- Email: [email protected]
threonine protein phosphatase 1 (PP1cα–PP1r7) in spermatogenesis of Toxocara canis
Acta Tropica 149 (2015) 148–154
Contents lists available at ScienceDirect
Acta Tropica journal homepage: www.elsevier.com/locate/actatropica
Molecular mechanism of serine/threonine protein phosphatase 1 (PP1c␣–PP1r7) in spermatogenesis of Toxocara canis Guang Xu Ma a , Rong Qiong Zhou a,∗ , Zhen Hui Song a , Hong Hong Zhu a , Zuo Yong Zhou a , Yuan Qin Zeng b a b
Department of Veterinary Medicine, Rongchang Campus, Southwest University, Chongqing 402460, People’s Republic of China College of Life Sciences, Southwest University, Chongqing 402460, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 21 March 2015 Received in revised form 20 May 2015 Accepted 25 May 2015 Available online 27 May 2015 Keywords: Toxocariasis Serine/threonine protein phosphatase 1 Reproduction Spermatogenesis
a b s t r a c t Toxocariasis is one of the most important, but neglected, zoonoses, which is mainly caused by Toxocara canis. To better understand the role of serine/threonine protein phosphatase 1 (PP1) in reproductive processes of male adult T. canis, differential expression analysis was used to reveal the profiles of PP1 catalytic subunit ␣ (PP1c␣) gene Tc-stp-1 and PP1 regulatory subunit 7 (PP1r7) gene TcM-1309. Indirect fluorescence immunocytochemistry was carried out to determine the subcellular distribution of PP1c␣. Double-stranded RNA interference (RNAi) assays were employed to illustrate the function and mechanism of PP1c␣ in male adult reproduction. Real-time quantitative PCR (qPCR) showed transcriptional consistency of Tc-stp-1 and TcM-1309 in sperm-producing germline tissues and localization research showed cytoplasmic distribution of PP1c␣ in sf9 cells, which indicated relevant involvements of PP1c␣ and PP1r7 in spermatogenesis. Moreover, spatiotemporal transcriptional differences of Tc-stp-1 were determined by gene knockdown analysis, which revealed abnormal morphologies and blocked meiotic divisions of spermatocytes by phenotypic aberration scanning, thereby highlighting the crucial involvement of PP1c␣ in spermatogenesis. These results revealed a PP1c␣–PP1r7 mechanism by which PP1 regulates kinetochore–microtubule interactions in spermatogenesis and provided important clues to identify novel drug or vaccine targets for toxocariasis control. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Toxocariasis is one of the most important, but neglected, parasitic canine diseases, which is mainly caused by the nematode Toxocara canis (Hotez and Wilkins, 2009; Moreira et al., 2014; Woodhall et al., 2014). Humans and various animals can be infected by accidental ingestion of embryonated Toxocara eggs or consumption of arrested larvae in the viscera or raw/undercooked meat from infected hosts (Taira et al., 2004; Morimatsu et al., 2006; Choi et al., 2008). Significantly, T. canis larvae can migrate throughout the human body and encyst as arrested larvae in the muscles and nervous system causing visceral larva migrans, ocular larva migrans or neural larva migrans (Kayes, 1997; Despommier, 2003; Caldera et al., 2013). Epidemiological studies in some African, Asian and Latin American countries indicated a high prevalence of this zoonotic disease, ranging from 12.3% to 93% (Schoenardie et al., 2013; Macpherson, 2013; Cong et al., 2014; Moreira et al., 2014).
∗ Corresponding author. Tel.: +86 23 46751100; fax: +86 23 46751732. E-mail address: [email protected] (R.Q. Zhou). http://dx.doi.org/10.1016/j.actatropica.2015.05.026 0001-706X/© 2015 Elsevier B.V. All rights reserved.
Although treatment with albendazole or mebendazole is indicated for visceral toxocariasis, it is crucial that new anthelmintics and strategies are developed to control this neglected zoonosis. Recent molecular investigations have provided invaluable data of gender-specific or -enriched genes in development and reproductive processes that could be potential targets to disrupt development or reproduction of parasites (Nisbet and Gasser, 2004; Nisbet et al., 2008; Li et al., 2011; Wang et al., 2013). Specifically, the functional roles of the male-specific serine/threonine protein phosphatase 1 (PP1) gene (stp-1) in reproduction have been investigated in Oesophagostomum dentatum (Boag et al., 2000; Boag et al., 2003), Trichostrongylus vitrinus, Haemonchus contortus and T. canis (Hu et al., 2007; Campbell et al., 2010; Ma et al., 2014), indicating potential roles of stp-1 in spermatogenesis of nematodes. However, functional PP1 requires formation of a complex composed of a catalytic subunit (PP1c) with PP1-binding regulatory subunits (PP1r) (Barford et al., 1998; Heijman et al., 2013). Although more than 200 putative PP1r have been identified (Watanabe et al., 2001; Ceulemans and Bollen, 2004; Shi, 2009), little is known about the molecular mechanisms of PP1c and PP1r that underlie reproductive physiology in parasitic nematodes.
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
In this work, we identified the molecular functions of PP1 in spermatogenesis through localization and double-stranded RNA interference (RNAi) assays to elucidate the functional mechanisms of PP1c␣–PP1r7 in nematode reproduction. 2. Materials and methods
149
was performed by incubating these cells with primary anti-PP1c␣ polyclonal antibodies (dilution, 1:500), anti-rabbit IgG secondary antibodies (dilution, 1:500) and DAPI. Pre-immune serum was used as a control. Polyclonal antibody and pre-immune serum used in this experiment were produced in our previous study (Ma et al., 2014). Fluorescence was detected using a fluorescence imaging microscope (Olympus Corporation, Tokyo, Japan).
2.1. Parasites and parasite culturing Dogs were experimentally infected with embryonated T. canis eggs and euthanized by intravenous injection of sodium pentobarbital 7 weeks later. The adult worms were collected from the intestines according to methodologies described elsewhere (Hanser, 2003). The adult male T. canis were identified based on their morphological features according to the guidelines of Veterinary Parasitology (Urquhart et al., 2003), and washed with 1.0% formaldehyde in PBS to eliminate or minimize contamination. Finally, these specimens were incubated in L 15 medium (Life Technologies, Carlsbad, CA, USA) at 37 ◦ C in an atmosphere of 5% CO2 . All experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals (eighth edition) published by the National Research Council of the National Academies (Garber et al., 2011), and circumstances relating to animal experimentation met the International Guiding Principles for Biomedical Research Involving Animals as issued by the Council for International Organizations of Medical Sciences (http://www.cioms.ch/publications/ guidelines/1985textsofguidelines.htm). 2.2. Characterization of TcM-1309 from male adult T. canis Total RNA was extracted from the entire body of one male adult T. canis using Trizol reagent (Invitrogen Corporation, Carlsbad, CA, USA) and reverse transcribed into first-strand cDNA with the PrimeScript RT reagent Kit (Takara Bio-Inc., Shiga, Japan). The expressed sequence tag TcM-1309 (GenBank: KP126898), representing PP1r7 from a male adult T. canis cDNA library, was amplified by PCR with gene-specific primers (Table 1), cloned into the pMD 19-T (simple) vector (Takara Bio-Inc.) and sequenced. The obtained sequence was characterized by searching the GenBank database with the Blast X algorithm (http://blast.ncbi.nlm.nih.gov/), and the predicted amino acid sequence was aligned to other protein sequences from GenBank using Clustal X software (Conway Institute UCD, Dublin). 2.3. qPCR Total RNA was extracted from tissue samples of the testis, vas deferens, seminal vesicle, intestine, musculature, and cuticle dissected from male adults, and reverse transcribed to produce cDNA, respectively. qPCR was performed to determine the expression profiles of Tc-stp-1 and TcM-1309, primers were given in Table 1. Relative fold changes in mRNA expression levels were obtained with 2−Ct method and presented as mean ± standard of devi−
2.5. Double-stranded RNA (dsRNA) interference 2.5.1. dsRNA preparation Tc-stp-1 fragments (about 500 bp) were amplified with specific primers and PCR products were purified using the Agarose Gel DNA Extraction Kit (Takara Bio-Inc.). Transcription and RNAi preparation were performed using the MEGAscript RNAi Kit (Ambion, Inc. Austin, TX, USA). Briefly, DNA templates were prepared by amplifications, then dsRNA was synthesized in vitro by incubation at 37 ◦ C for 4 h, 75 ◦ C for 5 min and cooled to room temperature. DNA/RNA digestion and purification were performed according to the manufacturer’s protocol. EGFP gene fragment dsRNA was also synthesized as a negative control. The primers used in this assay were shown in Table 1. The purities and integrities of prepared dsRNAs were determined by standard agarose gel electrophoresis, and the concentration was measured at 260 nm using a BioPhotometer (Eppendorf AG, Hamburg, Germany).
2.5.2. RNAi and gene knockdown analysis Cultured male adult T. canis, which were fully motile and in good condition, were divided into treatment group and control group. Interference was performed in vitro by soaking the worms in culture media supplemented with dsRNA corresponding to Tc-stp-1, and an equal concentration of EGFP dsRNA was used for the negative control group. Given the worm to worm differences, the testis, vas deferens and seminal vesicles were dissected from 3 worms to extract total RNA after treatment for 24, 48 and 72 h, respectively. qPCR was performed to determine Tc-stp-1 expression levels among sperm-producing tissues. The data of fold differences were −
obtained via the 2−Ct method and presented as ( x ± SD).
