Molecular Genetics of Bacteriophage P22 Scaffolding Protein's Functional Domains

doi:10.1016/j.jmb.2005.03.004

J. Mol. Biol. (2005) 348, 831–844

Molecular Genetics of Bacteriophage P22 Scaffolding Protein’s Functional Domains Peter R. Weigele, Laura Sampson, Danella Winn-Stapley and Sherwood R. Casjens* Department of Pathology University of Utah School of Medicine, 50 North 1900 East Salt Lake City, UT 84132 USA

The assembly intermediates of the Salmonella bacteriophage P22 are well defined but the molecular interactions between the subunits that participate in its assembly are not. The first stable intermediate in the assembly of the P22 virion is the procapsid, a preformed protein shell into which the viral genome is packaged. The procapsid consists of an icosahedrally symmetric shell of 415 molecules of coat protein, a dodecameric ring of portal protein at one of the icosahedral vertices through which the DNA enters, and approximately 250 molecules of scaffolding protein in the interior. Scaffolding protein is required for assembly of the procapsid but is not present in the mature virion. In order to define regions of scaffolding protein that contribute to the different aspects of its function, truncation mutants of the scaffolding protein were expressed during infection with scaffolding deficient phage P22, and the products of assembly were analyzed. Scaffolding protein amino acids 1–20 are not essential, since a mutant missing them is able to fully complement scaffolding deficient phage. Mutants lacking 57 N-terminal amino acids support the assembly of DNA containing virion-like particles; however, these particles have at least three differences from wild-type virions: (i) a less than normal complement of the gene 16 protein, which is required for DNA injection from the virion, (ii) a fraction of the truncated scaffolding protein was retained within the virions, and (iii) the encapsidated DNA molecule is shorter than the wild-type genome. Procapsids assembled in the presence of a scaffolding protein mutant consisting of only the C-terminal 75 amino acids contained the portal protein, but procapsids assembled with the C-terminal 66 did not, suggesting portal recruitment function for the region about 75 amino acids from the C terminus. Finally, scaffolding protein amino acids 280 through 294 constitute its minimal coat protein binding site. q 2005 Elsevier Ltd. All rights reserved.

*Corresponding author

Keywords: bacteriophage P22; scaffolding protein; procapsid; virus assembly

Introduction The icosahedral shells of large double-stranded (ds) DNA viruses typically contain hundreds of Present addresses: P. R. Weigele & D. Winn-Stapley, Department of Biology, MIT, Cambridge, MA 02139, USA. Abbreviations used: SCAFF, scaffolding protein; gpX, the protein product of gene X; Tris-Cl, Tris (hydroxymethyl) aminomethane chloride; IPTG, isopropyl-b-D-thiogalactopyranoside; AA, amino acid; GST, glutathione-S-transferase. E-mail address of the corresponding author: [email protected]

copies of a single kind of “coat” protein, and this economical use of a single protein to create a large capsid shell results in a robust container for protecting the viral genome from environmental insult. Although extensive symmetry exists within such assemblages, the coat subunits usually participate in non-identical interactions; notably bonding arrangements that create both hexamer and pentamer rings.1 Thus, paradoxically, the assembly of an apparently conformationally pliable coat protein results in the formation of a very stable virion. The spatial control of coat assembly so that its hexamers and pentamers are properly positioned is not understood. In the dsDNA

0022-2836/$ - see front matter q 2005 Elsevier Ltd. All rights reserved.

832 tailed-bacteriophages and viruses of the genera Herpesviridae and Microviridae, scaffolding proteins influence assembly of capsid proteins.2–7 Internal and external scaffolding proteins promote the accurate polymerization of capsid protein subunits, and they are essential to the formation of the procapsid, a precursor to the mature virion that has not yet packaged DNA. Both types of scaffolds are released during later steps in the assembly pathways. The bacteriophage P22 procapsid’s internal scaffold was the first scaffolding protein to be described.8 Only three proteins are essential for assembly of the P22 procapsid: 415 coat protein molecules arranged in a TZ7 icosahedral shell,9,10

Scaffolding Functional Domains

an internal core of approximately 250 molecules of scaffolding protein,11–13 and a dodecameric ring of portal protein subunits located at a single vertex of the coat protein shell.14 Coat, scaffolding and portal proteins are encoded by P22 genes 5, 8 and 1, respectively.15 In the absence of scaffolding protein, P22 coat protein assembles into TZ4 and TZ7 icosahedral shells as well as “spiral” structures, and all of these lack the essential portal protein and at least one protein required for DNA injection.16,17 The 303 amino acid (AA) P22 scaffolding protein is very elongated and in monomer–dimer–tetramer equilibrium in solution,18 appears to have little hydrophobic core,19–21 and does not assemble beyond tetramers without coat protein.11,18 We

Figure 1. SDS-PAGE analysis of P22 procapsid-like structures assembled with N-terminally truncated scaffolding proteins. Cells were treated with IPTG and infected with P22 as described in Materials and Methods. The resulting procapsid-like structures were displayed by sucrose gradient velocity sedimentation, and the gradients were fractionated into 12 equal fractions. Each fraction was subjected to 12% acrylamide SDS-PAGE and visualized by silver staining. The infecting phage and plasmids carried by the sup8 host strain DB7000 are as follows: (a) P22 c1K7 2KamH202 13KamH101, no plasmid; (b) P22 c1K7 8KamN123 2KamH202 13KamH101, no plasmid; (c) P22 c1K7 8KamN123 2KamH202 13KamH101, pSCAFF244-303; (d) P22 c1K7 8KamN123 2KamH202 13KamH101, pGEX4T-1; (e) P22 c1K7 8KamN123 2KamH202 13KamH101, pGST:SCAFF280-303; (f) P22 c1K7 8KamN123 2KamH202 13KamH101, pGST:SCAFF284-303. In each panel the leftmost lane is size markers (masses in kDa at left of (a)), the adjacent lane is the material loaded on the sucrose gradient, and the remaining lanes are the 12 gradient fractions where authentic procapsids sediment in fractions 6 and 7 from the top (a).

Scaffolding Functional Domains

report here a molecular genetic analysis of the functional domain structure of bacteriophage P22 scaffolding protein.

