Molecular evidence for the non-monophyletic status of Naidinae (Annelida, Clitellata, Tubificidae)

Molecular Phylogenetics and Evolution 40 (2006) 570–584 www.elsevier.com/locate/ympev

Molecular evidence for the non-monophyletic status of Naidinae (Annelida, Clitellata, TubiWcidae) Ida Envall a,b,c,¤, Mari Källersjö c, Christer Erséus d a

Department of Zoology, Stockholm University, SE-106 91 Stockholm, Sweden Department of Invertebrate Zoology, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden c Laboratory of Molecular Systematics, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden d Department of Zoology, Göteborg University, Box 463, SE-405 30 Göteborg, Sweden b

Received 24 October 2005; revised 9 February 2006; accepted 15 March 2006 Available online 8 May 2006

Abstract Naidinae (former Naididae) is a group of small aquatic clitellate annelids, common worldwide. In this study, we evaluated the phylogenetic status of Naidinae, and examined the phylogenetic relationships within the group. Sequence data from two mitochondrial genes (12S rDNA and 16S rDNA), and one nuclear gene (18S rDNA), were used. Sequences were obtained from 27 naidine species, 24 species from the other tubiWcid subfamilies, and Wve outgroup taxa. New sequences (in all 108) as well as GenBank data were used. The data were analysed by parsimony and Bayesian inference. The tree topologies emanating from the diVerent analyses are congruent to a great extent. Naidinae is not found to be monophyletic. The naidine genus Pristina appears to be a derived group within a clade consisting of several genera (Ainudrilus, Epirodrilus, Monopylephorus, and Rhyacodrilus) from another tubiWcid subfamily, Rhyacodrilinae. These results demonstrate the need for a taxonomic revision: either Ainudrilus, Epirodrilus, Monopylephorus, and Rhyacodrilus should be included within Naidinae, or Pristina should be excluded from this subfamily. Monophyly of four out of six naidine genera represented by more than one species is supported: Chaetogaster, Dero, Paranais, and Pristina, respectively. © 2006 Elsevier Inc. All rights reserved. Keywords: Naidinae; Naididae; Rhyacodrilinae; TubiWcidae; 12S rDNA; 16S rDNA; 18S rDNA; Phylogeny; Taxonomy

1. Introduction Naidid worms are small aquatic clitellate annelids, common worldwide. About 180 species have been described (Erséus, 2005), and 24 genera are currently recognized (Table 1). Most species inhabit freshwater, but some are adapted to brackish or marine habitats (Sperber, 1948). They are primarily found in superWcial sediment layers, or at the surface of aquatic vegetation, and some species are even active swimmers (Erséus, 2005). Most species are detritivorous, but carnivory and parasitism exist (Brinkhurst and Jamieson, 1971).

*

Corresponding author. Fax: +46 8 5195 5181. E-mail address: [email protected] (I. Envall).

1055-7903/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2006.03.021

Naidids are capable of reproducing asexually, by budding (paratomy) or fragmentation (architomy) (Brinkhurst and Jamieson, 1971; Sperber, 1948). Paratomic Wssion is most usual. This is a peculiar process in which a new head, and in front of this a new tail, is intercalated in the middle of the original worm’s body. In this way, a transient linked chain of individuals may be formed (Bely and Wray, 2001, 2004; Dehorne, 1916). Partly because of this vegetative mode of reproduction, which makes it possible for a worm to produce many oVspring in a short time, naidid populations may increase rapidly under favorable conditions (e.g., Armendáriz, 2000; Loden, 1981). Naidids also periodically reproduce sexually (e.g., Erséus, 2005; Sperber, 1948). Naididae was long regarded as a separate family within the clitellate order TubiWcida. However, several studies, both morphological (Brinkhurst, 1994; Erséus, 1987, 1990) and molecular, based on 28S rDNA (but referred to as

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584 Table 1 The genera within Naididae sensu Brinkhurst and Jamieson (1971) (plus the two genera Bratislavia Kosel, 1976, and Rhopalonais Dzwillo and Grimm, 1974 later described) Allonais Sperber, 1948 Amphichaeta Tauber, 1879 Arcteonais Piguet, 1928 Branchiodrilus Michaelsen, 1900 Bratislavia Kosel, 1976 Chaetogaster von Baer, 1827 Dero Oken, 1815 Haemonais Bretscher, 1900 Homochaeta Bretscher, 1896 Nais Müller, 1773 Neonaisa Sokolskaya, 1962 Ophidonais Gervais, 1838 Paranais Czerniavsky, 1880 Piguetiella Sperber, 1939 Pristina (including Pristinella)b Ehrenberg, 1828 Rhopalonais Dzwillo and Grimm, 1974 Ripistes Dujardin, 1842 Slavina Vejdovský, 1883 Specaria Sperber, 1939 Stephensoniana Cernosvitov, 1938 Stylaria Lamarck, 1816 Uncinais Levinsen, 1884 Vejdovskyella Michaelsen, 1903 Wapsac Marcus, 1965

• •

• • • • • • • • • • • • •

A bullet indicates that the genus is represented in this study a A genus which remains inadequately described (Brinkhurst and Jamieson, 1971). b Brinkhurst (1985) divided Pristina into Pristina and Pristinella, but the two groups were reunited, since species with a mix of Pristina and Pristinella characters were described by Collado and Schmelz (2000). c Wapsa is today regarded as a synonym of Paranais (Brinkhurst and Coates, 1985).

“23S”) in combination with the COI gene (Christensen and Theisen, 1998), 18S rDNA (Erséus et al., 2002; Erséus and Källersjö, 2004), and 18S rDNA combined with 16S rDNA (Sjölin et al., 2005), support that the naidids should be treated as an ingroup of another family, TubiWcidae. The genitalia have a more anterior position in naidids (in segments IV–V to VII–VIII) compared to in tubiWcids (segments X–XI), and this condition, together with the ability of Wssion, have been the main reasons assigning Naididae family status. Sometimes, Naididae has in fact been regarded as a “primitive” clitellate group, not even closely related to TubiWcidae (Omodeo, 1998), because of a comparatively simple circulatory system, and a somewhat leechlike embryology. However, the morphology of the genitalia of TubiWcidae and Naididae, respectively, is similar, with prostate glands directly associated with the atrium (which is a part of the male eVerent duct). Moreover, the reproductive structures are located in two consecutive segments in both groups (although in diVerent segment pairs), with the Wrst segment containing one pair of testes and one pair of spermathecae, and the other segment containing one pair of ovaries and one pair of male eVerent ducts. Furthermore, the spermatozoa exhibit ultrastructural similarities (Ferraguti et al., 1999). Erséus and Gustavsson (2002) have suggested that Naididae should be treated as a subfamily,

