Molecular identification and phylogeny of Myzomyia and Neocellia series of Anopheles subgenus Cellia (Diptera: Culicidae)

Infection, Genetics and Evolution 10 (2010) 931–939

Contents lists available at ScienceDirect

Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid

Molecular identification and phylogeny of Myzomyia and Neocellia series of Anopheles subgenus Cellia (Diptera: Culicidae) Sunita Swain a, Amitav Mohanty b, H.K. Tripathy a, Namita Mahapatra a, Santanu K. Kar a, Rupenangshu K. Hazra a,* a b

Regional Medical Research Centre, Bhubaneswar, India Institute of Life Sciences, Bhubaneswar, India

A R T I C L E I N F O

A B S T R A C T

Article history: Received 25 October 2009 Received in revised form 27 May 2010 Accepted 27 May 2010 Available online 4 June 2010

Any biological study is only meaningful if the concerned organism is accurately identified; this is particularly important in vector-borne disease studies where correct and precise identification of the target species has medical and practical implications, such as in vector control. The Myzomyia series is divided into four groups including the Funestus group, which consists of five subgroups, i.e. Aconitus, Culicifacies, Funestus, Minimus, Rivulorum, and the Neocellia series, which is divided into three groups Annularis, Jamesii and Maculatus. Members of the Funestus group of Myzomyia and the Annularis group of the Neocellia series are difficult to identify because of the morphological overlap that exists within the groups. Therefore a multiplex polymerase chain reaction (PCR) assay was developed based on the sequence of the D3 region of 28S rDNA to distinguish between four members (An. fluviatilis, An. culicifacies, An. varuna and An. aconitus) of three subgroups (Minimus, Aconitus, Culicifacies) of the Funestus group of Myzomyia and three members (An. annularis, An. pallidus and An. philippinensis) of the Annularis group of the Neocellia series of the Anopheles subgenus Cellia, prevalent in Orissa, India. Polymorphism present on the D3 region of rDNA allowed the development of a species-specific primer that when combined with two universal primers lead to a simple and sensitive multiplex allele-specific polymerase chain reaction (AS-PCR) assay. This assay can be applied as an unbiased confirmatory method for the identification of morphological variants, imperfectly preserved specimens and life stages for which taxonomic keys do not allow a definitive species determination. Finally, phylogenetic relationships between the members of the two series were determined using D3 sequence data. The phylogenetic relationships inferred from maximum parsimony and the neighbour joining analysis separated two distinct monophyletic clades, one consisting of species of Myzomyia and other of species of the Neocellia series. The molecular phylogeny obtained in this work matches with that of the classical morphological taxonomy reasonably well, with proper species arrangements. ß 2010 Elsevier B.V. All rights reserved.

Keywords: Subgenus Cellia Anophelines Myzomyia series Neocellia series Funestus group Annularis group 28S rDNA Multiplex polymerase chain reaction Phylogenetic analysis

1. Introduction Anopheles mosquitoes are responsible for human malaria transmission. Most of the important malaria vectors are members of species complexes or species groups, which are often difficult to distinguish morphologically from one another. Their accurate identification is the most basic requisite for understanding vector biology, malaria risk factors and epidemiology, and for designing and adequately measuring the impact of disease control interventions. Studies on mosquito susceptibility to Plasmodium

* Corresponding author at: Regional Medical Research Centre, Nalco Square, Chandrasekharpur, Bhubaneswar, 751 023, Orissa, India. Tel.: +91 6742301416; fax: +91 6742301351. E-mail address: [email protected] (R.K. Hazra). 1567-1348/$ – see front matter ß 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.meegid.2010.05.016

infection, behaviour and geographical distribution are all dependent on the correct species designation of acquired samples. Therefore, proper identification of malaria vectors is of the utmost importance for the success of vector control programmes. The subgenus Cellia, of the genus Anopheles, includes 217 formally recognized species and a growing number of unnamed members of sibling species complexes which are divided between six series comprised of groups and subgroups believed to represent phylogenetically related assemblages, based principally on morphological similarities (Harbach, 2004). The species of the Myzomyia and Neocellia series comprise those species, which are morphologically very similar. The Myzomyia series of the subgenus Cellia, of the genus Anopheles, consists of 69 species found in Afrotropical, Mediterranean and Oriental regions. The series is divided into four groups, including the Funestus group, which consists of five subgroups: Aconitus, Culicifacies, Funestus,