2.5.3. Microscopic and histological studies Another 3 worms from the 24-, 48- and 72-h treatment groups and control groups were fixed in neutral-buffered formalin, embedded in paraplast and cut into serial sections at thicknesses of 5 m. Corresponding to the decreased expression of Tc-stp-1 in male adult T. canis, histological changes in the sections of germ-line tissues were scanned using an imaging microscope (Olympus CX41).
3. Results
ation ( x ± SD).
3.1. Characterization and identification of TcM-1309
2.4. Indirect fluorescence immunocytochemistry
A 725-bp sequence of TcM-1309 was obtained, which encoded a C-terminal partial amino acid sequence. Blast X analysis showed 89% identity with PP1r7 from Ascaris suum and 61% identity with a H. contortus protein containing a leucine-rich repeat domain. The amino acid sequence predicted from TcM-1309 was aligned with PP1r7 or leucine-rich repeat family protein sequences of A. suum (ERG79283), H. contortus (CDJ93160), Strongyloides ratti (CEF65998), Mus musculus (EDL39961) and Homo sapiens (NP 001269341) retrieved from the GenBank database. Conserved leucine-rich repeat structures and the repeat LxxLxLxxNxIxxIxxLxxL motif were found in the multiple alignments (Fig. 1).
Male-specific Tc-stp-1 (KF563925) of adult T. canis was amplified with primers incorporating the BglII and NotI recognition sequences at the 5 and 3 termini with specific primers (Table 1), respectively. The entire coding sequence for PP1c␣ was cloned into the pMD 19T (simple) vector (Takara Bio-Inc.) to subsequently construct the recombinant Tc-stp-1/pSL 1180 plasmid. The liposome transfection method was utilized to transfect the recombined plasmids into Sf9 cells, a clonal isolate of Spodoptera frugiperda Sf21 cells, for expression. Then, indirect fluorescence immunocytochemical analysis
150
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
Table 1 Primers used in this study. Gene name
Assay
Primer direction
Primer sequence (5 -3 )
TcM-1309
PCR
TcM-1309
q-RT PCR
18S
q-RT PCR
Tc-stp-1
PCR
Tc-stp-1
RNAi
Tc-stp-1
RNAi
EGFP
RNAi
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
AAGGTTGAAAACTTGGACGCACTGGT GCCAATCCTCGCCGAACTGAAACA TCAGAGCAGCCTCATCG AGTGTTAAGCCTTCCCGCTA AATTGTTGGTCTTCAACGAGGA AAAGGGCAGGGACGTAGTCAA GAAGATCTTCATGGCGGCCGTATTTGACGTTGACA TGCGGCCGCTTAAGCAGGGGCAATGCCTTGTTGC GTCAGAGCAGCCTCATCG GTAATACGACTCACTATAGGGAGATGCCATCCTTTAACCCAC GTAATACGACTCACTATAGGGAGAGTCAGAGCAGCCTCATCG TGCCATCCTTTAACCCAC GTAATACGACTCACTATAGGGAGATGCTTCAGCCGCTACCC GTAATACGACTCACTATAGGGAGATCCAGCAGGACCATGTGAT
AGATCTTC: recognition sequence for Bgl II; GCGGCCGC: recognition sequence for Not I; GTAATACGACTCACTATAGGGAGA: 5’ terminal T7 promoter sequence.
Fig. 1. Characterization of TcM-1309 transcription for PP1r7. The partial amino acid sequence deduced from TcM-1309 was aligned with protein sequences from A. suum, H. contortus, S. ratti, M. musculus and H. sapiens. A consensus sequence of a leucine-repeat structure is indicated and the repeat motifs are underlined.
Fig. 2. Functionally related distributions of Tc-stp-1 and TcM-1309. (A) Transcriptional profiles of Tc-stp-1 among the testis, seminal vesicle, vas deferens, intestine, musculature and cuticle of male adult T. canis. (B) Transcriptional profiles of TcM-1309 among the testis, seminal vesicle, vas deferens, intestine, musculature and cuticle of male adult T. canis. (C) Subcelluar distribution of recombinant PP1c␣ in Sf9 cells. The localization procedure was performed using rabbit anti-PP1 polyclonal antiserum (pre-immune serum in the control experiment) and anti-rabbit IgG labeled with FITC (green). DAPI was used to stain the nuclei of sf9 cells (blue). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
151
Fig. 3. The preparation of dsRNA corresponding to Tc-stp-1. (A) DNA templates were prepared by PCR amplifications, lane 1: Tc-stp-1 fragments was amplified from the total RNA of male adult T. canis, M: DL2000 DNA marker. (B) T7 promoter sequences were added to DNA templates by two separated PCR, lane 1: amplified with reverse terminal T7 promoter-containing primer, lane 2: amplified with forward terminal T7 promoter-containing primer, lane 3: dsRNA was generated by annealing the two PCR products, M: DL2000 DNA marker. (C) DNA/RNA digestion and purification, lane 1: purified dsRNA, M: DL2000 DNA marker.
Fig. 4. Tc-stp-1 Expression in sperm producing tissues. Data are presented normalized values against control and expressed as the mean ± SD. Asterisks indicate significant differences (*P = 0.01; **P = 0.001).
3.2. Tissue expression and subcellular distribution analysis
3.3. Tc-stp-1 gene knockdown analysis
Tissue expression of Tc-stp-1 and TcM-1309 was determined and results showed specific expression of both in testis and vas deferens of male adult T. canis (Fig. 2A and B), which suggested consistent involvement of Tc-stp-1 and TcM-1309 in reproduction. Meanwhile, indirect-fluorescence immunocytochemical analysis was performed to detect the distribution of PP1c␣ with rabbit anti-PP1 primary antibodies and a peroxidase-conjugated goat anti-rabbit IgG secondary antibody, and localized green fluorescence indicated expression of the recombinant protein in the cytoplasm of sf9 cells (Fig. 2C).
The purities and integrities of prepared dsRNAs (Fig. 3) were measured, and a final concentration of dsRNA solution at 100 ng/l was used to suppress expression of the target gene. Compared to the control level, quantitative analysis showed a significant decrease of Tc-stp-1 in the testis and vas deferens after a 24-h treatment, but no obvious change was found in the seminal vesicles. Then, determination at 48 h indicated significant suppression of the target gene in the testis and seminal vesicle, with a sharp upregulation in the vas deferens. The last observation at 72 h showed an overall rebound in the testis, seminal vesicle and vas deferens (Fig. 4). Interestingly,
152
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
Fig. 5. Phenotypic aberrations in reproductive tissues during RNA interference. Histological changes were scanned in hematoxylin and eosin-stained sections of germline tissues after treatment for 24, 48 and 72 h and in the control group. The most significant changes in the seminal vesicle, front end and back end (vas deferens F and B) of vas deferens are shown. Interrupted meiotic divisions are indicated by black lines. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 6. A schematic mechanism of PP1c␣–PP1r7 regulation of meiotic division. (A) Phospho-aurora B (AurB) was dephosphorylated by PP1c␣–PP1r7, which plays a key role in kinetochore and microtubule interactions. (B) In contrast, phospho-AurB destabilizes the interactions between kinetochores and microtubules due to the absence of PP1c␣.
decreased expression of the target gene first appeared in the vas deference and lastly in the seminal vesicle. In contrast, expression was opposite in the recovery processes, which highlighted the indispensable functional roles of Tc-stp-1 in sperm-producing germline tissues.
of vas deferens after 48 h of suppression, which specifically manifested as blocked nuclear divisions. Interestingly, morphological features and the sperm formation process partly recovered after 72 h. Changes in morphology and spermatogenesis of male adult T. canis are shown in Fig. 5.