571

Naidinae, within TubiWcidae, and from now on we will use the proposed subfamily name Naidinae (sensu Erséus and Gustavsson, 2002) in this paper. [Erséus et al. (2005) has asked the International Commission of Zoological Nomenclature to conserve the usage of the family group name TubiWcidae, despite that it is younger than the family group name Naididae.] In addition to Naidinae, Wve tubiWcid subfamilies are recognized: Limnodriloidinae, Phallodrilinae, Rhyacodrilinae, Telmatodrilinae, and TubiWcinae (Erséus, 1990), although it is not probable that all these groups are natural (Erséus, 1990; Erséus and Ferraguti, 1995; Erséus and Gustavsson, 2002; Erséus et al., 2000, 2002; Sjölin et al., 2005). There are indications that Naidinae is closely related to Rhyacodrilinae. It has been placed close to, or even nested within, Rhyacodrilinae in several phylogenetic studies (Brinkhurst, 1994; Christensen and Theisen, 1998; Erséus, 1990; Erséus et al., 2000, 2002; Sjölin et al., 2005). However, in these studies the number of taxa from the two groups has been insuYcient to enable any detailed conclusions. Three morphology-based hypotheses on the naidine phylogeny have been formulated in the last century (Lastobkin, 1924; Nemec and Brinkhurst, 1987; Sperber, 1948). The two oldest of these were not based on explicit phylogenetic principles, but rather on mere morphological similarity. The three hypotheses are fundamentally diVerent in several respects, probably at least partly because of the low number of independent morphological characters. According to Lastobkin (1924) there are two groups within “Naididae”, i.e., Pristininae (Pristina) and Naidinae (sensu Lastobkin) (all other genera). Sperber (1948) identiWed four subfamilies: Pristininae (Pristina), Paranaidinae (Paranais), Chaetogastrinae (Chaetogaster and Amphichaeta), and Naidinae (sensu Sperber) (all remaining genera). According to Nemec and Brinkhurst (1987), Wnally, there are two subfamilies within “Naididae”: Stylarinae and Naidinae (sensu Nemec and Brinkhurst, 1987). Stylarinae consists of the genera Stylaria, Arcteonais, Ripistes, Vejdovskyella, Slavina, Stephensoniana (incertae sedis), and Piguetiella (incertae sedis). Naidinae (sensu Nemec and Brinkhurst, 1987) consists of all the remaining genera, divided into four tribes: Naidini, Derini, Pristinini, and Chaetogastrini. In a recent study, Bely and Wray (2004) used molecular data (COI) in the attempt to reconstruct the naidine phylogeny. The result from this study suggests two groups: one comprising the genus Pristina, and the other comprising all other genera sampled. The aim of the present study was to evaluate the monophyly of Naidinae sensu Erséus and Gustavsson (2002), with special emphasis on its relationship to Rhyacodrilinae, and to Wnd a hypothesis about the phylogeny within the group. 18S rDNA sequences have been used several times before, dealing with clitellate phylogenies (Apakupakul et al., 1999; Erséus et al., 2000, 2002; Erséus and Källersjö, 2004; Martin, 2001; Martin et al., 2000; Siddall et al., 2001; Sjölin et al., 2005). However, this nuclear gene is too slow-evolving to resolve within-family relationships of

572

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

TubiWcidae, or even higher-level relationships satisfactorily. Accordingly, we decided to use two mitochondrial genes, 12S rDNA and 16S rDNA, in combination with 18S rDNA, since these generally evolve more rapidly, providing resolution at levels of more recent divergence. Moreover, we were interested in obtaining two independent phylogenetic estimates (based on mitochondrial and nuclear DNA sequences, respectively). 2. Materials and methods 2.1. Taxon sampling and collection of specimens Twenty-seven naidine species, representing 15 out of the 24 genera currently recognized, were included (Tables 1 and 2). The tubiWcid subfamilies TubiWcinae, Phallodrilinae, and Limnodriloidinae were represented by four species each, whereas twelve rhyacodrilines were included to elucidate the relationship between this group and Naidinae in greater detail. Five species (Buchholzia fallax, Fridericia tuberosa, Insulodrilus biWdus, Lumbriculus variegatus, and Lumbricus castaneus) were chosen as outgroup taxa (see Table 2). They represent four additional families of oligochaetous Clitellata, one of which (Phreodrilidae) has been proposed as the sister group to TubiWcidae (Erséus et al., 2002). Most specimens were collected by Christer Erséus. These were identiWed live and preserved in 80–99% ethanol. Other, likewise ethanol preserved specimens, were provided by colleagues (for collection site and collector, see Table 2). 2.2. Extraction, gene ampliWcation, and sequencing DNA was extracted using the QIAamp DNA Mini Kit (Qiagen), following the manufacturer’s recommendations, with the exception of an elution step of 50 l followed by another elution of 100 l collected in separate tubes. The PCRs were carried out with PuReTaq Ready-To-Go PCR Beads (Amersham Pharmacia Biotech), following the manufacturer’s protocol in 25 l volumes, and run on a Perkin-Elmer 480 Thermal Cycler. All primers used for ampliWcation are described in Table 3. The details of the thermocycling procedures are described below; however, in many species they were changed slightly to improve the PCR result. An about 400 bp long fragment of the 12S rDNA region was ampliWed using the primers 12SE1 and 12SH (Jamieson et al., 2002). The PCR was performed with an initial denaturing step at 95 °C for 5 min, followed by an ampliWcation proWle of 43 cycles: 95 °C for 40 s, 45 °C for 45 s, and 72 °C for 60 s. The procedure was completed with a Wnal extension step at 72 °C for 8 min. Four 12S sequences are missing in the analyses, since we failed to receive a PCR product from Amphichaeta sannio, Dero vaga, Paranais litoralis, and Stylaria fossularis. The ampliWcation of the 16S rDNA region was performed using the primers 16Sar-L and 16Sbr-H (Palumbi et al., 1991), giving an about 480 bp long fragment. The thermocycling procedure was started with an initial denaturing

step at 95 °C for 5 min. This was followed by 35 cycles of 95 °C for 30 s, 45 °C for 30 s, and 72 °C for 60 s, and a Wnal extension step at 72 °C for 8 min. Two additional primers, 16S AnnF and 16S AnnR (Sjölin et al., 2005), were used for some taxa, since 16Sar-L and 16Sbr-H did not work well in these cases. The same ampliWcation proWle was applied, except for the annealing temperature, which was set to 50 °C. These primers give an about 300 bp long fragment. A nested PCR was performed to produce an about 1750 bp long fragment of the 18S rDNA region. First, the entire fragment was ampliWed with the primers TimA and TimB [Tim Littlewood (pers. comm. in Norén and Jondelius, 1999)]. Then two fragments were ampliWed from the product of the Wrst PCR, with the primer combinations TimA/1100R [Tim Littlewood (pers. comm. in Norén and Jondelius, 1999)], and 660F (Erséus et al., 2002)/TimB, respectively. The same PCR program was used for these three primer combinations: an initial denaturing step at 95 °C for 5 min, 30 cycles of 95 °C for 30 s, 54 °C for 30 s, and 72 °C for 90 s, and a Wnal extension step at 72 °C for 8 min. In some cases, when 660F did not work well, the primer combination 600F [Tim Littlewood (pers. comm. in Norén and Jondelius, 1999)]/TimB was used instead, with the same thermocycling procedure, except for the annealing temperature which was set to 60 °C. PCR products were puriWed using the QIAquick PCR PuriWcation Kit (Qiagen), or in a few cases the QIAquick Gel Extraction Kit (Qiagen). Sequencing reactions were performed using the BigDye Terminator Cycle Sequencing Kit, versions 1.1, 2.0, and 3.1 (Applied Biosystems) under the standard cycle sequencing conditions. Cycle sequencing products were cleaned using the DyeEx 96 Kit (Qiagen) and run on an ABI PRISM 377 DNA Sequencer (Applied Biosystems) or on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). All primers used for sequencing are described in Table 3. Both strands were sequenced for each gene, and the Staden Package (Staden et al., 1998) was used to assemble and evaluate the sequences. A total number of 52 12S rDNA sequences, 28 16S rDNA sequences, and 28 18S rDNA sequences are new. In addition, GenBank data on 16S rDNA and 18S rDNA from some taxa were included in the analyses. These were sequenced by Erséus et al. (2000, 2002), Siddall et al. (2001), and Sjölin et al. (2005) (see Table 2). 2.3. Alignments Sequences were aligned using CLUSTAL X, version 1.83 (Thompson et al., 1997). Except for the gap opening penalties, default settings were used. Six diVerent gap opening penalty combinations were applied (pairwise gap opening penalty/multiple gap opening penalty): 10/10, 15/15, 15/30, 15/45, 30/15, and 30/40. Concerning both 12S rDNA and 16S rDNA, there were large blocks of rather conserved, and thus less ambiguous regions, interspersed by some shorter, more variable parts. 18S rDNA was consistently less variable.

