-wise Prevalence rates of A. marginale and T. annulata.

A. marginale (%) 3.4 3.8 5.1 4.0 16.3

Total Prevalence (%)

T. annulata (%) 6.6 6.9 8.5 7.9 29.9

10.3 10.7 13.6 11.9 46.2

Jo

ur na

lP

re

-p

ro

Chitral Dir Lower Dir Upper Malakand Total Prevalence

Tick-borne Pathogens Prevalence (Species-wise)

of

Study Area (Districts)

Table Table 4: Prevalence rates with respect to bovine different age groups, breed, gender, grazing system and acaricides application.

Category

Variables

Positive No

OR (CI 95%)

P-Value

no (%)

20 (10.8) 27 (14.7) 25 (13.6) 27(14.7) 3 (1.6) 14 (7.6) 16 (8.7)

No Use

25 (13.6)

Grazing

Free

31 (16.8)

practice

Semi

Acaricides application

Jo

ur na

Zero

lP

Breed

32 (17.4) 12 (6.5)

0.1

of

Young Adult Indigenous Cross Exotic Regular Irregular

Age

2.71(0.82-9.21) 0.50(0.27-0.88)

ro

11 (5.8) 64 (34.8) 8 (4.3)

11.29 (2.24-81.07)

0.02

0.006

0.45(0.26-0.75)

0.003

8.78 (4.05-22.07)

0.001

re

Male Female Calves

-p

Gender

of ro

2.25 (0.98-5.21)

P value T. annulata %(n) 26.3 (15) 0.05 64.9 (37) 94.1(2) 8.0 (4) 0.17 27.2 (50) 17.2 (5) 0.19 50.0 (39) 12.9 (10) 68.9 (31) 0.17 28.9 (23) 0.0 (0) 15.0 (12) 0.03 9.3 (5) 74.0 (37)

re

OR (95% CI)

lP

A. marginale %(n) 5.3 (3) 7.6 (16) 2.0 (1) 6.0 (3) 12.7 (17) 17.2 (5) 16.7 (13) 2.5 (2) 24.4 (11) 2.5 (2) 11.3 (7) 12.5 (10) 3.7 (2) 16.0 (8)

1.28 (0.84-2.49) 0.68 (0.37-1.19)

ur na

Categories Indigenous Cross Exotic Male Gender Female Calf Age Young Adult Free Grazing system Semi Zero Acaricides Regular application Irregular No Use

-p

Table 5: Univariable analysis of the possible risk factors of A. marginale and T. annulata infections.

Jo

Variables Breed

Table

1.47 (0.82-2.49)

0.58 (0.35-0.94)

OR (95% CI)

P Value

0.48 (0.33-0.97)

0.048

0.18 (0.05-0.50)

0.002

0.43 (0.25-0.71)

0.001

34.74 (12.61-144.72)

0.001

0.41 (0.26-0.62)

0.001

Table Table 6: Multivariable analysis of the possible risk factors of A. marginale and T.

Indigenous

Calf Young Adult

Age

Grazing System Acaricides application

T. annulata OR (95% CI)

P Value

6.51 (1.34-50.76)

0.03

8.69 (0.56-189.2)

0.13

1.87 (0.77-9.01)

0.11

1.18 (0.16-7.29)

0.85

0.08

0.09

0.52 (0.23-1.04)

Free Semi Zero Regular Irregular

0.47 (0.23-0.87)

Jo

ur na

No Use

1.56 (0.66-3.69)

0.3

lP

Gender

Cross Exotic Male Female

P Value

of

Breed

A. marginale OR (95% CI)

ro

Categories

0.56 (0.28-1.07)

re

Variables

-p

annulata infections.

0.02

50.49 (14.38-328.42)

0.001

0.54 (0.28-1.01)

0.06

ur na

lP

re

-p

ro

of

Figure

Jo

Fig. 1: Map showing geographic location of study area (NW Pakistan) and sampled cattle farms.

ur

na

lP

re

-p

ro of

Figure

Jo

Fig. 2: NJ phylogenetic analysis inferred from 16S rRNA partial sequences of genus Anaplasma isolates. Species name followed by GenBank accession no and location. Samples sequenced from study area were shown bold. Bootstrap values were shown at each node. Scale bar indicates 0.010 substitution per site.

ur

na

lP

re

-p

ro of

Figure

Jo

Fig. 3: NJ phylogenetic analysis inferred from 18S rRNA partial sequences of genus Theileria isolates. Species name followed by GenBank accession no and location. Samples sequenced from study area were shown bold. Bootstrapping values were shown at each node. Scale bar indicates 0.050 substitution per site.

of

Figure

ur na

lP

re

-p

ro

Fig 4: Genetic Divergence analysis of A. marginale isolates from NW Pakistan.

Jo

Fig 5: Genetic Divergence analysis of T. annulata isolates from NW Pakistan.