3.4. Effect of suppressed PP1c˛ transcription
4. Discussion
Phenotypic changes in the reproductive tissues of T. canis during spermatogenesis were scanned after treatment for 24, 48 and 72 h. Compared to normal histological features, non-significant morphological changes were found in the testis during the entire experimental period, although morphological and structural disorders of primary/secondary spermatocytes and spermatids were observed in the seminal vesicle and vas deferens (front end and back end), especially in the 24-h treatment group. By contrast, meiotic divisions were blocked in the seminal vesicle and the front end
PP1 is a major protein serine/threonine phosphatase (Cohen, 2002; Ceulemans and Bollen, 2004) that plays important roles in diverse cellular processes, such as division, apoptosis, protein synthesis and metabolism (Ceulemans and Bollen, 2004; Shi, 2009; Peti et al., 2013). As a holoenzyme, each functional PP1 requires formation of a PP1c (PP1c␣, PP1c, PP1c␥1 and PP1c␥2) complex with PP1-binding regulatory subunits to target and regulate its activity (Barford et al., 1998). A variety of putative PP1r molecules have been identified (Watanabe et al., 2001; Ceulemans and Bollen,
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
2004; Shi, 2009; Heijman et al., 2013), which have contributed to investigations of PP1 function. Specifically, the important roles of male-specific stp1 in spermatogenesis of nematodes have been investigated in several worms (Boag et al., 2000; Hu et al., 2007; Campbell et al., 2010; Ma et al., 2014); however, the precise molecular mechanisms remain largely unknown. In the current study, a leucine-rich repeat protein cDNA sequence, TcM-1309, obtained from a cDNA library of male adult T. canis was cloned and characterized, from which leucine-rich repeat protein structures were found, corresponding to the consensus of mouse PP1r7 LxxLxLxxNxIxxIxxLxxL and human sds22 ExLxxLxxLxxLxLxxNxIxxI (Renouf et al., 1995; Wang and Sperry, 2008). It has been reported that PP1r7 (also known as sds22) homologs regulate microtubule-kinetochore interactions and epithelial cell shape (Grusche et al., 2009; Posch et al., 2010), which is presumed to be involved in the development of spermatids (Chun et al., 2000; Wang and Sperry, 2008). Therefore, understanding the interaction of Tc-stp-1 and TcM-1309 may offer clues to reveal the mechanisms of PP1c␣–PP1r7 interactions in reproduction processes. Although expression and localization researches were done with only Tc-stp-1, transcriptional consistence of Tc-stp-1 and TcM-1309 facilitates the process to elucidate PP1c␣–PP1r7 functions in spermatogenesis. Tissue transcriptional studies of some important genes have been reported in A. suum, H. contortus and B. malayi, which have provided valuable information regarding tissue-specific genes (Yin et al., 2008; Wang et al., 2013; Rosa et al., 2014). For example, Bm-shp-1 expression in the epithelium of uterine and Bm-msp-1 in spermatocytes and spermatids indicated potential roles in reproductive processes (Jiang et al., 2008). Similarly, in our study, differential expression analysis among tissues revealed consistent transcription profiles of Tc-stp-1 and TcM-1309 in the testis and vas deferens, suggesting important involvement of these genes in spermatogenesis. Moreover, PP1r has been reported to target PP1c␣ in distinct subcellular locations (Hubbard and Cohen, 1993; Cohen, 2002). The cytoplasmic distribution of free PP1c␣ in this work provided further information regarding the intracellular molecular roles of PP1c␣–PP1r7 in reproduction of male adult T. canis. The spatiotemporal differences of suppression reflected important roles of Tc-stp-1 in reproduction. With assumptions of functional conservation, RNAi is often utilized in Caenorhabditis elegans as a surrogate target validation tool to explore reproductive and developmental processes of parasites (Kuwabara and Coulson, 2000; Knox et al., 2007; Campbell et al., 2008). RNAi analysis of other nematode species have also been performed in studies of parasitic infection (Geldhof et al., 2006; Visser et al., 2006; Chen et al., 2011), which revealed that C. elegans double-stranded RNAi phenotypes are more often seen for homologues and orthologues of female-specific genes than those of male-specific genes (Nisbet et al., 2008). Thereby, in vitro RNAi assays were performed in the present study, which showed significant suppression of target genes in the testis and vas deferens after 24 h of treatment and in the testis and seminal vesicle after 48 h treatment, while rapid recovery of suppressed expression was detected in the vas deferens at 48 h and in the testis at 72 h. This spatial and temporal variation might be influenced by the mode of delivery, target gene abundance and transcriptional levels, which support the variable and inconsistent susceptibilities reported elsewhere (Maule et al., 2011; Britton et al., 2012; Selkirk et al., 2012). Suppression of Tc-stp-1 expression resulted in morphological aberrations of germ cells and blocked meiosis. RNAi is an effective tool to elucidate gene function, and available RNAi data in C. elegans can be interpreted to predict roles of functional genes of parasitic nematode (Hashmi et al., 2001; Britton and Murray, 2006; Britton et al., 2012). However, some stp genes subjected to highthroughput RNAi analysis did not show mutant phenotypes (Maeda
153
et al., 2001; Kamath et al., 2003; Rual et al., 2004; Sönnichsen et al., 2005; Campbell et al., 2011). Although gene silencing of Od-stp-1 in O. dentatum by targeting the two C. elegans homologues resulted in a reduction in progeny (Boag et al., 2000; Boag et al., 2003), the precise mechanisms require further clarification. In this study, Tcstp-1 gene knockdown resulted in morphological changes of sperm cells and interrupted meiosis, which indicated that PP1r7 can regulate PP1c targeting to the kinetochores and force generation at the kinetochore–microtubule interface (Posch et al., 2010). In other words, diminished PP1c␣ expression leads to insufficient dephosphorylation of phospho-AurB, which destabilized the interactions between kinetochores and microtubules, thereby intervened in force generation, resulting in abnormal chromosome segregation during meiotic division (Fig. 6). Further experiments on TcM-1309 characterization and functional analysis could be carried out, which would be helpful to confirm the existence and function of this important partner protein. In conclusion, consistent transcription of Tc-stp-1 and TcM1309 in male adult T. canis indicated the important roles of these genes in reproduction, while the subcellular distribution of PP1c␣ and RNAi analysis of Tc-stp-1 confirmed the function of PP1c␣ in meiosis during spermatogenesis, and the reciprocal dependence of PP1c␣–PP1r7 suggested the functional mechanism in spermatogenesis. The results of this study provide important clues to reveal the molecular reproductive physiology of parasitic nematodes and will aid in the informed design of new anthelmintics and control strategies. Conflict of interest The authors declare no conflict of interest. Acknowledgements This work was funded by National Natural Science Foundation of China (no. 31172313) and Fundamental Research Funds for the Central Universities (no. XDJK2014D038). References Barford, D., Das, A.K., Egloff, M.P., 1998. The structure and mechanism of protein phosphatases: insights into catalysis and regulation. Annu. Rev. Biophys. Biomol. Struct. 27, 133–164. Boag, P.R., Newton, S.E., Hansen, N., Christensen, C.M., Nansen, P., Gasser, R.B., 2000. Isolation and characterisation of sex-specific transcripts from Oesophagostomum dentatum by RNA arbitrarily-primed PCR. Mol. Biochem. Parasitol. 108, 217–224. Boag, P.R., Ren, P., Newton, S.E., Gasser, R.B., 2003. Molecular characterisation of a male-specific serine/threonine phosphatase from Oesophagostomum dentatum (Nematoda: Strongylida), and functional analysis of homologues in Caenorhabditis elegans. Int. J. Parasitol. 33, 313–325. Britton, C., Murray, L., 2006. Using Caenorhabditis elegans for functional analysis of genes of parasitic nematodes. Int. J. Parasitol. 36, 651–659. Britton, C., Samarasinghe, B., Knox, D.P., 2012. Ups and downs of RNA interference in parasitic nematodes. Exp. Parasitol. 132, 56–61. Caldera, F., Burlone, M.E., Genchi, C., Pirisi, M., Bartoli, E., 2013. Toxocara encephalitis presenting with autonomous nervous system involvement Toxocara encephalitis presenting with autonomous nervous system involvement. Infection 41, 691–694. Campbell, B.E., Hofmann, A., McCluskey, A., Gasser, R.B., 2011. Serine/threonine phosphatases in socioeconomically important parasitic nematodes – prospects as novel drug targets? Biotechnol. Adv. 29, 28–39. Campbell, B.E., Nagaraj, S.H., Hu, M., Zhong, W., Sternberg, P.W., Ong, E.K., Loukas, A., Ranganathan, S., Beveridge, I., McInnes, R.L., Hutchinson, G.W., Gasser, R.B., 2008. Gender-enriched transcripts in Haemonchus contortus – predicted functions and genetic interactions based on comparative analyses with Caenorhabditis elegans. Int. J. Parasitol. 38, 65–83. Campbell, B.E., Rabelo, E.M., Hofmann, A., Hu, M., Gasser, R.B., 2010. Characterization of a Caenorhabditis elegans glc seven-like phosphatase (gsp) orthologue from Haemonchus contortus (Nematoda). Mol. Cell. Probes 24, 178–189. Ceulemans, H., Bollen, M., 2004. Functional diversity of protein phosphatase-1, a cellular economizer and reset button. Physiol. Rev. 84, 1–39.
