- Email: [email protected]
Molecular method for rapid detection of the red tide dinoflagellate Karenia mikimotoi in the coastal region of Xiangshan Bay, China
Journal of Microbiological Methods 168 (2020) 105801
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Molecular method for rapid detection of the red tide dinoflagellate Karenia mikimotoi in the coastal region of Xiangshan Bay, China
T
⁎
Hai-Long Huanga,b, Wei-Fang Gaoc, Peng Zhua,c, , Cheng-Xu Zhoua, Long-Liang Qiaoa, ⁎ Chen-Yang Danga, Jian-Hu Panga, Xiao-Jun Yana, a
Key Laboratory of Applied Marine Biotechnology, Ningbo University, Ningbo 315211, China Key Laboratory of Marine Ecology & Environmental Sciences, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China c Ningbo Institute of Oceanography, Ningbo 315832, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Karenia mikimotoi ITS LAMP-LFD assay Rapid Harmful algae
The species Karenia mikimotoi is a common nearshore red tide alga that can secrete hemolytic exotoxin and ichthyotoxin, which can induce the death of fish and shellfish, causing severe economic losses. In this study, loop-mediated isothermal amplification (LAMP) was employed in combination with the lateral flow dipstick (LFD) visual detection method to establish the LAMP-LFD rapid detection method for K. mikimotoi. The internal transcribed spacer ITS1-5.8S-ITS2 of K. mikimotoi was used as the target sequence and was amplified with specific primers designed in this study. The results indicated that the amplification optimal reaction conditions for LAMP in this paper were for 20 min at 65 °C. Moreover, LAMP had excellent specificity, showing negative results for other common red tide causing algal species. In field samples, we successfully reduced the total time, with only 23 min needed from LAMP amplification to LFD result display, which was shorter than that of conventional PCR. Consequently, LAMP-LFD should be useful for rapid field detection of low-density K. mikimotoi and for the early prevention of red tide induced by such algae.
1. Introduction The species Karenia mikimotoi, which belongs to the order Gymnodiniales, was first identified in Gokasho Bay of Kyoto in 1935 (Oda, 1935) under the name Gymnodinium mikimotoi. G. mikimotoi has been found in different areas around the world. It was finally transferred to a new genus, Karenia G. Hansen and Moestrup, as Karenia mikimotoi by Daugbjerg et al. (2000). This species can secrete hemolytic exotoxins and ichthyotoxins, which lyse fish branchial cells, resulting in the death of fish and shellfish (Naar et al., 2002; Brand et al., 2012; Guo et al., 2015). Karenia mikimotoi has caused tremendous economic losses and has severely impacted the ecological environment. Moreover, K. mikimotoi displays strong adaptability and is extensively distributed. Large-scale red tides caused by K. mikimotoi have been reported in New Zealand (Seki et al., 1995), Japan (Nakamura et al., 1996; Yang et al., 2000; Aoki et al., 2017), India (Godhe et al., 2001; Robin et al., 2013), Ireland (Raine et al., 2001), and the Gulf of Mexico (Steidinger et al., 1998), as well as in Hong Kong (Yang et al., 2000; Fang and Tang,
2009), Zhejiang, and Fujian coastal regions (Yao et al., 2006b; Long and Du, 2005). Since the first K. mikimotoi red tide was observed in Hong Kong in 1980, the frequency and scope of K. mikimotoi-induced red tides have increased notably, and it has become the second most dominant species of coastal red tides in China (Yao et al., 2007; Lin et al., 2012). From 2001 to 2006, a total of 59 K. mikimotoi-induced red tides have occurred, involving a total area of 25,920 km2. In addition, K. mikimotoi often occurs in red tide communities in Fujian coastal areas. Moreover, K. mikimotoi occasionally forms diphasic red tides with Prorocentrum donghaiense (Yao and Lu, 2005; Yao et al., 2006a, 2006b; Liu et al., 2015). From 2001 to 2008, 17 K. mikimotoi-induced red tides occurred in Fujian coastal waters. Among them, K. mikimotoi was the second most dominant species, primarily forming red tides with P. donghaiense; K. mikimotoi accounted for 9.2% of the total red tides observed (Xu et al., 2010). The optimal way to prevent K. mikimotoi-induced red tides is to detect and provide an early warning of the alga before large-scale proliferation occurs. At present, traditional morphological
Abbreviations: LAMP, loop mediated isothermal amplification; LFD, lateral flow dipstick; ITS, internal transcribed spacer; PCR, polymerase chain reaction; AGE, agarose gel electrophoresis; FIP, forward inner primer; BIP, backward inner primer; FITC, fluorescein isothiocyanate; POCT, point of care testing ⁎ Corresponding authors at: Key Laboratory of Applied Marine Biotechnology, Ningbo University, Ningbo 315211, China. E-mail addresses: [email protected] (H.-L. Huang), [email protected] (W.-F. Gao), [email protected] (P. Zhu), [email protected] (C.-X. Zhou), [email protected] (X.-J. Yan). https://doi.org/10.1016/j.mimet.2019.105801 Received 29 June 2019; Received in revised form 27 November 2019; Accepted 2 December 2019 Available online 04 December 2019 0167-7012/ © 2019 Published by Elsevier B.V.
