Molecular epidemiology of respiratory syncytial virus: rapid identification of subgroup A lineages

291

Journal of Virological Methods, 40 (1992) 297-306 0 1992 Elsevier Science Publishers B.V. / All rights reserved / 0166-0934/92/$05.00 VIRMET

01420

Molecular epidemiology of respiratory syncytial virus: rapid identification of subgroup A lineages P.A. Cane and C.R. Pringle Department of Biological Sciences, University of Warwick, Coventry (UK) (Accepted

17 July 1992)

Summary Methods for the rapid analysis of samples of respiratory syncytial (RS) virus are described using the polymerase chain reaction (PCR) followed by restriction mapping. Isolates (either clinical samples or tissue culture grown virus) can readily be divided into subgroups and then further classified into lineages. These methods enable examination of large numbers of isolates by molecular techniques, thereby facilitating research into the molecular epidemiology of the virus. RS virus; Classification; Restriction mapping; G gene

Introduction Respiratory syncytial (RS) virus is the major cause of lower respiratory tract infection in infants. Annual epidemics occur which in temperate climates usually peak during the winter months, placing considerable pressure on the provision of paediatric hospital beds. Two subgroups, A and B, of RS virus exist: these were originally defined serologically (Anderson et al., 1985; Mufson et al., 1985; Gimenez et al., 1986), and later shown to be distinct at the nucleotide sequence level (Johnson et al., 1987; Johnson and Collins, 1989; Cane and Pringle, 1991). We have previously shown that isolates of subgroups A and B of RS virus can be further subdivided into distinct groupings or lineages on the basis of three criteria: restriction mapping of part of the Correspondence ro: P.A. Cane, Department CV4

7AL, UK. Fax: (44) (203) 523568.

of Biological

Sciences,

University

of Warwick,

Coventry

298

nucleocapsid (N) gene, nucleotide sequencing of part of the small hydrophobic (SH) gene (Cane and Pringle, 1991) and nucleotide sequencing of the attachment (G) protein gene (Cane et al., 1991). The deduced amino acid sequence of the G proteins of isolates from the various subgroup A lineages differed by up to 20% with the variability being concentrated in a central and the C-terminal regions of the protein. These lineages appear to be distributed worldwide (Cane et al., 1992) but as yet their significance in terms of degree of virulence and immunity at the individual and community level has not been determined. We now describe methods for the rapid classification of RS viruses of subgroup A into these various lineages: such methods allow the speedy analysis of large numbers of samples without the necessity of nucleotide sequencing.

Materials and Methods Viruses Virus isolates examined in this study are listed in Table 1 and have mostly been detailed before (Cane and Pringle, 1991; Cane et al., 1992). Strain numbers prefixed RSB originate from Birmingham, UK; RSN from Newcastle, UK; RSL from Liverpool, UK; RSH from Hannover, Germany; RSF from Turku, Finland; RSM from Kuala Lumpur, Malaysia; RSU from Montevideo, Uruguay. RNA extraction Jiom clinical specimens All small-scale RNA extractions were carried out in IS-ml microfuge tubes without any attempt at separating RNA from DNA, using an adaptation of the method of Kumar and Lindberg (1972). Nasopharyngeal aspirate samples were centrifuged in a microfuge for 2 min. The cell pellet was resuspended in 0.5 ml of 3.5 M urea, 200 mM NaCl, 10 mM Tris-HCl pH 7.8,5 mM EDTA, 0.75 mM MgC12, 0.5% SDS and 0.35% NP40. 0.5 ml of phenol-chloroform (1:l) (equilibrated with 150 mM NaCl, 10 mM Tris-HCl pH 7.8, 1 mM EDTA) was added, the mixture vortexed for about 5 s and then centrifuged for 10 min. The aqueous layer was extracted again with phenol-chloroform and then added to 1 ml of ethanol; the nucleic acids were precipitated at - 20°C for 2-20 h, pelleted, washed with 0.5 ml 70% ethanol, vacuum-dried and resuspended directly into 30 ,nl reverse transcriptase mix (see below). RNA extraction from tissue cultures Virus isolates were cultured in MRC-5 cells in plastic flasks (Costar) with a surface area of 25 cm2, containing 5 ml of culture medium (GMEM with glutamine, penicillin, streptomycin, and 5% foetal calf serum). When extensive