932

S. Swain et al. / Infection, Genetics and Evolution 10 (2010) 931–939

Minimus and Rivulorum. The Neocellia series consists of 33 species found in Oriental and Afrotropical regions, which are divided into three groups (Harbach, 2004). In India, the Myzomyia and Neocellia series consists of 7 and 12 species, respectively (Rao, 1984). The 7 species of Myzomyia are An. culicifacies, An. fluviatilis, An. minimus, An. varuna, An. aconitus, An. jeyporiensis and An. majidi, and the 12 species of Neocellia are An. moghulensis, An. stephensi, An. maculatus, An. theobaldi, An. karwari, An. jamesii, An. ramsayi, An. splendidus, An. annularis, An. philippinensis, An. pallidus and An. pulcherrimus. Among these, An. fluviatilis, An. culicifacies, An. varuna and An. aconitus, of Myzomyia and An. annularis, An. pallidus and An. philippinensis of the Neocellia series are mainly prevalent in Orissa, India. An. culicifacies s.l. is a major vector of malaria in India, contributing to 60–70% of malaria cases in the country. An. fluviatilis James is a primary vector in the hilly and foothill regions of India and ranks second in contributing to the total malarial cases of the country. An. fluviatilis is the most anthropophilic species; additionally, An. fluviatilis and An. culicifacies are endophilic in nature and are the most efficient vectors of malaria (Sharma, 1998). In India, the role of An. annularis in malarial transmission has been established in Orissa, Assam, West Bengal and Andhra Pradesh (Ghosh et al., 1985; Prakash et al., 2004; Mahapatra et al., 2006). The other members of these two series are mainly zoophilic and feed on human beings depending upon the availability of the host, and are regarded as secondary vectors of malaria in India. Vectorial and behavioural variations among these species and groups constitute the major factors in an accurate and precise identification. The identification of anophelines in Orissa is complicated by the biodiversity, which characterizes the region. Some of the members of the two series are the major vectors of malaria in Orissa. The major problem in working with these series is the difficulty in identifying one species from another within the series. Morphological identification is dependent on various characteristics found in the different life stages of a species. The adults of the species are morphologically very similar and are often difficult to distinguish between, especially An. philippinensis and An. pallidus of the Annularis group of the Neocellia series, which cannot always be identified reliably unless accompanied by larval and pupal exuviae (Reid, 1968). Using immature characteristics, An. varuna and An. aconitus can be identified by both egg and larval morphologies (Rao, 1984). Examination of these characteristics entails capturing blood-fed females from the wild variety for egg laying and rearing of larvae to fourth instars, which is by no means simple as larvae are difficult to maintain under laboratory conditions. Mortality is high during the rearing process, and also time consuming. Cytogenetic studies showed that An. fluviatilis, An. varuna and An. aconitus of Myzomyia and An. annularis of the Neocellia series each posse unique chromosomal inversion rearrangements that can be used to identify them (Subbarao et al., 1994; Baimai et al., 1996; Atrie et al., 1999). Polytene chromosome identification is much faster than using morphology but there are disadvantages in routinely using cytogenetic tool for the identification of the half gravid females which are required for this purpose. These difficulties stimulated the development of molecular tools for precise and reliable species identification. Recent developments in the field of DNA-based techniques, such as allele-specific PCR, PCR direct sequencing, PCR restriction fragment length polymorphism and single-strand conformational polymorphism assay (Collins and Paskewitz, 1996; Proft et al., 1999; Wilkerson et al., 2004; Li and Wilkerson, 2005) have proven to be potential tools for the differentiation of numerous Anopheles species (Beebe and Saul, 1995; Van Bortel et al., 2001). One of the most widely used regions of the genome to infer genetic variations and phylogenetic relationships is the ribosomal DNA (rDNA) cluster, a tandemly repeated multigene family. The

tandemly arrayed rDNA is a common target of such methods because of useful features in its sequence organization and evolution. Concerted evolution acting on rDNA arrays maintains sequence homogeneity within species as it drives differentiation between species, a pattern which explains the utility of rDNA for species diagnostic assays (Collins and Paskewitz, 1996). This locus has many advantages, such as the fact that it is represented in multiple copies leads to high amplification signals, and it also contains variable regions that facilitate the selection of primer binding sites for each species to generate specific amplification products of different sizes. As such, the rDNA cluster has become an increasingly popular tool in molecular entomology (Collins and Paskewitz, 1996), in particular as a means for developing diagnostic tests to differentiate between anopheline species. Besides being useful for species identification, molecular sequences also provide phylogenetic information. The ability to efficiently and unequivocally identify these species is a priority for obtaining a clear understanding of malarial transmission in the region. We structured a single step multiplex PCR assay to improve the accuracy of identification of a number of key vectors which display significant morphological overlap within the two series. The assay is useful because it relies on a single PCR to produce fragments which can be easily fractionated by gel-electrophoresis and which can clearly differentiate between taxa that are often misidentified or unsuitable for morphological taxonomy. Finally, the phylogenetic relationships between the members of the Myzomyia and Neocellia series were estimated using the D3 sequences. 2. Materials and methods 2.1. Sample collection and identification The samples used in the study originated from various localities of Orissa. The samples were collected from Keonjhar, Mayurbhanj, Rayagada and Gajapati (Table 1 and Fig. 1). Adult female anopheline mosquitoes were collected with the help of a mechanical aspirator and light trap. The mosquitoes were collected from human dwellings, cattle sheds and mixed dwelling. After field capture, all mosquitoes were first identified on the basis of their morphology (Christophers, 1933; Nagpal et al., 2005). After identification the blood-fed females were transported to the laboratory in individual tubes for egg laying. The egg morphology was examined before the eggs were put into bowls with aerated water. The larvae were fed on a high protein diet consisting of yeast tablets. Fourth instar larvae and pupae characteristics were studied and compared with those of the adults for species verification. Morphological identification was carried out on all reared species according to standard taxonomic keys (Christophers, 1933; Nagpal et al., 2005). 2.2. DNA extraction, PCR amplification and sequencing of the D3 region of Anopheles mosquitoes Genomic DNA was extracted from single individual adult mosquitoes using the method described by Coen et al. (1982). The D3 forward 50 -GACCCGTCTTGAAACACGGA-30 and D3 reverse 50 TCGGAAGGAACCAGCTACTA-30 primers were used to amplify the D3 region of 28S rDNA (Litvaitis et al., 1994) from four members of the Funestus group of Myzomyia and three members of the Annularis group of the Neocellia series. The PCR conditions were 1 PCR buffer (Genei, Bangalore, India), 2 mM MgCl2, 500 mM dNTP, 1 mM of each primer and 1unit of Taq DNA polymerase (Genei, Bangalore, India) per 30 ml reaction. A 2 ml volume of DNA sample was used per 30 ml PCR reaction mix. The samples were heated at 94 8C for 5 min before 35 cycles of amplification at 94 8C

