Molecular genetic identification of crustose representatives of the order Corallinales (Rhodophyta) in Chile

MOLECULAR PHYLOGENETICS AND EVOLUTION Molecular Phylogenetics and Evolution 28 (2003) 404–419 www.elsevier.com/locate/ympev

Molecular genetic identification of crustose representatives of the order Corallinales (Rhodophyta) in Chileq Rodrigo Vidal,a Isabel Meneses,b,* and Macarena Smithb b

a Departamento de Biolog
ıa, Facultad de Qu
ımica y Biolog
ıa, Universidad de Santiago, Chile Departamento de Ecolog
ıa, Facultad de Ciencias Biol
ogicas, Pontificia Universidad Cat
olica de Chile, Casilla 114-D, Santiago, Chile

Received 24 July 2002; received in revised form 20 December 2002

Abstract Knowledge on species of the order Corallinales along the coast of Chile is still scarce despite a number of studies and records of other divisions of seaweeds made since the early 20th century. This lack of information is more dramatic among crustose representatives of the order, thus depriving biogeographic studies of a thorough analysis and resulting in inadequately representative accounts of biodiversity. The currently changing taxonomy of the group makes it difficult to identify and differentiate among taxa based on morphological and developmental characters. Therefore, the use of molecular tools has been adopted in this study in order to facilitate identification and comparison of crustose corallines collected at the rocky intertidal between 27° and 48°S along the Pacific temperate coast of South America. A sequence 600 bp (in length) from the SSU-rDNA gene was used to identify five taxa to the genus level: Lithophyllum, Spongites, Mesophyllum, Synarthrophyton, and Leptophytum. In all cases, the genus distinction based on morphological characters coincide with designations based on variation in the ribosomal DNA gene sequence. Spongites is the most frequently occurring genus and is found in all localities sampled while the others appear occasionally. Taxa recognition at species level must be examined with caution considering that morphological variability is not well understood in Chile because the SSU-rDNA region sequence does not always stand alone as an unambiguous means of identifying all coralline species. In such cases, more rapidly evolving markers are needed. For example, sequences from the ITS (rDNA) region often provide greater resolution among closely related species and genera. However, the methodology presented here remains a useful tool for species-level identification. Ó 2003 Elsevier Science (USA). All rights reserved.

1. Introduction The crustose coralline algae represent a very welldefined morphological group within the order Corallinales (Rhodophyta). In addition to having calcified cell walls (except for their sexual and asexual means of reproduction), all members are crustose and grow attached to the substrate by the entire or better part of their thallus extension. Along the Chilean coasts (18–56°S), despite information available for other components of the marine algal flora (Etcheverry et al., 1980; John et al., 1994; Pinto, 1989; Ram
ırez, 1982; Ram
ırez and Peters, 1992; Ram
ırez and Rojas, 1988; Santelices and Montalva, q Presented at the 2002 annual meeting of the Society for Molecular Biology and Evolution (SMBE), Sorrento, Italy, June 13–16, 2002. * Corresponding author. Fax: +56-2-686-2621. E-mail address: [email protected] (I. Meneses).

1983; Santelices et al., 1989; Westermeier and Ram
ırez, 1978), an extremely variable body of knowledge exists in crustose coralline species composition. Records from the beginning of the 20th century (Foslie, 1900, 1905, 1906, 1907a,b,c, 1908, 1909; Heydrich, 1901; Lemoine, 1913, 1920), either barely listed or fully described—with obsolete characters at this point—the collections from expeditions made at the time. The latest information on the group—in northern Chile (Meneses, 1988) and at the tip of South America (Mendoza, 1988; Mendoza et al., 1996)—indicate the occurrence of similar genera here and in other coasts of the Southern hemisphere such as Australia (Harvey et al., 1994; May and Woelkerling, 1988; Penrose, 1991, 1992a,b; Penrose and Woelkerling, 1988, 1991), New Zealand (Woelkerling and Foster, 1989), and South Africa (Chamberlain, 1994; Chamberlain and Keats, 1994; Keats and Chamberlain, 1997; Keats and Maneveldt, 1997). This is not surprising since biogeographical

1055-7903/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S1055-7903(03)00123-4

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

studies in the entire marine flora of the Pacific temperate coasts of South America (Meneses and Santelices, 2000) indicate that approximately 32% of this flora has a subAntarctic origin and that they share representatives also known in Australia, South Africa, and the sub-Antarctic islands. Nevertheless, biogeographical comparisons in Corallinales cannot be made without the basic information of the genera and species occurring on these coasts. Historically, the taxonomy of the Corallinales have been under constant examination, in particular the crustose representatives (e.g., Spongites, Mesophyllum, and Synarthrophyton), due to the variability of the morphological characters frequently used to differentiate among genera and species (Harvey et al., 1994; Penrose, 1991; Penrose and Woelkerling, 1988). Moreover, it has been reported that morphological differences in Coralline species can be affected by geographic, seasonal and environmental conditions, thereby further complicating attempts at morphological discrimination (Woelkerling, 1988). Over the decades, the value of some of the original characters used for taxonomic purposes has been tested and some of them (mainly vegetative) have been discarded and replaced by others (Woelkerling, 1985; Cabioch and Mendoza, 1988 among others) in the process. Most of the new characters under examination are reproductive and currently observed under light and SEM microscopy. However, the use of reproductive characters, has proven to be limiting to the collection of gametophytes and sporophytes with their structures in particular levels of development. The finding of the material for that purpose is hardened by the fact that it cannot be recognized directly in the field but through the slow processing of samples in order to observe them under light microscopy and SEM combined. Within the scope of a study that involves identifying the genera and species of intertidal crustose corallines along the coasts of Chile (27–48°S), it has been essential to redefine the approaches to this identification, because we have also encountered the difficulties implicit in the morphological variability of these algae. In taxonomically difficult groups of algae such as Corallinales, molecular tools are increasingly being used to elucidate the systematic positions of genera, species, and subspecies. Nucleotide sequences of the nuclear ribosomal RNA have been used successfully for taxonomic, systematic, and biogeographic studies in several red seaweed genera using phylogenetic methods (Brodie et al., 1996; Goff et al., 1994; Maggs and Ward, 1996; M€ uller et al., 1998; Pathway et al., 1998; Saunders et al., 1996). Therefore, we have approached the problem of identifying Corallinales in the Chilean coast, using molecular data as taxonomic characters as well as morphological ones. In particular, we compared the sequences of the first half of the small sub-unit ribosomal RNA (SSU-rRNA) gene obtained from material collected in the Chilean coast

405

(27–48°S) with the information available in the GenBank for genera and species of this order. The first half of the SSU-rDNA gene was chosen to confirm initial morphological identification because: (i) it can be amplified universally applying PCR in all algae including coralline algae—as clearly evidenced by Bailey and Chapman (1998) and Bailey (1999)—using primers anchored in conserved sections of the gene (Harper and Saunders, 2001; White et al., 1990), (ii) it undergoes rapid concerted evolution (Moritz and Hillis, 1996), which usually eliminates multiple alleles in a population in the absence of hybridization, (iii) it presents sufficient variability and easy alignment in a wide taxonomic range, (iv) short DNA fragments are more likely to occur in herbarium specimens, and thus it is more probable that the first half of the SSU-rDNA gene is amplified from these type of samples which facilitates examining genera and species types and (v), it is used extensively by systematic phycologists and there is an extensive data set. Once the Corallinales species has been identified, more cost-effective alternative methods—such as PCR-RFLP or oligonucleotide probes— will be developed. Thus, while at the same time morphological and phenetic studies of the crustose Corallinales of the coasts of Chile are underway, the results of this molecular approach are reported here.