Results Scaffolding protein’s N-terminal 279 amino acids and nine C-terminal amino acids are dispensable for binding to coat protein In order to define the coat protein binding domain of scaffolding protein, N and C-terminal truncations of the scaffolding protein were constructed as described in Materials and Methods (some of the properties of two of these mutants have been briefly described20,22–24). These truncated scaffolding proteins were tested for their ability to assemble into procapsids using an in vivo assembly assay. They were expressed from a plasmid in a non-suppressing host, Salmonella enterica serovar Typhimurium LT2, during infection with a strain of P22 carrying nonsense mutations in the genes for the scaffolding protein (gene 8), and terminase (either gene 2 or 3). The 8K mutant expresses only a 7 AA N-terminal fragment of scaffolding protein.13 The terminase mutation blocks DNA packaging to ensure that any assembly products made cannot progress beyond the procapsid stage and so release bound scaffold. Phage-related structures produced during these infections were partially purified and concentrated by pelleting through 20% sucrose. The resulting material, mainly assembled coat protein and any proteins bound to it, was further separated by sedimentation through a 10–40% sucrose gradient. Gradients were fractionated and their protein contents resolved by SDS-PAGE. Co-sedimentation of coat protein and scaffolding protein was considered to be evidence for physical association of the two proteins. Control experiments in which the same cells were not infected, or were infected with a P22 strain that does not express the coat protein (gp5), showed that the scaffolding protein fragments remain near the top of the gradient in the absence of coat protein (data not shown). Using this in vivo assay for coat protein binding, we found that truncated scaffolding proteins missing their N-terminal 20, 51, 140, 188, 195, 217, 228, 237, or 243 AAs are all able to bind to coat protein structures. Results for representative truncations are shown in Figure 1. The sedimentation of procapsids containing endogenous full-length scaffolding protein from a P22 2K infection is shown in Figure 1(a). Figure 1(c) shows that the smallest stably expressed scaffolding protein C-terminal fragment, SCAFF244-303, binds to coat protein (SCAFF244303 indicates the scaffolding protein AAs present in the truncated protein); the portion of the gradient that contained this scaffolding fragment corresponds exactly to the position of authentic procapsids. Electrophoresis through non-denaturing agarose gels and negative stain transmission electron microscopy (TEM) of samples from peak

833 fractions showed a largely homogenous population of procapsid-like structures (data not shown). Truncation mutants shorter than SCAFF244-303 did not express stably and were difficult to visualize by SDS-PAGE. Therefore we replaced scaffolding protein’s N terminus with glutathione-S-transferase (GST), a 26 kDa globular protein (see Materials and Methods). GST alone does not significantly associate with procapsids or coat protein aggregates (see Figure 1(d); the small amount of GST that co-sediments at the procapsid position in the gradient in Figure 1(d) most likely represents a small amount of non-specific trapping of the overexpressed protein within topologically closed coat protein shells). Fusion to GST allowed stable, high level expression of hybrid proteins containing short C-terminal scaffolding fragments, and fusions missing 243, 256, 269, and 279 N-terminal AAs were able to bind coat protein; again, the fusion proteins remained near the top of the gradient after infection by P22 coat protein deficient (5K) phage (data not shown). The presence of procapsid-like structures was confirmed by negative stain electron microscopy (see for example Figure 2). The association of GST with only the C-terminal 34 AA of scaffolding protein (GST:SCAFF280-303) with coat protein is demonstrated in Figure 1(e). A similar fusion containing the scaffolding protein residues 284–303 (GST:SCAFF284-303) did not associate with coat protein (Figure 1(f)). Therefore, the N-terminal boundary of the coat protein binding domain resides between AAs 280 and 284. To determine the C-terminal boundary of the coat binding site, we performed a similar analysis with scaffolding protein fragments that begin at AA 141 and terminate at different sites. We find that SCAFF141-294 does assemble but SCAFF141-292 does not (data not shown; see also Parker et al.24). Therefore, the C-terminal boundary of the scaffolding protein’s coat protein binding domain lies between AAs 292 and 294. These data are in agreement with previous reports indicating that the coat protein binding domain is located within the C-terminal half of the molecule.17,25 Additionally, a C-terminal fusion to the 23 AA six

Figure 2. Electron micrograph of negatively stained procapsid-like particles assembled with GST:SCAFF257303. The scale bar in the lower left represents 100 nm.

834 histidine-containing tag encoded by plasmid pTrcHis2B or to the 74 AA a-peptide of b-galactosidase did not interfere with assembly in this assay (data not shown). Procapsid-like particles assembled with scaffolding proteins missing residues C-terminal of AA 229 do not efficiently incorporate portal protein In order to map the region of the scaffolding protein that interacts with portal protein, immunoblot analysis was used to determine the presence or absence of portal protein in procapsids assembled in vivo with various truncated scaffolding proteins. The protein contents of whole infected cell lysates and sucrose gradient purified procapsid-like particles (prepared as described above after infection of scaffold truncation-expressing cells with P22 8K 3K) were resolved by SDS-PAGE (Figure 3(a)). Samples from infected cells that produce normal procapsids (from a P22 2K infection), portal deficient procapsid-like particles (from a P22 1K infection), and scaffolding-deficient coat assemblies (from a P22 8K infection) were included as controls. An identical gel was run and transferred to PVDF and probed with anti-portal protein polyclonal antibodies (Figure 3(b)). Portal protein was found to be associated with procapsid-like particles containing SCAFFs141-303, 189-303, 218-303 and 229-303 (data

Scaffolding Functional Domains

shown only for the last mutant); however, portal protein was absent in parallel experiments with SCAFF238-303 and GST:SCAFF275-303 (data not shown for the latter). Therefore, some AAs between 229 and 238 are required for portal protein recruitment. The C-terminal boundary for portal protein recruitment was not determined. We reproducibly detect a small amount of portal protein in the high molecular mass material purified from scaffolding deficient infections (Figure 3(b), lane 6), yet assembly products produced by the same phage strain had no detectable portal protein when either SCAFF238-303 (lane 10) or SCAFF257-303 was supplied during infection. We do not know the explanation of these findings, but it appears that the portal-recruiting defective, N-terminally truncated scaffolding proteins, which appear to bind coat more tightly than fulllength protein,24,26 may be able to exclude the portal protein. Scaffolding protein residues 1–20 are not required for full scaffolding protein function To assess complete scaffolding function N-terminal truncations were tested for their ability to complement P22 carrying only the 8KamN123 mutation. Serial dilutions of this phage were spotted onto lawns of cells expressing mutant scaffolding protein and the plates were observed

Figure 3. Incorporation of portal protein into procapsids. (a) Whole cell lysates (WC) and sucrose gradient purified procapsid-like particles (PC) from the P22 phages indicated above (see Materials and Methods for full genotypes) infecting Salmonella DB7000 carrying pGP1-2 were resolved by 12% SDS-PAGE. The scaffolding proteins present in each infection are as follows: full-length scaffold was supplied from the 1K and 2K phages, and plasmids pSCAFF229-303 and pSCAFF238-303 supplied the indicated truncated scaffolding proteins; the 8K phages produce only a non-functional 7 AA N-terminal scaffolding fragment.13 The band labeled “portal fragment” is consistent with the predicted size of the N-terminal portal fragment generated by the 1KamN10 mutation;52 it is not incorporated into procapsids.15 (b) An identical gel, transferred to a PVDF membrane, was probed with a polyclonal antibody that reacts with P22 portal and coat proteins as described in Materials and Methods.