S. Swain et al. / Infection, Genetics and Evolution 10 (2010) 931–939

933

Table 1 Different mosquito collection places, sites, number of specimen collected, and identification method used for the Myzomyia and Neocellia series specimens. Area

Species

Gajapati

An. An. An. An. An. An. An.

fluviatilis culicifacies varuna aconitus annularis pallidus philippinensis

An. An. An. An. An. An. An.

fluviatilis culicifacies varuna aconitus annularis pallidus philippinensis

An. An. An. An. An. An. An.

fluviatilis culicifacies varuna aconitus annularis pallidus philippinensis

An. An. An. An. An. An. An.

fluviatilis culicifacies varuna aconitus annularis pallidus philippinensis

Mayurbhanj

Keonjhar

[(Fig._1)TD$IG]

Rayagada

Series

Myzomyia

Neocellia

Myzomyia

Neocellia

Myzomyia

Neocellia

Myzomyia

Neocellia

Collecting site

No. of specimen identified Morphological method

Confirmation by molecular method

Indoors Indoors Indoors Indoors Indoors Indoors Indoors

6 12 8 7 14 11 16

6 12 8 7 14 11 16

Indoors Indoors Indoors Indoors Indoors Indoors Indoors

9 18 10 12 9 7 6

9 18 10 12 9 7 6

Indoors Indoors Indoors Indoors Indoors Indoors Indoors

12 21 11 15 21 12 7

12 21 9 (2a) 15 21 12 7

Indoors Indoors Indoors Indoors Indoors Indoors Indoors

10 30 5 7 24 19 3

10 30 5 7 24 18 (1b) 3

Numbers within the parentheses indicate the numbers of individuals misidentified by morphological method. a Indicate the number of An. aconitus species confirmed by molecular method. b Indicate the number of An. philippinensis species confirmed by molecular method.

Fig. 1. Map showing the study sites.

S. Swain et al. / Infection, Genetics and Evolution 10 (2010) 931–939

934

Table 2 Primers used for the multiplex PCR assay with nucleotide sequences and respective melting temperatures (Tm). Species

Primer name

Sequences (50 –30 )

Bases

C + G%

Tm (8C)

Universal forward primer Universal reverse primer An. fluviatilis An. culicifacies An. varuna An. aconitus

UF1 UR1 FLU CUL VAR ACO

ACCAAGAAGTCTATCTTGCGCG TCGGAAGGAACCAGCTACTA GTTGAAGTCAGGGGAAACCCT CCCACAGGCGAAGACAACTCGA GCTTGCCGTCCAGCAAACTG CCCGTAACGGAACACCCT

22 20 21 22 20 18

50 50 52.4 59.1 60 61.1

54.8 51.8 54.4 58.6 55.9 52.6

for 50 s, 50 8C for 1 min and 72 8C for 1 min, followed by a final extension at 72 8C for 8 min. To check the amplification, 10 ml of the PCR product was subjected to electrophoresis in a 2% agarose gel with TBE buffer and stained with ethidium bromide. The PCR product was excised from the gel, purified using a QIAquick spin column (Qiagen, Hilden, Germany), and directly sequenced in an automated DNA sequencer (Applied Biosystem Model No. 3130xl, Foster City, CA, USA) with either the D3 forward or the D3 reverse primer following the manufacturer’s instructions. The novel sequences obtained in this process were submitted to GenBank, NCBI (GenBank accession number of An. culicifacies – FJ159604, An. varuna – FJ159588 and An. aconitus – FJ159589 of the Funestus group of the Myzomyia series and An. annularis – FJ159579, An. pallidus – FJ176742, An. philippinensis – FJ159602 of the Annularis group of the Neocellia series). 2.3. Primer design Species-specific primers were designed from the DNA sequences of individual specimens and their specificity was tested. The D3 sequences of all the species were aligned using the Clustal W program (Thompson et al., 1994). Moreover, sequences from previous studies obtained through GenBank were used in the alignment for locating regions with sequence diversity. The location for primer sequences was chosen from the regions of nucleotide differences between species and care was taken to obtain PCR products which could be easily distinguished on agarose gel. The PCR primers for the assay were designed using Primer3 software (Rozen and Skaletsky, 2000) to assist with the assessment of primer melting temperature (Tm) compatibility and dimer hairpin formation (Table 2). Species-specific primers for the members of the Annularis group of the Neocellia series were accessed from Swain et al. (2009). 2.4. Species-specific PCR To check the length of the amplified fragments and to assess primer specificity, each primer was tested with the collected control samples and identified using all available standard identification keys for the larvae, pupae and adult stages from the different geographical locations. Amplification was performed in a final volume of 25 ml containing 1 PCR buffer (Genei, Bangalore, India), 2 mM MgCl2, 300 mM dNTP mix, 1.5 mM of each primer, 1 unit of Taq polymerase (Genei, Bangalore, India) and 2 ml of the DNA template. After an initial denaturation step at 95 8C for 8 min, 35 cycles were programmed as follows: 95 8C for 30 s, 50 8C for 1 min and 72 8C for 1 min, with a final extension at 72 8C for 10 min. Amplicons were resolved by agarose gel-electrophoresis with TBE buffer and stained with ethidium bromide. 2.5. Multiplex PCR All of the primers were used to develop a one step reaction to simultaneously detect each of the seven-anopheline species of the Funestus group of Myzomyia and the Annularis group of the