299

cpe was present, the cells were detached into the tissue culture medium by shaking with sterile glass beads, and the suspension aliquotted and stored at - 70°C. Approximately 0.5 ml of these infected cell suspensions were extracted The resulting nucleic acids were as for the nasopharyngeal aspirates. resuspended in 20 ~1 Hz0 and 3 ~1 used for each cDNA synthesis. cDNA synthesis cDNA reactions were done in a volume of 30 ~1. The primer used was S(GGCCCGGGAAGC)TTTTTTTTTTTTTTT3 which, as previously described, primes on polyadenylated mRNA (Cane et al., 1991). 0.15 ,ug of primer, 10 U AMV reverse transcriptase (Life Sciences), 1 mM each dNTP (Pharmacia) together with buffer supplied with the enzyme were used in each reaction. Reactions were incubated at 41°C for 30 min. Polymerase

chain reaction (PCR)

PCRs were carried out in loo-p1 volumes. Primers used for the N gene were as previously 199 l), namely:

described (Cane and Pringle,

Nl S’GGAACAAGTTGTTGAGGTTTATGAATATGC3’ N2 S’CTTCTGCTGTCAAGTCTAGTACACTGTAGT3’ These primers amplify a fragment of the N gene between nucleotides 858-l 135 (Collins et al., 1985). G gene primers: Gl S’(GGATCCC)GGGGCAAATGCAAACATGTCC3’: this corresponds to nucleotides 1-21 of the G gene (Wertz et al., 1985). Parentheses indicate linkers. G2 S’GGTATTCTTTTGCAGATAGC3’: this is complementary to nucleotides 584565 of the G gene (Wertz et al., 1985) a region of the gene which has been shown to be highly conserved between subgroup A isolates (Cane et al., 1991). The region amplified by these primers includes the most variable part of the G gene (Cane et al., 1991). Each PCR included 0.4 pg of each primer, 250 mM each dNTP, 1.5 mM MgC12, 2 U Taq polymerase (Promega), and buffer as supplied with the enzyme. 2-5 ~1 of cDNA were added to each reaction. Each reaction was cycled 30 times at 94°C for 45 s, 54°C for 45 s, 74°C for 45 s using a Hybaid TR2 thermal reactor. Analysis oj’ PCR products 10 ~1 of each PCR product was analysed initially by electrophoresis on 2% agarose gels with Tris-borate buffer. The rest of the product was diluted with 100 ~1 H20, extracted with 150 ~1 phenol-chloroform and ethanol precipitated.

300

N gene analysis. PCR products were digested with HindIII, Pstl, HaeIII, and RsaI as previously described (Cane and Pringle, 1991).

BgflI,

G gene analysis. PCR products were digested with AluI, TaqI, M&I, (GibcoBRL) and MseI (New England Biolabs), using buffers supplied by the manufacturers. These enzymes were selected with reference to the G gene nucleotide sequences previously determined (Cane et al., 1991). Restricted PCR products were analysed on 2% agarose gels stained with ethidium bromide. DNA size standards were a 1 kb ladder (Gibco-BRL).

Results Eighty-six isolates of RS virus were examined by amplification of parts of their N and G genes followed by restriction mapping of the PCR products. These RS virus strains were isolated during the period 1988-1992, and included isolates from the UK, Germany, Malaysia and Uruguay. PCRs The methods described here allowed rapid extraction of RNA suitable for cDNA synthesis followed by PCR amplification from either small volumes of tissue culture lysates or from nasopharyngeal aspirates. In our hands, success with nasopharyngeal aspirates was more variable than with tissue culture samples, so unless time was a critical factor in terms of rapid diagnosis, the latter method would be our preferred choice. Where isolates were examined by N and G gene restriction mapping, either from the original aspirates or the derived cultured virus, identical results were obtained. N gene restriction patterns These have been described before: briefly, human RS virus isolates can be divided into 6 groups, designated NPl-NP6, according to their restriction patterns. NPl (Hind111 -, PstI -, BgnI -, Hue111 -, RsaI +), NP3 (Hind111 - PstI -, BgOI + , Hue111 -, RsaI +) and NP6 (Hind111 -, PstI -, BgAI + 1 HaeII12 +, RsaI +) patterns are given by subgroup B isolates, while NP2 (Hind111 -, PstI -, BgflI -, HaeTIIl + , RsaI +), NP4 (Hind111 -, PstI -, BgflI + , Hue1111 + , RsaI +) and NP5 (Hind111 + , PstI -, BgflI + , HaeIIIi + , RsaI +) are given by subgroup A isolates. Two additional patterns have been defined for other pneumoviruses; namely, NP7 for two strains of bovine RS virus and NP8 for pneumonia virus of mice (strain 15) (Cane and Pringle, 1991). The pattern observed for each strain examined in this report is shown in Table 1.