154
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
Chen, N., Xu, M.J., Nisbet, A.J., Huang, C.Q., Lin, R.Q., Yuan, Z.G., Song, H.Q., Zhu, X.Q., 2011. Ascaris suum: RNAi mediated silencing of enolase gene expression in infective larvae. Exp. Parasitol. 127, 142–146. Choi, D., Lim, J.H., D, Choi, Paik, C., Kim, S.W., Huh, S.H., 2008. Toxocariasis and ingestion of raw cow liver in patients with eosinophilia. Korean J. Parasitol. 46, 139–143. Chun, Y.S., Park, J.W., Kim, G.T., Shima, H., Nagao, M., Kim, M.S., Chung, M.H., 2000. A sds22 homolog that is associated with the testis-specific serine/threonine protein phosphatase 1gamma2 in rat testis. Biochem. Biophys. Res. Commun. 273, 972–976. Cohen, P.T., 2002. Protein phosphatase 1-targeted in many directions. J. Cell Sci. 115, 241–256. Cong, W., Zhang, X.X., Zhou, N., Yu, C.Z., Chen, J., Wang, X.Y., Li, B., Qian, A.D., Zhu, X.Q., 2014. Toxocara seroprevalence among clinically healthy individuals, pregnant women and psychiatric patients and associated risk factors in Shandong Province, Eastern China. PLoS Negl. Trop. Dis. 8, e3082. Despommier, D., 2003. Toxocariasis: clinical aspects, epidemiology, medical ecology, and molecular aspects. Clin. Microbiol. Rev. 16, 265–272. Garber, J.C., Barbee, R.W., Bielitzki, J.T., Clayton, L.A., Donovan, J.C., Hen-driksen, C.F., Kohn, D.F., Lipman, N.S., Locke, P.A., Melcher, J., Quimby, F.W., Tuner, P.V., Wood, G.A., Wurbel, H., 2011. Guide for the Care and Use of Laboratory Animals, eighth ed. The National Academics, Washington, DC, pp. 11–40. Geldhof, P., Murray, L., Couthier, A., Gilleard, J.S., McLauchlan, G., Knox, D.P., Britton, C., 2006. Testing the efficacy of RNA interference in Haemonchus contortus. Int. J. Parasitol. 36, 801–810. Grusche, F.A., Hidalgo, C., Fletcher, G., Sung, H.H., Sahai, E., Thompson, B.J., 2009. Sds22, a PP1 phosphatase regulatory subunit, regulates epithelial cell polarity and shape [Sds22 in epithelial morphology]. BMC Dev. Biol. 9, 14. Hanser, E., 2003. In vitro studies on the effects of flubendazole against Toxocara canis and Ascaris suum. Parasitol. Res. 89, 63–74. Hashmi, S., Tawe, W., Lustigman, S., 2001. Caenorhabditis elegans and the study of gene function in parasites Caenorhabditis elegans and the study of gene function in parasites. Trends Parasitol. 17, 387–393. Heijman, J., Dewenter, M., EI-Armouche, A., Dobrev, D., 2013. Function and regulation of serine/threonine phosphatases in the healthy and diseased heart. J. Mol. Cell. Cardiol. 64, 90–98. Hotez, P.J., Wilkins, P.P., 2009. Toxocariasis: America’s most common neglected infection of poverty and a helminthiasis of global importance? PLoS Negl. Trop. Dis. 3, e400. Hu, M., Abs EL-Osta, Y.G., Campbell, B.E., Boag, P.R., Nisbet, A.J., Beveridge, I., Gasser, R.B., 2007. Trichostrongylus vitrinus (Nematoda: Strongylida): molecular characterization and transcriptional analysis of Tv-stp-1, a serine/threonine phosphatase gene Trichostrongylus vitrinus (Nematoda: Strongylida): molecular characterization and transcriptional analysis of Tv-stp-1, a serine/threonine phosphatase gene. Exp. Parasitol. 17, 22–34. Hubbard, M.J., Cohen, P., 1993. On target with a new mechanism for the regulation of protein phosphorylation. Trends Biochem. Sci. 18, 172–177. Jiang, D., Li, B.W., Fischer, P.U., Weil, G.L., 2008. Localization of gender-regulated gene expression in the filarial nematode Brugia malayi. Int. J. Parasitol. 38, 503–512. Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D.P., Zipperlen, P., Ahringer, J., 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237. Kayes, S.G., 1997. Human toxocariasis and the visceral larva migrans syndrome: correlative immunopathology. Chem. Immunol. 66, 99–124. Knox, D.P., Geldhof, P., Visser, A., Britton, C., 2007. RNA interference in parasitic nematodes of animals: a reality check. Trends Parasitol. 23, 105–107. Kuwabara, P.E., Coulson, A., 2000. RNAi – prospects for a general technique for determining gene function. Parasitol. Today 16, 347–349. Li, B.W., Rush, A.C., Jiang, D.J., Mitreva, M., Abubucker, S., Weil, G.J., 2011. Gender-associated genes in filarial nematodes are important for reproduction and potential intervention targets. PLoS Negl. Trop. Dis. 5, e947. Ma, G.X., Zhou, R.Q., Hu, S.J., Huang, H.C., Zhu, T., Xia, Q.Y., 2014. Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis. Exp. Parasitol. 141, 55–61. Macpherson, C.N., 2013. The epidemiology and public health importance of toxocariasis: a zoonosis of global importance. Int. J. Parasitol. 43, 999–1008. Maeda, I., Kohara, Y., Yamamoto, M., Sugimoto, A., 2001. Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr. Biol. 11, 171–176. Maule, A.G., McVeigh, P., Dalzell, J.J., Atkinson, L., Mousley, A., Marks, N.J., 2011. An eye on RNAi in nematode parasites. Trends Parasitol. 27, 505–513. Moreira, G.M., Telmo Pde, L., Mendonca, M., Moreira, A.N., McBride, A.J., Scaini, C.J., Conceic¸ão, F.R., 2014. Human toxocariasis: current advances in diagnostics, treatment, and interventions. Trends Parasitol. 30, 456–464. Morimatsu, Y., Akao, N., Akiyoshi, H., Kawazu, T., Okabe, Y., Aizawa, H., 2006. A familial case of visceral larva migrans after ingestion of raw chicken livers:
appearance of specific antibody in bronchoalveolar lavage fluid of the patients. Am. J. Trop. Med. Hyg. 75, 303–306. Nisbet, A.J., Cottee, P.A., Gasser, R.B., 2008. Genomics of reproduction in nematodes: prospects for parasite intervention. Trends Parasitol. 24, 89–95. Nisbet, A.J., Gasser, R.B., 2004. Profiling of gender-specific gene expression for Trichostrongylus vitrinus (Nematoda: Strongylida) by microarray analysis of expressed sequence tag libraries constructed by suppressive-subtractive hybridization. Int. J. Parasitol. 34, 633–643. Peti, W., Nairn, A.C., Page, R., 2013. Structural basis for protein phosphatase 1 regulation and specificity. FEBS J. 280, 596–611. Posch, M., Khoudoli, G.A., Swift, S., King, E.M., Deluca, J.G., Swedlow, J.R., 2010. Sds22 regulates aurora B activity and microtubule-kinetochore interactions at mitosis. J. Cell. Biol. 191, 61–74. Renouf, S., Beullens, M., Wera, S., Van Eynde, A., Sikela, J., Stalmans, W., Bollen, M., 1995. Molecular cloning of a human polypeptide related to yeast sds22, a regulator of protein phosphatase-1. FEBS Lett. 375, 75–78. Rosa, B.A., Jasmer, D.P., Mitreva, M., 2014. Genome-wide tissue-specific gene expression, co-expression and regulation of co-expressed genes in adult nematode Ascaris suum. PLoS Negl. Trop. Dis. 8, e2678. Rual, J.F., Ceron, J., Koreth, J., Hao, T., Nicot, A.S., Hirozane-Kishikawa, T., Vandenhaute, J., Orkin, S.H., Hill, D.E., van den Heuvel, S., Vidal, M., 2004. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Res. 14, 2162–2168. Schoenardie, E.R., Scaini, C.J., Brod, C.S., Pepe, M.S., Villela, M.M., McBride, A.J., Borsuk, S., Berne, M.E., 2013. Seroprevalence of Toxocara infection in children from southern Brazil. J. Parasitol. 99, 537–539. Selkirk, M.E., Huang, S.C., Knox, D.P., Britton, C., 2012. The development of RNA interference (RNAi) in gastrointestinal nematodes. Parasitology 139, 605–612. Shi, Y., 2009. Serine/threonine phosphatases: mechanism through structure. Cell 139, 468–484. Sönnichsen, B., Koski, L.B., Walsh, A., Marschall, P., Neumann, B., Brehm, M., Alleaume, A.M., Artelt, J., Bettencourt, P., Cassin, E., Hewitson, M., Holz, C., Khan, M., Lazik, S., Martin, C., Nitzsche, B., Ruer, M., Stamford, J., Winzi, M., Heinkel, R., Röder, M., Finell, J., Häntsch, H., Jones, S.J., Jones, M., Piano, F., Gunsalus, K.C., Oegema, K., Gönczy, P., Coulson, A., Hyman, A.A., Echeverri, C.J., 2005. Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature 434, 462–469. Taira, K., Saeed, I., Permin, A., Kapel, C.M., 2004. Zoonotic risk of Toxocara canis infection through consumption of pig or poultry viscera. Vet. Parasitol. 121, 115–124. Urquhart, G.M., Armour, J., Duncan, J.L., Dunn, A.M., Jennings, F.W., 2003. Veterinary Parasitology. Blackwell Science, Scotland, pp. 67–74. Visser, A., Geldhof, P., de Maere, V., Knox, D.P., Vercruysse, J., Claerebout, E., 2006. Efficacy and specificity of RNA interference in larval life-stages of Ostertagia ostertagi. Parasitology 133, 777–783. Wang, R., Sperry, A.O., 2008. Identification of a novel Leucine-rich repeat protein and candidate PP1 regulatory subunit expressed in developing spermatids. BMC Cell Biol. 9, 9. Wang, Z., Gao, X., Martin, J., Yin, Y., Abubucker, S., Rash, A.C., Li, B.W., Nash, B., Hallsworth-Pepin, K., Jasmer, D.P., Mitreva, M., 2013. Gene expression analysis distinguishes tissue-specific and gender-related functions among adult Ascaris suum tissues. Mol. Genet. Genomics 288, 243–260. Watanabe, T., Huang, H.B., Horiuchi, A., da Cruze Silva, E.F., Hsieh-Wilson, L., Allen, P.B., Shenolikar, S., Greengard, P., Nairn, A.C., 2001. Protein phosphatase 1 regulation by inhibitors and targeting subunits. Proc. Natl. Acad. Sci. U. S. A. 98, 3080–3085. Woodhall, D.M., Eberhard, M.L., Parise, M.E., 2014. Neglected parasitic infections in the United States: Toxocariasis. Am. J. Trop. Med. Hyg. 90, 810–813. Yin, Y., Martin, J., Abubucker, S., Scott, A.L., McCarter, J.P., Wilson, R.K., Jasmer, D.P., Mitreva, M., 2008. Intestinal transcriptomes of nematodes: comparison of the parasites Ascaris suum and Haemonchus contortus with the free-living Caenorhabditis elegans. PLoS Negl. Trop. Dis. 2, e269.
Web reference http://blast.ncbi.nlm.nih.gov/. Blast X algorithm, 2015 January 20. http://www.cioms.ch/publications/guidelines/ 1985textsofguidelines.htm. International Guiding Principles for Biomedical Research Involving Animals, Council for the International Organizations of Medical Sciences, Switzerland, 1985/2014.8.29.