Neocellia series. The final 25 ml volume of the PCR reaction mix contained 1 PCR buffer (Genei, Bangalore, India), 2 mM MgCl2, 300 mM dNTP mix, 1.5 mM universal primer, 1 mM of each speciesspecific primer for species differentiation, 1 unit of Taq polymerase (Genei, Bangalore, India) and 2 ml of the DNA template. After an initial denaturation step at 95 8C for 5 min, 35 cycles were programmed as follows: 95 8C for 30 s, 55 8C for 45 s and 72 8C for 1 min, with a final extension at 72 8C for 8 min. The PCR products were subjected to agarose gel-electrophoresis, stained with ethidium bromide. We used the temperature gradient PCR for annealing condition optimization of the various primers. 2.6. Validation of the assay To determine the reliability of the new PCR assay, the studied specimens of the two series collected from different districts in Orissa were tested (Table 1). Standards used for the testing of the assays were run as positive controls on the electrophoresis gel. 2.7. Sequence analysis and phylogenetic relationships Multiple sequence alignment of the D3 sequences was carried out using the Clustal W software 1.6 multiple sequence alignment program (Thompson et al., 1994). We used the D3 sequences available from the GenBank database for comparison. The DNA sequence-based phylogenetic analyses were performed using the distance methods (neighbour joining (NJ)) and discrete character methods (maximum parsimony (MP)) included in the Molecular evolutionary genetic analysis 4 (MEGA 4) program version 4.0 (Tamura et al., 2007). Genetic distances were estimated using the Tamura–Nei distance (Tamura and Nei, 1993) and Jukes–Cantor (Jukes and Cantor, 1969) methods. The reliability of the branching order was determined by 1000 bootstrap replications (Felsenstein, 1985). The number of polymorphic, transition and transversion sites was calculated from the program. A phylogenetic tree for the D3 gene was reconstructed by the neighbour joining and maximum parsimony methods. Gaps or missing data were considered as complete deletions and numbers of nucleotide substitutions per site were estimated as per the setting of the MEGA4 software. The phylogenetic tree was drawn using Tree Explorer (Tamura and Nei, 1993). Aedes aegypti was chosen as the out group. 3. Results 3.1. Sequencing of the D3 fragment The nucleotide alignment of the D3 region for the four members of the Funestus group of Myzomyia and the three members of the Annularis group of the Neocellia series is shown in Fig. 2. The percentage similarity between the species is shown in Table 3. The sequence used for development of the primers for An. fluviatilis was accessed from GenBank (GenBank accession no. of An. fluviatilis DQ238495). Multiple sequence alignment between the species showed a large degree of sequence similarity (Table 3). The BLAST search

[(Fig._2)TD$IG]

S. Swain et al. / Infection, Genetics and Evolution 10 (2010) 931–939

935

Fig. 2. Sequence alignment of the D3 domain of 28S ribosomal DNA of members of Funestus group of Myzomyia and Annularis group of Neocellia series. Underlined areas indicate primer positions, with their primer names for the polymerase chain reaction assay. UF1: universal forward primer; UR1: universal reverse primer; FLU: An. fluviatilis specific primer; CUL: An. culicifacies specific primer; VAR: An. varuna specific primer; ACO: An. aconitus specific primer; ANN: An. annularis specific primer; PAL: An. pallidus specific primer; PHI: An. philippinensis specific primer.

(www.ncbi.nlm.nih-gov/blast/Blast.cgi) using the An. fluviatilis nucleotide sequence revealed sequence similarity with An. varuna (93%), An. culicifacies (92%), An. aconitus (94%), An. annularis (89%) and An. pallidus and An. philippinensis (88%). 3.2. Multiplex PCR The lengths of amplified species-specific products were 120 bp for An. fluviatilis, 290 bp for An. culicifacies, 318 bp for An. varuna

and 160 bp for An. aconitus of the Myzomyia series and 350 bp for An. annularis, 190 bp for An. pallidus and 205 bp for An. philippinensis of the Neocellia series along with a common band of 400 bp. None of the amplification products visually interfered with each other on the gel (Fig. 3). The lengths of the PCR-amplified species-specific products of two species of the Neocellia series, i.e. An. pallidus and An. philippinensis, showed a close proximity in the gel. To obtain a better visualization and reconfirmation between these amplified fragments, another universal reverse primer

