- Email: [email protected]
Molecular markers for gyrodactylids (Gyrodactylidae: Monogenea) from five fish families (Teleostei)
International Journal for Parasitology 31 (2001) 738±745
www.parasitology-online.com
Molecular markers for gyrodactylids (Gyrodactylidae: Monogenea) from ®ve ®sh families (Teleostei) q Iveta Matejusova a, Milan Gelnar a, Alastair J.A. McBeath b, Catherine M. Collins c, Carey O. Cunningham b,* a
Department of Zoology and Ecology, Faculty of Science, Masaryk University, KotlaÂrska 2, 611 37 Brno, Czech Republic b FRS Marine Laboratory, P.O. Box 101, Victoria Road, Aberdeen AB11 9DB, Scotland, UK c Department of Molecular & Cell Biology, University of Aberdeen, Zoology Building, Tillydrone Avenue, Aberdeen AB24 3TZ, Scotland, UK Received 11 January 2001; received in revised form 8 February 2001; accepted 8 February 2001
Abstract Thirty-one gyrodactylid species from ®ve families of freshwater ®sh were examined and variable region V4 of the 18S small subunit ribosomal RNA gene and ribosomal RNA internal transcribed spacers ITS1 and ITS2 were sequenced. Both the V4 region and spacers ITS1 and ITS2 proved useful for gyrodactylid diagnosis. Sequences of these fragments exhibited interspeci®c variations and allowed clear determination at the species level. In some cases, the length of the ITS1 PCR fragment provided useful genetic markers. Species that yielded a short ITS1 fragment also showed distinct groupings in ITS2 and V4 sequences that were markedly different to sequences from species that contain a long ITS1. Repetitive sequences located in the ITS1 of Gyrodactylus gobii and Gyrodactylus vimbi accounted for some of the variations in length of PCR products. There was no evidence for intraspeci®c variation within these regions and short tandem repeats were not found in the other species studied. The number of polymorphic and intraspeci®c variations in nucleic acid sequences was low, therefore these variations did not affect species determination of gyrodactylids. Minor differences in the sequences between Western and Eastern European populations were detected for Gyrodactylus salaris/Gyrodactylus thymalli, Gyrodactylus teuchis and Gyrodactylus truttae, but these do not affect species diagnosis based on ribosomal DNA sequence. These results con®rm the utility of both variable region V4 and the ITS as molecular markers for Gyrodactylus species. q 2001 Published by Elsevier Science Ltd. on behalf of Australian Society for Parasitology Inc. Keywords: Gyrodactylus; rRNA; Polymerase chain reaction; Internal transcribed spacers; Species-level identi®cation
1. Introduction Gyrodactylids are viviparous monogenean parasites, living mainly on the skin and ®ns of freshwater and marine ®shes. Gyrodactylids were ®rst identi®ed at the beginning of the nineteenth century with over 300 species named to date (Williams and Jones, 1994). The great diversity of this taxon is displayed in the large range of host organisms, the shape of attachment organs and in the way they affect the health condition of their ®sh hosts. Species identi®cation of gyrodactylids is mainly based on the hard parts of the attachment apparatus, where the shape and length of marginal hooks have proven to be especially useful (Malmberg, 1970). Nevertheless, it has q Nucleotide sequence data reported in this paper are available in the EMBL database under the accession numbers AJ407865±AJ407880, AJ407882±AJ407887, and AJ407889±AJ407936. * Corresponding author. Tel.: 144-1224-295-634; fax: 144-1224-295620. E-mail address: [email protected] (C.O. Cunningham).
been demonstrated, both experimentally and under natural conditions, that these hard parts show a high degree of variation in size and shape that is linked to water temperature (Ergens, 1981; Ergens and Gelnar, 1985; Mo, 1991), age of parasites (Ergens, 1965, 1983), species of host ®sh (Ergens, 1983; Mo, 1993; Geets et al., 1999), geographical distribution (Malmberg, 1987; Ergens, 1991) or site on hosts (Appleby, 1996). Increased intraspeci®c divergence in Gyrodactylus salaris resulting from genetic drift in ®sh farm populations. Proceedings of the XIII Symposium of the Scandinavian Society for Parasitology, Helsinki, Finland, June 12±14th, 1987, Abo, 19, 33; Ergens, 1991) or site on hosts (Appleby, 1996). Consequently, determination of gyrodactylids demands a great deal of skill and experience. Pathogenic effects on hosts have been described in some gyrodactylid species, notably Gyrodactylus salaris (Cone and Odense, 1984; Cone and Cusack, 1988; Mo, 1994). Because of the pathogenicity and great variability within the gyrodactylids, there was a need to distinguish species
0020-7519/01/$20.00 q 2001 Published by Elsevier Science Ltd. on behalf of Australian Society for Parasitology Inc. PII: S00 20-7519(01)0017 6-X
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
pathogenic to salmonids to prevent introduction to other countries by imports or natural movements of ®sh. Signi®cant advances have been made in the development of molecular techniques to effectively diagnose parasite species (McManus and Bowles, 1996). The genes and spacer regions of the rRNA gene repeat have been found to be useful in molecular taxonomy and phylogeny of many parasite taxa, including digeneans, cestodes and nematodes (Blair et al., 1996; Gasser et al., 1999; van Herwerden et al., 2000). In the case of salmonid gyrodactylids, the rRNA gene repeat (rDNA) has been studied and it is now possible to distinguish three species, at the level of a single worm. Sequence differences detected in the V4 region of the 18S rRNA gene and the internal transcribed spacers (ITS) can be exploited in restriction fragment length polymorphism (RFLP) analysis for rapid diagnosis (Cunningham et al., 1995a; Cunningham, 1997). Oligonucleotide probes that hybridise to the V4 PCR product have also been used to discriminate G. salaris, Gyrodactylus derjavini and Gyrodactylus truttae (Cunningham et al., 1995b). However, the sequences of the V4 region and the ITS of G. salaris and Gyrodactylus thymalli are identical and thus cannot be used to separate these species. The present study reports the results of molecular analysis of a larger number of gyrodactylid species, isolated from the ®sh families Salmonidae, Balitoridae, Cobitidae, Cyprinidae and Percidae in the Czech Republic. We demonstrate that the sequences of the V4 region, the rDNA ITS, and in some cases the length of PCR products, provide useful genetic markers for a wide range of species in the genus Gyrodactylus. 2. Materials and methods 2.1. Parasite collection Fish from ®ve families, caught by electro®shing in the Dyje, Morava and VlaÂra Rivers, in the Czech Republic, were transported to the laboratory in tanks with original river water and killed. Parasites were removed from the ®ns; the opisthaptor of each specimen was cut off, ®xed with mixture of glycerine and ammonium-picrate (Malmberg, 1970) and placed on a microscope with a coverslip. The remainder of the parasites' bodies were stored in absolute ethanol (Allied-Signal, Riedel-de HaeÈn) at 48C. The opisthaptor was examined and species identi®ed according to the shape and length of the hard parts of opisthaptor (Gussev, 1985). Thirty-one species of gyrodactylids, parasitising 18 host species, were determined (Table 1). 2.2. DNA extraction and PCR ampli®cation Individual parasites were removed from ethanol and placed in 0.5 ml tubes containing 7.5 ml lysis buffer (proteinase K 20 mg/ml, NP40 0.45%, Tween 20 0.45% in Tris± HCl 10 mM, EDTA 1 mM, pH 8.0). Tubes were incubated at
739