2. Materials and methods 2.1. Study area and sample collection Samples of crustose corallines were collected during 2 years of sampling the rocky intertidal of eight localities (Fig. 1): Caleta Angosta (28°16–71°110 W), Baratillo (28°190 S, 71°100 W), Totoralillo (30°040 S, 71°220 W), Playa Blanca (30°140 S, 71°290 W), Maitencillo (32°380 S, 71°280 W), Montemar (32°580 S, 71°340 W), Las Cruces (33°290 S, 71°380 W), and La Desembocadura (36°480 S, 73°110 W). Samples were detached from the rocky substrata with a spatula and sometimes using a hammer and chisel. Pieces of material (usually less than 2 g) were dried in the field with a paper towel and stored with Silica gel in labeled plastic bags kept at room temperature. Material was sorted in the field to be used for molecular identification and for light microscopy and SEM examination. Once in the laboratory, the material was rinsed in 70% ethanol, examined under a dissecting scope and cleaned manually of epiphytes, washed three times with sterile water, and then air-dried on filter paper. Phenotypic characters and their states were collected from specimens also included in the molecular study to permit direct comparison and avoid biases due to phenotypic differences between type specimens and the ones included in this study.

406

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

ultrafiltration of the DNA present (Centricon-100; Amicon, Beverly, MA) was added. All manipulations prior to thermal cycling (pre-PCR) were carried out in a laboratory physically separated and remote from procedures performed after PCR (post-PCR). Protective clothing, reagents, pipettes, UV-irradiated filter tips, tubes and solutions, and sterile disposable plasticware were used at all times during pre-PCR operations. A 600bp fragment of the first half of the SSU-rDNA gene was amplified by PCR following protocols (Vidal et al., 2002) using primers SPF-30 (TCTCAAAGACTAAGCCA TGC), SPR-540 (TTACAGAGCTGGAATTACCG), Taq DNA Polymerase, and Taq DNA Polymerase High Fidelity (Gibco-BRL). In the case of material that was 7 years old, a PCR product of expected size was excised from the gel with a scalpel blade and used as a template for a secondary PCR. Sequences of the PCR products were determined by cycle sequencing of double-stranded products using fluorescent dideoxy-terminators and an ABI 310 automated sequencer according to the manufacturerÕs instructions (Applied Biosystems, Prism kit). The primers utilized for the PCR were used as sequencing primers. Sequences were determined for both strands and all ABI traces were checked by eye for misread bases and polymorphism before the sequences were assembled. Intra-individual polymorphisms that could be confirmed on both strands were retained. All reference sequences have been submitted to the GenBank (Lithophyllum sp.; Accession No. AY083172, Spongites sp. 1; Accession No. AF515055, and Spongites sp. 2, Accession No. AF515056) and test sequences are available by e-mail. 2.3. Phylogenetic analysis of reference sequences and identification of test individuals

Fig. 1. Map of Chile, showing the collection sites for the Corallinales used in the present study. CA, Caleta Angosta; BAR, Baratillo, TOT, Totoralillo; PBB, Playa Blanca; MT, Maintencillo; MON, Montemar; LC, Las Cruces; and LD, La Desembocadura.

2.2. DNA extraction and sequencing Total DNA extraction followed the protocol of Vidal et al. (2002). Extractions of DNA from herbarium samples were also made according to the same protocol but with the following changes: The period of digestion was prolonged by 24 h and a step of concentration and

To make positive identifications of coralline algae from DNA extractions, we required a reference database of SSU-rDNA sequences from known samples. These reference sequences were obtained from a complete search of the GenBank database and from our own collection. Samples from the Chilean coast were included in the reference database if the organism was already examined and temporarily identified based on its morphological characters and extensive photographic evidence compared to diagnostic material (vegetative and reproductive). Where a sample was not available in vegetative and reproductive form and/or was identified only partially, the sample was considered a test. A herbarium sample test (CC-G2 05/09/91) collected by I. Meneses 10 years ago was also analyzed to confirm generic identity. Variability along the complete SSU-rDNA gene was estimated as an entropy function of the nucleotide variation using the sliding-window approach implemented in Swan (version 1) (Proutski and Holmes, 1998). An initial alignment of 41 reference taxa was

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

made with the Clustal method (Thompson et al., 1994). The multiple sequence files generated were then visually checked and corrected for alignment inconsistencies. We explored the quality of our alignment by varying alignment parameter specifications (gap opening cost, gap extension cost) and comparing alignments. Sample names were temporarily removed during manual alignments to avoid bias. Extensive use of the SSU-rDNA gene for phylogenetic reconstruction has shown that inter-generic comparisons routinely reveal multiple diagnostic differences in the form of point mutations and often include insertions and deletions (Hillis and Dixon, 1991). Intragenerically, the level of divergence between species varies from multiple differences to none. In our study, intergeneric polymorphisms were considered diagnostic for a species when multiple base substitutions or insertions and deletions were unique for the species or when combinations of changes uniquely identified a species. We did not perform extensive population-level sampling to determine if small numbers of intra-generic differences were diagnostic for our species since we assumed that the rate of mutation in the SSU-rDNA gene is conserved at that scale. Prior to phylogenetic reconstructions for identification of sample test sequences, we tested for homogeneity of base frequencies among taxa. This was done using the v2 test as implemented in PAUP, version 4.0b3a* (Swofford, 1999; which ignores correlations due to phylogenetic structure) over all sites and over parsimony-informative sites only, without constant sites (parsimony-uninformative and constant sites will mislead the v2 test). Test sequences were added to the reference database and analyzed individually and as a group to establish species identity. Phylogenetic reconstruction methods using neighbor-joining distance algorithms, as implemented in the program MEGA (Version 2.1; Kumar et al., 2001), and parsimony, as implemented in PAUP were used to determine the relationships between the reference and sample test sequences. The heuristic search option, with tree bisection-reconnection, was used for parsimony analyses. For the neighbor-joining method, the Tamura–Nei (T–N) distance correction option, available in MEGA, was used to adjust multiple substitutions. The most parsimonious trees found were consistent with the neighbor-joining tree in all details relevant to the identification of test sequences. Only the results of the neighbor-joining analyses are reported. The statistical consistency of reference and sample test sequence groupings was evaluated by bootstrapping with 1000 replicates and neighbor-joining reconstructions. Although parsimony and maximum likelihood outperform neighbor-joining for phylogenetic reconstructions under many conditions (Hillis et al., 1994) only the latter allowed bootstrap simulations with the large number of taxa used here.