Scaffolding Functional Domains

835

Figure 4. Minimal N-terminal sequence required for fully functional P22 scaffolding protein. Lawns of Salmonella cells (supC, strain DB7004; sup8, strain LB5000) that carry plasmids that express full-length or truncated scaffolding protein in response to IPTG were prepared by soft LB agar overlay on LB agar plates with 100 mg/ml of ampicillin and 0.5 mM IPTG in the bottom agar only. Aliquots (10 ml) of serial dilutions of P22 c1K7 8KamN123 (7!106/ml) were spotted on the plates, which were then incubated overnight at 37 8C.

for the formation of plaques. As shown in Figure 4, full-length scaffolding protein is able to complement this phage’s defect and allow plaque formation, and full complementation is dependent upon full expression of the cloned SCAFF1-303 gene. Expression of the truncated scaffolding protein SCAFF21-303 also supported plaque formation, although they were smaller than those produced in the presence of the full-length protein. No plaques were seen on the following hosts without IPTG: sup8 with no plasmid; sup8 pPW:SCAFF21-303; or with IPTG: sup8 pPW:SCAFF36-303; sup8 pPW:SCAFF58-303; and sup8 pPW:SCAFF141-303, so some AAs between 21 and 36 are required for full function. Plaques formed by complementation with SCAFF21-303 were not due to recombinational repair of the phage to 8C from the plasmid, since the nonsense

mutation in the phage lies in codon eight,13 a sequence that is not present on the plasmid, and the complemented phages did not form plaques on the sup8 host DB7000. Scaffolding protein amino acid residues 58–303 are sufficient to mediate DNA packaging We also asked whether truncated scaffolding proteins were capable of assembling procapsids that are competent to package DNA in vivo. Cells carrying pPW:SCAFF plasmids were infected by P22 8K 13K, which lacks the scaffolding and lysis functions but carries no 2K mutation to block DNA packaging, and the resulting assembly products were analyzed by sucrose gradient sedimentation as described above. Equal amounts of total protein were applied to each gradient. During a P22 8C 13K

Figure 5. Sucrose gradient analysis of assembly products produced by P22 c1K7 8KamN123 13KamH101 infected LB5000 cells harboring plasmids expressing either full-length or truncated scaffolding protein as described in Materials and Methods. (a) Infection by lysis defective “wild-type” P22 13K phage and no plasmid. (b)–(e) Infection by scaffolding deficient P22 13K 8K with the following plasmids: (b) none; (c) full-length scaffolding protein expressed from plasmid pPW:SCAFF1-303; (d) truncated scaffolding protein missing the 35 N-terminal AAs expressed from pPW:SCAFF36-303; (e) truncated scaffolding protein missing the 57 N-terminal AAs expressed from pPW:SCAFF58-303.

836

Scaffolding Functional Domains

infection, most of the large structures made are mature virions and procapsids (Figure 5(a)), while in the absence of scaffolding protein, no virions are made, and many of the structures sedimented slightly above the procapsid position (Figure 5(b)).8,11,15,27 Below this band in gradient B is a broad distribution of heterogeneous coat protein assemblages. When full-length scaffolding protein was supplied from the plasmid pPW:SCAFF1-303 during such a scaffolding protein deficient infection, the assembly of virions was restored (Figure 5(c)). Virion-sized material was also produced in the presence of SCAFF36-303 (Figure 5(d)) and SCAFF58-303 (Figure 5(e)). The virion-sized material made by the SCAFF36-303 and SCAFF58303 infections was found to band at approximately rZ1.5 gm/cc in a CsCl step gradient, indicating that they are filled with DNA. Electron micrographs of these particles are indistinguishable from wildtype virions (data not shown). The procapsid and empty shell material from these infections banded between rZ1.3 gm/cc and 1.4 gm/cc, indicating that they do not contain DNA. The band at the virion position in each sucrose gradient was harvested in identical volumes and the numbers of infectious phage determined by titering on the supC host DB7004 (Table 1). These titers demonstrate that complementation by fulllength scaffolding protein restores the virion yield to nearly wild-type levels. Only a subset of the virion-like particles made by SCAFF36-303 complementation are infectious. Their titer was 100-fold less than from an equal volume of cells expressing full-length scaffolding protein; this weak complementation likely reflects the fact that only a small fraction of particles contain a full complement of gp16 and DNA (see below). The SCAFF58-303 virion-like particles, although they contain DNA, are not infectious on the supC host. A similar experiment with SCAFF141-303 showed that no phage density particles were formed (data not shown). Virion-like particles assembled with SCAFF58303 have altered protein and DNA composition In order to determine why the SCAFF58-303 Table 1. Infectivity of purified virions assembled by scaffolding protein truncation mutants P22 strain and scaffolding plasmid P22 13K P22 13K P22 13K P22 13K P22 13K

8 8K, pPW:SCAFF1-303 8K, pPW:SCAFF36-303 8K, pPW:SCAFF58-303 K

Plaque forming units (pfu)/ mla 1.28!1011 2.45!106 6.4!1010 4.1!108 1.06!106

a Material isolated from each infection was loaded onto a 10–40% sucrose gradient and centrifuged in a Beckman SW41 rotor at 25,000 rpm, at 8 8C for 105 minutes. Equal volumes of sucrose gradient were harvested from identical positions within each gradient and titered on DB7004.

complemented virion-like particles are not infectious, their protein and DNA contents were analyzed. The SDS-PAGE analysis of virion proteins shown in Figure 6(a) reveals two protein composition differences from wild-type virions. The SCAFF58-303 particles contain portal, tail spike and coat proteins in normal amounts, but have a substantially reduced amount of gp16. The gp16 protein is required for successful injection of DNA from the P22 virion,15,28–30 and so this defect no doubt lowers the number of infectious particles in these samples (above). Even more striking is that the virion-like particles assembled with SCAFF58303 contain a major protein band migrating at approximately 34 kDa that is not present in wildtype virions. In order to determine the identity of this protein, it was subjected to N-terminal microsequencing. The sequence determined, NH 2AKNAEFARRRIE, is identical to P22 scaffolding protein residues 58 through 69. The presence of the truncated SCAFF58-303 scaffolding protein (with its N-terminal methionine residue removed) in these particles indicates that it was not properly released during DNA packaging. Since electron micrographs of the SCAFF58-303 virion-like particles are indistinguishable from wild-type virions, it is likely that the SCAFF58-303 protein is inside the capsid (as is expected, since full-length scaffold is inside procapsids12). To analyze the DNA composition of the SCAFF58-303 complemented virion-like particles, their DNA was extracted and compared to DNA from wild-type virions by contour-clamped homogenous electric field (CHEF) agarose gel electrophoresis (Figure 6(b)). As expected, the DNA from wild-type P22 virions ran as a slightly more diffuse band than the phage lambda DNA, since normal P22 DNA is heterogeneous in length (G850 bp) due to imprecision in the headful mechanism of DNA packaging.31,32 The DNA from the SCAFF58-303 virions ran as a smaller and substantially more diffuse band, indicating a greater heterogeneity in DNA length ranging from 43 kbp to 35 kbp, which is on average about 10% shorter than wild-type, 43.5(G0.85) kbp long P22 DNA. 32 P22 DNA molecules less that 41,724 bp in length lack any terminal redundancy,33 and so, in addition to having (likely essential) genes missing, most of the DNA molecules packaged into SCAFF58-303 virion-like particles are too short to circularize and so must be defective.