658C for 20 min, then for 10 min at 958C to inactivate the proteinase K. The V4 region of the 18S rDNA was ampli®ed using primers V4F (5 0 ±CTATTGGAGGGCAGTCT) and V4R (5 0 ±CTTTTCAGGCTTCAAGG) as described previously (Cunningham et al., 1995a). Each ampli®cation reaction contained 2.5 ml lysate, 1£ buffer (Bioline), 1.5 mM MgCl2, 200 mM dNTPs, 1 mM each primer and 1U Taq polymerase (Bioline) in a total volume of 20 ml. The reaction was carried out in a Genius thermocycler (Techne) using 5 min at 958C (hot start), then 25 cycles of 1 min at 928C, 30 s at 508C and 30 s at 728C. PCR products were analysed on ethidium bromide-stained 1.5% agarose gels. The oligonucleotide primers used for ampli®cation of the ITS1 region were ITS1A (5 0 ±GTAACAAGGTTTCCGTAGGTG) complementary to sequence at the 3 0 terminus of the 18S rRNA gene and ITSR3A (5 0 ±GAGCCGAGTGATCCACC) complementary to sequence at the 5 0 end of the 5.8S gene. PCR reagent concentrations were as described above. Reactions were heated to 958C for 5 min then subjected to 30 cycles of 948C for 1 min, 508C for 1 min and 728C for 2 min. A fragment spanning ITS2 was ampli®ed using primers ITS4.5 (5 0 -CATCGGTCTCTCGAACG) and ITS2 (5 0 TCCTCCGCTTAGTGATA). The reaction mix and cycling conditions were as described for ampli®cation of ITS1. 2.3. Nucleotide sequencing PCR products were puri®ed using spin columns (Wizard PCR Preps, Promega) or by puri®cation from agarose gel (Geneclean III, Bio 101). Puri®ed fragments were sequenced in both directions using the same primers as in the ampli®cation reaction. Sequencing was carried out using Big Dye and an ABI377 DNA Sequencer (Applied Biosystems). Sequences were analysed using Sequencher software (Gene Codes Corp.). Consensus sequences for each species were obtained using forward and reverse reactions from the number of parasites indicated in Table 1. Sequence alignments were produced using CLUSTALW (Thompson et al., 1994). Genetic distances were calculated using MEGA (Kumar, S., Tamura K., Jakobsen, I.B., Nei, M., 2000. MEGA: Molecular Evolutionary Genetics Analysis, Version 2.0. Pennsylvania State University, University Park, and Arizona State University, Tempe). 3. Results 3.1. Characteristics of the V4 region A fragment of approximately 330 bp was ampli®ed from 21 gyrodactylid species using primers V4F and V4R. The V4 sequences were determined and partial sequences are shown in Fig. 1, aligned with the 18S rDNA sequence of G. salaris (EMBL accession number Z26942). V4 sequences obtained have been deposited in the EMBL
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
740
Table 1 Gyrodactylus species samples used in this study a Gyrodactylus species
Host species
Fish family
Sampling site
No. specimens sequenced
G. aphyae G. barbi G. blicensis G. carassii G. cernuae G. derjavini G. elegans G. fossilis G. gobiensis G. gobii G. gracilihamatus G. gurleyi G. hronosus G. jiroveci G. katharineri G. kobayashii G. laevis G. lomi G. longoacuminatus G. lotae G. luciopercae G. macronychus G. markakulensis G. misgurni G. rhodei G. rutilensis G. salaris/thymalli G. sedelnikovi G. teuchis G. teuchis G. truttae G. vimbi
Phoxinus phoxinus Barbus barbus Alburnus alburnus Alburnus alburnus Gymnocephalus cernuae Salvelinus fontinalis Blicca bjoerkna Misgurnus fossilis Gobio gobio Gobio gobio Abramis brama Carassius auratus Alburnoides bipunctatus Barbatula barbatula Barbus barbus Carassius auratus Alburnoides bipunctatus Leuciscus cephalus Carassius auratus Lota lota Perca ¯uviatilis Phoxinus phoxinus Gobio gobio Misgurnus fossilis Rhodeus sericeus Rutilus rutilus Salmo trutta Barbatula barbatula Salmo trutta Salvelinus fontinalis Salmo trutta Leuciscus cephalus
C C C C P S C Cb C C C C C B C C C C C C P C C Cb C C S B S S S C
V M, V M M M V M D M M M M V V M M V M M M M V M D M M V V V V V M
3 5 2 7 2 4 4 5 3 10 2 2 4 4 4 3 1 7 4 1 6 5 2 1 10 4 1 5 2 3 9 7
a
Fish families: B, Balitoridae; C, Cyprinidae; Cb, Cobitidae; P, Percidae; S, Salmonidae. Sampling sites; D, Dyje River; M, Morava River; V, VlaÂra River.
nucleotide database under accession numbers AJ407894± AJ407914. Clear differences were found among gyrodactylid species. Only one intraspeci®c variation was found within the V4 region of the studied species where Gyrodactylus truttae individuals were polymorphic for G or T at position 818 in Fig. 1. 3.2. Characteristics of the ITS1 region The ITS1 region was ampli®ed from individual parasites of 30 species of gyrodactylids. The PCR product obtained from different gyrodactylid species varied in size from approximately 420 to 930 bp. According to the length of the fragment, two groups (A, B) of species could be identi®ed (Table 2). Group A consisted of seven species of gyrodactylids with ITS1 shorter than 500 bp, whereas group B consisted of 23 species with ITS1 longer than 600 bp long. The ITS1 sequences determined from each gyrodactylid species displayed interspeci®c variability and provided discrimination at the level of species. ITS1 sequences obtained have been deposited in the EMBL nucleotide data-
base under accession numbers AJ407865±AJ407887 and AJ407889±AJ407893. Intraspeci®c variation within the ampli®ed fragment was detected only in three species; Gyrodactylus lomi, which contained A or T at 1 nucleotide, Gyrodactylus markakulensis had C or T at one nucleotide, and G. truttae, which also had C or T at one nucleotide. The G. markakulensis variation appeared as a difference between the forward and reverse sequencing reactions. The G. truttae variation was due to one parasite containing C at one position and two others containing T. A region of repetitive DNA was found near the 5 0 end of the ITS1 in Gyrodactylus gobii and Gyrodactylus vimbi that resembled a (GAA)n short tandem repeat (STR) or microsatellite. This region lies within nucleotides 137±164 of the G. gobii sequence and 126±173 of the G. vimbi sequence. There was no evidence for intraspeci®c variation within these regions. 3.3. Characteristics of the ITS2 region The ITS2 region of rDNA was ampli®ed from 27 gyro-
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
741
Fig. 1. Multiple alignment of the consensus sequences of the V4 region of the 18S rRNA gene from 21 species of gyrodactylids obtained in this study. (.:) Nucleotide identical to G. salaris, (-:) alignment gap. Numbers correspond to G. salaris 18S rRNA gene sequence.
dactylid species. ITS2 sequences obtained have been deposited in the EMBL nucleotide database under accession numbers AJ407915±AJ407936 and AJ407893. ITS2 sequence was obtained from one specimen that could not be unambiguously identi®ed as either G. salaris or G. thymalli and therefore is described as G. salaris/thymalli. The sequences of ITS2 from G. salaris/thymalli, G. derjaTable 2 Grouping of gyrodactylid species according to the length of ITS1 fragment ITS length grouping
Length of fragment (bp)
Gyrodactylus species
A
, 500
B
. 600
G. carassii, G. elegans, G. laevis, G. lotae, G. markakulensis, G. misgurni, G. sedelnikovi G. aphyae, G. barbi, G. blicensis, G. cernuae, G. derjavini G. fossilis, G. gobiensis, G. gobii, G. gracilihamatus, G. gurleyi, G. hronosus, G. jiroveci, G. katharineri, G. kobayashii, G. lomi, G. longoacuminatus, G. luciopercae G. macronychus, G. rhodei, G. rutilensis, G. teuchis, G. truttae, G. vimbi
vini, G. truttae and Gyrodactylus teuchis were the same as previously reported (EMBL accession numbers Z72477, AJ132259, AJ132260 and AJ249350, respectively). The ampli®ed ITS2 fragment was approximately 420 to 520 bp long. The variation in the size of this fragment was not as clear as that of the ITS1. Clear differences could be seen in comparisons of ITS2 sequences from group A and group B species, reinforcing the grouping of species with long and short ITS1 fragments. The ITS2 fragment exhibited interspeci®c variability with stable differences in nucleotide sequences of all the studied species. Intraspeci®c differences were found among individual specimens of Gyrodactylus barbi, where one specimen contained an A at position 173 in the alignment and three others contained G. Polymorphism was noted at position 154 of the Gyrodactylus carassii sequence, where six individuals produced A/T and one contained only A. 3.4. Genetic differences between consensus sequences of gyrodactylids Sequence variation in the V4 region between twenty-one species of gyrodactylids ranged from 1.3 to 12.1%. The V4
742
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
Fig. 2. Percentage pairwise genetic distances in ITS1 (A) and ITS2 (B) sequences, calculated using the Kimura 2-parameter model in MEGA (Kumar, S., Tamura K., Jakobsen, I.B., Nei, M., 2000. MEGA: Molecular Evolutionary Genetics Analysis, Version 2.0. Pennsylvania State University, University Park, and Arizona State University, Tempe). Shaded values indicate comparisons between sequences from group A (G. (Gyrodactylus) subgenus) and group B (G. (Limnonephrotus) subgenus) species.