Contents lists available at ScienceDirect
Acta Tropica journal homepage: www.elsevier.com/locate/actatropica
Molecular mechanism of serine/threonine protein phosphatase 1 (PP1c␣–PP1r7) in spermatogenesis of Toxocara canis Guang Xu Ma a , Rong Qiong Zhou a,∗ , Zhen Hui Song a , Hong Hong Zhu a , Zuo Yong Zhou a , Yuan Qin Zeng b a b
Department of Veterinary Medicine, Rongchang Campus, Southwest University, Chongqing 402460, People’s Republic of China College of Life Sciences, Southwest University, Chongqing 402460, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 21 March 2015 Received in revised form 20 May 2015 Accepted 25 May 2015 Available online 27 May 2015 Keywords: Toxocariasis Serine/threonine protein phosphatase 1 Reproduction Spermatogenesis
a b s t r a c t Toxocariasis is one of the most important, but neglected, zoonoses, which is mainly caused by Toxocara canis. To better understand the role of serine/threonine protein phosphatase 1 (PP1) in reproductive processes of male adult T. canis, differential expression analysis was used to reveal the profiles of PP1 catalytic subunit ␣ (PP1c␣) gene Tc-stp-1 and PP1 regulatory subunit 7 (PP1r7) gene TcM-1309. Indirect fluorescence immunocytochemistry was carried out to determine the subcellular distribution of PP1c␣. Double-stranded RNA interference (RNAi) assays were employed to illustrate the function and mechanism of PP1c␣ in male adult reproduction. Real-time quantitative PCR (qPCR) showed transcriptional consistency of Tc-stp-1 and TcM-1309 in sperm-producing germline tissues and localization research showed cytoplasmic distribution of PP1c␣ in sf9 cells, which indicated relevant involvements of PP1c␣ and PP1r7 in spermatogenesis. Moreover, spatiotemporal transcriptional differences of Tc-stp-1 were determined by gene knockdown analysis, which revealed abnormal morphologies and blocked meiotic divisions of spermatocytes by phenotypic aberration scanning, thereby highlighting the crucial involvement of PP1c␣ in spermatogenesis. These results revealed a PP1c␣–PP1r7 mechanism by which PP1 regulates kinetochore–microtubule interactions in spermatogenesis and provided important clues to identify novel drug or vaccine targets for toxocariasis control. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Toxocariasis is one of the most important, but neglected, parasitic canine diseases, which is mainly caused by the nematode Toxocara canis (Hotez and Wilkins, 2009; Moreira et al., 2014; Woodhall et al., 2014). Humans and various animals can be infected by accidental ingestion of embryonated Toxocara eggs or consumption of arrested larvae in the viscera or raw/undercooked meat from infected hosts (Taira et al., 2004; Morimatsu et al., 2006; Choi et al., 2008). Significantly, T. canis larvae can migrate throughout the human body and encyst as arrested larvae in the muscles and nervous system causing visceral larva migrans, ocular larva migrans or neural larva migrans (Kayes, 1997; Despommier, 2003; Caldera et al., 2013). Epidemiological studies in some African, Asian and Latin American countries indicated a high prevalence of this zoonotic disease, ranging from 12.3% to 93% (Schoenardie et al., 2013; Macpherson, 2013; Cong et al., 2014; Moreira et al., 2014).
∗ Corresponding author. Tel.: +86 23 46751100; fax: +86 23 46751732. E-mail address: [email protected] (R.Q. Zhou). http://dx.doi.org/10.1016/j.actatropica.2015.05.026 0001-706X/© 2015 Elsevier B.V. All rights reserved.
Although treatment with albendazole or mebendazole is indicated for visceral toxocariasis, it is crucial that new anthelmintics and strategies are developed to control this neglected zoonosis. Recent molecular investigations have provided invaluable data of gender-specific or -enriched genes in development and reproductive processes that could be potential targets to disrupt development or reproduction of parasites (Nisbet and Gasser, 2004; Nisbet et al., 2008; Li et al., 2011; Wang et al., 2013). Specifically, the functional roles of the male-specific serine/threonine protein phosphatase 1 (PP1) gene (stp-1) in reproduction have been investigated in Oesophagostomum dentatum (Boag et al., 2000; Boag et al., 2003), Trichostrongylus vitrinus, Haemonchus contortus and T. canis (Hu et al., 2007; Campbell et al., 2010; Ma et al., 2014), indicating potential roles of stp-1 in spermatogenesis of nematodes. However, functional PP1 requires formation of a complex composed of a catalytic subunit (PP1c) with PP1-binding regulatory subunits (PP1r) (Barford et al., 1998; Heijman et al., 2013). Although more than 200 putative PP1r have been identified (Watanabe et al., 2001; Ceulemans and Bollen, 2004; Shi, 2009), little is known about the molecular mechanisms of PP1c and PP1r that underlie reproductive physiology in parasitic nematodes.
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
In this work, we identified the molecular functions of PP1 in spermatogenesis through localization and double-stranded RNA interference (RNAi) assays to elucidate the functional mechanisms of PP1c␣–PP1r7 in nematode reproduction. 2. Materials and methods
149
was performed by incubating these cells with primary anti-PP1c␣ polyclonal antibodies (dilution, 1:500), anti-rabbit IgG secondary antibodies (dilution, 1:500) and DAPI. Pre-immune serum was used as a control. Polyclonal antibody and pre-immune serum used in this experiment were produced in our previous study (Ma et al., 2014). Fluorescence was detected using a fluorescence imaging microscope (Olympus Corporation, Tokyo, Japan).
2.1. Parasites and parasite culturing Dogs were experimentally infected with embryonated T. canis eggs and euthanized by intravenous injection of sodium pentobarbital 7 weeks later. The adult worms were collected from the intestines according to methodologies described elsewhere (Hanser, 2003). The adult male T. canis were identified based on their morphological features according to the guidelines of Veterinary Parasitology (Urquhart et al., 2003), and washed with 1.0% formaldehyde in PBS to eliminate or minimize contamination. Finally, these specimens were incubated in L 15 medium (Life Technologies, Carlsbad, CA, USA) at 37 ◦ C in an atmosphere of 5% CO2 . All experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals (eighth edition) published by the National Research Council of the National Academies (Garber et al., 2011), and circumstances relating to animal experimentation met the International Guiding Principles for Biomedical Research Involving Animals as issued by the Council for International Organizations of Medical Sciences (http://www.cioms.ch/publications/ guidelines/1985textsofguidelines.htm). 2.2. Characterization of TcM-1309 from male adult T. canis Total RNA was extracted from the entire body of one male adult T. canis using Trizol reagent (Invitrogen Corporation, Carlsbad, CA, USA) and reverse transcribed into first-strand cDNA with the PrimeScript RT reagent Kit (Takara Bio-Inc., Shiga, Japan). The expressed sequence tag TcM-1309 (GenBank: KP126898), representing PP1r7 from a male adult T. canis cDNA library, was amplified by PCR with gene-specific primers (Table 1), cloned into the pMD 19-T (simple) vector (Takara Bio-Inc.) and sequenced. The obtained sequence was characterized by searching the GenBank database with the Blast X algorithm (http://blast.ncbi.nlm.nih.gov/), and the predicted amino acid sequence was aligned to other protein sequences from GenBank using Clustal X software (Conway Institute UCD, Dublin). 2.3. qPCR Total RNA was extracted from tissue samples of the testis, vas deferens, seminal vesicle, intestine, musculature, and cuticle dissected from male adults, and reverse transcribed to produce cDNA, respectively. qPCR was performed to determine the expression profiles of Tc-stp-1 and TcM-1309, primers were given in Table 1. Relative fold changes in mRNA expression levels were obtained with 2−Ct method and presented as mean ± standard of devi−
2.5. Double-stranded RNA (dsRNA) interference 2.5.1. dsRNA preparation Tc-stp-1 fragments (about 500 bp) were amplified with specific primers and PCR products were purified using the Agarose Gel DNA Extraction Kit (Takara Bio-Inc.). Transcription and RNAi preparation were performed using the MEGAscript RNAi Kit (Ambion, Inc. Austin, TX, USA). Briefly, DNA templates were prepared by amplifications, then dsRNA was synthesized in vitro by incubation at 37 ◦ C for 4 h, 75 ◦ C for 5 min and cooled to room temperature. DNA/RNA digestion and purification were performed according to the manufacturer’s protocol. EGFP gene fragment dsRNA was also synthesized as a negative control. The primers used in this assay were shown in Table 1. The purities and integrities of prepared dsRNAs were determined by standard agarose gel electrophoresis, and the concentration was measured at 260 nm using a BioPhotometer (Eppendorf AG, Hamburg, Germany).
2.5.2. RNAi and gene knockdown analysis Cultured male adult T. canis, which were fully motile and in good condition, were divided into treatment group and control group. Interference was performed in vitro by soaking the worms in culture media supplemented with dsRNA corresponding to Tc-stp-1, and an equal concentration of EGFP dsRNA was used for the negative control group. Given the worm to worm differences, the testis, vas deferens and seminal vesicles were dissected from 3 worms to extract total RNA after treatment for 24, 48 and 72 h, respectively. qPCR was performed to determine Tc-stp-1 expression levels among sperm-producing tissues. The data of fold differences were −
obtained via the 2−Ct method and presented as ( x ± SD).