Discussion The functional domain of scaffolding protein that binds coat protein By analyzing truncation and truncation/fusion mutants of phage P22 scaffolding protein, we have identified a short region near its C terminus that mediates coat protein binding in vivo. It is interesting to note that the internal scaffolding proteins of

Scaffolding Functional Domains

837

Figure 6. The protein and DNA composition of virion-like particles assembled by SCAFF58-303. (a) Protein composition. Virions and virion-like particles were purified from P22 c1K7 8KamN123 13KamH101 infected LB5000 cells harboring plasmids expressing either full-length or truncated scaffolding protein as described in Materials and Methods. Particles were banded in a CsCl step gradient, subjected to 12% acrylamide SDS-PAGE, and proteins were visualized by staining with Coomassie Brilliant Blue R-250. The lanes are as follows: stds, molecular mass standards with masses in kDa at the left; 1-303, virions made with scaffolding function supplied by plasmid pPW:SCAFF1-303; 58-303, virion-like particles made with scaffolding function supplied by plasmid pPW:SCAFF58-303. (b) Virion DNA. DNAs were resolved by CHEF gel electrophoresis and visualized by ethidium bromide staining. The lanes are as follows: l/HIII, HindIII cut phage lambda DNA; l, full-length phage lambda DNA; P22, DNA from wild-type P22 virions; 58-303, DNA from virionlike particles made with scaffolding function supplied by plasmid pPW:SCAFF58-303. A scale in kbp is shown on the right.

the Herpesviridae and Microviridae also bind their capsid proteins using residues near the C terminus.4,34–36 The properties of the P22 scaffolding protein mutants tested here are summarized in Figure 7. Its minimal coat protein binding domain is only 15 AAs long and spans residues 280–294. ˚ resoluThuman-Commike et al.37,38 compared 15 A tion three-dimensional cryo-electron microscopic reconstructions and identified a small density present on the inner surface of the procapsid coat protein shell (near the holes in the shell) that disappears when scaffold is removed. It is quite possible that this density is the coat-binding domain of scaffolding protein that is identified here. The failure to reconstruct the remainder of the scaffolding molecules most likely indicates that scaffold’s coat binding site is flexibly attached the rest of the molecule. The NMR solution structure of SCAFF238-303 has been determined,23 and this structure shows that the functional domain of scaffolding protein which binds to coat protein is contained within a structural domain consisting of a helix-loop-helix (Figure 8(a)). However, the minimal coat-binding region includes the loop and only a portion of each helix, so parts of this structural domain are dispensable for binding function (Figure 8(a)). The small size, perhaps too small to retain the helix-loop-helix fold, of the binding

region makes it seem possible that the structure of the coat protein binding domain might be different when bound to coat protein. Although our in vivo analysis cannot distinguish between promotion of coat assembly by scaffold and simple binding of scaffold to preformed coat aggregates, two observations suggest that fragments can actively promote coat protein assembly: (i) it is unlikely that the GST-scaffolding proteins are able to diffuse into the topologically closed shells seen in Figure 2 since GST alone (pdb ID: 1UA5) is a ˚ in dimer of a globular protein roughly 40 A diameter and the holes in the procapsid coat lattice ˚ in their largest dimension,39 and (ii) we are 40 A have shown that SCAFFs 141-303 and 238-303 activate de novo capsid assembly in vitro.23,24 Scaffolding protein recruitment of portal protein and gp16 P22 virions contain eight different “minor” proteins that are present in less than 25 molecules/ virion: tailspike, portal protein, three “injection” proteins (gp7, gp16 and gp20) and three “head completion” proteins (gp4, gp10 and gp26) (reviewed by Casjens and Weigele40). It has been suggested that gp16 is involved in portal protein recruitment;41 however, 16K defective P22

838

Scaffolding Functional Domains

Figure 7. Summary of truncation and fusion scaffolding mutant findings. (a) The horizontal bars and numbers on them depict the portion of scaffolding protein present in each construct; their activities (C) or lack of them (K) are indicated on the right; asterisks (*) indicate that although DNA is packaged, the particles are not fully infectious; gray Cs note that although this function was not measured directly, it must be active since DNA is packaged. (b) A diagrammatic depiction of the known functional domains of scaffolding protein. The dark end of each gradient indicates the point where truncation removes function, while the light end marks a yet to be determined functional domain boundary.

infections yield essentially wild-type numbers of virion-like particles that only lack gp16,15,29,30 and a 7K 16K 20K triple amber mutant that is lacking all three injection proteins incorporates portal and packages DNA when grown on a sup8 host (S. R. C., unpublished results), suggesting that gp16 and the other injection proteins are not essential for portal recruitment. On the other hand, scaffolding protein conditional point mutations Q149W and L177I are known to cause a defect in incorporation of gp16 into the procapsid at non-permissive temperature.17 We also find that scaffold mutations can affect gp16 incorporation, since virions assembled using the SCAFF58-303 also lack the full gp16 complement. Scaffolding proteins have also been implicated in the recruitment of portal proteins into the procapsid

in phages P22,16,17,27 T4,42 l,43 SPP1,44 and f29.45 We have found that the N-terminal boundary of the domain necessary for recruitment of P22 portal to the assembling procapsid lies between scaffolding protein residues 229 and 238. These residues form or complete a domain that either binds directly to portal protein or modifies coat protein so that it binds portal. The possibility that a fourth protein serves as a bridge between scaffold or coat and portal protein has not been formally ruled out, but is unlikely since co-expression of coat, scaffolding, and portal proteins from a plasmid is sufficient to generate procapsid-like particles that contain portal protein (P.R.W. & S.R.C., unpublished observation), and there is no evidence for the participation of any host proteins. The facts that SCAFF141-303 and SCAFF238-303 have both been shown to activate

839

Scaffolding Functional Domains

Figure 8. P22 scaffolding protein’s minimal coat protein binding domain. (a) The structure of scaffolding protein’s C-terminal 35 AAs.23 The red box encloses the experimentally determined minimal coat binding domain. Blue and red AAs are positively and negatively charged, respectively. (b) Diagrammatic linear scaffolding protein with proposed interactions indicated by open arrows. (c) Possible tertiary folding model for scaffolding protein.

coat protein polymerization in vitro23,24 and that binding of portal protein to preformed coat shells has never been observed, suggest that this portal protein recruitment likely occurred during de novo procapsid assembly in our experiments. Portal protein appears not to be a kinetic initiator of in vivo procapsid assembly for phages P22 and SPP1,11,16,44 so the question of how only one portal ring is incorporated into the procapsid remains unanswered. Scaffold release and DNA packaging All dsDNA viruses that use a scaffolding protein remove it before or during DNA packaging.3,46 Since DNA is very tightly packaged in the P22 virion,2,12 its scaffold must exit to create enough room in the interior for a full-length DNA molecule. Interestingly, a substantial amount of SCAFF58-303 is retained in the virion, demonstrating that, for this