Table 2 Taxa included in the study, sources of material, year of collection, name of collector (for newly sequenced specimens), and GenBank accession number for the respective sequences Collector

12S rDNA

16S rDNA

18S rDNA

Siena, Toscana, Italy, 1995 Siena, Toscana, Italy, 1995

E. Rota E. Rota

DQ459883 DQ459884

AY885581d AY885580d

AF411895c AF209453a

Annelida, Clitellata, Phreodrilidae Insulodrilus biWdus Pinder and Brinkhurst, 1997

Bow River tributary, Western Australia, 2000

A. Pinder

DQ459882

AY885636d

AF411906c

Annelida, Clitellata, Lumbricidae Lumbricus castaneus (Savigny, 1826)

Nationalstadsparken, Stockholm, Sweden, 1995

C. Erséus et al.

DQ459881

AY885579d

AF209458a

Viktoriadammen Pond, Bergius Botanic Garden, Stockholm, Sweden, 1993

C. Erséus et al.

DQ459885

AY885578d

AF209457a

Culture maintained at Vörtsjärv Limnological Station, Rannu, Estonia, 2000 Lången Lake, near Alingsås, Västergötland, Sweden, 2000 Tjärnö, Bohuslän, Sweden, 2000 Tjärnö, Bohuslän, Sweden, 2000

T. Timm

DQ459923

AY885613d

AF469007b

C. Erséus C. Erséus C. Erséus

DQ459921 DQ459925 DQ459922

AY885610d AY885611d AY885609d

AF411879c AF411872c AF411873c

Lee Stocking Island, Great Exuma, Bahamas, 1999 Carrie Bow Cay, Belize, 1993 Elba, Italy, 2000

C. Erséus C. Erséus C. Erséus

DQ459926 DQ459928 DQ459929

AY885619d AY885593d AY885596d

AF411889c AF411891c AF411870c

Kosterfjorden, Bohuslän, Sweden, 1997

C. Erséus

DQ459880

DQ459958

DQ459986

Lee Stocking Island, Great Exuma, Bahamas, 1999 Elba, Italy, 2000 Lee Stocking Island, Great Exuma, Bahamas, 1999 Carrie Bow Cay, Belize, 1993

C. Erséus C. Erséus C. Erséus C. Erséus

DQ459919 DQ459918 DQ459920 DQ459917

AY885621d AY885629d AY885608d AY885628d

AF411866c AF411869c AF411899c AF209465a

Haikou, Hainan Island, China, 2000 Haikou, Hainan Island, China, 2000 Culture maintained at Vörtsjärv Limnological Station, Rannu, Estonia, 2000 Wuhan, Hubei, China, 2000 Rokytná River, Czech Republic, 2004 Heron Island, Great Barrier reef, Queensland, Australia, 1994 Sanya, Hainan Island, China, 2000 Torö Island, near Stockholm, Södermanland, Sweden, 1998 Lången Lake, near Alingsås, Västergötland, Sweden, 2003 Vitärtkällan Spring, near Kappelshamn, Gotland, Sweden, 2003 Otsu near Lake Biwa, Japan, 2003 Lerum, Västergötland, Sweden, 2004

C. Erséus and H. Wang C. Erséus and H. Wang T. Timm

DQ459887 DQ459886 DQ459879

AY885587d AY885588d AY885635d

AF411867c AF411871c AF411908c

(Courtesy H. Wang) J. Schenkova C. Erséus

DQ459924 DQ459890 DQ459927

DQ459957 DQ459936 AY885616d

DQ459985 DQ459963 AF209454a

C. Erséus and H. Wang M. Norén C. Erséus C. Erséus

DQ459930 DQ459891 DQ459888 DQ459893

AY885601d AY885637d DQ459931 DQ459938

AY885574d AF209459a DQ459969 DQ459965

T. Narita C. Erséus

DQ459889 DQ459892

DQ459932 DQ459964 DQ459937 DQ459962 (continued on next page)

Annelida, Clitellata, Lumbriculidae Lumbriculus variegatus (Müller, 1774) Annelida, Clitellata, TubiWcidae, TubiWcinae Limnodrilus hoVmeisteri Claparède, 1862 Tubifex ignotus (Stolc, 1886) TubiWcoides benedii (d’Udekem, 1855) TubiWcoides pseudogaster (Dahl, 1960) Annelida, Clitellata, TubiWcidae, Phallodrilinae Bathydrilus formosus Erséus, 1986 Inanidrilus aduncosetis Erséus, 1984 Olavius algarvensis Giere, Erséus and Stuhlmacher, 1998 Pirodrilus minutus (Hrabe, 1973) Annelida, Clitellata, TubiWcidae, Limnodriloidinae Limnodriloides anxius Erséus, 1982 Limnodriloides appendiculatus Pierantoni, 1903 Limnodriloides baculatus Erséus, 1982 Smithsonidrilus hummelincki (Righi and Kanner, 1979) Annelida, Clitellata, TubiWcidae, Rhyacodrilinae Ainudrilus lutulentus (Erséus, 1984) Ainudrilus pauciseta Wang and Erséus, 2003 Bothrioneurum vejdovskyanum Stolc, 1888 Branchiura sowerbyi Beddard, 1892 Epirodrilus pygmaeus (Hrabe, 1935) Heronidrilus heronae (Erséus and Jamieson, 1981) Heterodrilus chenianus Wang and Erséus, 2003 Monopylephorus rubroniveus Levinsen, 1884 Rhyacodrilus coccineus (Vejdovský, 1875) Rhyacodrilus falciformis Bretscher, 1901 Rhyacodrilus hiemalis Ohtaka, 1995 Rhyacodrilus subterraneus Hrabe, 1963

573

Collection site and year

Annelida, Clitellata, Enchytraeidae Buchholzia fallax Michaelsen, 1887 Fridericia tuberosa Rota, 1995

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

Taxon

574

Table 2 (continued) Collection site and year

Collector

12S rDNA

16S rDNA

18S rDNA

Annelida, Clitellata, TubiWcidae, Naidinae Allonais inaequalis (Stephenson, 1911) Amphichaeta sannio Kallstenius, 1892 Chaetogaster diaphanus (Gruithuisen, 1828) Chaetogaster diastrophus (Gruithuisen, 1828) Dero digitata (Müller, 1773) Dero vaga (Leidy, 1880)

Pacaya-Samiria Reserve, Amazon Basin, Peru, 2003 Tjärnö, Bohuslän, Sweden, 2000 Lången Lake, near Alingsås, Västergötland, Sweden, 2002 Lången Lake, near Alingsås, Västergötland, Sweden, 2000 Lången Lake, near Alingsås, Västergötland, Sweden, 2002 Bear Creek, Calveras Co., California, USA, 2003

(Courtesy D. Shain) C. Erséus C. Erséus C. Erséus C. Erséus J. Hayworth (courtesy D. Kathman) C. Erséus et al. C. Erséus et al. C. Erséus et al. C. Erséus et al. C. Erséus et al. S. Fend

DQ459907 — DQ459911 DQ459912 DQ459908 —

DQ459952 DQ459955 DQ459956 AY885586d DQ459954 DQ459953

DQ459967 DQ459970 DQ459968 AF411874c DQ459984 DQ459966

DQ459906 DQ459895 DQ459894 DQ459905 DQ459903 DQ459896

DQ459943 DQ459949 DQ459940 DQ459944 DQ459941 DQ459939

DQ459975 DQ459980 DQ459983 DQ459977 DQ459978 DQ459974

C. Erséus C. Erséus C. Erséus C. Erséus C. Erséus C. Erséus C. Erséus H. Wang C. Erséus C. Erséus C. Erséus et al. J. Hayworth (courtesy D. Kathman) C.Erséus C.Erséus C.Erséus