2.5.3. Microscopic and histological studies Another 3 worms from the 24-, 48- and 72-h treatment groups and control groups were fixed in neutral-buffered formalin, embedded in paraplast and cut into serial sections at thicknesses of 5 m. Corresponding to the decreased expression of Tc-stp-1 in male adult T. canis, histological changes in the sections of germ-line tissues were scanned using an imaging microscope (Olympus CX41).
3. Results
ation ( x ± SD).
3.1. Characterization and identification of TcM-1309
2.4. Indirect fluorescence immunocytochemistry
A 725-bp sequence of TcM-1309 was obtained, which encoded a C-terminal partial amino acid sequence. Blast X analysis showed 89% identity with PP1r7 from Ascaris suum and 61% identity with a H. contortus protein containing a leucine-rich repeat domain. The amino acid sequence predicted from TcM-1309 was aligned with PP1r7 or leucine-rich repeat family protein sequences of A. suum (ERG79283), H. contortus (CDJ93160), Strongyloides ratti (CEF65998), Mus musculus (EDL39961) and Homo sapiens (NP 001269341) retrieved from the GenBank database. Conserved leucine-rich repeat structures and the repeat LxxLxLxxNxIxxIxxLxxL motif were found in the multiple alignments (Fig. 1).
Male-specific Tc-stp-1 (KF563925) of adult T. canis was amplified with primers incorporating the BglII and NotI recognition sequences at the 5 and 3 termini with specific primers (Table 1), respectively. The entire coding sequence for PP1c␣ was cloned into the pMD 19T (simple) vector (Takara Bio-Inc.) to subsequently construct the recombinant Tc-stp-1/pSL 1180 plasmid. The liposome transfection method was utilized to transfect the recombined plasmids into Sf9 cells, a clonal isolate of Spodoptera frugiperda Sf21 cells, for expression. Then, indirect fluorescence immunocytochemical analysis
150
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
Table 1 Primers used in this study. Gene name
Assay
Primer direction
Primer sequence (5 -3 )
TcM-1309
PCR
TcM-1309
q-RT PCR
18S
q-RT PCR
Tc-stp-1
PCR
Tc-stp-1
RNAi
Tc-stp-1
RNAi
EGFP
RNAi
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
AAGGTTGAAAACTTGGACGCACTGGT GCCAATCCTCGCCGAACTGAAACA TCAGAGCAGCCTCATCG AGTGTTAAGCCTTCCCGCTA AATTGTTGGTCTTCAACGAGGA AAAGGGCAGGGACGTAGTCAA GAAGATCTTCATGGCGGCCGTATTTGACGTTGACA TGCGGCCGCTTAAGCAGGGGCAATGCCTTGTTGC GTCAGAGCAGCCTCATCG GTAATACGACTCACTATAGGGAGATGCCATCCTTTAACCCAC GTAATACGACTCACTATAGGGAGAGTCAGAGCAGCCTCATCG TGCCATCCTTTAACCCAC GTAATACGACTCACTATAGGGAGATGCTTCAGCCGCTACCC GTAATACGACTCACTATAGGGAGATCCAGCAGGACCATGTGAT
AGATCTTC: recognition sequence for Bgl II; GCGGCCGC: recognition sequence for Not I; GTAATACGACTCACTATAGGGAGA: 5’ terminal T7 promoter sequence.
Fig. 1. Characterization of TcM-1309 transcription for PP1r7. The partial amino acid sequence deduced from TcM-1309 was aligned with protein sequences from A. suum, H. contortus, S. ratti, M. musculus and H. sapiens. A consensus sequence of a leucine-repeat structure is indicated and the repeat motifs are underlined.
Fig. 2. Functionally related distributions of Tc-stp-1 and TcM-1309. (A) Transcriptional profiles of Tc-stp-1 among the testis, seminal vesicle, vas deferens, intestine, musculature and cuticle of male adult T. canis. (B) Transcriptional profiles of TcM-1309 among the testis, seminal vesicle, vas deferens, intestine, musculature and cuticle of male adult T. canis. (C) Subcelluar distribution of recombinant PP1c␣ in Sf9 cells. The localization procedure was performed using rabbit anti-PP1 polyclonal antiserum (pre-immune serum in the control experiment) and anti-rabbit IgG labeled with FITC (green). DAPI was used to stain the nuclei of sf9 cells (blue). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
151
Fig. 3. The preparation of dsRNA corresponding to Tc-stp-1. (A) DNA templates were prepared by PCR amplifications, lane 1: Tc-stp-1 fragments was amplified from the total RNA of male adult T. canis, M: DL2000 DNA marker. (B) T7 promoter sequences were added to DNA templates by two separated PCR, lane 1: amplified with reverse terminal T7 promoter-containing primer, lane 2: amplified with forward terminal T7 promoter-containing primer, lane 3: dsRNA was generated by annealing the two PCR products, M: DL2000 DNA marker. (C) DNA/RNA digestion and purification, lane 1: purified dsRNA, M: DL2000 DNA marker.
Fig. 4. Tc-stp-1 Expression in sperm producing tissues. Data are presented normalized values against control and expressed as the mean ± SD. Asterisks indicate significant differences (*P = 0.01; **P = 0.001).
3.2. Tissue expression and subcellular distribution analysis
3.3. Tc-stp-1 gene knockdown analysis
Tissue expression of Tc-stp-1 and TcM-1309 was determined and results showed specific expression of both in testis and vas deferens of male adult T. canis (Fig. 2A and B), which suggested consistent involvement of Tc-stp-1 and TcM-1309 in reproduction. Meanwhile, indirect-fluorescence immunocytochemical analysis was performed to detect the distribution of PP1c␣ with rabbit anti-PP1 primary antibodies and a peroxidase-conjugated goat anti-rabbit IgG secondary antibody, and localized green fluorescence indicated expression of the recombinant protein in the cytoplasm of sf9 cells (Fig. 2C).
The purities and integrities of prepared dsRNAs (Fig. 3) were measured, and a final concentration of dsRNA solution at 100 ng/l was used to suppress expression of the target gene. Compared to the control level, quantitative analysis showed a significant decrease of Tc-stp-1 in the testis and vas deferens after a 24-h treatment, but no obvious change was found in the seminal vesicles. Then, determination at 48 h indicated significant suppression of the target gene in the testis and seminal vesicle, with a sharp upregulation in the vas deferens. The last observation at 72 h showed an overall rebound in the testis, seminal vesicle and vas deferens (Fig. 4). Interestingly,
152
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
Fig. 5. Phenotypic aberrations in reproductive tissues during RNA interference. Histological changes were scanned in hematoxylin and eosin-stained sections of germline tissues after treatment for 24, 48 and 72 h and in the control group. The most significant changes in the seminal vesicle, front end and back end (vas deferens F and B) of vas deferens are shown. Interrupted meiotic divisions are indicated by black lines. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 6. A schematic mechanism of PP1c␣–PP1r7 regulation of meiotic division. (A) Phospho-aurora B (AurB) was dephosphorylated by PP1c␣–PP1r7, which plays a key role in kinetochore and microtubule interactions. (B) In contrast, phospho-AurB destabilizes the interactions between kinetochores and microtubules due to the absence of PP1c␣.
decreased expression of the target gene first appeared in the vas deference and lastly in the seminal vesicle. In contrast, expression was opposite in the recovery processes, which highlighted the indispensable functional roles of Tc-stp-1 in sperm-producing germline tissues.
of vas deferens after 48 h of suppression, which specifically manifested as blocked nuclear divisions. Interestingly, morphological features and the sperm formation process partly recovered after 72 h. Changes in morphology and spermatogenesis of male adult T. canis are shown in Fig. 5.