mutant, DNA packaging and scaffolding protein release are uncoupled. P22 packages a length of DNA that is dictated by the volume of available space inside the capsid (i.e. it utilizes a headful packaging strategy), since P22 strains with altered genome sizes package the same length DNA as wild-type.47,48 Furthermore, under circumstances favoring the formation of smaller TZ4 capsids, P22 packages a commensurately shorter length DNA.49 We show here that virions built with SCAFF58-303 contain a chromosome that is only about 39 kbp in length. Thus, reducing the available space within the normal TZ7 coat shell interior through failure to release scaffold, as expected from the headful packaging model, reduces the length of DNA that is packaged. If we estimate that the SCAFF58-303 protein band is 20% as intense as coat (Figure 6), then these virion-like particles would contain about 140 molecules of SCAFF58-303, and their volume should be about 6% of the procapsid interior volume (using a partial specific volume of 0.73 cc/g18 for SCAFF58-303 and an interior radius of 26 nm10). We believe that this is in reasonable agreement with the observation that the DNA is about 10% shorter given possible inaccuracies in the calculation and/ or the unusual physical properties of scaffolding protein.19–21 The 57 N-terminal AAs of scaffolding protein thus are important for sensing the scaffold release signal and/or allowing it to exit the procapsid, but it is not clear whether SCAFF58-303 remains inside the mature virion because it is still bound to coat or has been released but is topologically trapped inside. The scaffolding protein of conditional scaffold mutants Q149W and L177I also fails to exit the procapsid at non-permissive temperatures, but unlike SCAFF58-303, both of these mutants make procapsids that do not package DNA at nonpermissive temperature.17 Despite these differences, the phenotypes of these three mutants show that sequences N-terminal to the coat protein binding domain can affect its function, perhaps by modulating the affinity of scaffolding protein for the coat protein. Long-range control of function within scaffolding protein? As mentioned above, there are several examples of scaffold deletion-identified functional domains that do not coincide perfectly with point mutantidentified domains. Greene and King17 found that P22 scaffold mutations Y214W and S242F block portal incorporation; however, we find that SCAFF229-303 is missing AA 214 and yet recruits portal protein. It appears that Y214W affects a region of scaffolding protein that regulates portal recruitment by scaffolding protein, but is not the actual portal protein contact site. In addition, SCAFF58-303 fails to release and to incorporate gp16 properly, both phenotypes that are similar to single changes at AAs 149 and 177, AAs that are present in the truncated protein. These findings

840

Scaffolding Functional Domains

suggest that the coat protein binding, minor protein recruitment, and scaffold exit functions are each affected by changes in multiple regions of scaffolding protein. Whether the latter is the result of transmission of conformational information along a linearly arranged protein (scaffold is a very elongated protein;18 Figure 8(b)) or through contact between different regions (Figure 8(c)) is not yet known. Additional research will be necessary to fully understand these conclusions in terms of how the scaffolding protein’s functions are conformationally regulated.

Materials and Methods Bacteria and phage strains Plasmids were constructed and carried in Escherichia coli MC106150 or NF1829,51 and plasmids were moved into Salmonella by electroporation as described.52 The phage P22 strains used here were propagated on S. enterica serovar Typhimurium DB7004,53 and plasmids were carried in sup8 S. enterica DB700053 or LB5000.54 Phage strains P22 c1K7 8KamN123, P22 c1K7 1KamN10 13KamH101, P22 c1K7 5KamN114 13KamH101, P22 c1K7 2 KamH202 13 KamH101 and P22 c1 K7 8 K amN123 13KamH101 were described by Botstein et al.15 The triple

amber mutants P22 c1K 7 8 K amN123 2 KamH202 13 KamH101 and P22 c1 K7 8 K amN123 3 KamN6 13KamH101 were constructed for this study. Strains defective in lysis of the host cells (13K) allow the products of phage assembly to be concentrated by centrifugation of the infected cells, and the clear mutation (c1K) blocks establishment of lysogeny. Plasmid construction Plasmids encoding scaffolding protein truncation mutants were made by cloning fragments of P22 gene 8 into the expression vector pET3a (Novagen, Madison, WI)55 between the NdeI and BamHI restriction sites so that only a methionine residue is added to the N terminus of the fragment. Gene fragments were generated by polymerase chain reaction (PCR) using tailed primers (listed in Table 2) containing appropriate restriction sites, sequences complementary to the desired regions of the gene and, where necessary, a start or stop codon. PCR reactions were performed using Elongasew (Invitrogen, Carlsbad, CA) in the supplied buffer with 1.5 mM MgCl2, 1 mM of each primer and 200 mM of each dNTP. The cycling parameters included an initial two minute 94 8C denaturation step followed by 30 cycles of 30 s at 94 8C, 30 s at, 55 8C, and one minute at 68 8C. NdeI and BamHI cut PCR product and pET3a vector DNAs were ligated together overnight at 16 8C with T4 DNA ligase (New England Biolabs, Beverly, MA) and used to transform competent56 E. coli strain NF1829. All DNA inserts were

Table 2. Oligonucleotide primers used in this study Name Upstream primers 8KSD 21A 36A 58A 141A W Z AH AJ AK AL AT AU BA BD BG BJ BK BM DC FW FB Downstream primers Xb XXb XX8Rb CC AB DD Upstream primers FA FC

Sequencea AAACGGGGTACCAAGGAGATATAATGGAACCAACCACCGAAATTCAGGC AAACGGGGTACCAAGGAGATATAATGGCGGCATCTGCTGATAGC AAACGGGGTACCAAGGAGATATAATGGCAGGTCAGGAAGAGGGC AAACGGGGTACCAAGGAGATATAATGGCAAAGAACGCAGAATTCGCCCGCCGC AAACGGGGTACCAAGGAGATATAATGGCCCGCAGCAATGCCGTAGC GACGATGCATATGGCTCGCAGCAATGCCGTAGCAG GACGATGCATATGGCTTTTATGCAACTGGTTCCGC GACGATGCATATGGCTATGGATGGGCAGTCCGCG GACGATGCATATGGCTGCACCAAAACAAGACCCGGC GACGATGCATATGGCTCCGGAAAAGTCCGCCGCG GACGATGCATATGGCTGCAAACCCGGAGAAAGCCCGC GACGATGCATATGGCTCTCACTCGACTATCCGAACGC GACGATGCATATGGCTCGCTTAACTCTCAAGCCTCGC GACGATGGGATCCGCTCGCTTAACTCTCAAGCCTCGC GACGATGGGATCCGCTGCTCCCCATGCTGACCAGCC GACGATGGGATCCGCTGCAGCAAATAAAGATGCCATTCG GACGATGGGATCCGCTGCGAGCAAGGGAGATGTGG GACGATGGGATCCGCTCGCAAGCTAAAGGCAAAACTTAAAGG GACGATGGGATCCGCTATGGATGCTGCTGCGAGCAAGGG AGCTAGCCATGGCCCGCAGCAATGCCGTAGC AAACGGGGTACCATGGCTCGCAGCAATGCCGTAGC GCGACGGCCGGCCCCGTCGTTTTACAACGTCG GTAGAGAGGATCCTTGGAGTGATTGCGGAGATG GATGAGACTCGAGTTGGAGTGATTGCGGAGATG TAAGCGTCTAGACTTGGAGTGATTGCGGAGATG GTAGAGAGGATCC(TTA)CTTGCGGTAGGTTTCCACATCTCCC GTAGAGAGGATCC(TTA)GTAGGTTTCCACATCTCC TAAGCGTCTAGAGCTCGGATTCCTTTAAGTTTTGCC GCGACGGCCGGCTCGGATTCCTTTAAGTTTTGC TAAGCGTCTAGATTACTACCTCAGGAAGATCGCACTCC

Sequences are given 5 0 to 3 0 . Non-complementary tails are italicized, restriction sites are boldface, stop codons are in parentheses, and complementary sequences follow in plain text. The first and last codons of scaffolding gene fragments are underlined. b The endogenous stop codon for gene 8 is utilized. a