sequences from G. markakulensis and Gyrodactylus misgurni were notably different to the sequences from other species of gyrodactylids and genetic differences between these and other species reached up to 40%. Interspeci®c variation in ITS sequences, expressed as percentage similarity in nucleotide sequence, is tabulated in Fig. 2. ITS1 sequences were variable and dif®cult to
align at the 5 0 end, due to the length differences in the PCR products. The 3 0 end of ITS1 was more conserved and 350 bp of sequence from this portion of ITS1, which could be reliably aligned, were used to calculate the values in Fig. 2. Group A and Group B sequences share low ITS1 similarity, ranging from 44.0±58.9%. Within Group A, ITS1 similarity ranges from 55.1±92.1%. Group B species show
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
greater ITS1 similarity, ranging from 69.1±96.7%. Analysis of ITS2 sequences revealed the same pattern, with low similarity between Group A and Group B sequences and relatively high similarity of sequences within Group B. 4. Discussion The ampli®cation of all three fragments of rDNA was performed using PCR and even part of a single specimen of the gyrodactylids was suf®cient to yield a product concentrated enough for puri®cation and sequencing without the necessity for cloning. Thus the important taxonomic structures of the opisthaptor, such as anchors, marginal hooks and ventral bar, were measured for each specimen while the body was retained for molecular analysis. Species identi®cations made using morphological structures of the opisthaptor produced the same results as sequencing all three fragments of rDNA. Although each specimen provides enough DNA for several ampli®cation reactions, not all fragments were obtained from each parasite. It was not possible to obtain each fragment from all species in cases where only a very few specimens were obtained. Differences in sequences of both ITS1 and ITS2 spacers were detected when comparing sequences produced in this study and those generated by Cable et al. (1999) for G. kobayashii and G. gurleyi. The magnitude of these differences was greater than that between populations of gyrodactylids from different geographical areas and could potentially arise through use of different methodologies in different laboratories and care must be taken if using sequences from different sources in alignments. The boundaries of the V4 region and internal transcribed spacers 1 and 2 were determined by comparison with the sequence of G. salaris (see Cunningham et al., 1995a, 2000). Using primers V4F and V4R, the V4 sequences presented here also contain approximately 100 nucleotides of 18S rDNA sequence upstream of the V4 region. Sequences from all three fragments; the V4 region of the 18S rDNA and both the internal transcribed spacers, contain interspeci®c variations and clearly allow discrimination at the species level. This ®nding has also been con®rmed during study of salmonid gyrodactylids. The number of intraspeci®c variations or polymorphisms in nucleic acid sequences was low. The polymorphism in G. carassii ITS2 could potentially be due to heterozygosity or perhaps the existence of polymorphism between individual units of the rDNA repeat. This was not examined further as it was not a common occurrence, and the degree of interspeci®c differences revealed by sequencing can be con®dently used for gyrodactylid diagnosis. There is still a lack of information concerning population differences in nucleotide sequences of monogenean parasites. Molecular data from the salmonid gyrodactylids G. derjavini, G. salaris/thymalli, G. teuchis and G. truttae in the present study were compared with known sequences of
743
these species from Western Europe (Cunningham et al., 2000, 2001). Minor differences, ranging from one to four nucleotides, were detected for G. salaris/thymalli, G. teuchis and G. truttae when comparing ITS1 sequences between Western and Eastern European populations. The sequence variations did not affect discrimination of these species using restriction enzyme digestion of PCR-ampli®ed ITS as described by Cunningham (1997). No population differences between the gyrodactylids from Western and Eastern Europe were found in ITS2. This resembles the situation in digeneans and nematodes (Adlard et al., 1993; Hoste et al., 1993). Within the V4 region one difference in nucleic acid sequences of Western and Eastern populations was detected for G. truttae. This conservation of sequence between geographically distinct populations of these species demonstrates the validity of these regions of the genome as species markers. Unfortunately, for many of the species examined in this study, very few specimens were available and these were collected from single locations, so the degree of intraspeci®c sequence variation cannot be determined with certainty. Gyrodactylus barbi was collected from both Morava and VlaÂra rivers and the polymorphism in ITS2 sequences was found between individuals from the Morava river and was not seen when comparing sequences of parasites from the different locations. This result, and the high degree of sequence conservation in populations of the salmonid parasites that are widely separated, indicates that intraspeci®c variation is likely to be very low and will not be confused with the signi®cant differences found between species. Sequence differences between populations of gyrodactylid species from different ®sh hosts were also considered. Gyrodactylus teuchis was found parasitising two species of salmonid hosts, Salmo trutta and Salvelinus fontinalis. The occurrence of G. teuchis on the latter host represents a new host record for this Gyrodactylus species, which appears less host-speci®c than gyrodactylids are commonly assumed to be. No differences in the ITS were found between the populations from these two ®sh hosts. For the purposes of a diagnostic test, the V4 fragment is well suited, due to the relatively short length of the fragment and great interspeci®c variability as was previously noted for G. derjavini, G. salaris and G. truttae (see Cunningham et al., 1995a). Analysis of the V4 region is best carried out by sequencing because restriction fragments are small and dif®cult to analyse and reliance on probe hybridisation can lead to inaccurate diagnoses, as illustrated by hybridisation of one probe to the V4 DNA of both G. salaris and G. teuchis (see Cunningham et al., 2001). The ribosomal spacers have proved suitable for discriminating species from other groups of parasites (Gasser et al., 1999; Hoste et al., 1995; van Herwerden et al., 1998). However, the great number and diversity of Gyrodactylus species creates special concerns when developing such tools. As demonstrated by Cunningham et al. (2001), some methods of diagnosis may not provide suf®cient speci-
744
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
®city to separate some species and nucleotide sequencing still provides the greatest detail. Sequencing large numbers of samples can be costly, therefore, for large scale diagnostic testing, restriction fragment analysis of the ITS may be more suitable. RFLP within the ITS have already been demonstrated to provide useful species markers for Gyrodactylus (see Cunningham, 1997, 2001). The ITS1 was found to be variable not only in nucleic acid sequence but also in length of fragment. This feature could be also useful for identi®cation of groups of gyrodactylids, followed by restriction digests to provide exact species determination of the worm. Alternatively, one of the many other methods that have been employed to demonstrate sequence differences in parasite ITS (see Gasser, 1999) could be employed. Length variation in the ITS1 was previously recorded in the investigation of 11 species of gyrodactylids (Cable et al., 1999) where the short ITS1 (approximately 400 bp) was obtained from four species and the long ITS1 (approximately 600 bp) from seven species of gyrodactylids. Microsatellites were detected in the ITS1 of two strains in the Schistosoma japonicum species complex and showed intraspeci®c variation (van Herwerden et al., 1998). In the present study, a 50 bp STR was found in the ITS1 sequence of G. vimbi and a 29 bp STR in G. gobii. This accounts for the greater length of ITS1 in these species, but no other ITS1 sequence contained STR and thus the presence or absence of repeat units cannot account for the majority of length variation in Gyrodactylus ITS. The product of ITS1 ampli®cation from G. lomi also contained additional sequence upstream of the start of the ITS that was not homologous to the ITS of other Gyrodactylus species. This could be due to non-speci®c ampli®cation and the sequence has not been identi®ed following BLAST searches of the EMBL nucleotide database. Several specimens of G. lomi produced a PCR product of the same size, and the primers used have not resulted in non-speci®c ampli®cation from any other Gyrodactylus species examined to date. Despite the uncertain origin of this additional sequence, the length of the PCR fragment is still suitable for diagnostic purposes, being longer than others from Group B species. The group of species that have a short ITS1 could also be clearly discriminated from the other species in alignments of ITS2 and V4 sequences (see Figs. 1 and 2). This group has previously been differentiated from the others on the basis of protonephridial system morphology (Malmberg, 1956) and contains members of the subgenus G. (Gyrodactylus) whereas species with a long ITS1 are members of G. (Limnonephrotus). Thus features of DNA sequences concur with species groupings made using morphological features. The morphological similarity of the attachment organs of gyrodactylids belonging to groups of species with short or long ITS1 was also considered. No strong support for groups of species based on morphology was established by previous authors, using different species to those sampled in the present study (Cable et al., 1999). In conformity with Malmberg (1970), the shape of anchors, ventral bar and