301 TABLE 1 G gene restriction Virus isolate

patterns for subgroup NP grouping

A isolates SHL grouping’

G gene restriction Ah1

RSB89-5857 RSB89-6256 RSB89-6614 RSB89-1202 RSL459 RSL5346 RSHI RSH3 RSB91-8927+52 RSB91-2290 RSB9 I-2326 RSB91-7091 RSB91-8382 RSB89-6190 RSB89-6598 RSM99302 RSF23669 RSB90-8336 + 4 RSB91-8135+23 RSN864 RSN1642 RSH6 RSU0051 RSL495 RSB92-0170 RSH5 RSB90-8 106 RSB9 l-7978 + 10 RSB91-191 RSB91-8100+3 RSB91-48 RSU47 I RSM92186 RSF13366 RSF768 RSM9940 I RSB89-1734 RSH4 RSF14570 RSU0037 RSB89-642

2 2 2 2 2 2 2 2 2 2 2

;

3 4 3 3 3 3 ND3 ND

4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4

ND 2 2 2 ND 2 24 2 ND 2 2 ND ND 2 6 65 ND ND 6 6 6 6 6 6

5

5 ND

A A A A A A A A A A A A A A 2 B B B B B ; A A E D D c” D

‘Nearest match; 25 other strains from same epidemic; 3not determined; strains only examined.

pattern

Taql

MboI

A A A

A” A

; A A A A A A A A B B B B B B B B B B B B B

2 A A A A C C E E :

AA

: B B B B B B H B B B B B B F

;

:

a:

!z

: A A A A

B” B

2 A

! G

Msel

E E E E E E E E E E E E E B B B B B B B B B B B C E A A D A” : E D : E E E G

41 strain only examined; 52

G gene restriction patterns The primers used here allow amplification of 584 bp from the 5’ end of the mRNA’s derived from the G gene of subgroup A RS virus isolates only. The total fragment size is 591 bp due to the 7 nucleotide linker on primer Gl. Considerable variability was observed in the restriction patterns obtained from

302

r-

Ib

Taq

t

Fig. I. Diagrammatic representation of restriction patterns given by PCR products derived from G gene mKNA’s between nucleotides I and 584. Actual size of undigested fragment is 591 bp due to seven nucleotide linkers attached to one primer (see text). Panel la shows patterns given by AM digestion, 1b by Tuql digestion, lc by Mbot digestion, Id by MSPI digestion. Where fragment sizes are given. these are deduced from known sequences. or by ~oll~igratjon with fragments of known sequence; otherwise approximate positions of fragments of unknown size are drawn with reference to the DNA standards. Fragments in brackets are not normally discernable due to their small size. MhoI cleaves one nucleotide from primer Gl, so fragments derived from that end of the PCR product are smaller by one nucleotide.

this region in the subgroup A strains examined, illustrated in Fig. 1: AM. seven different patterns observed (Fig. la), Ar, AT? A3, B, C, D and E. Patterns A,, A2 and A3 are difficult to distinguish unless products from strains giving each pattern are run adjacent to each other, therefore no distinction is made between these three patterns for the rest of this report. TuqI: three patterns observed, A-C, (Fig. lb). MhoI: eight patterns observed, A-H, (Fig. lc). M.&: seven patterns observed, A-G, (Fig. Id). The patterns observed for 41 strains is listed in Table 1; a further 45 isolates examined gave identical patterns to some isolates already examined from the same epidemics so they have not been listed separately. Fig. 2 shows representative patterns from a selection of strains isolated in Birmingham, UK, since 1989. In all, 18 different combinations of patterns were observed in the strains examined in this report. Loss of a particular cutting site for a restriction enzyme involves change of only one nucleotide so some patterns can be considered as closely related to each other, for example MhoI B and H. The other patterns shown in Fig. 1 can be deduced from the published sequence for strains isolated prior to 1988, such as Long, isolated in 1956 (Johnson et al., 1987) which gives pattern Alul:A, TaqI:C, k&&D, and MseI:F. Some of these patterns have not been observed in any strain of RS virus isolated in the last 5

303

6

7m89lOlll

Fig. 2. Photographs of examples of restriction patterns given by some RS virus strains isolated in Birmingham, UK from 1989-1991. Lanes 1, 8: RSB90-8336; lanes 2, 9: RSB91-8927; lanes 3, 10: RSB918382; lanes 4, 11: RSB89-642; lanes 5, 12: RSB90-8106; lanes 6, 13: RSB91-48; lanes 7, 14: RSB91-191. Panel (a) shows A/u1 restrictions (lanes l-7) followed by Taql restrictions (lanes 8814); panel (b) shows Mb01 restrictions (lanes I-7) followed by MseI restrictions (lanes 8-14). M: DNA size standard ladder (see Fig. 1).