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
identification remains the major method for identification of K. mikimotoi. However, many microalgae are similar in morphology, which makes them difficult to distinguish. In addition, such methods depend greatly on diagnostic personnel with algal taxonomy expertise, and are time consuming and labor intensive. They cannot be applied to a rapid analysis of large sample numbers. Consequently, there is an urgent need to establish a rapid method for the daily monitoring and early warning of K. mikimotoi. Molecular, nucleic acid amplification-based detection methods are associated with the advantages of high sensitivity, excellent specificity and short detection time. Among these, molecular methods, such as Polymerase Chain Reaction (PCR) or those employing molecular probes as the major reaction principle, have been applied to detect and identify microalgal species rapidly (Yuan et al., 2012; Chen et al., 2015; Park et al., 2016; Toldrà et al., 2018; Huang et al., 2019). PCR-based assays are among the most promising and attractive new methods compared to the traditional methods. However, PCR needs to be done in a laboratory that is usually distant from the location where samples are taken. This restricts the application of PCR in point-of-care testing (POCT). Loop-mediated isothermal amplification (LAMP) is a nucleic acid amplification-based detection method developed by Notomi et al. (2000) that requires only a simple water bath or heater and has no strict requirements regarding the technical background of the operator (Tanner and Evans, 2014). Accordingly, this method has become popular in the field of bacteria, viruses, fungi, parasites and algae (Niemz et al., 2011; Mori et al., 2013; Chen et al., 2015; Wong et al., 2017; Huang et al., 2017a, 2017b; Zhu et al., 2019). However, the traditional LAMP result display shows some drawbacks. The detection of LAMP products is initially observed by agarose gel electrophoresis (AGE), followed by either adding dyes or calcein (fluorescent detection reagent). Some dyes, such as SYBR green, affect LAMP amplification reactions (Yang et al., 2016). Additionally, there is always the possibility that a sample may be somewhat ambiguous to the naked eye when the concentration of products is low (Yan et al., 2015). In order to compensate for the disadvantages of LAMP in terms of its result display, this study has established a LAMP-LFD assay. The lateral flow dipstick (LFD), also known as lateral flow immunochromatographic assay, can form colorful detection lines on the strip and thus easily display the amplification results (Kiatpathomchai et al., 2008; Arunrut et al., 2011). Moreover, the probe can effectively avoid a false positive induced by conventional nucleic acid amplification methods, leading to more specific detection results. In this study, we designed a set of primers applicable for LAMP amplification based on the internal transcribed spacer (ITS1-5.8S-ITS2) of K. mikimotoi. This enabled a rapid and simple LAMP-LFD detection method for the harmful red tide alga, K. mikimotoi, to be established.
Table 1 Algal species for LAMP-LFD assay. Species
Algal isolates
Source
Karenia mikimotoi Prorocentrum micans Heterosigma akashiwo Prorocentrum donghaiense Karlodinium veneficum Alexandrium tamarense Prorocentrum minimum Skeletonema costatum s.s. (sensu stricto) Karenia brevis
NMBjah052 NMBjah041 NMBRah03-2 NMBjah045 NMB jah047-1 NMBjah048 NMBjah049 NMBguh004-2
Dong tou Qingdao Marine research South tajima Dong tou Dong tou Hong Kong Yu mountain Xia men
GY-DH36
Shanghai Guangyu Biological Technology Co., Ltd
centrifugation at 12,000× g for 10 min at 4 °C, and the supernatant was removed. Then genomic DNAs of all algal species were prepared in accordance with the extraction steps described in the instructions of a Takara genomic DNA extraction kit (Takara Biotechnology Co., Ltd., Dalian, China). The obtained genomic DNA was quantified using a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, USA), then preserved at −20 °C until use. 2.3. ITS cloning and sequencing The ITS (ITS1 and ITS2, including the 5.8S rDNA) region of K. mikimotoi was amplified by conventional PCR with the specific primers designed by Zhuang et al. (2001) and synthesized commercially (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd., Shanghai, China): LH2: 5’-AGGTGAACCTGCGGAAGGATC-3′; Dlam:5’-CCTGCAGTCGACA(TG)ATGCTTAA(AG)TTCAGC(AG)GG-3′. Karenia mikimotoi DNA obtained from culture was used as the template. One reaction system consisted of 25 μL of Premix×Taq, 1 μL both of all primers (final concentration 400 nM each), and 72 ng of DNA template with sterile water to a final volume of 50 μL. The reaction was conducted in an Eppendorf Mastercycler gradient PCR (Eppendorf China Ltd.) subjecting the samples to 94 °C for 5 min, followed by 35 cycles of 94 °C for 45 s, 57 °C for 45 s, and 72 °C for 60 s and then final extension at 72 °C for 7 min. The amplification products were separated using 1% agarose gel electrophoresis (AGE) (1%), and images were taken by using the gel imaging system (Bio-Rad Laboratories, Shanghai, China) for results observation. The PCR products (500 bp) were purified by quick gel extraction using a Takara MiniBEST Agarose kit. The collected products were ligated to the Takara PMD 19-T vector, transferred into Takara E. coli Competent Cells DH5α for cultivation (37 °C, 16–18 h); all of the positive clones were screened by colony PCR and sequenced by Sangon Bioengineering Co., Ltd. (Shanghai, China).
2. Materials and methods 2.4. LAMP primer design 2.1. Algae culture The sequence of the cloned PCR product (Section 2.3) was used as the target sequence, and four groups of primers were designed using the Primer Explorer V4 software (http://primerexplorer.jp/lamp) in accordance with the LAMP primer design principle. Six primers were included in each group: the outer primers (F3 and B3), inner primers (FIP and BIP), and loop primers (LF and LB). The optimal amplifier group was obtained through LAMP amplification screening and is presented in Table 2. Km-11-FIP was labeled with biotin, whereas FITC (fluorescein isothiocyanate) was added onto Km-11-LF. The relative positions of primers in the sequence are displayed in Fig. 1. The primers were synthesized by Sangon Bioengineering Co., Ltd.
Nine common red tide algae species for LAMP specificity analysis were selected, K. mikimotoi, Alexandrium tamarense, Prorocentrum minimum, Prorocentrum donghaiense, Prorocentrum micans, Skeletonema costatum s.s. (sensu stricto), Heterosigma akashiwo, Karlodinium veneficum and Karenia brevis (Table 1). These algal species were provided by the Microalgae Collection at Ningbo University and cultured in the BG 11 liquid medium under the following conditions: temperature, 25 °C; illumination intensity, 40 μmol·m−2·s−1; light-dark cycle, L:D = 12 h:12 h; shaking 1–2 times daily (Huang et al., 2017a, 2017b). All of the cultures were grown to exponential phase under these culture conditions before being used in the experiments.