marginal hooks were considered as major criteria. Certain species with short ITS1 (G. carassii, G. elegans, G. laevis, G. markakulensis, G. misgurni, G. sedelnikovi) have speci®c types of marginal hooks and a ventral bar with reduced lateral processes that differ from those of species with long ITS1 and thus the molecular evidence is in agreement with morphological groupings. Even in species that have very similar morphology, such as G. longoacuminatus and G. gurleyi, clear sequence differences were evident, as is the case with G. salaris and G. teuchis (Cunningham et al., 2001). There was no major correlation between sequences of Gyrodactylus species from either Group A or B and families of ®sh hosts. The gyrodactylids from Group A were parasitising hosts from three ®sh families, Balitoridae, Cobitidae, Cyprinidae, but not ®sh from the families Percidae and Salmonidae and Group B contained gyrodactylid species from all ®sh families studied. Acknowledgements The authors would like to thank Dr Radim Ergens for help with morphological determination of material. We also thank to Dr Pavel Jurajda and Martin Reichard from Institute of Vertebrate Biology, Brno, Czech Republic for electro®shing. We are very grateful to MarkeÂta Ondrackova and Radim Blazek from Masaryk University in Brno, Czech Republic and also Sandy Mitchell, Julie Inglis and Nicola Bain from FRS Marine Laboratory, Aberdeen, Scotland for kind help in laboratory work and sequencing. This work was supported by EC FAIR project PL97-3406, Research Project of Masaryk University No. J07/98: 143100010 and Grant Agency of the Czech Republic 524/00/0844. References Adlard, R.D., Barker, S.C., Blair, D., Cribb, T.H., 1993. Comparison of the second internal transcribed spacer (ribosomal DNA) from populations and species of fasciolidae (Digenea). Int. J. Parasitol. 23, 423±5. Appleby, C., 1996. Variability of the opisthaptoral hard parts of Gyrodactylus callariatis Malmberg, 1957 (Monogenea, Gyrodactylidae) from Atlantic cod Gadus morhua L. in the Oslo Fjord, Norway. Syst. Parasitol. 33, 199±207. Blair, D., Campos, A., Cummings, M.P., Laclette, J.P., 1996. Evolutionary biology of parasitic platyhelminths: the role of molecular phylogenetics. Parasitol. Today 12, 66±71. Cable, J., Harris, P.D., Tinsley, R.C., Lazarus, C.M., 1999. Phylogenetic analysis of Gyrodactylus spp. (Platyhelminthes: Monogenea) using ribosomal DNA sequences. Can. J. Zool. 77, 1439±49. Cone, D.K., Cusack, R.A., 1988. Study of Gyrodactylus colemanensis Mizelle & Kritsky, 1967 and Gyrodactylus salmonis (Yin & Sproston, 1948) (Monogenea) parasitizing captive salmonids in Nova Scotia. Can. J. Zool. 66, 409±15. Cone, D.K., Odense, P.H., 1984. Pathology of ®ve species of Gyrodactylus Nordmann, 1832 (Monogenea). Can. J. Zool. 61, 1084±8. Cunningham, C.O., 1997. Species variation within the internal transcribed spacer (ITS) region of Gyrodactylus (Monogenea: Gyrodactylidae) ribosomal RNA genes. J. Parasitol. 83, 215±9. Cunningham, C.O., McGillivray, D.M., MacKenzie, K., Melvin, W.T., 1995a. Discrimination between Gyrodactylus salaris, G. derjavini and
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745 G. truttae (Platyhelminthes: Monogenea) using restriction fragment length polymorphisms and an oligonucleotide probe within the small subunit ribosomal RNA gene. Parasitology 111, 87±94. Cunningham, C.O., McGillivray, D.M., MacKenzie, K., 1995b. Identi®cation of Gyrodactylus (Monogenea) species parasitising salmonid ®sh using DNA probes. J. Fish Dis. 18, 539±44. Cunningham, C.O., Aliesky, H., Collins, C.M., 2000. Sequence and secondary structure variation in the Gyrodactylus (Platyhelminthes: Monogenea) ribosomal RNA gene array. J. Parasitol. 86, 537±44. Cunningham, C.O., Mo, T.A., Collins, C.M., Buchmann, K., Thiery, R., Blanc, G., Lautraite, A., 2001. Redescription of Gyrodactylus teuchis Lautraite, Blanc, Thiery, Daniel & Vigneulle, 1999 (Monogenea: Gyrodactylidae), a species identi®ed by ribosomal RNA sequence. Syst. Parasitol. 48, 141±50. Ergens, R., 1965. Die morphogenese der chitinoiden Teile des Haptors bei Gyrodactylus tincae (Malmberg, 1956) Malmberg, 1964 (Monogenoidea) und ihre morphologish-metrische Variabilitat. Z. f. Parasitenkunde 26, 173±84. Ergens, R., 1981. Variability of hard parts of opisthaptor in Gyrodactylus truttae GlaÈser, 1974 (Gyrodactylidae: Monogenea). Folia Parasitol. 28, 37±42. Ergens, R., 1983. A survey of the results of studies on Gyrodactylus katharineri Malmberg, 1964 (Gyrodactylidae: Monogenea). Folia Parasitol. 30, 319±27. Ergens, R., 1991. Variability of the hard parts of opisthaptor of Gyrodactylus leucisci Zitnan, 1964 (Monogenea: Gyrodactylidae). Folia Parasitol. 38, 23±28. Ergens, R., Gelnar, M., 1985. Experimental veri®cation of the effect of temperature on the size of hard parts of opisthaptor of Gyrodactylus katharineri Malmberg, 1964 (Monogenea). Folia Parasitol. 32, 377± 80. Gasser, R.B., 1999. PCR-based technology in veterinary parasitology. Vet. Parasitol. 84, 229±58. Gasser, R.B., Rossi, L., Zhu, X., 1999. Identi®cation of Nematodirus species (Nematoda: Molineidae) from wild ruminants in Italy using ribosomal DNA markers. Int. J. Parasitol. 29, 1809±17. Geets, A., Appleby, C., Ollevier, F., 1999. Host-dependent and seasonal variation in opisthaptoral hard parts of Gyrodactylus cf. arcuatus from three Pomatoschistus spp. and G. arcuatus from Gasterosteus aculeatus: a multivariate approach. Parasitology 119, 27±40. Gussev, A.V., 1985. Parasitic Monogeneans (Part 1). In: Bauer, O.N. (Ed.), Key to Parasites of Freshwater Fish Fauna of the USSR, Vol. 2. Nauka, Leningrad, p. 424 (in Russian).
745
Hoste, H., Gasser, R.B., Chilton, N.B., Mallet, S., Beveridge, I., 1993. Lack of intraspeci®c variation in the second internal transcribed spacer (ITS2) of Trichostrongylus colubriformis ribosomal DNA. Int. J. Parasitol. 23, 1069±71. Hoste, H., Chilton, N.B., Gasser, R.B., Beveridge, I., 1995. Differences in the second internal transcribed spacer (ribosomal DNA) between ®ve species of Trichostrongylus (Nematoda: Trichostrongylidae). Int. J. Parasitol. 25, 75±80. Malmberg, G., 1956. On a new genus of viviparous monogenetic trematodes. Arkiv. Zool. 10, 317±29. Malmberg, G., 1970. The excretory systems and the marginal hooks as a basis for the systematics of Gyrodactylus (Trematoda, Monogenea). Arkiv. Zool. Serie 2 (Band 23), 235. Malmberg, G., 1970. Increased intraspeci®c divergence in Gyrodactylus salaris resulting from genetic drift in ®sh farm populations. Proceedings of the XIII Symposium of the Scandinavian Soceity for Parasitology, Helsinki, Finland, June 12±14th, 1987, Abs 19, 33. McManus, D.P., Bowles, J., 1996. Molecular genetic approaches to parasite identi®cation: their value in diagnostic parasitology and systematics. Int. J. Parasitol. 26, 687±704. Mo, T.A., 1991. Seasonal variations of opisthaptoral hard parts of Gyrodactylus salaris Malmberg, 1957 (Monogenea: Gyrodactylidae) on parr of Atlantic salmon Salmo salar L. in the River Batnfjordselva, Norway. Syst. Parasitol. 19, 231±40. Mo, T.A., 1993. Seasonal variations of the opisthaptoral hard parts of Gyrodactylus derjavini Mikailov, 1975 (Monogenea: Gyrodactylidea) on brown trout Salmo trutta L. parr and Atlantic salmon S. salar L. parr in the River Sandvikselva, Norway. Syst. Parasitol. 26, 225±31. Mo, T.A., 1994. Status of Gyrodactylus salaris problems and research in Norway. In: Pike, A.W., Lewis, J.W. (Eds.). Parasitic Diseases of Fish, Samara, Dyfed, UK, pp. 43±56. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-speci®c gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673±80. van Herwerden, L., Blair, D., Agatsuma, T., 1998. Intra- and inter-speci®c variation in nuclear ribosomal internal transcribed spacer 1 of the Schistosoma japonicum species complex. Parasitology 116, 311±7. van Herwerden, L., Gasser, R.B., Blair, D., 2000. ITS-1 ribosomal DNA sequence variants are maintained in different species and strains of Echinococcus. Int. J. Parasitol. 30, 157±69. Williams, H., Jones, A., 1994. Parasitic Worms of Fish, Taylor & Francis, London.