DQ459909 DQ459910 — DQ459898 DQ459914 DQ459916 DQ459915 DQ459913 DQ459900 DQ459902 DQ459897 —

DQ459951 DQ459950 AY885585d DQ459948 DQ459934 DQ459935 AY885589d DQ459933 DQ459946 AY885582d AY885583d DQ459945

DQ459982 DQ459981 AF411864c DQ459979 DQ459961 DQ459959 AF411875c DQ459960 DQ459972 AF411876c AF411878c,e DQ459971

DQ459901 DQ459904 DQ459899

DQ459947 DQ459942 AY885584d

DQ459973 DQ459976 AY411877d

Nais alpina Sperber, 1948 Nais communis Piquet, 1906 Nais elinguis Müller, 1773 Nais pardalis Piguet, 1906 Nais variabilis Piquet, 1906 Ophidonais serpentina Müller, 1773 Paranais botniensis Sperber, 1948 Paranais frici Hrabe, 1941 Paranais litoralis (Müller, 1784) Piguetiella blanci (Piguet, 1906) Pristina aequiseta Bourne, 1891 Pristina jenkinae sensu lato (Stephenson, 1931) Pristina longiseta Ehrenberg, 1828 Pristina proboscidea Beddard, 1896 Ripistes parasita (Schmidt, 1847) Slavina appendiculata (d’Udekem, 1855) Specaria josinae (Vejdovský, 1883) Stylaria fossularis Leidy, 1852

Igelbäcken Stream, Solna, Uppland, Sweden, 2002 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 San Fransisquito Creek, San Mateo Co., California, USA, 2003 Hoburgen, Gotland, Sweden, 2003 Tjärnö, Bohuslän, Sweden, 2000 Tjärnö, Bohuslän, Sweden, 1998 Lången Lake, near Alingsås, Västergötland, Sweden, 2002 Lången Lake, near Alingsås, Västergötland, Sweden, 2003 Lången Lake, near Alingsås, Västergötland, Sweden, 2003 Lången Lake, near Alingsås, Västergötland, Sweden, 2000 Esperence, Western Australia, 2003 Lången Lake, near Alingsås, Västergötland, Sweden, 2002 Lången Lake, near Alingsås, Västergötland, Sweden, 2000 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 Seven Mile Slough, Sacramento Co., California, USA, 2003

Stylaria lacustris (Linnaeus, 1767) Uncinais uncinata (Oersted, 1842) Vejdovskyella comata (Vejdovský, 1883)

Lången Lake, near Alingsås, Västergötland, Sweden, 2002 Lången Lake, near Alingsås, Västergötland, Sweden, 2003 Lången Lake, near Alingsås, Västergötland, Sweden, 2000

a b c d e

Erséus et al. 2000. Siddall et al. 2001. Erséus et al. 2002. Sjölin et al. 2005. Taxon was earlier misidentiWed as Nais communis Piguet, 1906 (Erséus et al., 2002; Erséus and Källersjö, 2004).

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

Taxon

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

575

Table 3 Primers used for ampliWcation and sequencing (5⬘–3⬘) Primer name

Used for

Primer sequence

Reference

12SE1 12SH 16Sar-L 16Sbr-H 16S AnnF 16S AnnR TimA TimB 1100R 660F 600F 18S4FB 18S4FBK 18S5F 18S7FK 1806R

PCR, sequencing (12S) PCR, sequencing (12S) PCR, sequencing (16S) PCR, sequencing (16S) PCR, sequencing (16S) PCR, sequencing (16S) PCR, sequencing (18S) PCR (18S) PCR, sequencing (18S) PCR, sequencing (18S) PCR, sequencing (18S) Sequencing (18S) Sequencing (18S) Sequencing (18S) Sequencing (18S) Sequencing (18S)

AAAACATGGATTAGATACCCRYCTAT ACCTACTTTGTTACGACTTATCT CGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT GCGGTATCCTGACCGTRCWAAGGTA TCCTAAGCCAACATCGAGGTGCCAA AMCTGGTTGATCCTGCCAG TGATCCATCTGCAGGTTCACCT GATCGTCTTCGAACCTCTG GATCTCGGGTCCAGGCT GGTGCCAGCMGCCGCGGT CCAGCAGCCGCGGTAATTCCAG CTGGAATTACCGCGGCTGCTGG GCGAAAGCATTTGCCAAGAA GCATCACAGACCTGTTATTGC CCTTGTTACGACTTTTACTTCCTC

Jamieson et al. (2002) Jamieson et al. (2002) Palumbi et al. (1991) Palumbi et al. (1991) Sjölin et al. (2005) Sjölin et al. (2005) Tim Littlewood (pers. comm. in Norén and Jondelius, 1999) Tim Littlewood (pers. comm. in Norén and Jondelius, 1999) Tim Littlewood (pers. comm. in Norén and Jondelius, 1999) Erséus et al. (2002) Tim Littlewood (pers. comm. in Norén and Jondelius, 1999) Norén and Jondelius (1999) Norén and Jondelius (1999) Marta Riutort (pers. comm. in Norén and Jondelius, 1999) Marta Riutort (pers. comm. in Norén and Jondelius, 1999) Michael Norén (pers. comm. in Hovmöller et al., 2002)

2.4. Analyses Parsimony jackknife analyses (Farris et al., 1996) based on the diVerent alignments of each gene were performed, to compare the impact of diVerent gap opening penalties on the phylogenetic results. The computer program Xac (which codes gaps as missing data) (Farris, 1997a; discussed in Källersjö et al., 1998) was used, with one thousand replicates, global branch swapping, and 10 random addition sequences each. There were no supported conXicts among the taxa of concern, between the respective gene trees based on diVerent alignments. Hence, just two gap opening penalty combinations were selected for the analyses of the combined data set: 15/15 and 15/45. The combined data set was analysed by parsimony jackkniWng, using the computer programs Xac and Gax (which codes gaps as a Wfth character state) (Farris, 1997b), with settings as above. (Gax was used to utilise the phylogenetic information of gaps. Coding gaps as a Wfth character state may give gaps too much weight, but, the other hand, coding gaps as missing data gives gaps too little weight, why we Wnd it appropriate to perform both analyses.) Trees were rooted using the outgroup criterion (Farris, 1972). Furthermore, the combined data set (15/15 and 15/45 alignments) was analysed by Bayesian inference, using MrBayes, version 3.0b4 (Huelsenbeck and Ronquist, 2001; Ronquist and Huelsenbeck, 2003). The models for the analyses were selected using the Akaike information criterion in MrModeltest, version 2.1 (Nylander, 2004), in conjunction with PAUP¤, version 4.0b10 (SwoVord, 2002). The same model, GTR+I+G (a general time-reversible model with estimated proportion of invariable sites, and gamma distributed rate variation across sites), was selected for all three genes. Substitution rates, character state frequencies, gamma shape parameter, and proportion of invariable sites were unlinked between the genes. Four Markov chains (one cold and three heated) were run simultaneously for 2 million generations, with trees sampled every 100th generation. Each of the chains was started from a random starting tree.