Table 3 Percentage of sequence similarity of D3 region of 28S rDNA between the members of the Myzomyia and Neocellia series. Species/genus An. An. An. An. An. An. An.

fluviatilis culicifacies varuna aconitus annularis pallidus philippinensis

Series

Myzomyia

Neocellia

An. fluviatilis

An. culicifacies

An. varuna

An. aconitus

An. annularis

An. pallidus

An. philippinensis

–

94 –

93 95 –

94 94 94 –

89 87 88 89 –

88 88 86 87 93 –

88 87 88 87 93 93 –

[(Fig._3)TD$IG]

936

S. Swain et al. / Infection, Genetics and Evolution 10 (2010) 931–939

Fig. 3. Ethidium bromide-stained agarose gel-electrophoresis of multiplex PCR products of members of Funestus group of Myzomyia and Annularis group of Neocellia series. Lanes 1 and 2: An. annularis species (350 bp); lanes 3 and 4: An. pallidus species (190); lanes 5 and 6: An. philippinensis (206); lanes 7 and 8: An. culicifacies species (290 bp); lanes 9 and 10: An. fluviatilis species (120 bp); lanes 11 and 12: An. varuna species (318 bp); lanes 13 and 14: An. aconitus species (160 bp). Lane M, 20-bp DNA ladder, lanes 1– 14 showed common 400-bp product from the D3 domain of 28S rDNA of members of the Myzomyia and Neocellia series.

(ANR1) accessed from Swain et al. (2009) was used; the amplified fragments were 194 bp for An. pallidus and 137 bp for An. philippinensis, with a common band of 324 bp (Fig. 4). 3.3. Testing the multiplex PCR Table 1 gives the origins of the samples used to develop the PCR assay and to test the species-specific PCR on specimens identified earlier by morphology. Individual mosquitoes from each species, for which all the morphological characteristics from larval to adult stages were studied, were designated as standards and PCR products from these specimens were taken as positive controls. Table 1 also gives the details of the multiplex PCR results from the all of the field-collected individual mosquitoes. Out of 342 mosquitoes, 37 were confirmed as An. fluviatilis, 81 as An. culicifacies, 32 as An. varuna and 43 as An. aconitus, all species of the Funestus group of Myzomyia, and 68 were confirmed as An. annularis, 48 as An. pallidus and 33 as An. philippinensis, all belonging to the Annularis group of the Neocellia series. This includes two species of An. varuna and one species of An. pallidus which were previously misidentified by the morphological method and were subsequently confirmed as An. aconitus and An. philippinensis by the multiplex PCR assay, respectively. 3.4. Phylogenetic analysis

[(Fig._4)TD$IG]

The nucleotide sequences of the D3-rDNA region of the 23 members of the Myzomyia and Neocellia series were phylogenetically analysed. Among the 23 Anopheles species, 12 sequences of the Minimus and Culicifacies subgroups were been retrieved from GenBank and compared with the 11 newly submitted sequences of approximately 400 bp fragments of the

Fig. 4. Ethidium bromide-stained agarose gel-electrophoresis of multiplex PCR products of members of Annularis group of Neocellia series. Lanes 1 and 2: An. philippinensis species (138 bp); lanes 3 and 4: An. pallidus species (190); lane M: 100-bp DNA ladder; lanes 1–4 showed common 324-bp product from the D3 domain of 28S rDNA.

28S rDNA. Multiple sequence alignment was carried out by ClustalW 1.7 (Fig. 2) (Thompson et al., 1994). Neighbour joining and maximum parsimony (MP) tree building methods produced distinct monophyletic clades for species of the Myzomyia and Neocellia series. The MP analysis generated 91 parsimonious trees with a length = 275, consistency index = 0.664 and retention index = 0.850. All positions containing gaps and missing data were eliminated from the dataset (complete deletion option). There were a total of 270 positions in the final dataset, out of which 55 were parsimony informative. The constructed phylogeny confirmed the presence of two unambiguous monophyletic clades; one consisting of species of the Myzomyia series and the other consisting of species of the Neocellia series, of the subgenus Cellia (Fig. 5). In the tree topology it became evident that of the Funestus group (Garros et al., 2005) of the Myzomyia (Christophers, 1924) series, An. fluviatilis S, T and U, with An. minimus A, C (An. harrisoni) (Harbach et al., 2007) and E, lie in close proximity within a single cluster under the Minimus subgroup. This supports the morphological characteristics-based classification (Chen et al., 2003; Harbach, 2004). Under the same group, it was found that the Aconitus subgroup (Chen et al., 2003) consisting of An. aconitus and An. varuna and the Culicifacies subgroup lie in the same cluster whereas An. jeyporiensis lies in a basal position to the group. Similarly, An. annularis, An. pallidus, An. philippinensis, An. nivipes of the Annularis group (Reid, 1968), An. maculatus of the Maculatus group (Rattanarithikul and Green, 1987), An. spendidus of the Jamesii group (Rattanarithikul et al., 2006) and An. stephensi of the Neocellia series (Christophers, 1924) fall under separate clusters. Aedes aegypti was taken as the out group. 4. Discussion Due to the problematic nature of identifying species of the Myzomyia and Neocellia series of Anopheles mosquitoes based on the existing morphological keys, molecular methods of identification are likely to prove useful as tools for confirming species identities and for identifying ambiguous or damaged field samples. Accurate species identification will likely hasten our understanding of malaria vectors and assist disease control strategies. The molecular assay proved to be a sensitive and accurate method of discrimination between species, it was successful with all life stages including exuviae samples and required only minute portions of the original sample. The test also reduced the need to rear samples for morphological diagnosis, thereby ensuring that all samples, rather than just the survivors, could be identified. We considered four species from the Funestus group of Myzomyia and three species of the Annularis group of the Neocellia series because the other the species (An. minimus, An. jeyporiensis of Myzomyia and An. nivipes, An. schueffneri) collected from the malaria endemic