www.parasitology-online.com
Molecular markers for gyrodactylids (Gyrodactylidae: Monogenea) from ®ve ®sh families (Teleostei) q Iveta Matejusova a, Milan Gelnar a, Alastair J.A. McBeath b, Catherine M. Collins c, Carey O. Cunningham b,* a
Department of Zoology and Ecology, Faculty of Science, Masaryk University, KotlaÂrska 2, 611 37 Brno, Czech Republic b FRS Marine Laboratory, P.O. Box 101, Victoria Road, Aberdeen AB11 9DB, Scotland, UK c Department of Molecular & Cell Biology, University of Aberdeen, Zoology Building, Tillydrone Avenue, Aberdeen AB24 3TZ, Scotland, UK Received 11 January 2001; received in revised form 8 February 2001; accepted 8 February 2001
Abstract Thirty-one gyrodactylid species from ®ve families of freshwater ®sh were examined and variable region V4 of the 18S small subunit ribosomal RNA gene and ribosomal RNA internal transcribed spacers ITS1 and ITS2 were sequenced. Both the V4 region and spacers ITS1 and ITS2 proved useful for gyrodactylid diagnosis. Sequences of these fragments exhibited interspeci®c variations and allowed clear determination at the species level. In some cases, the length of the ITS1 PCR fragment provided useful genetic markers. Species that yielded a short ITS1 fragment also showed distinct groupings in ITS2 and V4 sequences that were markedly different to sequences from species that contain a long ITS1. Repetitive sequences located in the ITS1 of Gyrodactylus gobii and Gyrodactylus vimbi accounted for some of the variations in length of PCR products. There was no evidence for intraspeci®c variation within these regions and short tandem repeats were not found in the other species studied. The number of polymorphic and intraspeci®c variations in nucleic acid sequences was low, therefore these variations did not affect species determination of gyrodactylids. Minor differences in the sequences between Western and Eastern European populations were detected for Gyrodactylus salaris/Gyrodactylus thymalli, Gyrodactylus teuchis and Gyrodactylus truttae, but these do not affect species diagnosis based on ribosomal DNA sequence. These results con®rm the utility of both variable region V4 and the ITS as molecular markers for Gyrodactylus species. q 2001 Published by Elsevier Science Ltd. on behalf of Australian Society for Parasitology Inc. Keywords: Gyrodactylus; rRNA; Polymerase chain reaction; Internal transcribed spacers; Species-level identi®cation
1. Introduction Gyrodactylids are viviparous monogenean parasites, living mainly on the skin and ®ns of freshwater and marine ®shes. Gyrodactylids were ®rst identi®ed at the beginning of the nineteenth century with over 300 species named to date (Williams and Jones, 1994). The great diversity of this taxon is displayed in the large range of host organisms, the shape of attachment organs and in the way they affect the health condition of their ®sh hosts. Species identi®cation of gyrodactylids is mainly based on the hard parts of the attachment apparatus, where the shape and length of marginal hooks have proven to be especially useful (Malmberg, 1970). Nevertheless, it has q Nucleotide sequence data reported in this paper are available in the EMBL database under the accession numbers AJ407865±AJ407880, AJ407882±AJ407887, and AJ407889±AJ407936. * Corresponding author. Tel.: 144-1224-295-634; fax: 144-1224-295620. E-mail address: [email protected] (C.O. Cunningham).
been demonstrated, both experimentally and under natural conditions, that these hard parts show a high degree of variation in size and shape that is linked to water temperature (Ergens, 1981; Ergens and Gelnar, 1985; Mo, 1991), age of parasites (Ergens, 1965, 1983), species of host ®sh (Ergens, 1983; Mo, 1993; Geets et al., 1999), geographical distribution (Malmberg, 1987; Ergens, 1991) or site on hosts (Appleby, 1996). Increased intraspeci®c divergence in Gyrodactylus salaris resulting from genetic drift in ®sh farm populations. Proceedings of the XIII Symposium of the Scandinavian Society for Parasitology, Helsinki, Finland, June 12±14th, 1987, Abo, 19, 33; Ergens, 1991) or site on hosts (Appleby, 1996). Consequently, determination of gyrodactylids demands a great deal of skill and experience. Pathogenic effects on hosts have been described in some gyrodactylid species, notably Gyrodactylus salaris (Cone and Odense, 1984; Cone and Cusack, 1988; Mo, 1994). Because of the pathogenicity and great variability within the gyrodactylids, there was a need to distinguish species
0020-7519/01/$20.00 q 2001 Published by Elsevier Science Ltd. on behalf of Australian Society for Parasitology Inc. PII: S00 20-7519(01)0017 6-X
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
pathogenic to salmonids to prevent introduction to other countries by imports or natural movements of ®sh. Signi®cant advances have been made in the development of molecular techniques to effectively diagnose parasite species (McManus and Bowles, 1996). The genes and spacer regions of the rRNA gene repeat have been found to be useful in molecular taxonomy and phylogeny of many parasite taxa, including digeneans, cestodes and nematodes (Blair et al., 1996; Gasser et al., 1999; van Herwerden et al., 2000). In the case of salmonid gyrodactylids, the rRNA gene repeat (rDNA) has been studied and it is now possible to distinguish three species, at the level of a single worm. Sequence differences detected in the V4 region of the 18S rRNA gene and the internal transcribed spacers (ITS) can be exploited in restriction fragment length polymorphism (RFLP) analysis for rapid diagnosis (Cunningham et al., 1995a; Cunningham, 1997). Oligonucleotide probes that hybridise to the V4 PCR product have also been used to discriminate G. salaris, Gyrodactylus derjavini and Gyrodactylus truttae (Cunningham et al., 1995b). However, the sequences of the V4 region and the ITS of G. salaris and Gyrodactylus thymalli are identical and thus cannot be used to separate these species. The present study reports the results of molecular analysis of a larger number of gyrodactylid species, isolated from the ®sh families Salmonidae, Balitoridae, Cobitidae, Cyprinidae and Percidae in the Czech Republic. We demonstrate that the sequences of the V4 region, the rDNA ITS, and in some cases the length of PCR products, provide useful genetic markers for a wide range of species in the genus Gyrodactylus. 2. Materials and methods 2.1. Parasite collection Fish from ®ve families, caught by electro®shing in the Dyje, Morava and VlaÂra Rivers, in the Czech Republic, were transported to the laboratory in tanks with original river water and killed. Parasites were removed from the ®ns; the opisthaptor of each specimen was cut off, ®xed with mixture of glycerine and ammonium-picrate (Malmberg, 1970) and placed on a microscope with a coverslip. The remainder of the parasites' bodies were stored in absolute ethanol (Allied-Signal, Riedel-de HaeÈn) at 48C. The opisthaptor was examined and species identi®ed according to the shape and length of the hard parts of opisthaptor (Gussev, 1985). Thirty-one species of gyrodactylids, parasitising 18 host species, were determined (Table 1). 2.2. DNA extraction and PCR ampli®cation Individual parasites were removed from ethanol and placed in 0.5 ml tubes containing 7.5 ml lysis buffer (proteinase K 20 mg/ml, NP40 0.45%, Tween 20 0.45% in Tris± HCl 10 mM, EDTA 1 mM, pH 8.0). Tubes were incubated at
739