2.5. Optimization of LAMP reaction conditions and construction of LAMPLFD
2.2. Preparation of genomic DNA
Genomic DNA of K. mikimotoi was used as the template for the
Algal cells in the exponential growth phase were collected by 2
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
Table 2 Designed primers and DNA probe of K. mikimotoi used in LAMP-LFD assay. Primer
Type
length
Sequence (5′-3′)
Km-11-F3 Km-11-B3 Km-11-FIPa Km-11-BIP Km-11-LFb Km-11-LB
Forward-outer primer Backward-outer primer Forward-inner primer Backward-inner primer Loop-forward primer Loop-backward primer
18 20 39 41 17 19
AATCGCAGCCGAGTGGAT AGAGTGCAATGCGAGTTCAG CTTGCGCCCAAGAGCTTTTGC-CTGGTTGCTATGGCCCCT CGACGGATATCTTGGCTCGGG-ACGGAGTTCTGCAATTCACA CTTCAGCGGTGCCCTCA CCAATGAAGGGCGCAGCGA
a b
Km-11-FIP-bio was 5′-biotinylated at the 5’end. Km-11-LF-fitc was labeled by fluorescein isothiocyanate (FITC) at the 5’end.
2.7. Specificity To determine the specificity of LAMP-LFD, another eight common red tide algal species were selected: A. tamarense, P. micans, P. donghaiense, P. minimum, S. costatum, H. akashiwo, K. veneficum and K. brevis. Genomic DNAs (at least 72 ng per reaction) of nine algal isolates including K. mikimotoi were amplified using the constructed LAMP-LFD method and conventional PCR. LAMP-LFD products were displayed by real-time PCR (65 °C, 50 min) and LFD detection, whereas the PCR reaction products were analyzed by 1% AGE. 2.8. Sensitivity
Fig. 1. Design diagram for primers of K. mikimotoi used in LAMP-LFD assay.
The total genomic DNA (72 ng·μL−1) was extracted from K. mikimotoi cells. Then, 10-fold gradient diluted gDNA (7.2 × 101 ng·μL−1–7.2 × 10−6 ng·μL−1) was used as templates for the PCR, LAMP, and LAMP-LFD assays to determine the analytical sensitivity. Subsequently, the LAMP amplification products were analyzed by the quantitative PCR thermal cycler and by LFD as previously described. The same 10-fold serial dilutions of total genomic DNA from K. mikimotoi were also used as templates for conventional PCR with the LAMP primers (Km-11-F3 and Km-11-B3). The products were then observed by real-time PCR, LFD strip, and 1% AGE.
optimization of LAMP-LFD reaction conditions. The LAMP assay was carried out with a reaction mixture that consisted of 40 pmol of each inner primer (FIP and BIP), 5 pmol of each outer primer (F3 and B3), 20 pmol of each loop primer (LF and LB), 10 μL of buffer BQE2 (Beijing Boao Biological Company, Beijing, China), and 1 μL (72 ng/μL) of DNA template that was diluted with sterile water to 25 μL. The negative control contained distilled water instead of DNA template. The DNA reaction kit used for the LAMP method in this experiment was purchased from Beijing Boao Biological Company, Beijing, China. To determine the optimal temperature for LAMP, the reactions were conducted using the selected primers at three different temperatures (61 °C, 63 °C, and 65 °C). Real-time amplification by the LAMP assay was monitored based on the fluorescence ratio using the quantitative PCR thermal cycler (Roche Life Sciences, Shanghai, China). The reaction time was 50 min, and the optimal reaction temperature was identified based on the amplification effect (Results appeared in the shortest time). To simplify the detection of LAMP products, we established a probebased LFD (Lateral-Flow Dipstick) method and a commercially available LFD (Milenia® GenLine HybriDetect Kit, Milenia Biotec GmbH, Giessen, Germany) was applied. The optimized LAMP reaction system was adopted for amplification, and 5 μL of reaction product was added to 50 μL of buffer. The LFD strip was inserted vertically into the mixture for 3 min, after which the detection results were visualized as lines on the strips.
2.9. Applicability of the LAMP-LFD assay A total of ten surface water samples were collected in the coastal region off the mouth of the Xiangshan Bay in the East China Sea by research vehicle“Runjiang1”in July 2016. The sampling locations were labeled NP1, NP3, NP4, NP5, NP6, NP7, NP8, NP9, NA1, and NA2 and are shown in Fig. 2. Surface water samples (500 mL) for each station were collected in polyethylene terephthalate (PET) bottles. Additionally, 200 mL of filtered water (0.45 μm cellulose acetate membrane; Millipore, USA) was used for genomic DNA extraction as described in Section 2.2. Appropriate amounts (1 × 105 cells/mL) of the each algal isolate listed in Section 2.1 were collected and mixed, after which the DNA was extracted. 75 ng of gDNA from each algal species mixed, together with K. mikimotoi DNA was used. K. mikimotoi was detected using the designed LAMP-LFD method (the total time was limited to 23 min) and PCR, with the aforementioned DNA samples and reaction conditions as the template.
2.6. PCR detection
3. Results
The LAMP outer primers designed in Section 2.4 (Km-11-F3 and Km-11-B3) were used as the PCR primers for amplification of K. mikimotoi template DNA. The reaction system consisted of 25 μL of Premix×Taq, 1 μL of all primers (final concentration 400 nM each), and 1 μL (72 ng/μL) of DNA template diluted with sterile water to 50 μL. The reaction conditions were as follows: 94 °C for 5 min followed by 35 cycles of 45 s at 94 °C, 45 s at 57 °C, and 60 s at 72 °C and then final extension at 72 °C for 7 min. The amplification products (227 bp) were separated using 1% AGE.