Trees sampled during the burn-in phase were discarded. Four replicate analyses (times four Markov chains each) were performed, to insure that the individual runs converged on the same target distribution (Huelsenbeck et al., 2002). 3. Results 3.1. Trees based on analyses of the combined data set Regarding the 15/45 alignment, there were 800 informative sites when gaps were coded as missing data, and 829 when gaps were coded as a Wfth character state. The total number of sites was 2699. The corresponding number for the 15/15 alignment was 772 and 813, respectively, out of a total number of 2722 sites. Since the topologies of all of the trees emanating from the diVerent analyses based on the combined data set are similar, we have chosen to describe the parsimony tree based on the 15/45 alignment in more detail, and just present in which important respects the other trees diVer from this one. When jackknife frequencies diVer between the Xac (gaps treated as missing data) and the Gax (gaps treated as a Wfth character state) analyses, they are presented in the following way: (Xac/Gax). Posterior probabilities from the four individual runs (of each of the two alignments) in MrBayes are reported as a range, when they are not identical. 3.1.1. Parsimony, alignment 15/45 (Fig. 1) There is strong support (jackknife frequency 100%) for TubiWcidae (sensu Erséus and Gustavsson, 2002; i.e., including the former Naididae). The rhyacodriline Heronidrilus heronae is placed as the sister to Naidinae + Rhyacodrilus spp., Epirodrilus pygmaeus, Ainudrilus spp., and Monopylephorus rubroniveus, albeit weakly supported (52%/71%). The clade containing Naidinae and Rhyacodrilus spp., Epirodrilus pygmaeus, Ainudrilus spp., and Monopylephorus rubroniveus is strongly supported (100%). These rhyacodriline genera group together with Pristina spp. (95%), but the clade that

576

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

these taxa constitute is an unresolved tetrachotomy: Rhyacodrilus subterraneus is placed together with R. falciformis (67%/75%), Epirodrilus pygmaeus is placed together with Monopylephorus rubroniveus (100%), Rhyacodrilus hiemalis is placed together with R. coccineus (100%), and Ainudrilus spp. (100%) and Pristina spp. (100%) are sister groups (82%/92%). Naidinae sensu stricto (without Pristina), is well-supported (99%/91%), although poorly resolved. Within this clade the

genus Chaetogaster (100%) is the sister group to the rest. Dero spp. are recovered as monophyletic (100%) as are Paranais spp. (100%). A third group, although more weakly supported (77%/80%), contains Ophidonais serpentina, Slavina appendiculata, Vejdovskyella comata, Nais spp., Specaria josinae, Piguetiella blanci, Stylaria spp., Ripistes parasita, and Uncinais uncinata. The two Stylaria species are placed together with Ripistes parasita, and this assemblage is well-

Fig. 1. Phylogenetic tree obtained from the parsimony analysis of the combined data set, alignment 15/45, with gaps coded as missing data (Xac). Jackknife frequencies 750% are indicated in front of the nodes. Nai, Naidinae; Rhy, Rhyacodrilinae; Pha, Phallodrilinae; Tub, TubiWcinae; Lim, Limnodriloidinae.

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

supported (96%). Nais alpina, N. pardalis, and N. variabilis form a clade together with Uncinais uncinata (100%/99%). Limnodriloidinae is recovered as monophyletic (100%). In the Gax tree, TubiWcinae forms a clade together with the rhyacodriline Branchiura sowerbyi (89%), but this assemblage is not recovered in the Xac tree. The three tubiWcine species Limnodrilus hoVmeisteri, TubiWcoides pseudogaster, and Tubifex ignotus are consistently clustered together (73%/86%). The four phallodriline species form a clade together with the rhyacodrilines Bothrioneurum vejdovskyanum and Heterodrilus chenianus (92%/83%), making Phallodrilinae appearing non-monophyletic. The rhyacodriline species are scattered in the tree, suggesting the group is polyphyletic. 3.1.2. Parsimony, alignment 15/15 (Fig. 2) The Pristina species are not clustered together with the rhyacodriline genera Ainudrilus, Rhyacodrilus, Epirodrilus, and Monopylephorus. The four Pristina species form a strongly supported group (jackknife frequency 100%), but this clade holds a basal position in the Rhyacodrilinae/ Naidinae clade (which is strongly supported; 100%) in the Xac tree (although the support for the sister group is weak; 61%), and is part of a polytomy in the Gax tree. The rhyacodriline Heronidrilus heronae is the sister to this clade (63%) in the Gax tree (as it was in the 15/45 trees), but this node is not present in the Xac tree. Within Naidinae sensu stricto, there is a group (although weakly supported; 64%/ 53%) comprising Ophidonais serpentina and Nais elinguis, not recovered in the 15/45 trees. In the Gax tree, the monophyly of TubiWcinae is supported (71%). 3.1.3. Bayesian inference, alignment 15/45 (Fig. 3) TubiWcidae is divided into two groups. One comprises Naidinae and the rhyacodrilines Rhyacodrilus spp., Ainudrilus spp., Epirodrilus pygmaeus, Monopylephorus rubroniveus, and Heronidrilus heronae (posterior probability 0.99–1.00). The other clade consists of the rest of the rhyacodrilines together with Phallodrilinae, TubiWcinae, and Limnodriloidinae. Dero spp. is suggested to be monophyletic (1.00), and has a basal position in the Naidinae sensu stricto clade, instead of Chaetogaster spp., the group holding that position in the parsimony trees. Allonais inaequalis is the second branch. Specaria josinae, Piguetiella blanci, and Nais communis are clustered together (0.87–0.93). TubiWcinae is recovered as monophyletic (0.90–0.95) and this group is placed as the sister to Branchiura sowerbyi (1.00). 3.1.4. Bayesian inference, alignment 15/15 (Fig. 4) The rhyacodriline Bothrioneurum vejdovskyanum is placed as the sister to the remaining tubiWcid clade, the latter holding posterior probability 0.97–1.00. Specaria josinae, Piguetiella blanci, and Nais communis are clustered together (0.84–0.88). Slavina appendiculata, Vejdovskyella comata, Ophidonais serpentina, and Nais elinguis form an assemblage (0.75–0.78).

577

TubiWcinae is recovered as monophyletic (0.98–0.99), and this group is the sister to Branchiura sowerbyi (0.99–1.00). 3.2. Gene trees (parsimony) Jackknife frequencies are presented as a range when they are not identical in all of the trees (based on the six diVerent alignments, respectively). 3.2.1. 12S rDNA (trees not shown) The six alignments varied in length between 414 (alignment 15/45) and 441 (10/10) base pairs, of which the number of informative sites ranged from 290 (15/15) to 304 (15/ 45). The tree topologies are similar, with no important supported conXicts, regardless of alignment parameters. A clade containing Naidinae and the rhyacodriline genera Ainudrilus, Rhyacodrilus, Epirodrilus, and Monopylephorus is present in all of the trees (jackknife frequency 55–90%), except for in the 30/15 tree, in which the Pristina species are placed as part of an unresolved basal node. Pristina spp. are placed together, consistently strongly supported (100%). Within the Naidinae/Rhyacodrilinae clade, Naidinae sensu stricto (without Pristina) is strongly supported (99–100%). However, within this clade, resolution is low, but the genera Paranais and Chaetogaster show strong support (100% and 91–99%, respectively). The four species belonging to Limnodriloidinae are clustered together (88–100%). 3.2.2. 16S rDNA (trees not shown) The six alignments varied in length between 510 (15/45) and 527 (30/15) base pairs, and the number of informative sites ranged from 300 (10/10) to 321 (15/30). The tree topologies are similar, regardless of alignment parameters. The same Naidinae/Rhyacodrilinae clade as recovered in the 12S rDNA trees is identiWed by 16S rDNA (jackknife frequency 55–96%). Naidinae sensu stricto (without Pristina) is strongly supported in all of the trees (97–100%), and Pristina is recovered as monophyletic (100%). Within Naidinae sensu stricto, resolution is low. However, Paranais and Chaetogaster are each supported by 100%, and Dero by 84–100%. The four species belonging to Limnodriloidinae are clustered together (55–84%). 3.2.3. 18S rDNA (trees not shown) The six alignments varied in length between 1775 (15/45) and 1779 (10/10) sites, and the number of informative sites ranged from 174 (10/10) to 177 (15/30 and 30/40). The tree topologies are virtually identical, regardless of alignment parameters. TubiWcidae (sensu Erséus and Gustavsson, 2002) is supported (jackknife frequency 81–96%). The Naidinae/Rhyacodrilinae clade recovered in the two mitochondrial gene trees is identiWed by 18S rDNA as well (94–97%). Pristina is recovered as monophyletic (92–95%). Nais alpina, N. pardalis, N. variabilis and Uncinais uncinata form a well-supported clade (93–95%). Stylaria lacustris, S.