658C for 20 min, then for 10 min at 958C to inactivate the proteinase K. The V4 region of the 18S rDNA was ampli®ed using primers V4F (5 0 ±CTATTGGAGGGCAGTCT) and V4R (5 0 ±CTTTTCAGGCTTCAAGG) as described previously (Cunningham et al., 1995a). Each ampli®cation reaction contained 2.5 ml lysate, 1£ buffer (Bioline), 1.5 mM MgCl2, 200 mM dNTPs, 1 mM each primer and 1U Taq polymerase (Bioline) in a total volume of 20 ml. The reaction was carried out in a Genius thermocycler (Techne) using 5 min at 958C (hot start), then 25 cycles of 1 min at 928C, 30 s at 508C and 30 s at 728C. PCR products were analysed on ethidium bromide-stained 1.5% agarose gels. The oligonucleotide primers used for ampli®cation of the ITS1 region were ITS1A (5 0 ±GTAACAAGGTTTCCGTAGGTG) complementary to sequence at the 3 0 terminus of the 18S rRNA gene and ITSR3A (5 0 ±GAGCCGAGTGATCCACC) complementary to sequence at the 5 0 end of the 5.8S gene. PCR reagent concentrations were as described above. Reactions were heated to 958C for 5 min then subjected to 30 cycles of 948C for 1 min, 508C for 1 min and 728C for 2 min. A fragment spanning ITS2 was ampli®ed using primers ITS4.5 (5 0 -CATCGGTCTCTCGAACG) and ITS2 (5 0 TCCTCCGCTTAGTGATA). The reaction mix and cycling conditions were as described for ampli®cation of ITS1. 2.3. Nucleotide sequencing PCR products were puri®ed using spin columns (Wizard PCR Preps, Promega) or by puri®cation from agarose gel (Geneclean III, Bio 101). Puri®ed fragments were sequenced in both directions using the same primers as in the ampli®cation reaction. Sequencing was carried out using Big Dye and an ABI377 DNA Sequencer (Applied Biosystems). Sequences were analysed using Sequencher software (Gene Codes Corp.). Consensus sequences for each species were obtained using forward and reverse reactions from the number of parasites indicated in Table 1. Sequence alignments were produced using CLUSTALW (Thompson et al., 1994). Genetic distances were calculated using MEGA (Kumar, S., Tamura K., Jakobsen, I.B., Nei, M., 2000. MEGA: Molecular Evolutionary Genetics Analysis, Version 2.0. Pennsylvania State University, University Park, and Arizona State University, Tempe). 3. Results 3.1. Characteristics of the V4 region A fragment of approximately 330 bp was ampli®ed from 21 gyrodactylid species using primers V4F and V4R. The V4 sequences were determined and partial sequences are shown in Fig. 1, aligned with the 18S rDNA sequence of G. salaris (EMBL accession number Z26942). V4 sequences obtained have been deposited in the EMBL
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
740
Table 1 Gyrodactylus species samples used in this study a Gyrodactylus species
Host species
Fish family
Sampling site
No. specimens sequenced
G. aphyae G. barbi G. blicensis G. carassii G. cernuae G. derjavini G. elegans G. fossilis G. gobiensis G. gobii G. gracilihamatus G. gurleyi G. hronosus G. jiroveci G. katharineri G. kobayashii G. laevis G. lomi G. longoacuminatus G. lotae G. luciopercae G. macronychus G. markakulensis G. misgurni G. rhodei G. rutilensis G. salaris/thymalli G. sedelnikovi G. teuchis G. teuchis G. truttae G. vimbi
Phoxinus phoxinus Barbus barbus Alburnus alburnus Alburnus alburnus Gymnocephalus cernuae Salvelinus fontinalis Blicca bjoerkna Misgurnus fossilis Gobio gobio Gobio gobio Abramis brama Carassius auratus Alburnoides bipunctatus Barbatula barbatula Barbus barbus Carassius auratus Alburnoides bipunctatus Leuciscus cephalus Carassius auratus Lota lota Perca ¯uviatilis Phoxinus phoxinus Gobio gobio Misgurnus fossilis Rhodeus sericeus Rutilus rutilus Salmo trutta Barbatula barbatula Salmo trutta Salvelinus fontinalis Salmo trutta Leuciscus cephalus
C C C C P S C Cb C C C C C B C C C C C C P C C Cb C C S B S S S C
V M, V M M M V M D M M M M V V M M V M M M M V M D M M V V V V V M
3 5 2 7 2 4 4 5 3 10 2 2 4 4 4 3 1 7 4 1 6 5 2 1 10 4 1 5 2 3 9 7
a
Fish families: B, Balitoridae; C, Cyprinidae; Cb, Cobitidae; P, Percidae; S, Salmonidae. Sampling sites; D, Dyje River; M, Morava River; V, VlaÂra River.
nucleotide database under accession numbers AJ407894± AJ407914. Clear differences were found among gyrodactylid species. Only one intraspeci®c variation was found within the V4 region of the studied species where Gyrodactylus truttae individuals were polymorphic for G or T at position 818 in Fig. 1. 3.2. Characteristics of the ITS1 region The ITS1 region was ampli®ed from individual parasites of 30 species of gyrodactylids. The PCR product obtained from different gyrodactylid species varied in size from approximately 420 to 930 bp. According to the length of the fragment, two groups (A, B) of species could be identi®ed (Table 2). Group A consisted of seven species of gyrodactylids with ITS1 shorter than 500 bp, whereas group B consisted of 23 species with ITS1 longer than 600 bp long. The ITS1 sequences determined from each gyrodactylid species displayed interspeci®c variability and provided discrimination at the level of species. ITS1 sequences obtained have been deposited in the EMBL nucleotide data-
base under accession numbers AJ407865±AJ407887 and AJ407889±AJ407893. Intraspeci®c variation within the ampli®ed fragment was detected only in three species; Gyrodactylus lomi, which contained A or T at 1 nucleotide, Gyrodactylus markakulensis had C or T at one nucleotide, and G. truttae, which also had C or T at one nucleotide. The G. markakulensis variation appeared as a difference between the forward and reverse sequencing reactions. The G. truttae variation was due to one parasite containing C at one position and two others containing T. A region of repetitive DNA was found near the 5 0 end of the ITS1 in Gyrodactylus gobii and Gyrodactylus vimbi that resembled a (GAA)n short tandem repeat (STR) or microsatellite. This region lies within nucleotides 137±164 of the G. gobii sequence and 126±173 of the G. vimbi sequence. There was no evidence for intraspeci®c variation within these regions. 3.3. Characteristics of the ITS2 region The ITS2 region of rDNA was ampli®ed from 27 gyro-
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
741
Fig. 1. Multiple alignment of the consensus sequences of the V4 region of the 18S rRNA gene from 21 species of gyrodactylids obtained in this study. (.:) Nucleotide identical to G. salaris, (-:) alignment gap. Numbers correspond to G. salaris 18S rRNA gene sequence.
dactylid species. ITS2 sequences obtained have been deposited in the EMBL nucleotide database under accession numbers AJ407915±AJ407936 and AJ407893. ITS2 sequence was obtained from one specimen that could not be unambiguously identi®ed as either G. salaris or G. thymalli and therefore is described as G. salaris/thymalli. The sequences of ITS2 from G. salaris/thymalli, G. derjaTable 2 Grouping of gyrodactylid species according to the length of ITS1 fragment ITS length grouping
Length of fragment (bp)
Gyrodactylus species
A
, 500
B
. 600
G. carassii, G. elegans, G. laevis, G. lotae, G. markakulensis, G. misgurni, G. sedelnikovi G. aphyae, G. barbi, G. blicensis, G. cernuae, G. derjavini G. fossilis, G. gobiensis, G. gobii, G. gracilihamatus, G. gurleyi, G. hronosus, G. jiroveci, G. katharineri, G. kobayashii, G. lomi, G. longoacuminatus, G. luciopercae G. macronychus, G. rhodei, G. rutilensis, G. teuchis, G. truttae, G. vimbi
vini, G. truttae and Gyrodactylus teuchis were the same as previously reported (EMBL accession numbers Z72477, AJ132259, AJ132260 and AJ249350, respectively). The ampli®ed ITS2 fragment was approximately 420 to 520 bp long. The variation in the size of this fragment was not as clear as that of the ITS1. Clear differences could be seen in comparisons of ITS2 sequences from group A and group B species, reinforcing the grouping of species with long and short ITS1 fragments. The ITS2 fragment exhibited interspeci®c variability with stable differences in nucleotide sequences of all the studied species. Intraspeci®c differences were found among individual specimens of Gyrodactylus barbi, where one specimen contained an A at position 173 in the alignment and three others contained G. Polymorphism was noted at position 154 of the Gyrodactylus carassii sequence, where six individuals produced A/T and one contained only A. 3.4. Genetic differences between consensus sequences of gyrodactylids Sequence variation in the V4 region between twenty-one species of gyrodactylids ranged from 1.3 to 12.1%. The V4
742
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
Fig. 2. Percentage pairwise genetic distances in ITS1 (A) and ITS2 (B) sequences, calculated using the Kimura 2-parameter model in MEGA (Kumar, S., Tamura K., Jakobsen, I.B., Nei, M., 2000. MEGA: Molecular Evolutionary Genetics Analysis, Version 2.0. Pennsylvania State University, University Park, and Arizona State University, Tempe). Shaded values indicate comparisons between sequences from group A (G. (Gyrodactylus) subgenus) and group B (G. (Limnonephrotus) subgenus) species.