[(Fig._5)TD$IG]

S. Swain et al. / Infection, Genetics and Evolution 10 (2010) 931–939

937

Fig. 5. The evolutionary history was inferred using the Neighbor-Joining method (Saitou and Nei, 1987). The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analysed (Felsenstein, 1985). Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches (Felsenstein, 1985). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 270 positions in the final dataset. Phylogenetic analyses were conducted in MEGA4 (Tamura et al., 2007).

regions of Orissa, India, in this study could not identified. Also, we only considered the species, which are prevalent and important in malaria transmission in Orissa. In this study, we developed a multiplex PCR assay to distinguish between the species of the Myzomyia series, i.e. An. culicifacies, An. fluviatilis, An. varuna and An. aconitus, and between species of the Neocellia series, i.e. An. annularis, An. philippinensis and An. pallidus. As An. culicifacies and An. fluviatilis are species complexes, in the design of the species-specific primers we focused on the common region of the respective species complexes so that any sibling species would be amplified. Molecular methods have recently been developed for distinguishing between different sibling species of An. culicifacies and An. fluviatilis, and PCR-based techniques such as allele-specific PCR and PCR-RFLP were elaborated for distinguishing between the members of the An. culicifacies complex (Singh et al., 2004a; Goswami et al., 2005, 2006; Manonmani et al., 2007). Different PCR-based methods were also designed for the identification of members of the An. fluviatilis complex (Singh et al., 2004b; Mohanty et al., 2007). The present PCR-based assay will provide easy

identification of sibling species for further analysis. This method has the advantage of being able to amplify any of the Anopheles species by universal primers, whereas the species-specific primers can only amplify species of the Myzomyia and Neocellia series with specific banding patterns. This assay correctly identified three species that were morphologically misidentified. Validation of the multiplex PCR, which showed that the two specimens from Keonjhar and one species from the Rayagada district, originally identified as An. varuna and An. pallidus by the morphological method but later identified as An. aconitus, An. philippinensis, respectively, by the molecular method, illustrated the difficulty in making precise identifications using only adult morphologies. This assay can be used as a practical tool for reliable molecular identification in the study of the ecology, population genetics and malarial epidemiology in relation to these species. Reliable species identification is indeed important in determining areas of sympatry and for evaluating the relative role-played by each species in the transmission of malaria. Furthermore, the easy availability of such a diagnostic tool will enhance our ability to evaluate the efficacy of vector control

938

S. Swain et al. / Infection, Genetics and Evolution 10 (2010) 931–939

measures implemented in areas where several species of these series are present, a situation that could potentially lead to incorrect evaluations of control programmes. In addition to being used for differentiation between species, the D3 markers were used for phylogenetic reconstruction of the two series. In the process of reconstructing the classical relationships between the members of the Myzomyia and Neocellia series, we considered the molecular method of phylogenetic analysis. This gives an overview of the line of descendants starting from a common ancestral member. Generally, wide arrays of morphological as well as anatomical characters are studied and grouped together in order to determine the affinity between the various taxa of interest. This system of cladistic analysis provides an overview of the evolutionary patterns of individuals which have evolved from a common ancestor. The objective of the molecular phylogenetic analysis in the present study was to draw a broader outline of evolutionary affinity between the different species of the Myzomyia and Neocellia series prevalent in the Indian subcontinent with particular reference to Orissa. While choosing a gene for analysing the phylogenetic relationships between various taxa, it is important to select the region of the gene which is the most conserved. In the present study, we selected the more conserved region of rRNA D3 of the 28S rDNA for analysing the relationships between the different species of the Myzomyia and Neocellia series because of its useful feature of concerted evolution. The phylogenetic tree obtained after MEGA-4 analysis of the D3 region of the 28S rDNA separated the two series into two distinct clades. The molecular phylogeny, based on the D3 region of the rDNA, formed two series with four groups: the Funestus, Annularis, Maculatus and Jamesii group, and the Funestus group was further subdivided into three subgroups, i.e. the Minimus, Aconitus and Culicifacies subgroups. Within the Myzomyia series, species belonging to the Minimus, Aconitus and Culicifacies subgroup of the Funestus group clustered together. The genetic distance between An. minimus C (An. harrisoni) (Harbach et al., 2007) and An. fluviatilis S was null, indicating that they represent the same genetic species. This supports the morphological characteristicsbased classification by Chen et al. (2003) and Harbach (2004). An. jeyporiensis was not assigned to a subordinate group within the Myzomyia series (Harbach, 1994). In the current study, this species shared a basal relationship with the members of the Funestus group and was the most divergent species in respect to the genetic distance of the D3 markers. Species belonging to the Annularis, Jamesii and Maculatus group of the Neocellia series were all separated into distinct clades, except An. philippinensis and An. splendidus, which grouped together, suggesting a close relationship between the Annularis and Jamseii groups. The two series of the Anopheles subgenus Cellia formed a distinct cluster as per the morphological classification. This is the very first study to simultaneously investigate the Myzomyia and Neocellia series by using molecular markers. Such studies not only advance our knowledge of anophelines taxonomy but also provide a platform for investigating various epidemiological phenomena such as vector prevalence and species divergence. Acknowledgments We are grateful to B. Pradhan, S.S. Beuria, C.S. Tripathy and G. Simachalam of Regional Medical Research Centre, Bhubaneswar, India for their technical support. The authors duly acknowledge the financial support provided by National Vector Borne Disease Control Programme, Delhi and Council of Scientific and Industrial Research, Delhi. Miss Sunita Swain was supported by the fellowship from the Indian Council of Medical Research, Delhi.