3.4. Effect of suppressed PP1c˛ transcription
4. Discussion
Phenotypic changes in the reproductive tissues of T. canis during spermatogenesis were scanned after treatment for 24, 48 and 72 h. Compared to normal histological features, non-significant morphological changes were found in the testis during the entire experimental period, although morphological and structural disorders of primary/secondary spermatocytes and spermatids were observed in the seminal vesicle and vas deferens (front end and back end), especially in the 24-h treatment group. By contrast, meiotic divisions were blocked in the seminal vesicle and the front end
PP1 is a major protein serine/threonine phosphatase (Cohen, 2002; Ceulemans and Bollen, 2004) that plays important roles in diverse cellular processes, such as division, apoptosis, protein synthesis and metabolism (Ceulemans and Bollen, 2004; Shi, 2009; Peti et al., 2013). As a holoenzyme, each functional PP1 requires formation of a PP1c (PP1c␣, PP1c, PP1c␥1 and PP1c␥2) complex with PP1-binding regulatory subunits to target and regulate its activity (Barford et al., 1998). A variety of putative PP1r molecules have been identified (Watanabe et al., 2001; Ceulemans and Bollen,
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
2004; Shi, 2009; Heijman et al., 2013), which have contributed to investigations of PP1 function. Specifically, the important roles of male-specific stp1 in spermatogenesis of nematodes have been investigated in several worms (Boag et al., 2000; Hu et al., 2007; Campbell et al., 2010; Ma et al., 2014); however, the precise molecular mechanisms remain largely unknown. In the current study, a leucine-rich repeat protein cDNA sequence, TcM-1309, obtained from a cDNA library of male adult T. canis was cloned and characterized, from which leucine-rich repeat protein structures were found, corresponding to the consensus of mouse PP1r7 LxxLxLxxNxIxxIxxLxxL and human sds22 ExLxxLxxLxxLxLxxNxIxxI (Renouf et al., 1995; Wang and Sperry, 2008). It has been reported that PP1r7 (also known as sds22) homologs regulate microtubule-kinetochore interactions and epithelial cell shape (Grusche et al., 2009; Posch et al., 2010), which is presumed to be involved in the development of spermatids (Chun et al., 2000; Wang and Sperry, 2008). Therefore, understanding the interaction of Tc-stp-1 and TcM-1309 may offer clues to reveal the mechanisms of PP1c␣–PP1r7 interactions in reproduction processes. Although expression and localization researches were done with only Tc-stp-1, transcriptional consistence of Tc-stp-1 and TcM-1309 facilitates the process to elucidate PP1c␣–PP1r7 functions in spermatogenesis. Tissue transcriptional studies of some important genes have been reported in A. suum, H. contortus and B. malayi, which have provided valuable information regarding tissue-specific genes (Yin et al., 2008; Wang et al., 2013; Rosa et al., 2014). For example, Bm-shp-1 expression in the epithelium of uterine and Bm-msp-1 in spermatocytes and spermatids indicated potential roles in reproductive processes (Jiang et al., 2008). Similarly, in our study, differential expression analysis among tissues revealed consistent transcription profiles of Tc-stp-1 and TcM-1309 in the testis and vas deferens, suggesting important involvement of these genes in spermatogenesis. Moreover, PP1r has been reported to target PP1c␣ in distinct subcellular locations (Hubbard and Cohen, 1993; Cohen, 2002). The cytoplasmic distribution of free PP1c␣ in this work provided further information regarding the intracellular molecular roles of PP1c␣–PP1r7 in reproduction of male adult T. canis. The spatiotemporal differences of suppression reflected important roles of Tc-stp-1 in reproduction. With assumptions of functional conservation, RNAi is often utilized in Caenorhabditis elegans as a surrogate target validation tool to explore reproductive and developmental processes of parasites (Kuwabara and Coulson, 2000; Knox et al., 2007; Campbell et al., 2008). RNAi analysis of other nematode species have also been performed in studies of parasitic infection (Geldhof et al., 2006; Visser et al., 2006; Chen et al., 2011), which revealed that C. elegans double-stranded RNAi phenotypes are more often seen for homologues and orthologues of female-specific genes than those of male-specific genes (Nisbet et al., 2008). Thereby, in vitro RNAi assays were performed in the present study, which showed significant suppression of target genes in the testis and vas deferens after 24 h of treatment and in the testis and seminal vesicle after 48 h treatment, while rapid recovery of suppressed expression was detected in the vas deferens at 48 h and in the testis at 72 h. This spatial and temporal variation might be influenced by the mode of delivery, target gene abundance and transcriptional levels, which support the variable and inconsistent susceptibilities reported elsewhere (Maule et al., 2011; Britton et al., 2012; Selkirk et al., 2012). Suppression of Tc-stp-1 expression resulted in morphological aberrations of germ cells and blocked meiosis. RNAi is an effective tool to elucidate gene function, and available RNAi data in C. elegans can be interpreted to predict roles of functional genes of parasitic nematode (Hashmi et al., 2001; Britton and Murray, 2006; Britton et al., 2012). However, some stp genes subjected to highthroughput RNAi analysis did not show mutant phenotypes (Maeda
153
et al., 2001; Kamath et al., 2003; Rual et al., 2004; Sönnichsen et al., 2005; Campbell et al., 2011). Although gene silencing of Od-stp-1 in O. dentatum by targeting the two C. elegans homologues resulted in a reduction in progeny (Boag et al., 2000; Boag et al., 2003), the precise mechanisms require further clarification. In this study, Tcstp-1 gene knockdown resulted in morphological changes of sperm cells and interrupted meiosis, which indicated that PP1r7 can regulate PP1c targeting to the kinetochores and force generation at the kinetochore–microtubule interface (Posch et al., 2010). In other words, diminished PP1c␣ expression leads to insufficient dephosphorylation of phospho-AurB, which destabilized the interactions between kinetochores and microtubules, thereby intervened in force generation, resulting in abnormal chromosome segregation during meiotic division (Fig. 6). Further experiments on TcM-1309 characterization and functional analysis could be carried out, which would be helpful to confirm the existence and function of this important partner protein. In conclusion, consistent transcription of Tc-stp-1 and TcM1309 in male adult T. canis indicated the important roles of these genes in reproduction, while the subcellular distribution of PP1c␣ and RNAi analysis of Tc-stp-1 confirmed the function of PP1c␣ in meiosis during spermatogenesis, and the reciprocal dependence of PP1c␣–PP1r7 suggested the functional mechanism in spermatogenesis. The results of this study provide important clues to reveal the molecular reproductive physiology of parasitic nematodes and will aid in the informed design of new anthelmintics and control strategies. Conflict of interest The authors declare no conflict of interest. Acknowledgements This work was funded by National Natural Science Foundation of China (no. 31172313) and Fundamental Research Funds for the Central Universities (no. XDJK2014D038). References Barford, D., Das, A.K., Egloff, M.P., 1998. The structure and mechanism of protein phosphatases: insights into catalysis and regulation. Annu. Rev. Biophys. Biomol. Struct. 27, 133–164. Boag, P.R., Newton, S.E., Hansen, N., Christensen, C.M., Nansen, P., Gasser, R.B., 2000. Isolation and characterisation of sex-specific transcripts from Oesophagostomum dentatum by RNA arbitrarily-primed PCR. Mol. Biochem. Parasitol. 108, 217–224. Boag, P.R., Ren, P., Newton, S.E., Gasser, R.B., 2003. Molecular characterisation of a male-specific serine/threonine phosphatase from Oesophagostomum dentatum (Nematoda: Strongylida), and functional analysis of homologues in Caenorhabditis elegans. Int. J. Parasitol. 33, 313–325. Britton, C., Murray, L., 2006. Using Caenorhabditis elegans for functional analysis of genes of parasitic nematodes. Int. J. Parasitol. 36, 651–659. Britton, C., Samarasinghe, B., Knox, D.P., 2012. Ups and downs of RNA interference in parasitic nematodes. Exp. Parasitol. 132, 56–61. Caldera, F., Burlone, M.E., Genchi, C., Pirisi, M., Bartoli, E., 2013. Toxocara encephalitis presenting with autonomous nervous system involvement Toxocara encephalitis presenting with autonomous nervous system involvement. Infection 41, 691–694. Campbell, B.E., Hofmann, A., McCluskey, A., Gasser, R.B., 2011. Serine/threonine phosphatases in socioeconomically important parasitic nematodes – prospects as novel drug targets? Biotechnol. Adv. 29, 28–39. Campbell, B.E., Nagaraj, S.H., Hu, M., Zhong, W., Sternberg, P.W., Ong, E.K., Loukas, A., Ranganathan, S., Beveridge, I., McInnes, R.L., Hutchinson, G.W., Gasser, R.B., 2008. Gender-enriched transcripts in Haemonchus contortus – predicted functions and genetic interactions based on comparative analyses with Caenorhabditis elegans. Int. J. Parasitol. 38, 65–83. Campbell, B.E., Rabelo, E.M., Hofmann, A., Hu, M., Gasser, R.B., 2010. Characterization of a Caenorhabditis elegans glc seven-like phosphatase (gsp) orthologue from Haemonchus contortus (Nematoda). Mol. Cell. Probes 24, 178–189. Ceulemans, H., Bollen, M., 2004. Functional diversity of protein phosphatase-1, a cellular economizer and reset button. Physiol. Rev. 84, 1–39.