sequences from G. markakulensis and Gyrodactylus misgurni were notably different to the sequences from other species of gyrodactylids and genetic differences between these and other species reached up to 40%. Interspeci®c variation in ITS sequences, expressed as percentage similarity in nucleotide sequence, is tabulated in Fig. 2. ITS1 sequences were variable and dif®cult to
align at the 5 0 end, due to the length differences in the PCR products. The 3 0 end of ITS1 was more conserved and 350 bp of sequence from this portion of ITS1, which could be reliably aligned, were used to calculate the values in Fig. 2. Group A and Group B sequences share low ITS1 similarity, ranging from 44.0±58.9%. Within Group A, ITS1 similarity ranges from 55.1±92.1%. Group B species show
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
greater ITS1 similarity, ranging from 69.1±96.7%. Analysis of ITS2 sequences revealed the same pattern, with low similarity between Group A and Group B sequences and relatively high similarity of sequences within Group B. 4. Discussion The ampli®cation of all three fragments of rDNA was performed using PCR and even part of a single specimen of the gyrodactylids was suf®cient to yield a product concentrated enough for puri®cation and sequencing without the necessity for cloning. Thus the important taxonomic structures of the opisthaptor, such as anchors, marginal hooks and ventral bar, were measured for each specimen while the body was retained for molecular analysis. Species identi®cations made using morphological structures of the opisthaptor produced the same results as sequencing all three fragments of rDNA. Although each specimen provides enough DNA for several ampli®cation reactions, not all fragments were obtained from each parasite. It was not possible to obtain each fragment from all species in cases where only a very few specimens were obtained. Differences in sequences of both ITS1 and ITS2 spacers were detected when comparing sequences produced in this study and those generated by Cable et al. (1999) for G. kobayashii and G. gurleyi. The magnitude of these differences was greater than that between populations of gyrodactylids from different geographical areas and could potentially arise through use of different methodologies in different laboratories and care must be taken if using sequences from different sources in alignments. The boundaries of the V4 region and internal transcribed spacers 1 and 2 were determined by comparison with the sequence of G. salaris (see Cunningham et al., 1995a, 2000). Using primers V4F and V4R, the V4 sequences presented here also contain approximately 100 nucleotides of 18S rDNA sequence upstream of the V4 region. Sequences from all three fragments; the V4 region of the 18S rDNA and both the internal transcribed spacers, contain interspeci®c variations and clearly allow discrimination at the species level. This ®nding has also been con®rmed during study of salmonid gyrodactylids. The number of intraspeci®c variations or polymorphisms in nucleic acid sequences was low. The polymorphism in G. carassii ITS2 could potentially be due to heterozygosity or perhaps the existence of polymorphism between individual units of the rDNA repeat. This was not examined further as it was not a common occurrence, and the degree of interspeci®c differences revealed by sequencing can be con®dently used for gyrodactylid diagnosis. There is still a lack of information concerning population differences in nucleotide sequences of monogenean parasites. Molecular data from the salmonid gyrodactylids G. derjavini, G. salaris/thymalli, G. teuchis and G. truttae in the present study were compared with known sequences of
743
these species from Western Europe (Cunningham et al., 2000, 2001). Minor differences, ranging from one to four nucleotides, were detected for G. salaris/thymalli, G. teuchis and G. truttae when comparing ITS1 sequences between Western and Eastern European populations. The sequence variations did not affect discrimination of these species using restriction enzyme digestion of PCR-ampli®ed ITS as described by Cunningham (1997). No population differences between the gyrodactylids from Western and Eastern Europe were found in ITS2. This resembles the situation in digeneans and nematodes (Adlard et al., 1993; Hoste et al., 1993). Within the V4 region one difference in nucleic acid sequences of Western and Eastern populations was detected for G. truttae. This conservation of sequence between geographically distinct populations of these species demonstrates the validity of these regions of the genome as species markers. Unfortunately, for many of the species examined in this study, very few specimens were available and these were collected from single locations, so the degree of intraspeci®c sequence variation cannot be determined with certainty. Gyrodactylus barbi was collected from both Morava and VlaÂra rivers and the polymorphism in ITS2 sequences was found between individuals from the Morava river and was not seen when comparing sequences of parasites from the different locations. This result, and the high degree of sequence conservation in populations of the salmonid parasites that are widely separated, indicates that intraspeci®c variation is likely to be very low and will not be confused with the signi®cant differences found between species. Sequence differences between populations of gyrodactylid species from different ®sh hosts were also considered. Gyrodactylus teuchis was found parasitising two species of salmonid hosts, Salmo trutta and Salvelinus fontinalis. The occurrence of G. teuchis on the latter host represents a new host record for this Gyrodactylus species, which appears less host-speci®c than gyrodactylids are commonly assumed to be. No differences in the ITS were found between the populations from these two ®sh hosts. For the purposes of a diagnostic test, the V4 fragment is well suited, due to the relatively short length of the fragment and great interspeci®c variability as was previously noted for G. derjavini, G. salaris and G. truttae (see Cunningham et al., 1995a). Analysis of the V4 region is best carried out by sequencing because restriction fragments are small and dif®cult to analyse and reliance on probe hybridisation can lead to inaccurate diagnoses, as illustrated by hybridisation of one probe to the V4 DNA of both G. salaris and G. teuchis (see Cunningham et al., 2001). The ribosomal spacers have proved suitable for discriminating species from other groups of parasites (Gasser et al., 1999; Hoste et al., 1995; van Herwerden et al., 1998). However, the great number and diversity of Gyrodactylus species creates special concerns when developing such tools. As demonstrated by Cunningham et al. (2001), some methods of diagnosis may not provide suf®cient speci-
744
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745
®city to separate some species and nucleotide sequencing still provides the greatest detail. Sequencing large numbers of samples can be costly, therefore, for large scale diagnostic testing, restriction fragment analysis of the ITS may be more suitable. RFLP within the ITS have already been demonstrated to provide useful species markers for Gyrodactylus (see Cunningham, 1997, 2001). The ITS1 was found to be variable not only in nucleic acid sequence but also in length of fragment. This feature could be also useful for identi®cation of groups of gyrodactylids, followed by restriction digests to provide exact species determination of the worm. Alternatively, one of the many other methods that have been employed to demonstrate sequence differences in parasite ITS (see Gasser, 1999) could be employed. Length variation in the ITS1 was previously recorded in the investigation of 11 species of gyrodactylids (Cable et al., 1999) where the short ITS1 (approximately 400 bp) was obtained from four species and the long ITS1 (approximately 600 bp) from seven species of gyrodactylids. Microsatellites were detected in the ITS1 of two strains in the Schistosoma japonicum species complex and showed intraspeci®c variation (van Herwerden et al., 1998). In the present study, a 50 bp STR was found in the ITS1 sequence of G. vimbi and a 29 bp STR in G. gobii. This accounts for the greater length of ITS1 in these species, but no other ITS1 sequence contained STR and thus the presence or absence of repeat units cannot account for the majority of length variation in Gyrodactylus ITS. The product of ITS1 ampli®cation from G. lomi also contained additional sequence upstream of the start of the ITS that was not homologous to the ITS of other Gyrodactylus species. This could be due to non-speci®c ampli®cation and the sequence has not been identi®ed following BLAST searches of the EMBL nucleotide database. Several specimens of G. lomi produced a PCR product of the same size, and the primers used have not resulted in non-speci®c ampli®cation from any other Gyrodactylus species examined to date. Despite the uncertain origin of this additional sequence, the length of the PCR fragment is still suitable for diagnostic purposes, being longer than others from Group B species. The group of species that have a short ITS1 could also be clearly discriminated from the other species in alignments of ITS2 and V4 sequences (see Figs. 1 and 2). This group has previously been differentiated from the others on the basis of protonephridial system morphology (Malmberg, 1956) and contains members of the subgenus G. (Gyrodactylus) whereas species with a long ITS1 are members of G. (Limnonephrotus). Thus features of DNA sequences concur with species groupings made using morphological features. The morphological similarity of the attachment organs of gyrodactylids belonging to groups of species with short or long ITS1 was also considered. No strong support for groups of species based on morphology was established by previous authors, using different species to those sampled in the present study (Cable et al., 1999). In conformity with Malmberg (1970), the shape of anchors, ventral bar and