407

3. Results 3.1. Phylogenetic relationships of reference sequences The mutational spectrum from complete SSU-rDNA reference sequences obtained from the GenBank shows the first half of the SSU-rDNA gene to be the more variable portion (Fig. 2). An alignment of 524-bp for the 50 half of the SSUrDNA gene was obtained for three reference specimens (Lithophyllum sp. 1 from the locality of Totoralillo, Spongites sp. 1 from Montemar and Spongites sp. 2 from Playa Blanca) obtained during our sampling collections, representing two genera with 155 variable positions (including gaps; Fig. 3). A further 37 reference sequences of 23 genera from six families (including representatives of the same genera recorded from our collection sites) were obtained from GenBank giving a total of 40 reference sequences plus 34 sample tests from our collection sites (Table 1). The phylogenetic relationships reconstructed from the 40 reference sequences are presented in Fig. 4. Four major lineages were resolved within the order: the Sporolithaceae, Melobesioideae, Corallinoideae, and a fourth clade comprised of geniculate and non-geniculate subfamilies. Bootstrap values indicate that most nodes of the tree are strongly supported (Hillis and Bull, 1993). When all characters were included, we found no significant deviation from homogeneity of base frequencies among taxa (P > 0:05). Similar results were obtained with the exclusion of constant and parsimony-uninformative sites. 3.2. Identification of sample test organisms The target fragment of the first half of the SSUrDNA gene was successfully amplified and sequenced for 34 test samples obtained from the collection sites. The taxonomic range of non-geniculate coralline identified was broad, including six genera from three subfamilies. By far, the most common genus was Spongites (53%). Bootstrapped phylogenetic reconstructions unambiguously (>80%) aligned 18 sequences from ChileÕs northern and central coast with reference sequence of Spongites yendoi (Foslie) Chamberlain from South Africa. All samples of Spongites from Chile have the same common features: for visual understanding, the anatomical structures mentioned here refer to the genera descriptions in Woelkerling (1988). Crusts colors vary depending on the irradiance condition under which the thallus grow, from pale pink to light brownish. The thallus surface can be totally smooth or have few or frequent rugosities in the case of tetrasporophytes, protuberances in all specimens collected are blunt and with soft contours. Often thallus rugosities and sinuosities

408

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

Fig. 2. Sliding-window analyses comparing the variability along the complete (insert) and the first half of the SSU-rDNA gene among 37 coralline algae deposited in GenBank (Bailey and Chapman, 1998). Running window of 10 bp.

follow the irregularities of the substrata. Thallus is of monomerous construction, hypothallus (medullar core) is variable and may be absent, reduced to the presence of a single-cell row of cells perpendicular to the substrata, or as multistratified, non-coaxial, and formed by less than 10 rows of elongated cells parallel to the substrata, with frequent cell fusions. The presence/absence condition of the hypothallus can be observed in the same individual. The cortical portion of the thallus also referred to as perithallus consists in two-thirds up to 100% of the entire thallus thickness depending on the sample. Perithallic cell rows can be placed in an orderly fashion or in a more disorganized manner. Cells are isodiametric in basal portions are longer rather than wide in the upper portions of the thallus. Cell fusions are also common in the perithallus between two and even three cells involving almost the entire length of the cells of adjacent cell columns. No secondary pit-connections have been observed. Perithallic cell walls measurements indicate that this varies between and within individuals. There is also considerable variation among individuals in different localities. Epithallus may be completely absent in some specimens or it may be formed by up to three cell rows of flat cells with their superior margins rounded. Sporangial conceptacles are uniporate, shallow, and slightly protruding, formed by the elongation of meristematic cells.

The conceptacle roof is formed by the contribution of meristem and epithallic cells with a relatively long pore canal. Cell filaments from the roof participate in the pore canal formation. Other nine test sequences grouped with reference sequences of the genus Lithophyllum with moderate to high bootstrap values. Lithophyllum specimens have a variable crust thickness and their surfaces can be smooth or slightly rugose with occasional to frequent small or large and blunt protuberances. Construction varies depending on the specimen: it can be either monomerous or dimerous, the hypothallus either absent or multistratified. When multistratified, they may have few to 20 or more cell rows parallel to the substrate. Cells are twice as long as wide or isodiametric depending on the specimen. Those thalli with dimerous construction have a single-cell row of hypothallus of cells with a length two-times its width (in some specimens they reach 30 or even 50 lm long). In thalli with monomerous construction the hypothallus can be multiaxial of elongated cells parallel to the substrata. Perithallus is formed by cells 1 to 2 (3) times longer than wide and organized in parallel columns (palisade-like) connected by secondary pits. Epithallus is formed by one to three rows of rectangular and flattened cells with the meristem subepithallic. Asexual conceptacles are uniporate with a

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

409

Fig. 3. DNA alignment of the first half of the SSU gene for Corallinales reference species; only variable nucleotide positions are shown. The first sequence is used as a reference. Agreement in the alignment is indicated by periods and disagreement by a nucleotide position. Gaps introduced to improve the alignment are indicated by dashes.

central columella, becoming embedded with adjacent tissue when old. Spermatangial conceptacles have been observed either shallow or deeply immersed in the crust with no contents observed. Three samples, MON1.C5, MON1.C3, and LD1.2, were placed respectively with the reference sequences of species from Leptophytum, Lithothamnion, and Synarthrophyton (>70% bootstrap values). Leptophytum specimens show a thick and wrinkled thallus with abundant protuberances, and whitish and conspicuous margins. The hypothallus is difficult to detect, and is often absent, in which case the cells of the perithallus are adjacent to the substrata. When present, the hypothallus is formed by 1–5 rows of elongated cells parallel to the substrata. The perithallic tissue constitutes almost the entire crust thickness. Perithallic cells are isodiametric or slightly longer than wide. When the tissue is decalcified, the perithallic cells tend to separate in disaggregated columns similar to bead chains. The

meristem has no clear location in the material observed, and apparently it is found at several cell-rows deep, as shown by the levels of calcification in certain parts of the thallus. Cell walls can reach one-third of the total diameter of the cell. Cell fusions are scarce (between 9 and 17% of the perithallic cells are involved in a fusion). No secondary pits have been observed. Epithallus consists of two rows of slightly flattened cells and sporangial conceptacles are multiporate, semispherical, and large compared to the total thickness of the crust. The specimens of Lithothamnion show a thin thallus of pink color with a rather smooth surface or with protuberances that follow the topography of the substrata. Hypothallus is formed by 3–5 cell rows parallel to the substrata or, in some cases, completely absent except for a row of cells larger than the rest of the perithallus. The perithallus constitutes between one and two-thirds of the total crust thickness. No secondary pits have been observed. Cell fusions are common (38–44% of the cells

410

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

Fig. 3. (continued)

were involved in fusions). Epithallus are formed by 3–4 rows of flattened cells of rounded edges, with the exception of the cells of the upper row that have their superior edges flared (Lithothamnion-type). The asexual conceptacles are multiporate. Although sample LD1.2 and samples, MON3.CR, MON3.CX, MON3.CL, and PB1.B3, are grouped in different clades, LD1.2 with the reference sequence of Synarthrophyton and the other four samples with the reference sequences from species of Mesophyllum (but with a low bootstrap value, Fig. 5), we have not found morphological characters that allow us to separate them generically. Therefore the following description includes material from all these samples together. Mesophyllum and Synarthrophyton have individual thalli easily recognizable in the field, usually growing under the canopy of foliose algae or in rock crevices. Its color varies from dark pink to salmon. Individuals are thin with lamelated or lobated margins and showing some rugosities at their center. The thallus is monomerous with a multistratified hypothallus with coaxial

portions in some specimens and the hypothallus constitutes between 40 and 60% of the total crust thickness. Hypothallic cells are elongated with narrow and large cell fusions in periclinal as well as anticlinal cell walls. Perithallus forms the rest of the crust with cells slightly longer than wide, with thick walls between 1.7 and 2.6 lm. These may reach up to 4 lm in developed zones of the perithallus. Narrow and wide fusions are also present in the perithallus. Epithallus are formed by a single layer of rectangular flattened cells. Sporangial conceptacles are multiporate, semispherical, and with cells flanking the canal of the pores; these cells look similar to those of the rest of the cell filaments of the roof. 3.3. Inter and intrageneric variation To assess the possibility of misidentification due to an incomplete database and uncertainties in Corallinales taxonomy, pairwise sequence differences were calculated for coralline algae for which more than one reference

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

Fig. 3. (continued)

sequence was available by subfamily. A plot of mean pairwise genetic distance among congeneric species and genera from the same subfamily corrected for mutational bias (Tamura and Nei, 1993) reveals that levels of divergence among genera within a subfamily are higher that among congeneric species (Fig. 6). In all cases, species in different genera could be readily distinguished by multiple sequence differences (nucleotide differences or gaps).