References Atrie, B., Subbarao, S.K., Pillai, M.K.K., Rao, S.R.V., Sharma, V.P., 1999. Population cytogenetic evidence for sibling species within the taxon Anopheles annularis Van der Wulp. Ann. Entomol. Soc. Am. 92, 243. Baimai, V., Kijchalao, U., Rattanarithikul, R., 1996. Metaphase karyotypes of Anopheles of Thailand and Southeast Asia: V. The Myzomyia Series, subgenus Cellia (Diptera: Culicidae). J. Am. Mosq. Control Assoc. 12, 97–105. Beebe, N.W., Saul, A., 1995. Discrimination of all members of the Anopheles punctulatus complex by polymerase chain reaction–restriction fragment length polymorphism analysis. Am. J. Trop. Med. Hyg. 53, 478–481. Chen, B., Butlin, R.K., Harbach, R.E., 2003. Molecular phylogenetics of the Oriental members of the Myzomyia series of Anopheles subgenus Cellia (Diptera: Culicidae) inferred from nuclear and mitochondrial DNA sequences. Syst. Entomol. 28, 57–69. Christophers, S.R., 1933. The Fauna of British India. Dipter, Vol. IV. Family-Culicidae. Tribe Anophelini Today and Tomorrow’s Printers and Publishers, New Delhi. Christophers, S.R., 1924. Provisional list and reference catalogue of the Anophelini. Indian Med. Res. Memoir. 3, 1–105. Coen, E., Strachan, T., Dover, G., 1982. Dynamics of concerted evolution of ribosomal DNA and histone gene families in the melanogaster species subgroup of Drosophila. J. Mol. Biol. 158, 17–35. Collins, F.H., Paskewitz, S.M., 1996. A review of the use of ribosomal DNA (rDNA) to differentiate among cryptic Anopheles species. Insect Mol. Biol. 5, 1–9. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Garros, C., Harbach, R.E., Manguin, S., 2005. Morphological assessment and molecular phylogenetics of the Funestus and Minimus groups of Anopheles (Cellia). J. Med. Entomol. 42, 522–536. Ghosh, K.K., Chakraborty, S., Bhattacharya, S., Palit, A., Tandon, N., Hati, A.K., 1985. Anopheles annularis as a vector of malaria in rural West Bengal. Indian J. Malariol. 22, 65–69. Goswami, G., Raghavendra, K., Nanda, N., Gakhar, S.K., Subbarao, S.K., 2005. PCRRFLP of mitochondrial cytochrome oxidase subunit II and ITS2 of ribosomal DNA: markers for the identification of members of the Anopheles culicifacies complex (Diptera: Culicidae). Acta Trop. 95, 92–99. Goswami, G., Singh, O.P., Nanda, N., Raghavendra, K., Gakhar, S.K., Subbarao, S.K., 2006. Identification of all members of the anopheles culicifacies complex using allele-specific polymerase chain reaction assays. Am. J. Trop. Med. Hyg. 75, 454– 460. Harbach, R.E., 1994. Review of the internal classification of the genus Anopheles (Diptera: Culicidae): the foundation for the comparative systematic and phylogenetic research. Bull. Entomol. Res. 84, 331–342. Harbach, R.E., Garros, C., Manh, N.D., Manguin, S., 2007. Formal taxonomy of species C of the Anopheles minimus sibling species complex (Diptera: Culicidae). Zootaxa 1654, 41–54. Harbach, R.E., 2004. The classification of the genus Anopheles (Diptera: Culicidae), a working hypothesis of phylogenetic relationships. Bull. Entomol. Res. 94, 537– 553. Jukes, T.H., Cantor, C.R., 1969. Evolution of protein molecules. In: Munro, H.N. (Ed.), Mammalian Protein Metabolism. Academic Press, New York, pp. 21– 132. Li, C., Wilkerson, R.C., 2005. Identification of Anopheles (Nyssorhynchus) albitarsis complex species (Diptera: Culicidae) using rDNA internal transcribed spacer 2based polymerase chain reaction primes. Mem. Inst. Oswaldo Cruz 100, 495– 500. Litvaitis, M.K., Nunn, G., Thomas, W.K., Kocher, T.D., 1994. A molecular approach for the identification of Meiofaunal turbellarians (Platyhelminthes Turbellaria). Mar. Biol. 120, 437–442. Mahapatra, N., Marai, N.S., Ranjit, M.R., Parida, S.K., Hansdah, D.P., Hazra, R.K., Kar, S.K., 2006. Detection of Plasmodium falciparum infection in anopheles mosquitoes from Keonjhar district, Orissa, India. J. Vector Borne Dis. 43, 191–194. Manonmani, A.M., Sadanandane, C., Sahu, S.S., Mathivanan, A., Jambulingam, P., 2007. rDNA-ITS2-PCR assay for grouping the cryptic species of Anopheles culicifacies complex (Diptera: Culicidae). Acta Trop. 104, 72–77. Mohanty, A., Kar, P., Mishra, K., Singh, D.V., Mohapatra, N., Kar, S.K., Dash, A.P., Hazra, R.K., 2007. Multiplex PCR assay for the detection of Anopheles fluviatilis species complex, human host preference, and Plasmodium falciparum sporozoite presence, using a unique mosquito processing method. Am. J. Trop. Med. Hyg. 76, 837–843. Nagpal, B.N., Srivastava, A., Saxena, R., Ansari, M.A., Dash, A.P., Das, S.C., 2005. Pictorial Identification Key for Indian Anophelines. Malaria Research Centre (ICMR), New Delhi. Prakash, A., Bhattacharya, D.R., Mohapatra, P.K., Mahanta, J., 2004. Role of the prevalent Anopheles species in the transmission of Plasmodium falciparum and P.vivax in Assam state North Eastern India. Ann. Trop. Med. Parasitol. 98, 559–568. Proft, J., Maier, W.A., Kampen, H., 1999. Identification of six sibling species of the Anopheles maculipennis complex (Diptera: Culicidae) by a polymerase chain reaction assay. Parasitol. Res. 85, 837–843. Rao, T.R., 1984. The Anophelines of India. Malaria Research Centre, Indian Council of Medical Research, New Delhi. Rattanarithikul, R., Green, C.A., 1987. Formal recognition of the species of Anopheles maculates group (Diptera: Culicidae) occurring in Thailand, including the description of two new species and a preliminary key to females. Mosq. Syst. 18, 246–278.