578

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

Fig. 2. Phylogenetic tree obtained from the parsimony analysis of the combined data set, alignment 15/15, with gaps coded as missing data (Xac). Jackknife frequencies 750% are indicated in front of the nodes. Nai, Naidinae; Rhy, Rhyacodrilinae; Pha, Phallodrilinae; Tub, TubiWcinae; Lim, Limnodriloidinae.

fossularis and Ripistes parasita group together (76–79%). Monophyly of the genus Chaetogaster is supported (81–91%). The four species belonging to Limnodriloidinae cluster together (52–65%). Another clade containing the rhyacodriline Heterodrilus chenianus and the phallodrilines Pirodrilus minutus, Olavius algarvensis, and Inanidrilus aduncosetis

is recovered in all of the trees (74–90%). Furthermore, the rhyacodriline Branchiura sowerbyi forms a clade together with the four species belonging to TubiWcinae (64–71%). Jackknife frequencies and posterior probabilities for the most important clades are listed in Table 4.

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

579

Fig. 3. Phylogenetic tree obtained from one of the four Bayesian analyses (MrBayes) of the combined data set, alignment 15/45. Posterior probabilities 70.75 are indicated in front of the nodes (lowest–highest value from the four runs). Nai, Naidinae; Rhy, Rhyacodrilinae; Pha, Phallodrilinae; Tub, TubiWcinae; Lim, Limnodriloidinae.

4. Discussion The decision to use two mitochondrial genes in combination with the frequently used nuclear gene 18S rDNA proved to be fruitful. The trees based on the combined data set are more resolved and have stronger supported nodes than the trees based on 18S rDNA alone. Moreover, several clades are supported by all three individual genes, which is positive, bearing in mind that the mitochondrial and nuclear genomes are separate genetic entities. A possible disadvantage dealing

with fast-evolving mitochondrial genes is that there may be hyper-variable regions, leading to ambiguous alignments. These “noisy” regions may have an impact on the outcome of the phylogenetic analysis, if the signal of the more stable regions is not strong enough. However, since we obtained the same basic phylogenetic pattern from all the alignments that we investigated, we found it justiWable to ignore these apprehensions in our case. The monophyletic status of TubiWcidae sensu Erséus and Gustavsson (2002), that is, the hypothesis that “Naididae”

580

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

Fig. 4. Phylogenetic tree obtained from one of the four Bayesian analyses (MrBayes) of the combined data set, alignment 15/15. Posterior probabilities 70.75 are indicated in front of the nodes (lowest–highest value from the four runs). Nai, Naidinae; Rhy, Rhyacodrilinae; Pha, Phallodrilinae; Tub, TubiWcinae; Lim, Limnodriloidinae.

is a derived group within TubiWcidae (see also Brinkhurst, 1994; Christensen and Theisen, 1998; Erséus, 1987, 1990; Erséus and Källersjö, 2004; Erséus et al., 2000, 2002; Ferraguti et al., 1999; Sjölin et al., 2005) is strongly supported by the combined data set, regardless of method used. This clade is recovered in the 18S rDNA trees as well, but not in the gene trees based on the analyses of 12S rDNA and 16S rDNA, respectively. However, the support for this clade is

stronger in the trees based on the combined data set than in the 18S rDNA trees. As noted above, the two most important reasons for assigning “Naididae” family status have been the ability of asexual reproduction, and the unique anterior position of the genitalia. However, these characters are probably coupled. Shifts in the position of genitalia most certainly occur occasionally in individuals of any oligochaete species, either as the result of a mutation or as a

Ranges reported for the individual gene trees refer to the six diVerent alignments; ranges reported for the Bayesian trees refer to the four separate runs in MrBayes.

1.00 1.00 1.00 0.88–0.93 91 95 99 95 100 — 100 — 97–100 (15/15: 55%, 15/45: 58%) 99–100 —

— —

0.99–1.00 0.93–0.96 71 52 63 — — —

—

1.00 1.00 1.00 1.00 100 100 100 100 100 100 100 100 (15/30: 52%) 55–90

TubiWcidae (incl. Naidinae) Naidinae + Ainudrilus, Rhyacodrilus, Epirodrilus, and Monopylephorus Naidinae + Heronidrilus, Ainudrilus, Rhyacodrilus, Epirodrilus, and Monopylephorus Naidinae without Pristina Pristina + Ainudrilus, Rhyacodrilus, Epirodrilus, and Monopylephorus

81–96 94–97 — 55–96

12S rDNA, Xac, jackknife frequency (%) Clade

Table 4 Comparison of trees with supports for various clades

16S rDNA, Xac, jackknife frequency (%)

18S rDNA, Xac, jackknife frequency (%)

Comb. data set, Xac, (15/15), jackknife frequency (%)

Comb. data set, Gax, (15/15), jackknife frequency (%)

Comb. data set, Xac, (15/45), jackknife frequency (%)

Comb. data set, Gax, (15/45), jackknife frequency (%)

Comb. data set, MrBayes, (15/15), posterior probability

Comb. data set, MrBayes, (15/45), posterior probability

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

581

developmental “error.” If caused by an occasional genetic variation in a single specimen, the forward shift may be rapidly spread, and Wnally established, in the population by cloning (Erséus, 1984). A clade containing Naidinae and the four rhyacodriline genera Ainudrilus, Rhyacodrilus, Epirodrilus, and Monopylephorus is recovered in all of our trees based on the individual genes (except for 12S, alignment 30/15), as well as the combined data set. Interestingly, according to our analyses, Naidinae is a non-monophyletic group, with these rhyacodriline genera nested within. As mentioned above, the naidines were placed among, or at least close to, rhyacodrilines in previous phylogenetic studies, based on morphological (Brinkhurst, 1994; Erséus, 1990) as well as molecular (Christensen and Theisen, 1998; Erséus et al., 2000, 2002; Sjölin et al., 2005) data. The coelomic Xuid of most naidines and most rhyacodrilines is mingled with numerous coelomocytes (a special type of freely circulating cells) (Jamieson, 1981). Moreover, both groups have prostate glands that cover most of the surface of the atrium (so called “diVuse” prostate glands) (Erséus, 1990). Morphogenetic studies of the male genitalia have shown that the prostate glands of species belonging to Naidinae and Rhyacodrilinae are of mesodermal instead of ectodermal origin, and this is probably a homology (Gustavsson and Erséus, 1997, 1999; Gustavsson, 2004). Another similarity is the possession of modiWed penial chaetae (a special type of chaetae associated with the male genital openings) (Erséus, 1990). Within the clade comprising Naidinae and four particular genera of Rhyacodrilinae, Pristina is of special interest; Pristina is the group that makes Naidinae non-monophyletic. In both of the parsimony analyses (Xac/Gax) of the combined data set, aligned with gap opening penalty combination 15/45, Pristina forms a clade together with the four rhyacodriline genera, and this is well supported. This is the outcome of the Bayesian analyses as well. The Xac analysis of the 15/15 alignment puts Pristina as the sister to a group containing the rest of the naidines together with Ainudrilus, Rhyacodrilus, Epirodrilus, and Monopylephorus [although this latter clade is weakly supported (61%)], whereas Pristina is one of four unresolved groups in the tree reXecting the Gax analysis of the 15/15 alignment of the combined data set. That is, interestingly, Pristina is never clustered together with the rest of the naidines. Pristina is actually morphologically deviant as compared to the other naidines. Its species possess testes and spermathecae in segment VII, and ovaries and atria in segment VIII, which is more posterior than the condition in the other naidines. Moreover, they usually have dorsal chaetae from segment II, which is the usual tubiWcid condition, whereas almost all other naidines have at least some anterior segments devoid of dorsal chaetae. Furthermore, Pristina forms seven segments anteriorly during Wssion, whereas the other naidines only form four to Wve segments (Brinkhurst and Jamieson, 1971; Sperber, 1948). Our results indicate that the ability of Wssion either has arisen once and later disappeared among particular rhyacodrilines, or has it arisen twice: once in the Pristina