4. Discussion The phylogenetic relationships reconstructed from the 40 reference sequences generally agreed with the published phylogenetic reconstructions based on molecular data by Bailey and Chapman (1998) and Bailey (1999). Nevertheless, some relationships among genera within subgroups are either unresolved (polytomy) or do

411

not agree with those previously described (Bailey and Chapman, 1998). However, this level of phylogenetic reconstruction is not significantly relevant to the identification of coralline algae and biogeographical aspects discussed here. Most samples of crustose Corallinales collected along the study sites were placed, according to their SSUrDNA gene sequence, within a subfamily clade and among generic components of that clade in the same position in the phylogenetic tree as they would be classified according to their morphological characteristics, particularly considering their internal anatomy (see Woelkerling, 1988 and the results section for a description on generic diagnostic characters). These results confirm that molecular analysis are an important tool for taxa identification in this and other seaweed orders (Bailey and Freshwater, 1997; Brodie et al., 1996; Goff et al., 1994; Kunimoto et al., 1999; Maggs and Ward, 1996; M€ uller et al., 1998; Pathway et al., 1998; Saunders and Kraft, 1994; Saunders et al., 1996). The morphological similarity between Mesophyllum and Synarthrophyton genus deserves to be specially mentioned. These two genera have been exhaustively examined in the literature (Athanasiadis, 1999; Chamberlain and Keats, 1994; Keats and Chamberlain, 1997; Keats and Maneveldt, 1997; Woelkerling and Harvey, 1992, 1993). Meanwhile, since variability has been increasingly observed in characters used to discriminate between both genera, it has become more difficult to differentiate between representatives of either one. At this point the morphological character that separates the two genera is a condition related to the structure of male reproductive system. Low bootstrap values in the group of Mesophyllum species suggests that either this genus is in current divergence or that their diagnostic characters are not well defined. In fact, the genus was originally established by Lemoine (1928) for species of non-geniculate corallines with multiporate tetrasporangial conceptacles and an hypothallus formed by concentric rows of cells (coaxial core). Later, several authors (Lebednik, 1978; Suneson, 1943; Townsend, 1979) characterized Mesophyllum as having simple spermatangial filaments that develop on the floor, walls, and roof of the male conceptacles while others (Adey, 1970; Cabioch, 1972) included the presence of fusions between cells of contiguous perithallic filaments. The presence of a coaxial core as the main character that separates Mesophyllum from other Melobesioideae has been discussed by Woelkerling and Irvine (1986) in their neotypification of the genus with Mesophyllum lichenoides (Ellis) Lemoine, indicating that the closest genus, Synarthrophyton, does not have a predominant coaxial hypothallus but rather a plumose one. Nevertheless, further observations on the variability of this character left in more recent works, the presence of simple spermatangial filaments as different from dendroid spermatangial filaments in species of

412

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

Table 1 Database of reference taxa and test specimens Reference taxon/test specimens

Tree location

Corallinoideae Arthrocardia filicula Bossiella californica Bosiella orbigniana Calliarthron cheilosporioides Calliarthron tuberculosum Cheilosporum sagittatum Corallina elongata Corallina officinalis Haliptilon roseum Jania crassa Jania rubens Serraticardia macmillani Lithophylloideae Amphiroa fragilissima Amphiroa sp. Amphiroa sp. Lithothrix aspergillum Lithophyllum kotschyanum Lithophyllum incrustans Titanoderma pustulatum Lithophyllum sp. TOT1.2 TOT1.3 TOT1.4 TOT1.7 PB1.A1 PB2.B1 BAR1.1 BAR1.3 CAR2.R1

A A A A A A A A A A

Mastophoroideae Spongites yendoi Spongites sp. 1 MON1A1 CA2.R4 CA2.R3 CA3 MT2.6 Spongites sp. 2 MON1.C1 LC2C1 LC1A1 LC1.B1 PBA3.1 CA1.4 MON1.C2 PB1.B1 MT3.2 MON1.1C CA1.1 TOT1.6 CC-G2(05/09/91)

B B B B B B B B B B B B B B B B B B B B

Melobesioideae Clathromorphum compactum Clathromorphum parcum Lithothamnion glaciale Lithothamnion tophiforme MON1.C3 Leptophytum acervatum Leptophytum ferox

Accession No.

Source

U61258 U60945 U60746 U60943 U60944 U60745 U60946 L26184 U60947 U62113 U61259 U62114

South Africa—Southern Hemisphere USA—Northern Hemisphere USA—Northern Hemisphere USA—Northern Hemisphere Canada—Northern Hemisphere Australia—Southern Hemisphere South Africa—Southern Hemisphere Canada—Northern Hemisphere Australia—Southern Hemisphere South Africa—Southern Hemisphere Ireland—Northern Hemisphere USA—Northern Hemisphere

U60744 U62115 U62116 U61249 U62117 AF093409 AF093410

USA—Northern Hemisphere Australia—Southern Hemisphere South Africa—Southern Hemisphere USA—Northern Hemisphere Fiji—Southern Hemisphere UK—Northern Hemisphere UK—Northern Hemisphere Chile (30°04–71°22)—S. Hemisphere Chile (30°04–71°22)—S. Hemisphere Chile (30°04–71°22)—S. Hemisphere Chile (30°04–71°22)—S. Hemisphere Chile (30°04–71°22)—S. Hemisphere Chile (30°14–71°29)—S. Hemisphere Chile (30°14–71°29)—S. Hemisphere Chile (28°19–71°10)—S. Hemisphere Chile (28°19–71°10)—S. Hemisphere Chile (28°16–71°11)—S. Hemisphere

U60948

South Africa—Southern Hemisphere Chile (32°58–71°34)—S. Hemisphere Chile (32°58–71°34)—S. Hemisphere Chile (28°29–71°11)—S. Hemisphere Chile (28°29–71°11)—S. Hemisphere Chile (28°29–71°11)—S. Hemisphere Chile (32°38–71°28)—S. Hemisphere Chile (30°14–71°29)—S. Hemisphere Chile (32°58–71°34)—S. Hemisphere Chile (33°29–71°38)—S. Hemisphere Chile (33°29–71°38)—S. Hemisphere Chile (33°29–71°38)—S. Hemisphere Chile (30°14–71°29)—S. Hemisphere Chile (28°29–71°11)—S. Hemisphere Chile (32°58–71°34)—S. Hemisphere Chile (30°14–71°29)—S. Hemisphere Chile (32°38–71°28)—S. Hemisphere Chile (32°58–71°34)—S. Hemisphere Chile (28°29–71°11)—S. Hemisphere Chile (30°04–71°22)—S. Hemisphere Chile (29°15–71°28)—S. Hemisphere