841

Scaffolding Functional Domains

confirmed by DNA sequencing. Plasmids encoding GSTscaffolding protein fusions were made by similarly cloning fragments of the scaffolding protein gene into pGEX4T-1 (Pharmacia, Uppsala, Sweden) between its BamHI and XhoI restriction sites. The resulting scaffolding protein fragments are fused to the C terminus of the GST protein. Plasmids used to test the full functionality of and support of DNA packaging express SCAFF fragments from pNFPW. The plasmid pNFPW was constructed by replacing the Ptac controlled operon of pTAT1357 with a similar operon from p2702 (both plasmids were a gift from N. Franklin), resulting in plasmid pULT1. This operon of p2702 is similar to that of pTAT13, but also contains a P22 nut site, which allows read-through of downstream transcriptional terminators in the presence of the P22 gene 24 protein. The EcoRI/ScaI fragment of pULT1 was replaced with the EcoRI/ScaI fragment from pGEX4T-1 containing the lacIq repressor. In the resultant vector, pNFPW, the promoter and adjacent nut site are followed by the bacterial alkaline phosphatase gene, phoA. Expression of PhoA in the E. coli strain NF1829, which has low endogenous alkaline phosphatase activity, in the presence of 0.1 mM 5-bromo-4-chloro-3-indolylphosphate-p-toluidene, a chromogenic substrate, yields blue colonies on agar plates. Expression of PhoA from pNFPW was induced by 0.1 mM IPTG. The phoA gene is flanked by unique 5 0 KpnI and 3 0 XbaI sites. PCRgenerated scaffold fragments and vector were cloned between these KpnI and XbaI sites as described above. In vivo coat protein binding assay Truncation mutants cloned into pET3a (pSCAFF

plasmids, Table 3) were transformed into strain DB7000 cells carrying the compatible plasmid pGP1-2,58 which encodes an T7 RNA polymerase whose expression is repressed by the temperature labile (ts857) phage lambda repressor also encoded by pGP1-2. Expression of truncated scaffolding proteins was induced by shifting cultures from 30 8C to 37 8C. After 15 minutes the cells were infected with P22 c1K 8K 2K 13K at a multiplicity of infection of 5. After 120 minutes the infected cells were pelleted, resuspended in 1/50 volume of TM (10 mM Tris-Cl (pH 7.5), 1 mM MgCl2) and lysed by vortexing with chloroform. Excess free DNA was digested by addition of 0.5 mg/ml of DNaseI (Roche Applied Science, Indianapolis, IN), and cellular debris was removed by centrifugation at 16,000 rpm in an Eppendorf centrifuge for 20 minutes at 4 8C. The supernatant was layered onto 20% (w/v) sucrose in TE7.5 (10 mM Tris-Cl (pH 7.5), 1 mM EDTA) and spun at 40,000 rpm in a Beckman SW50.1 rotor for 90 minutes. The pellet was resuspended in TE7.5 with gentle agitation overnight at 4 8C. The resuspended pellets were applied to 10–40% sucrose gradients and spun in an SW41 rotor (Beckman-Coulter, Fullerton, CA) at 25,000 rpm for two hours. Fractions were collected with a Piston Gradient Fractionator (BioComp, Fredericton, NB). Analysis of phage-related structures Electrophoresis of phage-related structures through 1% (w/v) agarose was described.59 Proteins were resolved by SDS-PAGE60 and detected by Coomassie Brilliant Blue R250 (BioRad, Richmond, CA) or silver staining.61 Proteins were electroblotted to PVDF membrane (BioRad Laboratories, Richmond, CA) and N-terminal AA

Table 3. Truncation and fusion mutants used in this study Plasmida

Primersb

Vectorc

pSCAFF21-303 pSCAFF52-303 pSCAFF141-303 pSCAFF189-303 pSCAFF196-303 pSCAFF218-303 pSCAFF229-303 pSCAFF238-303 pSCAFF244-303 pSCAFF141-294 pSCAFF141-292

AG,X AJ,X W,X Z,X AK,X AL,X AH,X AT,X AU,X W,CC W,AB

pET3a pET3a pET3a pET3a pET3a pET3a pET3a pET3a pET3a pET3a pET3a

pGST:SCAFF244-303 pGST:SCAFF257-303 pGST:SCAFF270-303 pGST:SCAFF280-303 pGST:SCAFF284-303 pGST:SCAFF293-303 pPW:SCAFF1-303 pPW:SCAFF21-303 pPW:SCAFF36-303 pPW:SCAFF58-303 pPW:SCAFF141-303 pTrc:SCAFF141-303 pLaca:SCAFF141-303d

BA,XX BD,XX BG,XX BM,XX BJ,XX BK,XX 8KSD,XX8R 21A,XX8R 36A,XX8R 58A,XX8R 141A,XX8R DC,DD FW,FA FB,FC

pGEX4T-1 pGEX4T-1 pGEX4T-1 pGEX4T-1 pGEX4T-1 pGEX4T-1 pNFPW pNFPW pNFPW pNFPW pNFPW pTrcHis2B pNFPW

Comment

Used in other studies20,24

Used in NMR structure determination22,23 Longest C-terminal truncation that assembles Shortest C-terminal truncation that does not assemble; used in other studies24

Shortest N-terminal truncation that assembles Longest N-terminal fusion that does not assemble

C-terminal fusion to 23 AA MycHis6 tag C-terminal fusion to residues 10 to 81 of LacZ

a Plasmid names include the numbers of the P22 scaffolding protein gene codons that are included in the construct (e.g. pSCAFF21303 has the first 20 P22 gene 8 codons deleted); when this AA is present, these constructs carry the P259H silent AA difference from wildtype that is also present in phage P22 c1K7 13KamH101.22 b PCR primers pairs: upstream, downstream. c Scaffold gene fragments were cloned between the NdeI and BamHI fragments of pET3a,55 the BamHI and XhoI sites of pGEX4T-1, the KpnI and XbaI sites of pNFPW, and the NcoI and BamHI sites of pTrcHis2b (Invitrogen, Carlsbad, CA) (see Materials and Methods). d Constructed using three-body ligation.

842 sequence was determined as described.13 Whole cell lysates for portal protein immunoblotting were prepared by boiling cells for five minutes in SDS-PAGE sample buffer.60 The presence of P22 portal protein was determined by probing with mouse anti-portal polyclonal antibody (a kind gift from S. Moore and P. Prevelige). Antibody bound to immobilized portal protein was visualized by an alkaline phosphatase conjugated antimouse secondary antibody and chemiluminescent detection using a Phototope Starw detection kit (New England Biolabs, Beverly, MA). DNA was isolated from purified virions as described.62 Large DNA molecules were resolved by contour-clamped homogeneous electric field (CHEF) electrophoresis with a CHEF Mapper apparatus (BioRad laboratories, Richmond, CA) as described.63 Negative strain electron microscopy was performed as follows: P22 virions or procapsids at about 1011 particles/ ml were spotted on 400-mesh, formvar/carbon-coated copper grids (Ted Pella, Inc., Redding, CA) for one minute, rinsed with three drops of Tris–Cl (pH 7.6), 1 mM MgCl2 and stained for one minute with 2% uranyl acetate. Stain solution was wicked away with bibulous paper, and grids were dried under vacuum with desiccant. Virus particles were visualized using a Hitachi H7100 transmission electron microscope at magnifications between 50,000! and 60,000! and accelerating voltages of 60–80 kv.