582

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

lineage, and once in the lineage leading to the remaining naidines. The last explanation may be the most probable, taking the deviant Pristina morphology into consideration. Our results are congruent with the study by Bely and Wray (2004), using the mitochondrial gene cytochrome oxidase I (COI), and including 26 species of naidines. In their analysis, Pristina came out as the sister to all other naidine taxa. However, they included only one representative of Rhyacodrilinae, Branchiura sowerbyi, a species that was not placed together with the naidines neither in our study, nor in theirs. Unfortunately, the resolution within Naidinae sensu stricto is low, and the trees based on parsimony and Bayesian inference, respectively, are not completely concordant, especially not in the basal parts. It is, thus, impossible to make any detailed conclusions about naidine phylogeny on the basis of the present study. Nevertheless, some groups are well-supported in all of the analyses based on the combined data set, as well as the individual genes. Three out of the six naidine genera represented by more than one species are recovered as monophyletic, with strong support: Pristina, Chaetogaster, and Paranais (Paranais not supported by 18S rDNA), respectively. Dero is well-supported in the parsimony trees based on the combined data set, and in the trees based on the Bayesian analyses of the 15/45 alignment (combined data set), but this clade is not present in the trees based on Bayesian analyses of the 15/15 alignment (combined data set). Dero is supported in the trees based on 16S rDNA, too, but not in the trees based on 18S rDNA. (Regarding 12S rDNA, only one of the two Dero species was included). Interestingly, Nais is not recovered as monophyletic: N. alpina, N. pardalis, and N. variabilis form a wellsupported clade together with Uncinais uncinata in all of the trees based on the combined data set, while N. elinguis and N. communis are not part of this clade. This is partly in accordance with the results of the study by Bely and Wray (2004), based on COI. They included three Nais species: N. bretscheri, N. communis, and N. variabilis, and in their analysis N. communis was separated from the other two. The two Stylaria species are consistently placed together with Ripistes parasita in the trees based on the combined data set, as well as in the trees based on 12S rDNA (however, 12S rDNA from Stylaria fossularis not included in the analysis), and 18S rDNA, respectively. This is especially interesting in the light of an annotation of Sperber (1948): the genera Stylaria, Arcteonais (not represented in this study), and Ripistes have several peculiar characters mainly to themselves, i.e., a more or less pronounced proboscis, a suddenly dilating stomach, and a special mode of swimming. The results of our study are congruent with the morphology-based division of the former Naididae, made by Lastobkin (1924). As described in Introduction, according to him, there are two groups within “Naididae”: Pristininae (Pristina) and Naidinae sensu Lastobkin (all other genera). However, resolution within this clade is too low to enable any detailed evaluation of the concordance between the

results of our study and the classiWcations proposed by Sperber (1948) and Nemec and Brinkhurst (1987). The non-monophyletic status of Rhyacodrilinae was suggested by Erséus (1990) on the basis of morphological characters, and this taxon is not supported by any of our present analyses, since most rhyacodrilines (Rhyacodrilus spp., Epirodrilus pygmaeus, Monopylephorus rubroniveus, and Ainudrilus spp.) are nested within Naidinae. In the trees based on the analyses of the combined data set, Heronidrilus heronae is the sister to this group (or is placed unresolved outside it), Branchiura sowerbyi is most often clustered with the tubiWcines, and Heterodrilus chenianus is consistently placed together with the phallodrilines Pirodrilus minutus, Olavius algarvensis, and Inanidrilus aduncosetis. A close relationship between Heterodrilus and Phallodrilinae has been proposed before, based on ciliated atria and lack of hair chaetae (Erséus, 1990), and this is also congruent with the studies by Erséus et al. (2000, 2002), based on 18S rDNA, and Sjölin et al. (2005), based on combined 16S rDNA and 18S rDNA data. Regarding the other tubiWcid subfamilies, the taxon sampling is too limited to enable any conclusions. However, it is worth mentioning that a monophyletic Limnodriloidinae clade was recovered in all of our trees, also in the individual gene trees. Limnodriloidinae was monophyletic in the study by Sjölin et al. (2005), but they did not use 12S rDNA. In our study, Limnodriloidinae is strongly supported also by this particular gene. To summarize, the most interesting results from this study is the close relationship between Naidinae and the rhyacodriline genera Rhyacodrilus, Epirodrilus, Monopylephorus, and Ainudrilus, and the suggestion that Naidinae as well as Rhyacodrilinae are non-natural groups. This is supported regardless of alignment parameters and phylogenetic method. Naidinae sensu stricto (without Pristina spp) is consistently recovered as monophyletic, but Pristina appears to represent a separate lineage among these rhyacodrilines. The taxonomic implication of this would be that either the rhyacodriline genera Rhyacodrilus, Epirodrilus, Monopylephorus, and Ainudrilus should be included within Naidinae, or Pristina should be excluded from this subfamily. Acknowledgments We are indebted to Emilia Rota, Adrian Pinder, Tarmo Timm, Hongzhu Wang, Michael Norén, Tetsuya Narita, Dan Shain, Steve Fend, Jana Schenkova, and Deedee Kathman for the donation of specimens. We are also grateful to Bodil Cronholm for skilful assistance with the laboratory work; to Steve Farris for providing software; to Johan A. Nylander and Martin Irestedt for advices regarding Bayesian analysis; and to Lena Gustavsson and Erica Sjölin for inspiring discussions about worms among other things. This research was supported by the Swedish Research Council (Grant number 621-2001-2788 to CE).