3.1. Establishment of LAMP reaction conditions High concentrations of K. mikimotoi gDNA (7.2 × 101 ng·μL−1) were used as the template for LAMP amplification at three different reaction temperatures of 61 °C, 63 °C, and 65 °C. Typical sigmoidal amplification curves were observed at each temperature when fluorescent LAMP was performed over 50 min (Fig. 3). As shown in the figure, amplification started at about 13 min after the start of the reaction, with the most rapid amplification observed at 65 °C, followed by 3
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
K. veneficum and A. tamarense (Fig. 4c). Taken together, these findings indicate that under the conditions tested, LAMP and LAMP-LFD had better specificity than PCR for detecting K. mikimotoi. 3.3. Sensitivity test To test the sensitivity of LAMP-LFD, 10-fold gradient diluted gDNA was used as the template for LAMP, LAMP-LFD, and PCR reactions (Fig. 5). Both LAMP and LAMP-LFD reactions could detect the lowest DNA concentration of 7.2 × 10−2 ng·μL−1. Although faint, a distinct band can be seen using the highest dilution (7.2 × 10−2 ng·μL−1) in PCR (Fig. 5c). Overall, the detection limit for conventional PCR with the LAMP primers (Km-11-F3 and Km-11-B3) was similar to the sensitivity achieved by LAMP and LAMP-LFD for detection of K. mikimotoi. 3.4. Analysis of simulated and field samples Ten groups of field samples and a group of mixed algal genomic DNA were used to evaluate the performance of the LAMP-LFD assay. All samples were used as templates for LAMP-LFD and PCR reactions, and the results of the reactions are displayed in Fig. 6. Overall, 10 groups of field samples showed negative results on LFD strips detection, whereas the mixed algal solution displayed positive amplification, and the negative control group in which sterile water was used as the template showed no amplification. The PCR results were negative in the field sample group, whereas faint amplified bands could be seen in the mixed algae solution group, the displayed positive result was not obvious. Although no naturally positive samples were available for inclusion and evaluation, LAMP-LFD was better than PCR for displaying the results using simulated samples.
Fig. 2. Geographic location of the field sampling sites (NP1, NP3, NP4, NP5, NP6, NP7, NP8, NP9, NA1, and NA2).
4. Discussion Among toxic and harmful algal species, K. mikimotoi is widely distributed, and is a common red tide dinoflagellate in the coastal regions of China (Liu et al., 2015). Zheng et al. (2009) developed a PCR method for detecting K. mikimotoi by designing specific PCR primers amplifying the ribosomal ITS. The authors suggested that this method could be successfully applied to detect K. mikimotoi in samples, where other common algal species are present, because no cross-reaction was observed with other algal species. Guillou et al. (2002) determined the partial sequence of the hypervariable regions D1 and D2 on the K. mikimotoi 28S rDNA and targeted K. mikimotoi using a semi-nested PCR technique. Yuan et al. (2012) treated the K. mikimotoi ITS as the target and designed highly specific primers and TaqMan probes to develop a real-time PCR detection assay that showed high sensitivity and reliability. Vrieling et al. (1997) detected K. mikimotoi by flow cytometry, whereas Ulrich (2010) developed a method for the detection and quantification of K. mikimotoi using real-time nucleic acid sequence-based amplification with internal control RNA (IC-NASBA). These methods have achieved accurate detection of K. mikimotoi through molecular methods. However, most of these methods require a long processing time and the availability of expensive equipment. As a result, these methods are limited for large scale applications such as rapid field detection of K. mikimotoi. Zhang et al. (2009) designed specific primers using K. mikimotoi ITS2 as the target sequence and established the LAMP detection system of K. mikimotoi, which had better sensitivity and specificity than PCR. However, their experiments adopted the traditional LAMP result display method based on LAMP product detection, by including AGE, observation of the white precipitation of magnesium pyrophosphate generated in the reaction, and addition of SYBR Green I into the reaction tube to observe the color change. Among these methods, AGE must be evaluated using a gel imaging system and is subject to aerosol pollution. In addition, precipitation of magnesium pyrophosphate and color changes in the reaction can also occur. Accordingly, this method
Fig. 3. Amplification of LAMP at different temperatures (61 °C, 63 °C, and 65 °C).
63 °C and 61 °C, with extremely small differences between each one. In addition, the fluorescence values of the three temperatures reached a plateau phase after approximately 20 min. These findings indicated that an optimal amplification efficiency could be achieved at 65 °C; therefore, 65 °C and 20 min were selected as the optimal reaction temperature and time, respectively. 3.2. Specificity test To test the specificity of LAMP-LFD, K. mikimotoi and eight other common red tide algal species were tested using the established LAMP, LAMP-LFD, and PCR methods. As shown in Fig. 4, both LAMP and LAMP-LFD reactions were positive for K. mikimotoi only, whereas the remaining eight algal species were negative. Additionally, a control group in which sterile water was used as the template produced no amplification. In comparison, PCR of K. mikimotoi produced a bright and discrete band on AGE, but faint (presumably non-specific) amplicons of variable size were obtained with S. costatum, H. akashiwo, 4
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
Fig. 4. Comparison of specificity of LAMP (a), LAMP-LFD (b), and PCR (c) for detection of K. mikimotoi. Amplification was performed at 65 °C for 30 min. M: DL2000 DNA Marker. NC, negative control; No gDNA was used as the template. gDNA extracted from A. tamarense, P. micans, P. donghaiense, P. minimum, S. costatum s.s., H. akashiwo, K. mikimotoi, K. veneficum and K. brevis used as the template, respectively.
suitable for implementation in field detection of K. mikimotoi. However, the DNA extraction step restricts the application of the LAMP-LFD method in point-of-care testing (POCT). There have been some reports of the rapid extraction of nucleic acid by membrane methods (Oblath et al., 2013; Mcfall et al., 2015; Govindarajan et al., 2011; Liu et al., 2011; Zou et al., 2017). These new methods directly transfer nucleic acid from the membrane to the amplification system while omitting the steps of nucleic acid elution to simplify the purification of nucleic acid. However, further study is needed to determine how to apply cellulose membranes to nucleic acid extraction in a way to take full advantage of its materials, facilitate the operation, and smoothly connect the extraction with nucleic acid amplification.