U60742 U61252 U60738 U60739

Canada—Northern Hemisphere USA—Northern Hemisphere Canada—Northern Hemisphere Canada—Northern Hemisphere Chile (32°58–71°34)—S. Hemisphere South Africa—Southern Hemisphere South Africa—Southern Hemisphere

D U62119 U62120

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

413

Table 1 (continued) Reference taxon/test specimens MON1.C5 Mastophoropsis canaliculata Mesophyllum engelhartii Mesophyllum erubescens MON3.CR MON3.CX MON3.CL PB1.B3 Phymatolithon laevigatum Phymatolithon lenormandii Synarthrophyton patena LD1.2 Metagoniolithoideae Metagoniolithon chara Metagoniolithon radiatum Metagoniolithon stelliferum

Tree location

Accession No.

E U62118 U61256 U61257 C C C C U60740 U60741 U61255 F

Sporolithaceae Heydrichia woelkerlingii Sporolithon durum

Synarthrophyton, as the only character that seems to separate both genera (Keats and Maneveldt, 1997). Further descriptions of Synarthrophyton species (Keats and Chamberlain, 1997; May and Woelkerling, 1988) show that there is an actual gradation of branch complexity and position of the spermatangial filaments between both genera. However Synarthrophyton representatives are grouped in a different subclade (Fig. 5) than our samples of Mesophyllum confirming the validity of Synarthrophyton and Mesophyllum as evolutive entities, regardless of the lack of morphological features and the variability of the condition of the gametangial filaments (branched versus simple). 4.1. SSU sequences as a tool for species identification We still need to determine whether this method is also suitable for recognition at the species level since it is not clear yet whether some of our samples grouped in a particular clade do actually belong to a unique variable species or to morphologically different species. Although several concepts have been proposed (de Pinna, 1999) to describe biological species, the biological species concept is the most widely held species criterion over several decades. However many criticisms have been put forward against its use as a unifying species concept (Avise, 2000). The phylogenetic species concept (PSC) makes no reference to reproductive isolation (Davis and Nixon, 1992; de Pinna, 1999) and provides a straightforward approach for delimitation of species specifically as minimal terminals for phylogenetic analysis (Davis and Nixon, 1992; Nixon and Wheeler, 1990). Thus, it is possible that within the framework of the PSC, we have encountered, for example, new species of Spongites and Lithophyllum

Source Chile (32°58–71°34)—S. Hemisphere Australia—Southern Hemisphere South Africa—Southern Hemisphere Brazil—Southern Hemisphere Chile (32°58–71°34)—S. Hemisphere Chile (32°58–71°34)—S. Hemisphere Chile (32°58–71°34)—S. Hemisphere Chile (30°14–71°29)—S. Hemisphere UK—Northern Hemisphere UK—Northern Hemisphere Australia—Southern Hemisphere 36°48–73°11

U60743 U61250 U61251

Australia—Southern Hemisphere Australia—Southern Hemisphere Australia—Southern Hemisphere

U61253 U61254

South Africa—Southern Hemisphere Australia—Southern Hemisphere

lineages. However a greater number of sequences and the analysis of other molecular markers with different rates of evolution are necessary to confirm this idea. Therefore, until then we will consider the method valid at the species level as long as its results coincide with morphological observations. As long as DNA can be extracted and purified from crustose algae, our method of identification using the first half of the SSU-rRNA region can reliably identify all samples to the level of genus and, probably in various cases to the level of species. For example, twenty samples collected during this study formed a reliable cluster (>80% bootstrap value) and were grouped within a higher cluster with the species S. yendoi from South Africa. This placement indicates that they belong to the same genus, although they can be separated into two entities, Spongites sp. 1 and Spongites sp. 2 of South American origin. This differentiation remains to be examined with the detailed study of morphological characters that appear to be quite variable within our samples. Current comparisons with material from the South American Patagonia are underway, in particular with representatives of the genus Hydrolithon, reported from localities of Tierra del Fuego (Mendoza, 1988; Mendoza and Cabioch, 1984; Mendoza et al., 1996). These comparisons are undertaken since the genus Hydrolithon has been questioned as an independent taxon from Spongites and then redefined (Penrose, 1991; Penrose and Woelkerling, 1988, 1992) due to the controversy in defining diagnostic characters between both genera. So far the evaluation of morphological characters of Spongites specimens collected in our coasts has rendered a high variability within and between individuals. At the same time, we are able to recognize—by external features and by the different microhabitats in

414

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

Fig. 4. Phylogenetic reconstruction of Corallinales reference sequences, with Rhodogorgon carriebowensis as the outgroup, using the neighbor-joining method. Bootstrap values >50% based on 1000 resamplings of the data are shown at relevant nodes. Nodes with bootstrap values <50% are collapsed.

which they grow—specimens from two specific entities which coincide with molecular results. We expect to publish these as new species as long as we do not find similarities with a number of taxa poorly described from the beginning of the 20th century for these coasts. In a second example, eight samples of Lithophyllum specimens collected along Chilean coasts were grouped with a higher bootstrap value (>90%) than any reference sequences from Lithophyllum species. Perithallic cell size and hypothallic structure show clear differences between the two entities, which sequence comparison fails to segregate. This morphological difference does not overlap between samples collected in the same locality and similar habitats, indicating that it is not a result of environmental conditions but truly taxonomic. So far we have not analyzed in detail these differences with pre-

vious records of the genus for these latitudes; therefore we will treat them as a separate species with no binomial designation until this task is done. On the other hand, two other samples, PB1.A1 and Lithophyllum sp., grouped with the reference sequence of Lithophyllum kotschyanum (Unger) Foslie from Fiji, indicating that although they relate to this one they are neither this species nor the species to which the other samples belong. In the case of the Mesophyllum subclade high bootstrap values (96%) suggest that all samples referred to this genus collected in our coasts belong to a same specific entity. The only Mesophyllum recorded so far for South America (Mendoza et al., 1996 for Tierra del Fuego) is Mesophyllum fuegianum (Foslie) Adey for which we have no sequence information available at the

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

415

Fig. 5. Phylogenetic reconstruction used to identify test sequences (alphanumeric code) relative to reference sequences using the neighbor-joining method. Bootstrap values >50% based on 1000 resamplings of the data are shown at relevant nodes. Individual coralline specimens are labeled as per Table 1. Outgroup is as shown in Fig. 4.