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

References Apakupakul, K., Siddall, M.E., Burreson, E.M., 1999. Higher level relationships of leeches (Annelida: Clitellata: Euhirudinea) based on morphology and gene sequences. Mol. Phylogenet. Evol. 12, 350–359. Armendáriz, L.C., 2000. Population dynamics of Stylaria lacustris (Linnaeus, 1767) (Oligochaeta, Naididae) in Los Talas, Argentina. Hydrobiologia 438, 217–226. Bely, A.E., Wray, G.A., 2001. Evolution of regeneration and Wssion in annelids: insights from engrailed- and orthodenticle-class gene expression. Development 128, 2781–2791. Bely, A.E., Wray, G.A., 2004. Molecular phylogeny of naidid worms (Annelida: Clitellata) based on cytochrome oxidase I. Mol. Phylogenet. Evol. 30, 50–63. Brinkhurst, R.O., 1985. The generic and subfamilial classiWcation of the Naididae (Annelida: Oligochaeta). Proc. Biol. Soc. Wash. 98, 470–475. Brinkhurst, R.O., 1994. Evolutionary relationships within the Clitellata: an update. Megadrilogica 5, 109–116. Brinkhurst, R.O., Coates, K.A., 1985. The genus Paranais (Oligochaeta, Naididae) in North America. Proc. Biol. Soc. Wash. 98, 303–313. Brinkhurst, R.O., Jamieson, B.G.M., 1971. Aquatic Oligochaeta of the World. Oliver & Boyd, Edinburgh. Christensen, B., Theisen, B.F., 1998. Phylogenetic status of the family Naididae (Oligochaeta, Annelida) as inferred from DNA analyses. J. Zool. Syst. Evol. Res. 36, 169–172. Collado, R., Schmelz, R.M., 2000. Pristina silvicola and Pristina terrena spp. nov., two new soil-dwelling species of Naididae (Oligochaeta, Annelida) from the tropical rain forest near Manaus, Brazil, with comments on the genus Pristinella. J. Zool. 251, 509–516. Dehorne, L., 1916. Les naïdimorphes et leur reproduction asexuée. Arch. Zool. Exp. Gén. 56, 25–157. Erséus, C., 1984. Aspects of the phylogeny of the marine TubiWcidae. Hydrobiologia 115, 37–44. Erséus, C., 1987. Phylogenetic analysis of the aquatic Oligochaeta under the principle of parsimony. Hydrobiologia 155, 75–89. Erséus, C., 1990. Cladistic analysis of the subfamilies within the TubiWcidae (Oligochaeta). Zool. Scr. 19, 57–63. Erséus, C., 2005. Phylogeny of oligochaetous Clitellata. Hydrobiologia 535/536, 357–372. Erséus, C., Ferraguti, M., 1995. The use of spermatozoal ultrastructure in phylogenetic studies of TubiWcidae (Oligochaeta). In: Jamieson, B.G.M., Ausio, J., Justine J.-L. (Eds.), Advances in Spermatozoal Phylogeny and Taxonomy. Mém. Mus. Natn. Hist. Nat. 166, 189–201. Erséus, C., Gustavsson, L., 2002. A proposal to regard the former family Naididae as a subfamily within TubiWcidae (Annelida, Clitellata). Hydrobiologia 485, 253–256. Erséus, C., Gustavsson, L., Brinkhurst, R.O., 2005. TubiWcidae Vejdovský, 1876 (Annelida, Clitellata): proposed precedence over Naididae Ehrenberg, 1828. Bull. Zool. Nomencl. 62, 226–231. Erséus, C., Källersjö, M., 2004. 18S rDNA phylogeny of Clitellata (Annelida). Zool. Scr. 33, 187–196. Erséus, C., Källersjö, M., Ekman, M., Hovmöller, R., 2002. 18S rDNA phylogeny of the TubiWcidae (Clitellata) and its constituent taxa: dismissal of the Naididae. Mol. Phylogenet. Evol. 22, 414–422. Erséus, C., Prestegaard, T., Källersjö, M., 2000. Phylogenetic analysis of TubiWcidae (Annelida, Clitellata) based on 18S rDNA sequences. Mol. Phylogenet. Evol. 15, 381–389. Farris, J.S., 1972. Inferring phylogenetic trees from distance matrices. Am. Naturalist 106, 645–668. Farris, J.S., 1997a. Xac (Computer Software and Manual). Distributed by the author. Laboratory of Molecular Systematics, Swedish Museum of Natural History, Stockholm. Farris, J.S., 1997b. Gax (Computer Software and Manual). Distributed by the author. Laboratory of Molecular Systematics Swedish Museum of Natural History, Stockholm. Farris, J.S., Albert, V.A., Källersjö, M., Lipscomb, D., Kluge, A.G., 1996. Parsimony jackkniWng outperforms neighbor-joining. Cladistics 12, 99–124.

583

Ferraguti, M., Erséus, C., Kaygorodova, I., Martin, P., 1999. New sperm types in Naididae and Lumbriculidae (Annelida: Oligochaeta) and their possible phylogenetic implications. Hydrobiologia 406, 213–222. Gustavsson, L.M., 2004. Development of the genital ducts in Telmatodrilinae (TubiWcidae, Clitellata). J. Morphol. 262, 791–799. Gustavsson, L.M., Erséus, C., 1997. Morphogenesis of the genital ducts and spermathecae in Clitellio arenarius, Heterochaeta costata, TubiWcoides benedii (TubiWcidae) and Stylaria lacustris (Naididae) (Annelida, Oligochaeta). Acta Zool. 78, 9–31. Gustavsson, L.M., Erséus, C., 1999. Development of the genital ducts and spermathecae in the rhyacodrilines Rhyacodrilus coccineus and Monopylephorus rubroniveus (Oligochaeta, TubiWcidae). J. Morphol. 242, 141– 156. Hovmöller, R., Pape, T., Källersjö, M., 2002. The Palaeoptera problem: basal pterygote phylogeny inferred from 18S and 28S rDNA sequences. Cladistics 18, 313–323. Huelsenbeck, J.P., Larget, B., Miller, R.E., Ronquist, F., 2002. Potential applications and pitfalls of Bayesian inference of phylogeny. Syst. Biol. 51, 673–688. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Jamieson, B.G.M., 1981. The Ultrastructure of the Oligochaeta. Academic Press, London, pp. 62–95. Jamieson, B.G.M., Tillier, S., Tillier, A., Justine, J.-L., Ling, E., James, S., McDonald, K., Hugall, A.F., 2002. Phylogeny of the Megascolecidae and Crassiclitellata (Annelida, Oligochaeta): combined versus partitioned analysis using nuclear (28S) and mitochondrial (12S, 16S) rDNA. Zoosystema 24, 707–734. Källersjö, M., Farris, J.S., Chase, M.W., Bremer, B., Fay, M.F., Humphries, C.J., Petersen, G., Seberg, O., Bremer, K., 1998. Simultaneous parsimony jackknife analysis of 2538 rbcL DNA sequences reveals support for major clades of green plants, land plants, seed plants and Xowering plants. Plant Syst. Evol. 213, 259–287. Lastobkin, D.A., 1924. New and rare Copepoda and Oligochaeta from Central Russia. Bull. Inst. Hydrol. Russ. Leningrad, 9 [cited in Sperber, 1948]. Loden, M.S., 1981. Reproductive ecology of Naididae (Oligochaeta). Hydrobiologia 83, 115–123. Martin, P., 2001. On the origin of the Hirudinea and the demise of the Oligochaeta. Proc. R. Soc. Lond. B 268, 1089–1098. Martin, P., Kaygorodova, I., Sherbakov, D.Yu., Verheyen, E., 2000. Rapidly evolving lineages impede the resolution of phylogenetic relationships among Clitellata (Annelida). Mol. Phylogenet. Evol. 15, 355–368. Nemec, A.F.L., Brinkhurst, R.O., 1987. A comparison of methodological approaches to the subfamilial classiWcation of the Naididae (Oligochaeta). Can. J. Zool. 65, 691–707. Norén, M., Jondelius, U., 1999. Phylogeny of the Prolecithophora (Platyhelminthes) inferred from 18S rDNA sequences. Cladistics 15, 103–112. Nylander, J.A.A., 2004. MrModeltest 2.1. (Computer Software). Distributed by the author. Evolutionary Biology Centre, Uppsala University, Uppsala. Omodeo, P., 1998. History of Clitellata. Ital. J. Zool. 65, 51–73. Palumbi, S.R., Martin, A.P., Romano, S.R., McMillan, W.O., Stice, L., Grabowski, G., 1991. The simple fool’s guide to PCR. Version 2.0. Department of Zoology, University of Hawaii, Honolulu. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Siddall, M.E., Apakupakul, K., Burreson, E.M., Coates, K.A., Erséus, C., Gelder, S.R., Källersjö, M., Trapido-Rosenthal, H., 2001. Validating Livanow: Molecular data agree that leeches, branchiobdellidans, and Acanthobdella peledina form a monophyletic group of oligochaetes. Mol. Phylogenet. Evol. 21, 346–351. Sjölin, E., Erséus, C., Källersjö, M., 2005. Phylogeny of TubiWcidae (Annelida, Clitellata) based on mitochondrial and nuclear sequence data. Mol. Phylogenet. Evol. 35, 431–441. Sperber, C., 1948. A taxonomical study of the Naididae. Zool. Bidrag Uppsala 28, Uppsala. Staden, R., Beal, K.F., BonWeld, J.K., 1998. The Staden Package. In: Misener, S., Krawets, S.A. (Eds.), Computer Methods in Molecular Biology

584

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

132: Bioinformatics Methods and Protocols. Humana Press, Totowa, pp. 115–130. SwoVord, D.L., 2002. PAUP¤. Phylogentic Analysis Using Parsimony (¤ and other methods). Version 4.0b10. Sinauer Associates, Sunderland, MA.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: Xexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.