marginal hooks were considered as major criteria. Certain species with short ITS1 (G. carassii, G. elegans, G. laevis, G. markakulensis, G. misgurni, G. sedelnikovi) have speci®c types of marginal hooks and a ventral bar with reduced lateral processes that differ from those of species with long ITS1 and thus the molecular evidence is in agreement with morphological groupings. Even in species that have very similar morphology, such as G. longoacuminatus and G. gurleyi, clear sequence differences were evident, as is the case with G. salaris and G. teuchis (Cunningham et al., 2001). There was no major correlation between sequences of Gyrodactylus species from either Group A or B and families of ®sh hosts. The gyrodactylids from Group A were parasitising hosts from three ®sh families, Balitoridae, Cobitidae, Cyprinidae, but not ®sh from the families Percidae and Salmonidae and Group B contained gyrodactylid species from all ®sh families studied. Acknowledgements The authors would like to thank Dr Radim Ergens for help with morphological determination of material. We also thank to Dr Pavel Jurajda and Martin Reichard from Institute of Vertebrate Biology, Brno, Czech Republic for electro®shing. We are very grateful to MarkeÂta Ondrackova and Radim Blazek from Masaryk University in Brno, Czech Republic and also Sandy Mitchell, Julie Inglis and Nicola Bain from FRS Marine Laboratory, Aberdeen, Scotland for kind help in laboratory work and sequencing. This work was supported by EC FAIR project PL97-3406, Research Project of Masaryk University No. J07/98: 143100010 and Grant Agency of the Czech Republic 524/00/0844. References Adlard, R.D., Barker, S.C., Blair, D., Cribb, T.H., 1993. Comparison of the second internal transcribed spacer (ribosomal DNA) from populations and species of fasciolidae (Digenea). Int. J. Parasitol. 23, 423±5. Appleby, C., 1996. Variability of the opisthaptoral hard parts of Gyrodactylus callariatis Malmberg, 1957 (Monogenea, Gyrodactylidae) from Atlantic cod Gadus morhua L. in the Oslo Fjord, Norway. Syst. Parasitol. 33, 199±207. Blair, D., Campos, A., Cummings, M.P., Laclette, J.P., 1996. Evolutionary biology of parasitic platyhelminths: the role of molecular phylogenetics. Parasitol. Today 12, 66±71. Cable, J., Harris, P.D., Tinsley, R.C., Lazarus, C.M., 1999. Phylogenetic analysis of Gyrodactylus spp. (Platyhelminthes: Monogenea) using ribosomal DNA sequences. Can. J. Zool. 77, 1439±49. Cone, D.K., Cusack, R.A., 1988. Study of Gyrodactylus colemanensis Mizelle & Kritsky, 1967 and Gyrodactylus salmonis (Yin & Sproston, 1948) (Monogenea) parasitizing captive salmonids in Nova Scotia. Can. J. Zool. 66, 409±15. Cone, D.K., Odense, P.H., 1984. Pathology of ®ve species of Gyrodactylus Nordmann, 1832 (Monogenea). Can. J. Zool. 61, 1084±8. Cunningham, C.O., 1997. Species variation within the internal transcribed spacer (ITS) region of Gyrodactylus (Monogenea: Gyrodactylidae) ribosomal RNA genes. J. Parasitol. 83, 215±9. Cunningham, C.O., McGillivray, D.M., MacKenzie, K., Melvin, W.T., 1995a. Discrimination between Gyrodactylus salaris, G. derjavini and
I. Matejusova et al. / International Journal for Parasitology 31 (2001) 738±745 G. truttae (Platyhelminthes: Monogenea) using restriction fragment length polymorphisms and an oligonucleotide probe within the small subunit ribosomal RNA gene. Parasitology 111, 87±94. Cunningham, C.O., McGillivray, D.M., MacKenzie, K., 1995b. Identi®cation of Gyrodactylus (Monogenea) species parasitising salmonid ®sh using DNA probes. J. Fish Dis. 18, 539±44. Cunningham, C.O., Aliesky, H., Collins, C.M., 2000. Sequence and secondary structure variation in the Gyrodactylus (Platyhelminthes: Monogenea) ribosomal RNA gene array. J. Parasitol. 86, 537±44. Cunningham, C.O., Mo, T.A., Collins, C.M., Buchmann, K., Thiery, R., Blanc, G., Lautraite, A., 2001. Redescription of Gyrodactylus teuchis Lautraite, Blanc, Thiery, Daniel & Vigneulle, 1999 (Monogenea: Gyrodactylidae), a species identi®ed by ribosomal RNA sequence. Syst. Parasitol. 48, 141±50. Ergens, R., 1965. Die morphogenese der chitinoiden Teile des Haptors bei Gyrodactylus tincae (Malmberg, 1956) Malmberg, 1964 (Monogenoidea) und ihre morphologish-metrische Variabilitat. Z. f. Parasitenkunde 26, 173±84. Ergens, R., 1981. Variability of hard parts of opisthaptor in Gyrodactylus truttae GlaÈser, 1974 (Gyrodactylidae: Monogenea). Folia Parasitol. 28, 37±42. Ergens, R., 1983. A survey of the results of studies on Gyrodactylus katharineri Malmberg, 1964 (Gyrodactylidae: Monogenea). Folia Parasitol. 30, 319±27. Ergens, R., 1991. Variability of the hard parts of opisthaptor of Gyrodactylus leucisci Zitnan, 1964 (Monogenea: Gyrodactylidae). Folia Parasitol. 38, 23±28. Ergens, R., Gelnar, M., 1985. Experimental veri®cation of the effect of temperature on the size of hard parts of opisthaptor of Gyrodactylus katharineri Malmberg, 1964 (Monogenea). Folia Parasitol. 32, 377± 80. Gasser, R.B., 1999. PCR-based technology in veterinary parasitology. Vet. Parasitol. 84, 229±58. Gasser, R.B., Rossi, L., Zhu, X., 1999. Identi®cation of Nematodirus species (Nematoda: Molineidae) from wild ruminants in Italy using ribosomal DNA markers. Int. J. Parasitol. 29, 1809±17. Geets, A., Appleby, C., Ollevier, F., 1999. Host-dependent and seasonal variation in opisthaptoral hard parts of Gyrodactylus cf. arcuatus from three Pomatoschistus spp. and G. arcuatus from Gasterosteus aculeatus: a multivariate approach. Parasitology 119, 27±40. Gussev, A.V., 1985. Parasitic Monogeneans (Part 1). In: Bauer, O.N. (Ed.), Key to Parasites of Freshwater Fish Fauna of the USSR, Vol. 2. Nauka, Leningrad, p. 424 (in Russian).
745
Hoste, H., Gasser, R.B., Chilton, N.B., Mallet, S., Beveridge, I., 1993. Lack of intraspeci®c variation in the second internal transcribed spacer (ITS2) of Trichostrongylus colubriformis ribosomal DNA. Int. J. Parasitol. 23, 1069±71. Hoste, H., Chilton, N.B., Gasser, R.B., Beveridge, I., 1995. Differences in the second internal transcribed spacer (ribosomal DNA) between ®ve species of Trichostrongylus (Nematoda: Trichostrongylidae). Int. J. Parasitol. 25, 75±80. Malmberg, G., 1956. On a new genus of viviparous monogenetic trematodes. Arkiv. Zool. 10, 317±29. Malmberg, G., 1970. The excretory systems and the marginal hooks as a basis for the systematics of Gyrodactylus (Trematoda, Monogenea). Arkiv. Zool. Serie 2 (Band 23), 235. Malmberg, G., 1970. Increased intraspeci®c divergence in Gyrodactylus salaris resulting from genetic drift in ®sh farm populations. Proceedings of the XIII Symposium of the Scandinavian Soceity for Parasitology, Helsinki, Finland, June 12±14th, 1987, Abs 19, 33. McManus, D.P., Bowles, J., 1996. Molecular genetic approaches to parasite identi®cation: their value in diagnostic parasitology and systematics. Int. J. Parasitol. 26, 687±704. Mo, T.A., 1991. Seasonal variations of opisthaptoral hard parts of Gyrodactylus salaris Malmberg, 1957 (Monogenea: Gyrodactylidae) on parr of Atlantic salmon Salmo salar L. in the River Batnfjordselva, Norway. Syst. Parasitol. 19, 231±40. Mo, T.A., 1993. Seasonal variations of the opisthaptoral hard parts of Gyrodactylus derjavini Mikailov, 1975 (Monogenea: Gyrodactylidea) on brown trout Salmo trutta L. parr and Atlantic salmon S. salar L. parr in the River Sandvikselva, Norway. Syst. Parasitol. 26, 225±31. Mo, T.A., 1994. Status of Gyrodactylus salaris problems and research in Norway. In: Pike, A.W., Lewis, J.W. (Eds.). Parasitic Diseases of Fish, Samara, Dyfed, UK, pp. 43±56. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-speci®c gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673±80. van Herwerden, L., Blair, D., Agatsuma, T., 1998. Intra- and inter-speci®c variation in nuclear ribosomal internal transcribed spacer 1 of the Schistosoma japonicum species complex. Parasitology 116, 311±7. van Herwerden, L., Gasser, R.B., Blair, D., 2000. ITS-1 ribosomal DNA sequence variants are maintained in different species and strains of Echinococcus. Int. J. Parasitol. 30, 157±69. Williams, H., Jones, A., 1994. Parasitic Worms of Fish, Taylor & Francis, London.