S. Swain et al. / Infection, Genetics and Evolution 10 (2010) 931–939 Rattanarithikul, R., Harrison, B.A., Harbach, R.E., Panthusiri, P., Coleman, R.E., Panthusiri, P., 2006. Illustrated keys to the mosquitoes of Thailand. IV. Anopheles. Southeast Asian J. Trop. Med. Public Health 37 (Suppl. 2), 1–128. Reid, J.A., 1968. Anopheline mosquitoes of Malaya and Borneo. Stud. Inst. Med. Res. Malaya 31, 1–520. Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist programmers. Methods J. Mol. Biol. 132, 365–386. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sharma, V.P., 1998. Fighting malaria in India. Curr. Sci. 75, 1127–1140. Singh, O.P., Chandra, D., Nanda, N., Raghavendra, K., Sunil, S., Sharma, S.K., Dua, V.K., Subbarao, S.K., 2004b. Differentiation of members of the Anopheles fluviatilis species complex by an allele-specific polymerase chain reaction based on 28S ribosomal DNA sequences. Am. J. Trop. Med. Hyg. 70, 27–32. Singh, O.P., Goswami, G., Nanda, N., Raghavendra, K., Chandra, D., Subbarao, S.K., 2004a. An allele-specific polymerase chain reaction assay for the differentiation of members of the Anopheles culicifacies complex. J. Biosci. 29, 275– 280. Subbarao, S.K., Nanda, N., Vasantha, K., Dua, V.K., Mohotra, M.S., Yadav, R.S., Sharma, V.P., 1994. Cytogenetic evidence for three sibling species in Anopheles fluviatilis (Diptera: Culicidae). Ann. Entomol. Soc. Am. 87, 116–121.

939

Swain, S., Mohanty, A., Mahapatra, N., Parida, S.K., Marai, N.S., Tripathy, H.K., Kar, S.K., Hazra, R.K., 2009. The development and evaluation of a single step multiplex PCR for simultaneous detection of Anopheles annularis group mosquitoes, human host preference and Plasmodium falciparum sporozoite presence. Trans. R. Soc. Trop. Med. Hyg. 103, 1146–1152. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512–526. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighing, position-specific gap penalties and weight matrix. Nucleic Acids Res. 22, 4673– 4680. Van Bortel, W., Harbach, R.E., Trung, H.D., Roelants, P., Backeljau, T., Coosemans, M., 2001. Confirmation of Anopheles varuna in Vietnam previously misidentified and mis-targeted as the malaria vector Anopheles minimus. Am. J. Trop. Med. Hyg. 65, 729–732. Wilkerson, R.C., Reinert, J.F., Li, C., 2004. Ribosomal DNA ITS2 sequences differentiate six species in the Anopheles crucians complex (Diptera: Culicidae). J. Med. Entomol. 41, 392–401.