is prone to extraneous or non-specific results and interpretations because of unapparent AGE bands or color changes and is therefore not sensitive enough to be applied to real-time field monitoring. Thus, Zhang et al. (2019) established rolling circle amplification (E-RCA) and double-ligation E-RCA (dlE-RCA) for the detection of K. mikimotoi. Similar to LAMP, E-RCA and dlE-RCA are relatively simple detection protocols that require no special instrumentation. In this study, LAMP was combined with LFD to detect K. mikimotoi. As shown in these experiments, LAMP results can be directly observed with LFD instead of using a PCR instrument. Therefore, LAMP results can be directly observed with LFD instead of using a PCR instrument. When compared with traditional PCR, E-RCA, and dlE-RCA, the LAMPLFD method does not require AGE for displaying the results, which saves time especially in the light of the need for fast, real-time detection. Moreover, LFD strip results are visible, rapid, specific, and convenient. As a result, when compared with the traditional LAMP, E-RCA, and dlE-RCA methods, the introduction of a LFD strip has led to higher accuracy and reliability of results while avoiding errors caused by the naked eye. In addition, the introduction of specific probes can also reduce the problem of false positives caused by fluorescent dye (Schnetzinger et al., 2013). The LAMP-LFD method established from this research can distinguish K. mikimotoi from the common red tide algal species. Notably, it shows extremely high specificity relative to PCR. In particular, LAMPLFD could detect K. mikimotoi genomic DNA at the lowest level of 7.2 × 10−2 ng·μL−1. With regard to time, LAMP amplification can be accomplished in 20 min, and the results can be observed 3 min after inserting the strip into a buffer containing the respective products. Therefore, the LAMP-LFD detection method for K. mikimotoi established in this paper can serve as a rapid detection means and should be
5. Conclusions In this study, we established a LAMP-LFD method for the rapid detection of K. mikimotoi. In addition, it had simple operation, a short detection time, and easily accessible results. Moreover, the developed method is free from dependence on experimental environments and experienced technical personnel. Therefore, applying this method to the field detection of K. mikimotoi should be useful for the early warning and prevention of red tides induced by this alga. Overall, LAMP-LFD technology has the potential to be promoted and applied on a large scale as a novel rapid field detection method of K. mikimotoi.
Declaration of competing interest There is no conflict of interest. 5
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
Fig. 5. Comparison of sensitivity of LAMP (a), LAMP-LFD (b), and PCR (c) for detection of K. mikimotoi Amplification was performed at 65 °C for 30 min. M: DL2000 DNA Marker. NC, negative control; No gDNA was used as the template. K. mikimotoi gDNA at concentrations of 7.8 × 101, 7.8 × 100, 7.8 × 10−1, 7.8 × 10−2, 7.8 × 10−3, 7.8 × 10−4, 7.8 × 10−5, and 7.8 × 10−6 ng·μL−1 as the template.
Fig. 6. Comparison of LAMP-LFD (a) and PCR (b) for detection of field samples M: DL2000 DNA Marker. NC, negative control; 1–11 gDNA extracted from NP1, NP3, NP4, NP5, NP6, NP7, NP8, NP9, NA1, NA2, and mixed algae as the template, respectively.
Acknowledgments
Science and Technology (2015GA701001), the Earmarked Fund for Modern Agro-industry Technology Research System, China (CARS-49), the Scientific Research Foundation of Graduate School of Ningbo University, the Li Dak Sum Yip Yio Chin Kenneth Li Marine Biopharmaceutical Development Fund, the National 111 Project of China; and partly supported by Laboratory of Marine Ecosystem and Biogeochemistry, Second Institute of Oceanography, China
This work was supported financially by the National Key Research and Development Program of China (2018YFD0900702), Zhejiang Provincial Public Welfare Technology Program of China (2017C33133), Ningbo Science and Technology Research Projects of China (2017C110003), China Spark Program of the National Ministry of 6
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
(LMEB201705); the K.C. Wang Magna Fund in Ningbo University (SS). We would like to thank LetPub (www.letpub.com) for providing linguistic assistance during the preparation of this manuscript.
K., Lancaster, J., Baden, D.G., 2002. A competitive ELISA to detect breve toxins from Karenia brevis (formerly Gymnodinium breve) in seawater, shellfish, and mammalian body fluid. Environ. Health Perspect. 110 (2), 179–185. Nakamura, Y., Suzuki, S., Hiromi, J., 1996. Development and collapse of a Gymnodinium mikimotoi red tide in the Seto Inland Sea. Aquat. Microb. Ecol. 10, 131–137. Niemz, A., Ferguson, T.M., Boyle, D.S., 2011. Point-of-care nucleic acid testing for infectious diseases. Trends Biotechnol. 29 (5), 240–250. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, 63. Oblath, E.A., Henley, W.H., Alarie, J.P., Ramsey, J.M., 2013. A microfluidic chip integrating DNA extraction and real-time PCR for the detection of bacteria in saliva. Lab Chip 13 (7), 1325–1332. Oda, M., 1935. The red tide of Gymnodinium mikimotoi sp. (MS) and the effect of altering copper sulphate to prevent the growth of it. Dobutsugaku Zasshi Zoolol. Soc. Jpn. 47 (555), 35–48. Park, T.G., Kim, J.J., Kim, W.J., Won, K.M., 2016. Development of real-time RT-PCR for detecting viable Cochlodinium polykrikoides, (Dinophyceae) cysts in sediment. Harmful Algae 60, 36–44. Raine, R., O’Boyle, S., O’Higgins, T., White, M., Patching, J., Cahill, B., McMahon, T., 2001. A satellite and field portrait of a Karenia mikimotoi bloom off the south coast of Ireland, August 1998. Hydrobiologia 465, 187–193. Robin, R.S., Kanuri, V.V., Muduli, P.R., Mishra, R.K., Kumar, C.S., 2013. Dinoflagellate bloom of Karenia mikimotoi along the southeast Arabian Sea, bordering western India. J. Ecosyst. 20, 1–11. Schnetzinger, F., Pan, Y., Nocker, A., 2013. Use of propidium monoazide and increased amplicon length reduce false-positive signals in quantitative PCR for bioburden analysis. Appl. Microbiol. Biotechnol. 97 (5), 2153–2162. Seki, T., Satake, M., Mackenzie, L., Kaspar, H.F., Yasumoto, T., 1995. Gymnodimine, a new marine toxin of unprecedented structure isolated from New-Zealand oysters and the Dinoflagellate, Gymnodinium sp. Tetrahedron Lett. 36, 7093–7096. Steidinger, K.A., Tomas, C., Vargo, G.A., Tester, P.A., 1998. Bloom dynamics and physiology of Gymnodinium breve with emphasis on the Gulf of Mexico. NATO ASI Ser. G Ecol. Sci. 41, 133–153. Tanner, N.A., Evans, T.C., 2014. Loop-mediated isothermal amplification for detection of nucleic acids. Curr. Protoc. Mol. Biol. 105, 1–14. Toldrà, A., Andree, K.B., Fernández-Tejedor, M., Diogène, J., Campàs, M., 2018. Dual quantitative PCR assay for identification and enumeration of Karlodinium veneficum and Karlodinium armiger combined with a simple and rapid DNA extraction method. J. Appl. Phycol. 30 (4), 2435–2445. Ulrich, R.M., 2010. Detection and quantification of Karenia mikimotoi using real-time nucleic acid sequence-based amplification with internal control RNA (ic-nasba). Harmful Algae 9 (1), 116–122. Vrieling, E.G., Poll, W.H.V.D., Vriezekolk, G., Gieskes, W.W.C., 1997. Immuno-flow cytometric detection of the ichthyotoxic dinoflagellates Gyrodinium aureolum, and Gymnodinium nagasakiense: independence of physiological state. J. Sea Res. 37 (1–2), 91–100. Wong, Y.P., Othman, S., Lau, Y.L., Son, R., Chee, H.Y., 2017. Loop mediated isothermal amplification (LAMP): a versatile technique for detection of microorganisms. J. Appl. Microbiol. 124, 626–643. Xu, C.Y., Huang, M.Z., Du, Q., 2010. Ecological characteristics of important red tide species in Fujian coastal waters. J. Appl. Oceanogr. 29 (3), 434–441. Yan, G., Jun, L., Kangchen, Z., Yiyue, G., Yang, Y., Xiaoyu, Z., et al., 2015. Rapid and visual detection of human enterovirus coxsackie virus a16 by reverse transcription loop-mediated isothermal amplification combined with lateral flow device. Lett. Appl. Microbiol. 61, 531–537. Yang, Z.B., Takayama, H., Matsuoka, K., Hodgkiss, I.J., 2000. Karenia digitata sp. nov. (Gymnodiniales, Dinophyceae), a new harmful algal bloom species from the coastal waters of West Japan and Hong Kong. Phycologia 39 (6), 463–470. Yang, Y., Li, Q., Wang, S., Chen, X., Du, A., 2016. Rapid and sensitive detection of babesia bovis and babesia bigemina by loop-mediated isothermal amplification combined with a lateral flow dipstick. Vet. Parasitol. 219, 71–76. Yao, W.M., Lu, Y.B., 2005. Red tide and red tide plankton in the center and south coastal area of Zhejiang. J. Wenzhou Univ. 26 (5), 59–62. Yao, W.M., Li, C., Gao, J.Z., 2006a. Red tide plankton along the south coastal area in Zhejiang province. Mar. Sci. Bull. 25 (3), 87–91. Yao, W., Li, C., Gao, J., 2006b. Red tide plankton along the south coastal area in Zhejiang province. Mar. Sci. Bull. 25 (3), 87–91. Yao, W.M., Pan, X.D., Hua, D.D., 2007. Preliminary studies on the formation cause of red tide by Karenia mikimotoi in the Zhejiang sea area. J. Hydroecol. 27 (6), 57–58. Yuan, J., Mi, T., Zhen, Y., Yu, Z., 2012. Development of a rapid detection and quantifcation method of Karenia mikimotoi by real-time quantitative PCR. Harmful Algae 17, 83–91. Zhang, F.Y., Ma, L.B., Xu, Z.L., Zheng, J.B., Shi, Y.H., Lu, Y.A., Miao, Y.P., 2009. Sensitive and rapid detection of Karenia mikimotoi (Dinophyceae) by loop-mediated isothermal amplification. Harmful Algae 8 (6), 839–842. Zhang, C.Y., Sun, R., Wang, Y.Y., Chen, G.F., Guo, C.L., Zhou, J., 2019. Comparative detection of Karenia mikimotoi by exponential rolling circle amplification (E-RCA) and double-ligation E-RCA. J. Appl. Phycol. 31, 505–518. Zheng, J.B., Zhang, F.Y., Ma, L.B., Lu, Y.N., Ma, C.Y., 2009. PCR identification of two alien invasive species of Red Tide Algae. Mar. Fish. 31 (3), 325–329. Zhu, P., Huang, H.L., Zhou, C.X., Xu, J.L., Qiao, L.L., Dang, C.Y., Pang, J.H., Gao, W.F., Yan, X.J., 2019. Sensitive and rapid detection of Prymnesium parvum (Haptophyceae) by loop-mediated isothermal amplification combined with a lateral flow dipstick. Aquaculture 505, 199–205. Zhuang, L., Chen, Y., Li, Q., Qu, L., 2001. Sequence determination and analysis of 18S rDNA and internal transcribed spacer regions of red tide – related Creratium furca. Oceanol. Limnol. Sin. 32 (2), 148–154. Zou, Y., Mason, M.G., Wang, Y., Wee, E., Botella, J.R., 2017. Nucleic acid purification from plants, animals and microbes in under 30 seconds. PLoS Biol. 15 (11), 96–104.