TABLE

2

Summary

of G gene restriction

SHL group

SHLl, SHL2 SHLS SHL6 Patterns

3, 4 (NP2) (NP4) (NP5) (NP4)

patterns

shown

by subgroup

G gene restriction

A lineages

pattern

Ah1

TuqI

MboI

MseI

A

A B A A

AWE B/C/H B/G B/F

E BICIE E/G AID/E

&D AWE

TuqI C, MboI D, and MseI F have not been observed

in current

epidemic

isolates.

years. As can be seen from Table 1, the G gene restriction pattern for recently isolated strains of RS virus correlated with their classification by nucleotide sequencing of parts of their SH and G genes (Cane and Pringle, 1991; Cane et al., 1991, 1992). Thus it would appear valid to replace nucleotide sequencing with restriction mapping of the G gene for the routine classification of isolates. A ‘consensus’ pattern for each lineage of subgroup A isolates is given in Table 2. Finally, Fig. 3 illustrates how this information can be used to provide rapid identitication of the lineage of current subgroup A strains of RS virus by PCR amplification and restriction analysis. Samples of the oligonucleotides used in

304

Fig. 3. Scheme for classification

of RS virus isolates

by the methods

described

in this paper.

this study are available on request for others wishing to evaluate these methods.

Discussion Analysis of the N and G gene restriction patterns allow isolates of RS virus to be classified by subgroup and, in the case of subgroup A isolates, into the lineages currently circulating worldwide. Fig. 3 shows a scheme summarising this method of identification. This scheme also takes into account the possibility of identification of subgroup B RS viruses, pneumonia virus of mice (PVM), a pneumovirus distantly related to RS virus (Barr et al., 1991), for which there is serological evidence of infection of humans (Pringle and Eglin, 1986), and bovine RS virus. The N gene primers described here did not allow amplification of the N gene of turkey rhinotracheitis virus (TRTV), also considered a pneumovirus (Cavanagh and Barrett, 1988), but recently shown to be only very distantly related to the other pneumoviruses (Ling et al., 1992). A feature of the method described here is that, in many instances, the results given by the N and G restriction patterns cross-match and so allow confirmation of the classification: this could be important should contamina-

305

tion of one of the sets of PCR’s be suspected. Undoubtedly, further G gene restriction patterns will occur as more extensive studies of RS virus epidemiology are undertaken. The method is rapid, relatively inexpensive, uses reagents that are routinely available commercially (i.e. restriction enzymes), and technically much simpler and quicker than nucleotide sequencing. This methodology is more discriminating than analysis using panels of monoclonal antibodies, and provision of the reagents does not necessitate animal experimentation. Our original analysis of RS virus isolates from an epidemic in Birmingham, UK, in 1989, showed that the subgroup A isolates could be divided into 5 different lineages, SHLI-SHLS on the basis of the nucleotide sequence of part of the SH gene. Analysis of subsequent epidemics in the Birmingham area showed the presence of a further SH lineage, SHL6 (unpublished results). Strains related to these lineages were subsequently found to be widely distributed (Cane et al., 1992). Strains of SHL6 show the greatest variability in their G gene restriction patterns, and this feature is also reflected in the deduced amino acid sequences for the G proteins for the much smaller numbers of strains analysed by nucleotide sequencing. Within an epidemic in a single region, in general, the G gene restriction patterns observed are usually fairly uniform. For example, only two patterns for SHL6 isolates were seen in isolates from Birmingham for the 1991-92 epidemic (Table 1). Strains from SHLl and 3 were very closely related, with SHL4 also closely related to SHLl and 3. Subsequent nucleotide sequencing of the G genes of isolates from these lineages confirmed their close relationship (Cane and Pringle, 1991; Cane et al., 1991). Analysis of strains from subsequent epidemics and from other locations have shown that there are many isolates also closely related but not absolutely identical to this grouping, which can be distinguished by its N gene and G gene restriction patterns. It is possible that all strains previously classified as SHLl, 3, and 4 could be considered as belonging to the same lineage which is in turn made up of a number of sublineages. The situation regarding variability within the lineages should become clearer as more isolates are analysed, and the contribution of selective drift due to immunological pressure is assessed. In summary, this paper reports a rapid method for the classification of RS virus isolates, starting with either tissue culture samples or clinical specimens, utilising PCR amplification together with restriction mapping. The method is also sufficiently sensitive to detect some degree of variability within the lineages. It should now be possible to analyse large numbers of RS virus isolates, thereby permitting examination of the molecular epidemiology of the virus in relation to virulence, immune response, and socioeconomic factors.