Scaffolding Functional Domains

7. 8. 9. 10.

11. 12.

13.

14.

Acknowledgements We thank Naomi Franklin for plasmids, Peter Prevelige and Sean Moore for anti-portal protein antibodies and access to unpublished work, Robert Schackmann and the University of Utah HSC Core Research Facility for N-terminal sequencing and oligonucleotide synthesis, and Nancy Chandler of the Health Sciences Center Research Microscopy Facility for assistance with electron microscopy. This work was supported by NSF grant MCB990526 to S.R.C. from the National Science Foundation. P.R.W. was supported by an NIH Genetics Training Grant.

15.

16. 17. 18. 19.

References 1. Caspar, D. & Klug, A. (1962). Physical principles in the construction of regular viruses. Cold Spring Harbor Symp. Quant. Biol. 27, 1–27. 2. Earnshaw, W. & Casjens, S. (1980). DNA packaging by the double-stranded DNA bacteriophages. Cell, 21, 319–331. 3. Dokland, T. (1999). Scaffolding proteins and their role in virus assembly. Cell. Mol. Life Sci. 56, 580–603. 4. Hong, Z., Beaudet-Miller, M., Durkin, J., Zhang, R. & Kwong, A. D. (1996). Identification of a minimal hydrophobic domain in the herpes simplex virus type 1 scaffolding protein which is required for interaction with the major capsid protein. J. Virol. 70, 533–540. 5. Newcomb, W. W., Homa, F. L., Thomsen, D. R. & Brown, J. C. (2001). In vitro assembly of the herpes simplex virus procapsid: formation of small procapsids at reduced scaffolding protein concentration. J. Struct. Biol. 133, 23–31. 6. Oien, N. L., Thomsen, D. R., Wathen, M. W.,

20.

21.

22.

23.

Newcomb, W. W., Brown, J. C. & Homa, F. L. (1997). Assembly of herpes simplex virus capsids using the human cytomegalovirus scaffold protein: critical role of the C terminus. J. Virol. 71, 1281–1291. Burch, A. D., Ta, J. & Fane, B. A. (1999). Crossfunctional analysis of the Microviridae internal scaffolding protein. J. Mol. Biol. 286, 95–104. King, J. & Casjens, S. (1974). Catalytic head assembling protein in virus morphogenesis. Nature, 251, 112–119. Casjens, S. (1979). Molecular organization of the bacteriophage P22 coat protein shell. J. Mol. Biol. 131, 1–14. Prasad, B. V., Prevelige, P. E., Marietta, E., Chen, R. O., Thomas, D., King, J. & Chiu, W. (1993). Threedimensional transformation of capsids associated with genome packaging in a bacterial virus. J. Mol. Biol. 231, 65–74. Casjens, S. & King, J. (1974). P22 morphogenesis I: Catalytic scaffolding protein in capsid assembly. J. Supramol. Struct. 2, 202–224. Earnshaw, W., Casjens, S. & Harrison, S. (1976). Assembly of the head of bacteriophage P22, X-ray diffraction from heads, proheads and related structures. J. Mol. Biol. 104, 387–410. Eppler, K., Wyckoff, E., Goates, J., Parr, R. & Casjens, S. (1991). Nucleotide sequence of the bacteriophage P22 genes required for DNA packaging. Virology, 183, 519–538. Bazinet, C., Benbasat, J., King, J., Carazo, J. M. & Carrascosa, J. L. (1988). Purification and organization of the gene 1 portal protein required for phage P22 DNA packaging. Biochemistry, 27, 1849–1856. Botstein, D., Waddell, C. H. & King, J. (1973). Mechanism of head assembly and DNA encapsulation in Salmonella phage P22. I. Genes, proteins, structures and DNA maturation. J. Mol. Biol. 80, 669–695. Bazinet, C. & King, J. (1988). Initiation of P22 procapsid assembly in vivo. J. Mol. Biol. 202, 77–86. Greene, B. & King, J. (1996). Scaffolding mutants identifying domains required for P22 procapsid assembly and maturation. Virology, 225, 82–96. Parker, M. H., Stafford, W. F., III & Prevelige, P. E., Jr (1997). Bacteriophage P22 scaffolding protein forms oligomers in solution. J. Mol. Biol. 268, 655–665. Galisteo, M. L. & King, J. (1993). Conformational transformations in the protein lattice of phage P22 procapsids. Biophys. J. 65, 227–235. Tuma, R., Parker, M. H., Weigele, P., Sampson, L., Sun, Y., Krishna, N. R. et al. (1998). A helical coat protein recognition domain of the bacteriophage P22 scaffolding protein. J. Mol. Biol. 281, 81–94. Tuma, R., Prevelige, P. E., Jr & Thomas, G. J., Jr (1996). Structural transitions in the scaffolding and coat proteins of P22 virus during assembly and disassembly. Biochemistry, 35, 4619–4627. Parker, M. H., Jablonsky, M., Casjens, S., Sampson, L., Krishna, N. R. & Prevelige, P. E., Jr (1997). Cloning, purification, and preliminary characterization by circular dichroism and NMR of a carboxyl-terminal domain of the bacteriophage P22 scaffolding protein. Protein Sci. 6, 1583–1586. Sun, Y., Parker, M. H., Weigele, P., Casjens, S., Prevelige, P. E., Jr & Krishna, N. R. (2000). Structure of the coat protein-binding domain of the scaffolding protein from a double-stranded DNA virus. J. Mol. Biol. 297, 1195–1202.