moment and we are in the process of obtaining material for a morphological comparison. One of the samples collected at Montemar (32°580 S, 71°340 W), MON1.C5, became clustered with reference species of Leptophytum. This genus, placed by Woelkerling (1988) as one whose status required further evaluation, has recently been re-established due to the finding and revision of its holotype material (Adey et al., 2001). Leptophytum species, as presently described, are characterized by the presence of distinctly stained and shaped pore cells that surround the apical wall plug of sporangia (although not observed in Leptophytum acervatum (Fos-

lie) Chamberlain & Keats, L. foveatum Chamberlain & Keats, and L. ferox (Foslie) Chamberlain & Keats according to Chamberlain and Keats, 1994), gonimoblasts cut off from the periphery of the fusion cell and, conceptacle primordia formed at 1–3 cells depth, below the intercalary meristem. The similarities in the sequence of the SSU-rDNA gene showed by our collected sample with L. acervatum (Foslie) Chamberlain & Keats from South Africa suggests that at least—based on this method—our material is conspecific with acervatum. In fact, these authors believe that material from Cape Alman, Chilo
e (43°050 S; 72°530 W) described as Lithothamnion

416

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

Fig. 6. Means (95% CI) corrected genetic distance (Tamura and Nei, 1993), computed from the first half of the SSU rDNA gene obtained from pairwise comparisons of coralline organisms (GenBank source). Filled circles represent comparisons among genera within families and open circles represent comparisons of congener species. The horizontal dashed line is the overall mean for congener comparisons.

pauciporosum by Lemoine is the same as L. acervatum, thus confirming the possibility that this species is distributed along Chilean coasts up to the locality of Montemar (32°580 S, 71°340 W) where we collected it. Test sample MON1.C3 was grouped with Lithothamnion tophiforme Unger and Lithothamnion glaciale Kjellman, both genera reported for the northern hemisphere, a fact that is not biogeographically clear at this point. We will retain this information without further discussion until we compare our material with species such as Lithothamnion granuliferum (Foslie) reported for the southern tip of South America (Mendoza, 1988; Mendoza et al., 1996). Finally, test sample LD1.2, collected at 36°S made a high-bootstrap-valued cluster with Synarthrophyton patena (Hooker and Harvey) Townsend from Australia. S. patena has been reported for the Antarctic Peninsula (Meneses and Ram
ırez, 1984) while Synarthrophyton magellanicum (Foslie) Keats and Chamberlain (1997) has been reported for Tierra del Fuego (Mendoza et al., 1996), thus it is probable that the genus extends its northernmost limits along the coast of Chile. 4.2. Universality, accuracy, and comparison of the method As long as the SSU-rDNA gene can be amplified throughout a wide taxonomic range in the order Co-

rallinales, the first half of the SSU-rDNA gene of any coralline algae from which DNA can be successfully extracted may be used to identify species. However, the SSU-rDNA region sequence by itself will not always provide an unambiguous means of identifying all species of coralline, which is more evident for taxa with a recent evolutive divergence. For these situations, more rapidly evolving markers will be needed if DNA is to used to identify Corallinales specimens. The main advantages of ITS sequences are their much greater resolution among closely related species and genera. However, the methodology presented here will remain as a useful tool to narrow the search for species-level identification. Another area of concern for the molecular identification of coralline algae are (i) the database of reference sequences is incomplete and (ii) the taxonomy of the group is in constant change. Evaluating levels of intraand inter-generic molecular difference in groups of interest can help to assess the potential for mistake (misidentification) and indicate possible problematic taxa. For example, a test sequence of a species not represented in the reference database will group with or basal to the reference sequences of the next most closely related species. An unusually large divergence between the test and reference sequences could indicate that such an intermediate species or taxa is missing. This was generally not the case in Corallinales. A congeneric pairwise sequence difference of less than 1% was found in the four groups for which more than one reference sequence was available. Therefore and fortunately, the low phylogenetic resolution (>50% bootstrap values) obtained, for example, in the Mesophyllum subclade, could have almost no effect on the congeneric placement of the unknown coralline algae test we encountered. Alternative methods of identification like PCRRFLP and oligonucleotide probe, widely utilized in algae and animals (Blomster et al., 2000; Quinteiro et al., 2001), will probably have a limited value in this stage of the work. Although these methods and sequencing of the SSU-rDNA gene amplify regions of DNA using primers that are well conserved throughout algal species and require only a small amount of purified DNA for successful amplifications, the large number of candidate species that may be needed to compare in order to find a PCR-RFLP match will remain a problem. Oligonucleotide probes will probably have a limited value too because few are currently available and they require a significant effort to test thoroughly. We treat this methodology as a working version that will continue to be developed over the next several years, incorporating new species to the database. Updated versions of the database will be posted in a specific website (currently underway), as they become available. In its current state it is a useful supplement to existing methods based in detailed morphotyping. The use of this database and methodology enables identifying

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

coralline algae to the level of genus and probably species. This is an improvement on the current state of affairs in many coralline algae (particularly nongeniculate) which cannot be certainly assigned to specific taxa utilizing morphologic characters. Also, the method is particularly useful when the morphology of the specimen is atypical due to the influence of geographic, seasonal and/or environmental conditions. Another advantage of this database and method is that it could be used for identification of Corallinales when samples are not available in vegetative and reproductive form at the same time. In synthesis, the use of the first half of the SSUrDNA gene sequence for identification of coralline algae should have broad applicability to the complete order of Corallinales, opening up avenues of investigation into geniculate and non-geniculate specimens that have previously been difficult or impossible to identify morphologically.

Acknowledgments This research was supported by Fondecyt 1000751/ 2000 granted to I.M.

References Adey, W.H., 1970. A revision of the Foslie Crustose Coralline Herbarium. Det kongelige norske videnskabers selskabs. Skrifter 1, 1–146. Adey, W.H., Athanasiadis, A., Lebednik, P.A., 2001. Re-instatement of Leptophytum and its type Leptophytum laeve: taxonomy and biogeography of the genera Leptophytum and Phymatolithon (Corallinales, Rhodophyta). Eur. J. Phycol. 36, 191–203. Athanasiadis, A., 1999. Mesophyllum macedonis, nov. sp. (Rhodophyta, Corallinales), a putative Tethyan relic in the North Aegian Sea. Eur. J. Phycol. 34, 239–252. Avise, J.C., 2000. Phylogeography, The History and Formation of Species. Harvard University Press, Cambrige, MA. Bailey, J.G., 1999. Phyogenetic positions of Lithophyllum incrustans and Titanoderma pustulatum (Corallinaceae, Rhodophyta) based on 18S rRNA gene sequence analyses, with revised classification of the Lithophylloideae. Phycologia, 38:208–216. Bailey, J.G., Chapman, R.L., 1998. A phylogenetic study of the Corallinales (Rhodophyta) based on nuclear small-subunit rRNA gene sequences. J. Phycol. 34, 692–705. Bailey, J.G., Freshwater, D.W., 1997. Molecular systematics of the Gelidiales: inferences from separate and combined analyses of plastid rbcL and nuclear SSU gene sequences. Eur. J. Phycol. 32, 343–352. Blomster, J., Hoey, E.M., Maggs, C.A., Stanhope, M.J., 2000. Species-specific oligonucleotide probes for macroalgae molecular discrimination of two marine fouling species of Enteromorpha (Ulvophyceae). Mol. Ecol. 9, 177–186. Brodie, J., Hayes, P.K., Barker, G.L., Irvine, L.M., 1996. Molecular and morphological characters distinguishing two Porphyra species (Rhodophyta: Bangiophycidae). Eur. J. Phycol. 31, 303–308.