Acknowledgements We are most grateful

to the following

for their generous

cooperation

in

306

provision of RS virus isolates: Dr U. Desselberger, now of P.H.L.S., Cambridge, UK; Mr A. Campbell of Regional Virus Laboratory, East Birmingham Hospital, Birmingham, UK; Prof. S.K. Lam, Kuala Lumpur, Malaysia; Dr Hortal de Peluffo, Montevideo, Uruguay; Dr J.A. Melero, Madrid, Spain; Dr H. Thomas, Liverpool, UK; Dr G. Toms, Newcastle-uponTyne, UK; Dr W. Verhagen, Hannover, Germany; and Dr M. Waris, Turku, Finland. We also wish to thank Mr. K. Tolley and Mr. D. Matthews for technical assistance. This work was supported by MRC programme Grant PG8322715 and E.E.C. Contract CT1/0762.

References Anderson, L.J., Hierholzer, J.C., Tsou, C., Hendry, R.M., Fernie, B.N., Stone, Y. and McIntosh, K. (1985) Antigenic characterization of respiratory syncytial virus strains with monoclonal antibodies. J. Infec. Dis. 151, 626-633. Barr, J., Chambers, P., Pringle, C.R. and Easton, A.J. (1991) Sequence of the major nucleocapsid protein gene of pneumonia virus of mice: sequence comparisons suggest structural homology between nucleocapsid proteins of pneumoviruses, paramyxoviruses, rhabdoviruses and tiloviruses. J. Gen. Virol. 72, 6777685. Cane, P.A. and Pringle, C.R. (1991) Respiratory syncytial virus heterogeneity during an epidemic: analysis by limited nucleotide sequencing (SH gene) and restriction mapping (N gene). J. Gen. Viral. 72, 3499357. Cane, P.A., Matthews, D.A. and Pringle, C.R. (1991) Identification of variable domains of the attachment (C) protein of subgroup A respiratory syncytial viruses. J. Gen. Virol. 72, 2091 2096. Cane, P.A., Matthews, D.A. and Pringle, CR. (1992) Analysis of relatedness of subgroup A respiratory syncytial viruses isolated worldwide. Virus Res. 25, 15-22. Cavanagh, D. and Barrett, T. (1988) Pneumovirus-like characteristics of the mRNA and proteins of turkey rhinotracheitis virus. Virus Res. 11, 241-256. Collins, P.L., Anderson, K., Langer, S.J. and Wertz, G.W. (1985) Correct sequence for the major nucleocapsid protein mRNA of respiratory syncytial virus. Virology 7 1, 69977. Gimenez, H.B., Hardman, N., Keir, H.M. and Cash, P. (1986) Antigenic variation between respiratory syncytial virus isolates. J. Gen. Viral. 67, 8633870. Johnson P.R. and Collins, P.L. (1989) The IB (NS2), 1C (NSI) and N proteins of human respiratory syncytial virus (RSV) of antigenic subgroups A and B: sequence conservation and divergence within RSV genomic RNA. J. Gen. Viral. 70, 153991547. Johnson, P.R., Spriggs, M.K., Olmsted, R.A. and Collins, P.L. (1987) The G glycoprotein of human respiratory syncytial viruses of subgroups A and B: extensive sequence divergence between antigenically related proteins. Proc. Natl. Acad. Sci. USA 84, 5625-5629. Ling, R., Easton, A.J. and Pringle, C.R. (1992) Sequence analysis of the 22K, SH and G genes of turkey rhinotracheitis virus and their intergenic regions reveals a gene order different to that of other pneumoviruses. J. Gen. Viral. 73, 170991715. Kumar, A. and Lindberg, U. (1972) Characterization of messenger ribonucleoprotein and messenger RNA from KB cells. Proc. Natl. Acad. Sci. USA 69, 681.-685. Mufson, M.A., Orvell, C., Rafnar, B. and Norrby, E. (1985) Two distinct subtypes of respiratory syncytial virus. J. Gen. Viral. 66, 211 I-2124. Wertz, G.W.. Collins, P.L., Huang, Y., Gruber, C., Levine, S. and Ball. A.L. (1985) Nucleotide sequence of the G protein gene of human respiratory syncytial virus reveals an unusual type of viral membrane protein. Proc. Nat]. Acad. Sci. USA 82, 40754079.