Scaffolding Functional Domains

24. Parker, M. H., Casjens, S. & Prevelige, P. E., Jr (1998). Functional domains of bacteriophage P22 scaffolding protein. J. Mol. Biol. 281, 69–79. 25. Greene, B. & King, J. (1999). In vitro unfolding/refolding of wild type phage P22 scaffolding protein reveals capsid-binding domain. J. Biol. Chem. 274, 16135–16140. 26. Weigele, P. (2003). The role of scaffolding protein in bacteriophage P22 morphogenesis. PhD dissertation, University of Utah. 27. Earnshaw, W. & King, J. (1978). Structure of phage P22 coat protein aggregates formed in the absence of the scaffolding protein. J. Mol. Biol. 126, 721–747. 28. King, J., Lenk, E. V. & Botstein, D. (1973). Mechanism of head assembly and DNA encapsulation in Salmonella phage P22. II. Morphogenetic pathway. J. Mol. Biol. 80, 697–731. 29. Hoffman, B. & Levine, M. (1975). Bacteriophage P22 virion protein which performs an essential early function. II. Characterization of the gene 16 function. J. Virol. 16, 1547–1559. 30. Hoffman, B. & Levine, M. (1975). Bacteriophage P22 virion protein which performs an essential early function. I. Analysis of 16-ts mutants. J. Virol. 16, 1536–1546. 31. Casjens, S., Wyckoff, E., Hayden, M., Sampson, L., Eppler, K., Randall, S. et al. (1992). Bacteriophage P22 portal protein is part of the gauge that regulates packing density of intravirion DNA. J. Mol. Biol. 224, 1055–1074. 32. Casjens, S. & Hayden, M. (1988). Analysis in vivo of the bacteriophage P22 headful nuclease. J. Mol. Biol. 199, 467–474. 33. Pedulla, M. L., Ford, M. E., Karthikeyan, T., Houtz, J. M., Hendrix, R. W., Hatfull, G. F. et al. (2003). Corrected sequence of the bacteriophage P22 genome. J. Bacteriol. 185, 1475–1477. 34. Dokland, T., Bernal, R. A., Burch, A., Pletnev, S., Fane, B. A. & Rossmann, M. G. (1999). The role of scaffolding proteins in the assembly of the small, single-stranded DNA virus phiX174. J. Mol. Biol. 288, 595–608. 35. Thomsen, D. R., Newcomb, W. W., Brown, J. C. & Homa, F. L. (1995). Assembly of the herpes simplex virus capsid: requirement for the carboxyl-terminal twenty-five amino acids of the proteins encoded by the UL26 and UL26.5 genes. J. Virol. 69, 3690–3703. 36. Kennard, J., Rixon, F. J., McDougall, I. M., Tatman, J. D. & Preston, V. G. (1995). The 25 amino acid residues at the carboxy terminus of the herpes simplex virus type 1 UL26.5 protein are required for the formation of the capsid shell around the scaffold. J. Gen. Virol. 76, 1611–1621. 37. Thuman-Commike, P. A., Greene, B., Malinski, J. A., Burbea, M., McGough, A., Chiu, W. & Prevelige, P. E., Jr (1999). Mechanism of scaffolding-directed virus assembly suggested by comparison of scaffoldingcontaining and scaffolding-lacking P22 procapsids. Biophys. J. 76, 3267–3277. 38. Thuman-Commike, P. A., Greene, B., Jakana, J., McGough, A., Prevelige, P. E. & Chiu, W. (2000). Identification of additional coat-scaffolding interactions in a bacteriophage P22 mutant defective in maturation. J. Virol. 74, 3871–3873. 39. Zhang, Z., Greene, B., Thuman-Commike, P. A., Jakana, J., Prevelige, P. E., Jr, King, J. & Chiu, W. (2000). Visualization of the maturation transition in bacteriophage P22 by electron cryomicroscopy. J. Mol. Biol. 297, 615–626.

843 40. Casjens, S. & Weigele, P. (2004). Headful DNA packaging by bacteriophage P22. In Viral Genome Packaging (Catalano, C., ed.), pp. 80–88, Landes Publishing, USA. 41. Thomas, D. & Prevelige, P., Jr (1991). A pilot protein participates in the initiation of P22 procapsid assembly. Virology, 182, 673–681. 42. van Driel, R. & Couture, E. (1978). Assembly of the scaffolding core of bacteriophage T4 preheads. J. Mol. Biol. 123, 713–719. 43. Ray, P. & Murialdo, H. (1975). The role of gene Nu3 in bacteriophage lambda head morphogenesis. Virology, 64, 247–263. 44. Droge, A., Santos, M. A., Stiege, A. C., Alonso, J. C., Lurz, R., Trautner, T. A., Tavares, P. & Shape, N. A. (2000). packaging activity of bacteriophage SPP1 procapsid: protein components and interactions during assembly. J. Mol. Biol. 296, 117–132. 45. Guo, P. X., Erickson, S., Xu, W., Olson, N., Baker, T. S. & Anderson, D. (1991). Regulation of the phage f29 prohead shape and size by the portal vertex. Virology, 183, 366–373. 46. Casjens, S. & Hendrix, R. (1988). Control mechanisms in dsDNA bacteriophage assembly. In The Bacteriophages (Calendar, R., ed.), vol. 1, pp. 15–91, Plenum Press, New York City. 47. Tye, B. K., Huberman, J. A. & Botstein, D. (1974). Nonrandom circular permutation of phage P22 DNA. J. Mol. Biol. 85, 501–528. 48. Tye, B. K., Chan, R. K. & Botstein, D. (1974). Packaging of an oversize transducing genome by Salmonella phage P22. J. Mol. Biol. 85, 485–500. 49. Moore, S. D. & Prevelige, P. E., Jr (2002). A P22 scaffold protein mutation increases the robustness of head assembly in the presence of excess portal protein. J. Virol. 76, 10245–10255. 50. Raleigh, E., Murray, N., Revel, H., Blumenthal, R., Westaway, D., Reith, A. et al. (1988). McrA and McrB restriction phenotypes of some E. coli strains and impolcations for gene cloning. Nucl. Acids Res. 16, 1563–1575. 51. Schultz, J., Silhavy, T., Berman, M., Fiil, N. & Emr, S. (1982). A previously unidentified gene in the spc operon of Escherichia coli K12 specifies a component of the protein export machinery. Genetics, 121, 635–649. 52. Casjens, S., Eppler, K., Sampson, L., Parr, R. & Wyckoff, E. (1991). Fine structure genetic and physical map of the gene 3 to 10 region of the bacteriophage P22 chromosome. Genetics, 127, 637–647. 53. Winston, F., Botstein, D. & Miller, J. H. (1979). Characterization of amber and ochre suppressors in Salmonella typhimurium. J. Bacteriol. 137, 433–439. 54. Bullas, L. R. & Ryu, J. I. (1983). Salmonella typhimurium LT2 strains which are rK mC for all three chromosomally located systems of DNA restriction and modification. J. Bacteriol. 156, 471–474. 55. Studier, W., Rosenberg, A., Dunn, J. & Dubendorff, J. (1990). Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60–89. 56. Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580. 57. Franklin, N. C. & Doelling, J. H. (1989). Overexpression of N antitermination proteins of bacteriophages lambda, 21, and P22: loss of N protein specificity. J. Bacteriol. 171, 2513–2522. 58. Tabor, S. & Richardson, C. C. (1985). A bacteriophage

844

Scaffolding Functional Domains

T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc. Natl Acad. Sci. USA. 82, 1074–1078. 59. Duda, R. L., Hempel, J., Michel, H., Shabanowitz, J., Hunt, D. & Hendrix, R. W. (1995). Structural transitions during bacteriophage HK97 head assembly. J. Mol. Biol. 247, 618–635. 60. O’Farrell, P. Z., Gold, L. M. & Huang, W. M. (1973). The identification of prereplicative bacteriophage T4 proteins. J. Biol. Chem. 248, 5499–5501. 61. Rabilloud, T., Carpentier, G. & Tarroux, P. (1988).

Improvement and simplification of low-background silver staining of proteins by using sodium dithionite. Electrophoresis, 9, 288–291. 62. Casjens, S., Winn-Stapley, D., Gilcrease, E., Moreno, R., Ku¨hlewein, C., Chua, J. E. et al. (2004). The chromosome of Shigella flexneri bacteriophage Sf6: complete nucleotide sequence, genetic mosaicism, and DNA packaging. J. Mol. Biol. 339, 379–394. 63. Casjens, S. & Huang, W. M. (1993). Linear chromosomal physical and genetic map of Borrelia burgdorferi, the Lyme disease agent. Mol. Microbiol. 8, 967–980.

Edited by Sir A. Klug (Received 5 November 2004; received in revised form 18 February 2005; accepted 1 March 2005)