417

Cabioch, J., 1972. Etude sur les Corallinac
ees. II. La morphogenese; cons
equences syst
ematiques et phylog
en
etiques. Cah. Biol. Mar. 13, 137–287. Chamberlain, Y.M., 1994. Pneophyllum coronatum (Rosanoff) D. Penrose comb.nov., P. keatsii sp. nov., Spongites discoideum (Foslie) D. Penrose and Woelkerling and S. impar (Foslie) Y. Chamberlain comb.nov. (Rhodophyta, Corallinacea) from South Africa. Phycologia 33, 141–157. Chamberlain, Y.M., Keats, D.W., 1994. Three melobesioid crustose coralline red algae from South Africa: Leptophytum acervatum (Foslie) comb.nov., L. foveatum sp. nov., L. ferox (Foslie) comb.nov. Phycologia 33, 11–133. Davis, J.I., Nixon, K.C., 1992. Population, genetic variation, and the delimitation of phylogenetics species. Syst. Biol. 41, 421–435. de Pinna, M.C.C., 1999. Species concept and phylogenetics. Rev. Fish Biol. Fish. 9, 353–373. Etcheverry, H., Collantes, E., R
ıos, V., 1980. Taxonomic and biological studies on species of Iridaea Bory from central Chile. Proc. Intl. Seaweed Symp. 10, 163–173. Foslie, M., 1900. Calcareous algae from Fuegia. Wissenshaftliche Ergebnisse der Schwedischen Expedition nach den Magellanstanden, Stockholm, 1895—1897. Foslie, M., 1905. Den Botaniske Sampling. Det kongelige norske videnskabers selskabs. Aarsberetning 1904, 15–18. Foslie, M., 1906. Algologiske Notiser II. Det kongelige norske videnskabers selskabs. Skrifter 1906 (2), 1–28. Foslie, M., 1907a. Algologiske Notiser III. Det kongelige norske videnskabers selskabs. Skrifter 1907 (8). Foslie, M., 1907b. Antarctic and subantarctic Corallinaceae. Wissenschaftliche Ergebnisse der Schwedischen S€ udpolar Expedition 1901–1903, IV, 1907 (5) 1.16, 2 plates. Foslie, M., 1907c. Algologiske Notiser IV. Det kongelige norske videnskabers selskabs. Skrifter 1907 (6), 1–30. Foslie, M., 1908. Die Lithothamnien der Deutschen Sudpolar Expedition 1901–1903, Botanik, Berlin 8, pp. 205–219, 1 plate. Foslie, M., 1909. Algologiske Notiser VI. Det kongelige norske videnskabers selskabs. Skrifter 1909 (2), 1–63. Goff, L.J., Moon, D.A., Coleman, A.W., 1994. Molecular delineation of species and species relationships in the red algal agarophytes Gracilariopsis and Gracilaria (Gracilariales). J. Phycol. 30, 521–537. Harper, T.J., Saunders, G.W., 2001. The application of sequences of the ribosomal cistron to the systematics and classification of the florideophyte red algae (Florideophyceae, Rhodophyta). Cah. Biol. Mar. 42, 25–38. Harvey, A.S., Woelkerling, W.M.J., Wilks, K.M., 1994. The genus Synarthrophyton (Corallinaceae, Rhodophyta) in southern Australia. Phycologia 33, 331–342. Heydrich, F., 1901. Die Lithothamnien des Museum dÕHistoire Naturelle in Paris. Botanische Jahtb€ ucher 28. Bd.: pp. 529–545, plate 11. Hillis, D.M., Bull, J.L., 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 42, 182–192. Hillis, D.A., Dixon, T.M., 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Q. Rev. Biol. 66, 411–453. Hillis, D.M., Huelsenbeck, J.P., Cunningham, C.W., 1994. Application and accuracy of molecular phylogenies. Science 264, 671–677. John, D., Tittley, I., Lawson, G.W., Pugh, P., 1994. Distribution of seaweed floras in the southern oceans. Bot. Mar. 37, 235–239. Keats, D.W., Chamberlain, Y.M., 1997. The non-geniculate algae Synarthrophyton eckloniae (Foslie) comb.nov., S. magellanicum (Foslie) comb.nov. (Rhodophyta) in South Africa including comparison with relevant types. Eur. J. Phycol. 32, 55–79. Keats, D.W., Maneveldt, G., 1997. Two melobesioid algae (Corallinales, Rhodophyta), Synarthrophyton robbenense sp. nov., S. munimentum sp. nov., in South Africa and Namibia. Phycologia 36, 447–467.

418

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419

Kumar, S., Tamura, K., Nei, M., 2001. MEGA: Molecular Evolutionary Genetics Analysis, Version 2.1. Pennsylvania State University, University Park, PA. Kunimoto, M., Kito, H., Yamamoto, Y., Cheney, D., Kaminishi, Y., Mizukami, Y., 1999. Discrimination of Porphyra species based on small subunit ribosomal RNA gene sequence. J. Appl. Phycol. 11, 203–209. Lebednik, P.A., 1978. Development of male conceptacles in Mesophyllum Lemoine and other genera of the Corallinaceae (Rhodophyta). Phycologia 17, 388–395. Lemoine, P., 1913. Deuxieme Exp
edition Antarctique Francßaise (1908–1910). Masson, Cie (Eds.), M
elob
esi
ees, Paris, 67 pp., 2 plates. Lemoine, P., 1920. Les M
elob
esi
ees. Botanische Ergebnisse der Schwedischen Expedition nach Patagonien und dem Feuerlande 1907–1909. VII. Kongelige svenska vetenskapsakademiens handlingar Bd. 61 (4), pp. 1–17, 1 plate. Lemoine, P., 1928. Un nouveau genre de M
elobesi
ees: Mesophyllum. Bulletin de la Societ
ebotanique francßaise 75, 251–254. Maggs, C.A., Ward, B.A., 1996. The genus Pikea (Dumontiaceae, Rhodophyta) in England and the North Pacific: comparative morphological, life history, and molecular studies. J. Phycol. 32, 176–193. May, D.I., Woelkerling, W.M.J., 1988. Studies on the genus Synarthrophyton (Corallinaceae, Rhodophyta) and its type species, S. patena (J.D. Hooker and W.H. Harvey) Townsend. Phycologia 27, 50–71. Mendoza, M.L., 1988. Morphogenetical, reproductive, biological and biogeographical studies of some Lithothamnion (Corallinaceae) from the coast of Tierra del Fuego (in Spanish) Gayana. Bot. 45, 173–191. Mendoza, M.L., Cabioch, J., 1984. Red
efinition compar
ee de deux especes de Corallinac
ees dÕArgentine: Pseudolithophyllum fuegianum (Heydrich) comb.nov. et Hydrolithon discoideum (Foslie) comb.nov. Cryptogamie: Algologie 4, 141–154. Mendoza, M.L., Molina, S., Ventura, P., 1996. Flora Criptog
amica de Tierra del Fuego. Rhodophyta: Corallinales Centro Austral de Investigaciones Cient
ıficas y T
ecnicas. CADIC, C.C. 92 (9410) Ushuaia, Tierra del Fuego, Argentina, 8 (3), 1–71. Meneses, I., 1988. Vertical distribution of coralline algae in the rocky intertidal of northern Chile. Hydrobiologia 260/261, 121–129. Meneses, I., Ram
ırez, M.E., 1984. Synarthrophyton patena (Hooker f. et Harvey) Townsend, in ‘‘Isla Elefante, Shetland del Sur, Ant
artica (Rhodophyta, Criptonemiales)’’. Series Cient
ıficas Instituto Ant
artico Chileno 31, 67–74. Meneses, I., Santelices, B., 2000. Patterns and breaking points in the distribution of benthic algae along the temperate Pacific coast of South America. Rev. Chil. Hist. Nat. 73, 615–623. Moritz, C., Hillis, D.M., 1996. Molecular systematics. Context and controversies. In: Hillis, D.M., Moritz, C., Mable, B.K. (Eds.), Molecular Systematics. Sinauer Associates, Sunderland, MA, pp. 1–16. M€ uller, K.M., Sheath, R.G., Vis, M.L., Crease, T.J., Cole, K.M., 1998. Biogeography and systematics of Bangia (Bangiales, Rhodophyta) based on the rubisco spacer, rbcL gene and 18S rRNA gene sequences and morphometric analyses. 1. North America. 1998. Phycologia 37, 195–207. Nixon, K.C., Wheeler, Q.D., 1990. An amplification of the phylogenetic species concept. Cladistics 6, 211–223. Pathway, M.U., Christoph, W.S., MacKay, R.M., van der Meer, J.P., 1998. Nucleotide sequences of small-subunit and internal transcribed spacer regions of nuclear rRNA genes support the autonomy of some genera of the Gelidiales (Rhodophyta). J. Phycol. 34, 299–305. Penrose, D., 1991. Spongites fruticulosus (Corallinaceae, Rhodophyta), the type species of Spongites, in Southern Australia. Phycologia 30, 438–448.