Author statement I have made substantial contributions to the conception or design of the work; I have approved the final version to be published; I agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All persons who have made substantial contributions to the work reported in the manuscript, including those who provided editing and writing assistance but who are not authors, are named in the Acknowledgments section of the manuscript and have given their written permission to be named. References Aoki, K., Kameda, T., Yamatogi, T., Ishida, N., Hirae, S., Kawaguchi, M., Syutou, T., 2017. Spatial-temporal variations in bloom of the red tide Dinoflagellate Karenia mikimotoi in Imari Bay, Japan, in 2014: factors controlling horizontal and vertical distribution. Mar. Pollut. Bull. 43, 1–10. Arunrut, N., Seetang-Nun, Y., Phromjai, J., Panphut, W., Kiatpathomchai, W., 2011. Rapid and sensitive detection of Laem-Singh virus by reverse transcription loopmediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 177, 71–74. Brand, L.E., Campbell, L., Bresnan, E., 2012. Karenia: the biology and ecology of a toxic genus. Harmful Algae 14, 156–178. Chen, X.F., Zhou, Q.J., Wang, R.N., Duan, W.J., Miao, L., Chen, J., 2015. Rapid detection of Ulva compressa by loop-mediated isothermal amplification combined with a lateralflow dipstick. Oceanol. Limnol. Sin. 46 (4), 819–827. Daugbjerg, N., Hansen, G., Larsen, J., Moestrup, O., 2000. Phylogeny of some of the major genera of Dinoflagellates based on ultrastructure and partial LSU rDNA sequence data, including the erection of three new genera of unarmoured Dinoflagellates. Phycologia 39 (4), 302–317. Fang, H., Tang, S., 2009. Comparative study of hydrographic conditions for algal bloom formation in the coastal waters of east and west of Hong Kong during 1998. Chin. J. Oceanol. Limnol. 27 (1), 13–21. Godhe, A., Otta, S.K., Rehnstam-Holm, A.S., Karunasagar, I., 2001. Polymerase chain reaction in detection of Gymnodinium mikimotoi and Alexandrium minutum in field samples from Southwest India. Mar. Biotechnol. 3, 152–162. Govindarajan, A.V., Ramachandran, S., Vigil, G.D., Yager, P., Böhringer, K.F.B., 2011. A low cost point-of-care viscous sample preparation device for molecular diagnosis in the developing world; an example of microfluidic origami. Lab. Chip 12 (1), 174–181. Guillou, L., Nézan, E., Cueff, V., Erard-Le, D.E., Cambon-Bonavita, M.A., Gentien, P., Barbier, G., 2002. Genetic diversity and molecular detection of three toxic dinoflagellate genera (Alexandrium, Dinophysis, and Karenia) from french coasts. Protist 153 (3), 223–238. Guo, H., Ding, D.W., Lin, F.A., Guan, C.J., 2015. Characteristics and patterns of red tide in China coastal waters during the last 20a. Adv. Mar. Sci. 33, 547–558. Huang, H.L., Zhu, P., Zhou, C.X., He, S., Yan, X.J., 2017a. The development of loopmediated isothermal amplification combined with lateral flow dipstick for detection of Karlodinium veneficum. Harmful Algae 62, 20–29. Huang, H.L., Zhu, P., Zhou, C.X., Yan, X.J., Zou, Y.X., Lv, P.W., 2017b. Detection of Skeletonema costatum, based on loop-mediated isothermal amplification combined with lateral flow dipstick. Mol. Cell. Probes 36, 36–42. Huang, H.L., Shao, Q.W., Zhu, X.J., Luo, J., Meng, R., Zhou, C.X., Zhu, P., Zhu, Y.F., Yan, X.J., 2019. Distribution of Karlodinium veneficum in the coastal region of Xiangshan Bay in the East China Sea, as detected by a real-time quantitative PCR assay of ribosomal ITS sequence. Harmful Algae 17, 83–91. Kiatpathomchai, W., Jaroenram, W., Arunrut, N., Jitrapakdee, S., Flegel, T.W., 2008. Shrimp taura syndrome virus detection by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 153, 214–217. Lin, F.A., Guan, C.J., Lu, X.W., 2012. Effects of red tide events monitoring, existence questions and suggestions in coastal areas in recent years in China. Mar. Environ. Sci. 29 (1), 148–151. Liu, C.C., Geva, E., Mauk, M., Qiu, X.B., Abrams, W.R., Malamud, D., Curtis, K., Owen, M., Bau, H., 2011. An isothermal amplification reactor with an integrated isolation membrane for point-of-care detection of infectious diseases. Analyst 136 (10), 2069–2076. Liu, G.Y., Ge, K., Song, L., Zang, Y.Y., Wang, N.B., 2015. Distribution of Karenia mikimotoi and rules of its causing red tide. Territ. Nat. Resour. Study 1, 38–41. Long, H., Du, Q., 2005. Primary research on Karenia mikimotoi bloom in Fujian coast. J Fujian Fish 4, 22–26. Mcfall, S.M., Wagner, R.L., Jangam, S.R., Yamada, D.H., Hardie, D., Kelso, D.M., 2015. A simple and rapid DNA extraction method from whole blood for highly sensitive detection and quantitation of HIV-1 proviral DNA by real-time PCR. J. Virol. Methods 214, 37–42. Mori, Y., Kanda, H., Notomi, T., 2013. Loop-mediated isothermal amplification (LAMP): recent progress in research and development. J. Infect. Chemother. 19 (3), 404–411. Naar, J., Bourdelais, A., Tomas, C., Kubanek, J., Whitney, P.L., Flewelling, L., Steidinger,
7
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Molecular method for rapid detection of the red tide dinoflagellate Karenia mikimotoi in the coastal region of Xiangshan Bay, China
T
⁎
Hai-Long Huanga,b, Wei-Fang Gaoc, Peng Zhua,c, , Cheng-Xu Zhoua, Long-Liang Qiaoa, ⁎ Chen-Yang Danga, Jian-Hu Panga, Xiao-Jun Yana, a
Key Laboratory of Applied Marine Biotechnology, Ningbo University, Ningbo 315211, China Key Laboratory of Marine Ecology & Environmental Sciences, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China c Ningbo Institute of Oceanography, Ningbo 315832, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Karenia mikimotoi ITS LAMP-LFD assay Rapid Harmful algae
The species Karenia mikimotoi is a common nearshore red tide alga that can secrete hemolytic exotoxin and ichthyotoxin, which can induce the death of fish and shellfish, causing severe economic losses. In this study, loop-mediated isothermal amplification (LAMP) was employed in combination with the lateral flow dipstick (LFD) visual detection method to establish the LAMP-LFD rapid detection method for K. mikimotoi. The internal transcribed spacer ITS1-5.8S-ITS2 of K. mikimotoi was used as the target sequence and was amplified with specific primers designed in this study. The results indicated that the amplification optimal reaction conditions for LAMP in this paper were for 20 min at 65 °C. Moreover, LAMP had excellent specificity, showing negative results for other common red tide causing algal species. In field samples, we successfully reduced the total time, with only 23 min needed from LAMP amplification to LFD result display, which was shorter than that of conventional PCR. Consequently, LAMP-LFD should be useful for rapid field detection of low-density K. mikimotoi and for the early prevention of red tide induced by such algae.