154
G.X. Ma et al. / Acta Tropica 149 (2015) 148–154
Chen, N., Xu, M.J., Nisbet, A.J., Huang, C.Q., Lin, R.Q., Yuan, Z.G., Song, H.Q., Zhu, X.Q., 2011. Ascaris suum: RNAi mediated silencing of enolase gene expression in infective larvae. Exp. Parasitol. 127, 142–146. Choi, D., Lim, J.H., D, Choi, Paik, C., Kim, S.W., Huh, S.H., 2008. Toxocariasis and ingestion of raw cow liver in patients with eosinophilia. Korean J. Parasitol. 46, 139–143. Chun, Y.S., Park, J.W., Kim, G.T., Shima, H., Nagao, M., Kim, M.S., Chung, M.H., 2000. A sds22 homolog that is associated with the testis-specific serine/threonine protein phosphatase 1gamma2 in rat testis. Biochem. Biophys. Res. Commun. 273, 972–976. Cohen, P.T., 2002. Protein phosphatase 1-targeted in many directions. J. Cell Sci. 115, 241–256. Cong, W., Zhang, X.X., Zhou, N., Yu, C.Z., Chen, J., Wang, X.Y., Li, B., Qian, A.D., Zhu, X.Q., 2014. Toxocara seroprevalence among clinically healthy individuals, pregnant women and psychiatric patients and associated risk factors in Shandong Province, Eastern China. PLoS Negl. Trop. Dis. 8, e3082. Despommier, D., 2003. Toxocariasis: clinical aspects, epidemiology, medical ecology, and molecular aspects. Clin. Microbiol. Rev. 16, 265–272. Garber, J.C., Barbee, R.W., Bielitzki, J.T., Clayton, L.A., Donovan, J.C., Hen-driksen, C.F., Kohn, D.F., Lipman, N.S., Locke, P.A., Melcher, J., Quimby, F.W., Tuner, P.V., Wood, G.A., Wurbel, H., 2011. Guide for the Care and Use of Laboratory Animals, eighth ed. The National Academics, Washington, DC, pp. 11–40. Geldhof, P., Murray, L., Couthier, A., Gilleard, J.S., McLauchlan, G., Knox, D.P., Britton, C., 2006. Testing the efficacy of RNA interference in Haemonchus contortus. Int. J. Parasitol. 36, 801–810. Grusche, F.A., Hidalgo, C., Fletcher, G., Sung, H.H., Sahai, E., Thompson, B.J., 2009. Sds22, a PP1 phosphatase regulatory subunit, regulates epithelial cell polarity and shape [Sds22 in epithelial morphology]. BMC Dev. Biol. 9, 14. Hanser, E., 2003. In vitro studies on the effects of flubendazole against Toxocara canis and Ascaris suum. Parasitol. Res. 89, 63–74. Hashmi, S., Tawe, W., Lustigman, S., 2001. Caenorhabditis elegans and the study of gene function in parasites Caenorhabditis elegans and the study of gene function in parasites. Trends Parasitol. 17, 387–393. Heijman, J., Dewenter, M., EI-Armouche, A., Dobrev, D., 2013. Function and regulation of serine/threonine phosphatases in the healthy and diseased heart. J. Mol. Cell. Cardiol. 64, 90–98. Hotez, P.J., Wilkins, P.P., 2009. Toxocariasis: America’s most common neglected infection of poverty and a helminthiasis of global importance? PLoS Negl. Trop. Dis. 3, e400. Hu, M., Abs EL-Osta, Y.G., Campbell, B.E., Boag, P.R., Nisbet, A.J., Beveridge, I., Gasser, R.B., 2007. Trichostrongylus vitrinus (Nematoda: Strongylida): molecular characterization and transcriptional analysis of Tv-stp-1, a serine/threonine phosphatase gene Trichostrongylus vitrinus (Nematoda: Strongylida): molecular characterization and transcriptional analysis of Tv-stp-1, a serine/threonine phosphatase gene. Exp. Parasitol. 17, 22–34. Hubbard, M.J., Cohen, P., 1993. On target with a new mechanism for the regulation of protein phosphorylation. Trends Biochem. Sci. 18, 172–177. Jiang, D., Li, B.W., Fischer, P.U., Weil, G.L., 2008. Localization of gender-regulated gene expression in the filarial nematode Brugia malayi. Int. J. Parasitol. 38, 503–512. Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D.P., Zipperlen, P., Ahringer, J., 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237. Kayes, S.G., 1997. Human toxocariasis and the visceral larva migrans syndrome: correlative immunopathology. Chem. Immunol. 66, 99–124. Knox, D.P., Geldhof, P., Visser, A., Britton, C., 2007. RNA interference in parasitic nematodes of animals: a reality check. Trends Parasitol. 23, 105–107. Kuwabara, P.E., Coulson, A., 2000. RNAi – prospects for a general technique for determining gene function. Parasitol. Today 16, 347–349. Li, B.W., Rush, A.C., Jiang, D.J., Mitreva, M., Abubucker, S., Weil, G.J., 2011. Gender-associated genes in filarial nematodes are important for reproduction and potential intervention targets. PLoS Negl. Trop. Dis. 5, e947. Ma, G.X., Zhou, R.Q., Hu, S.J., Huang, H.C., Zhu, T., Xia, Q.Y., 2014. Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis. Exp. Parasitol. 141, 55–61. Macpherson, C.N., 2013. The epidemiology and public health importance of toxocariasis: a zoonosis of global importance. Int. J. Parasitol. 43, 999–1008. Maeda, I., Kohara, Y., Yamamoto, M., Sugimoto, A., 2001. Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr. Biol. 11, 171–176. Maule, A.G., McVeigh, P., Dalzell, J.J., Atkinson, L., Mousley, A., Marks, N.J., 2011. An eye on RNAi in nematode parasites. Trends Parasitol. 27, 505–513. Moreira, G.M., Telmo Pde, L., Mendonca, M., Moreira, A.N., McBride, A.J., Scaini, C.J., Conceic¸ão, F.R., 2014. Human toxocariasis: current advances in diagnostics, treatment, and interventions. Trends Parasitol. 30, 456–464. Morimatsu, Y., Akao, N., Akiyoshi, H., Kawazu, T., Okabe, Y., Aizawa, H., 2006. A familial case of visceral larva migrans after ingestion of raw chicken livers:
appearance of specific antibody in bronchoalveolar lavage fluid of the patients. Am. J. Trop. Med. Hyg. 75, 303–306. Nisbet, A.J., Cottee, P.A., Gasser, R.B., 2008. Genomics of reproduction in nematodes: prospects for parasite intervention. Trends Parasitol. 24, 89–95. Nisbet, A.J., Gasser, R.B., 2004. Profiling of gender-specific gene expression for Trichostrongylus vitrinus (Nematoda: Strongylida) by microarray analysis of expressed sequence tag libraries constructed by suppressive-subtractive hybridization. Int. J. Parasitol. 34, 633–643. Peti, W., Nairn, A.C., Page, R., 2013. Structural basis for protein phosphatase 1 regulation and specificity. FEBS J. 280, 596–611. Posch, M., Khoudoli, G.A., Swift, S., King, E.M., Deluca, J.G., Swedlow, J.R., 2010. Sds22 regulates aurora B activity and microtubule-kinetochore interactions at mitosis. J. Cell. Biol. 191, 61–74. Renouf, S., Beullens, M., Wera, S., Van Eynde, A., Sikela, J., Stalmans, W., Bollen, M., 1995. Molecular cloning of a human polypeptide related to yeast sds22, a regulator of protein phosphatase-1. FEBS Lett. 375, 75–78. Rosa, B.A., Jasmer, D.P., Mitreva, M., 2014. Genome-wide tissue-specific gene expression, co-expression and regulation of co-expressed genes in adult nematode Ascaris suum. PLoS Negl. Trop. Dis. 8, e2678. Rual, J.F., Ceron, J., Koreth, J., Hao, T., Nicot, A.S., Hirozane-Kishikawa, T., Vandenhaute, J., Orkin, S.H., Hill, D.E., van den Heuvel, S., Vidal, M., 2004. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Res. 14, 2162–2168. Schoenardie, E.R., Scaini, C.J., Brod, C.S., Pepe, M.S., Villela, M.M., McBride, A.J., Borsuk, S., Berne, M.E., 2013. Seroprevalence of Toxocara infection in children from southern Brazil. J. Parasitol. 99, 537–539. Selkirk, M.E., Huang, S.C., Knox, D.P., Britton, C., 2012. The development of RNA interference (RNAi) in gastrointestinal nematodes. Parasitology 139, 605–612. Shi, Y., 2009. Serine/threonine phosphatases: mechanism through structure. Cell 139, 468–484. Sönnichsen, B., Koski, L.B., Walsh, A., Marschall, P., Neumann, B., Brehm, M., Alleaume, A.M., Artelt, J., Bettencourt, P., Cassin, E., Hewitson, M., Holz, C., Khan, M., Lazik, S., Martin, C., Nitzsche, B., Ruer, M., Stamford, J., Winzi, M., Heinkel, R., Röder, M., Finell, J., Häntsch, H., Jones, S.J., Jones, M., Piano, F., Gunsalus, K.C., Oegema, K., Gönczy, P., Coulson, A., Hyman, A.A., Echeverri, C.J., 2005. Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature 434, 462–469. Taira, K., Saeed, I., Permin, A., Kapel, C.M., 2004. Zoonotic risk of Toxocara canis infection through consumption of pig or poultry viscera. Vet. Parasitol. 121, 115–124. Urquhart, G.M., Armour, J., Duncan, J.L., Dunn, A.M., Jennings, F.W., 2003. Veterinary Parasitology. Blackwell Science, Scotland, pp. 67–74. Visser, A., Geldhof, P., de Maere, V., Knox, D.P., Vercruysse, J., Claerebout, E., 2006. Efficacy and specificity of RNA interference in larval life-stages of Ostertagia ostertagi. Parasitology 133, 777–783. Wang, R., Sperry, A.O., 2008. Identification of a novel Leucine-rich repeat protein and candidate PP1 regulatory subunit expressed in developing spermatids. BMC Cell Biol. 9, 9. Wang, Z., Gao, X., Martin, J., Yin, Y., Abubucker, S., Rash, A.C., Li, B.W., Nash, B., Hallsworth-Pepin, K., Jasmer, D.P., Mitreva, M., 2013. Gene expression analysis distinguishes tissue-specific and gender-related functions among adult Ascaris suum tissues. Mol. Genet. Genomics 288, 243–260. Watanabe, T., Huang, H.B., Horiuchi, A., da Cruze Silva, E.F., Hsieh-Wilson, L., Allen, P.B., Shenolikar, S., Greengard, P., Nairn, A.C., 2001. Protein phosphatase 1 regulation by inhibitors and targeting subunits. Proc. Natl. Acad. Sci. U. S. A. 98, 3080–3085. Woodhall, D.M., Eberhard, M.L., Parise, M.E., 2014. Neglected parasitic infections in the United States: Toxocariasis. Am. J. Trop. Med. Hyg. 90, 810–813. Yin, Y., Martin, J., Abubucker, S., Scott, A.L., McCarter, J.P., Wilson, R.K., Jasmer, D.P., Mitreva, M., 2008. Intestinal transcriptomes of nematodes: comparison of the parasites Ascaris suum and Haemonchus contortus with the free-living Caenorhabditis elegans. PLoS Negl. Trop. Dis. 2, e269.
Web reference http://blast.ncbi.nlm.nih.gov/. Blast X algorithm, 2015 January 20. http://www.cioms.ch/publications/guidelines/ 1985textsofguidelines.htm. International Guiding Principles for Biomedical Research Involving Animals, Council for the International Organizations of Medical Sciences, Switzerland, 1985/2014.8.29.