Penrose, D., 1992a. Hydrolithon cymodaceae (Foslie) comb.nov. (Corallinaceae, Rhodophyta) in southern Australia and its relationships to Fosliella. Phycologia 31, 89–100. Penrose, D., 1992b. Neogoniolithon fosliei (Corallinaceae, Rhodophyta), the type species of Neogoniolithon, in Southern Australia. Phycologia 31, 338–350. Penrose, D., Woelkerling, W.M.J., 1988. A taxonomic reassessment of Hydrolithon Foslie, Porolithon Foslie and Pseudolithophyllum Lemoine emend. Adey (Corallinaceae, Rhodophyta) and their relationships to Spongites K€ utzing. Phycologia 27, 159–176. Penrose, D., Woelkerling, W.M.J., 1991. Pneophyllum fragile in southern Australia: implications for generic concepts in the Mastophoroideae (Corallinaceae, Rhodophyta). Phycologia 30, 495–506. Penrose, D., Woelkerling, W.M.J., 1992. A reappraisal of Hydrolithon and its relationship to Spongites (Corallinaceae, Rhodophyta). Phycologia 31, 81–88. Pinto, R., 1989. Caracterizaci
on de la flora algol
ogica del
area de Iquique, Norte de Chile. Vultur (Bot
anica) 1, 1–16. Proutski, V., Holmes, E.C., 1998. SWAN: sliding window analysis of nucleotide sequence variability. Bioinformatics 14, 467–468. Quinteiro, J., Vidal, R., Izquierdo, M., Sotelo, C., Chapela, M.J., Perez-Mart
ın, R.I., Rehbein, H., Hold, G.L., Russell, V., Pryde, S.E., Rosa, C., Santos, A.T., Rey-M
endez, M., 2001. Identification of hake species (Merluccius genus) using sequencing and PCRRFLP analysis of mitochondrial DNA control region sequences. J. Agric. Food Chem. 49 (11), 5108–5114. Ram
ırez, M.E., 1982. Nuevos registros de algas marinas para Antofagasta (norte de Chile). Bol. Mus. Nac. Hist. Nat. (Chile) 39, 11–26. Ram
ırez, M.E., Peters, A.F., 1992. The South American species of Desmarestia (Phaeophyceae). Can. J. Bot. 70, 2430–2445. Ram
ırez, M.E., Rojas, G., 1988. Nuevos registros de algas marinas para la costa de Chile. I. Bol. Mus. Nac. Hist. Nat. (Chile) 41, 17–31. Santelices, B., Montalva, S., 1983. Taxonomic studies on the Gelidiaceae (Rhodophyta) from central Chile. Phycologia 22, 185–196. Santelices, B., Ram
ırez, M.E., Abbott, I.A., 1989. New species and new records of marine algae from Chile. Br. Phycol. J. 24, 73–82. Saunders, G.W., Kraft, G.T., 1994. Small-subunit rRNA gene sequences from representatives of selected families of the Gigartinales and Rhodymeniales (Rhodophyta). 1. Evidence for the Plocamiales ord.nov. Can. J. Bot. 72, 1250–1263. Saunders, G.W., Strachan, I.M., West, J.A., Kraft, G.T., 1996. Nuclear small-subunit ribosomal RNA genes sequences from representative Ceramiaceae (Ceramiales, Rhodophyta). Eur. J. Phycol. 31, 23–29. Suneson, S., 1943. The structure, life history and taxonomy of the Swedish Corallinaceae. Acta Univ. Lund, N.F. Avd. 2 (39), 1–56. Swofford, D.L., 1999. PAUP*: Phylogenetics Analysis Using Parsimony (*and other Methods). Sinauer Associates, Sunderland, MA. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512–526. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Townsend, R., 1979. Synarthrophyton, a new genus of Corallinaceae (Cryptonemiales, Rhodophyta) from the southern Hemisphere. J. Phycol. 15, 251–259. Vidal, R., Meneses, I., Smith, M., 2002. Enhanced DNA extraction and PCR amplification of ribosomal genes from crustose coralline algae. J. Appl. Phycol. 14, 223–227.

R. Vidal et al. / Molecular Phylogenetics and Evolution 28 (2003) 404–419 Westermeier, R., Ram
ırez, C., 1978. Algas marinas de Niebla y Mehu
ın (Valdivia—Chile). Medio Ambiente (Chile) 3, 44–49. White, T.J., Bruns, T.D., Lee, S.B., Taylor, J.W., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols—A Guide to Methods and Applications. Academic Press, New York, pp. 315–322. Woelkerling, W.J., 1985. A taxonomic reassessment of Spongites (Corallinaceae, Rhodophyta) based on studies of K€ utzingÕs original collections. Br. Phycol. J. 20, 123–153. Woelkerling, W.J., 1988. The Coralline Red Algae: An Analysis of the Genera and Subfamilies of Nongeniculate Corallinaceae. Oxford University Press, Oxford.

419

Woelkerling, W.M.J., Foster, M.S., 1989. A systematic and ecographic account of Synarthrophyton schelianum sp. Nov. (Corallinaceae, Rhodophyta) from the Chatham Islands. Phycologia 28, 39–60. Woelkerling, W.M.J., Harvey, A.S., 1992. Mesophyllum incisum (Corallinaceae, Rhodophyta) in Southern Australia: implications for generic and specific delimitation in the Melobesioideae. Br. Phycol. J. 27, 381–399. Woelkerling, W.M.J., Harvey, A.S., 1993. An account of Southern Australian species of Mesophyllum (Corallinaceae, Rhodophyta). Aust. Syst. Bot. 6, 571–637. Woelkerling, W.M.J., Irvine, L.M., 1986. The neotypification and status of Mesophyllum (Corallinaceae, Rhodophyta). Phycologia 25, 379–396.