1. Introduction The species Karenia mikimotoi, which belongs to the order Gymnodiniales, was first identified in Gokasho Bay of Kyoto in 1935 (Oda, 1935) under the name Gymnodinium mikimotoi. G. mikimotoi has been found in different areas around the world. It was finally transferred to a new genus, Karenia G. Hansen and Moestrup, as Karenia mikimotoi by Daugbjerg et al. (2000). This species can secrete hemolytic exotoxins and ichthyotoxins, which lyse fish branchial cells, resulting in the death of fish and shellfish (Naar et al., 2002; Brand et al., 2012; Guo et al., 2015). Karenia mikimotoi has caused tremendous economic losses and has severely impacted the ecological environment. Moreover, K. mikimotoi displays strong adaptability and is extensively distributed. Large-scale red tides caused by K. mikimotoi have been reported in New Zealand (Seki et al., 1995), Japan (Nakamura et al., 1996; Yang et al., 2000; Aoki et al., 2017), India (Godhe et al., 2001; Robin et al., 2013), Ireland (Raine et al., 2001), and the Gulf of Mexico (Steidinger et al., 1998), as well as in Hong Kong (Yang et al., 2000; Fang and Tang,
2009), Zhejiang, and Fujian coastal regions (Yao et al., 2006b; Long and Du, 2005). Since the first K. mikimotoi red tide was observed in Hong Kong in 1980, the frequency and scope of K. mikimotoi-induced red tides have increased notably, and it has become the second most dominant species of coastal red tides in China (Yao et al., 2007; Lin et al., 2012). From 2001 to 2006, a total of 59 K. mikimotoi-induced red tides have occurred, involving a total area of 25,920 km2. In addition, K. mikimotoi often occurs in red tide communities in Fujian coastal areas. Moreover, K. mikimotoi occasionally forms diphasic red tides with Prorocentrum donghaiense (Yao and Lu, 2005; Yao et al., 2006a, 2006b; Liu et al., 2015). From 2001 to 2008, 17 K. mikimotoi-induced red tides occurred in Fujian coastal waters. Among them, K. mikimotoi was the second most dominant species, primarily forming red tides with P. donghaiense; K. mikimotoi accounted for 9.2% of the total red tides observed (Xu et al., 2010). The optimal way to prevent K. mikimotoi-induced red tides is to detect and provide an early warning of the alga before large-scale proliferation occurs. At present, traditional morphological
Abbreviations: LAMP, loop mediated isothermal amplification; LFD, lateral flow dipstick; ITS, internal transcribed spacer; PCR, polymerase chain reaction; AGE, agarose gel electrophoresis; FIP, forward inner primer; BIP, backward inner primer; FITC, fluorescein isothiocyanate; POCT, point of care testing ⁎ Corresponding authors at: Key Laboratory of Applied Marine Biotechnology, Ningbo University, Ningbo 315211, China. E-mail addresses: [email protected] (H.-L. Huang), [email protected] (W.-F. Gao), [email protected] (P. Zhu), [email protected] (C.-X. Zhou), [email protected] (X.-J. Yan). https://doi.org/10.1016/j.mimet.2019.105801 Received 29 June 2019; Received in revised form 27 November 2019; Accepted 2 December 2019 Available online 04 December 2019 0167-7012/ © 2019 Published by Elsevier B.V.
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
identification remains the major method for identification of K. mikimotoi. However, many microalgae are similar in morphology, which makes them difficult to distinguish. In addition, such methods depend greatly on diagnostic personnel with algal taxonomy expertise, and are time consuming and labor intensive. They cannot be applied to a rapid analysis of large sample numbers. Consequently, there is an urgent need to establish a rapid method for the daily monitoring and early warning of K. mikimotoi. Molecular, nucleic acid amplification-based detection methods are associated with the advantages of high sensitivity, excellent specificity and short detection time. Among these, molecular methods, such as Polymerase Chain Reaction (PCR) or those employing molecular probes as the major reaction principle, have been applied to detect and identify microalgal species rapidly (Yuan et al., 2012; Chen et al., 2015; Park et al., 2016; Toldrà et al., 2018; Huang et al., 2019). PCR-based assays are among the most promising and attractive new methods compared to the traditional methods. However, PCR needs to be done in a laboratory that is usually distant from the location where samples are taken. This restricts the application of PCR in point-of-care testing (POCT). Loop-mediated isothermal amplification (LAMP) is a nucleic acid amplification-based detection method developed by Notomi et al. (2000) that requires only a simple water bath or heater and has no strict requirements regarding the technical background of the operator (Tanner and Evans, 2014). Accordingly, this method has become popular in the field of bacteria, viruses, fungi, parasites and algae (Niemz et al., 2011; Mori et al., 2013; Chen et al., 2015; Wong et al., 2017; Huang et al., 2017a, 2017b; Zhu et al., 2019). However, the traditional LAMP result display shows some drawbacks. The detection of LAMP products is initially observed by agarose gel electrophoresis (AGE), followed by either adding dyes or calcein (fluorescent detection reagent). Some dyes, such as SYBR green, affect LAMP amplification reactions (Yang et al., 2016). Additionally, there is always the possibility that a sample may be somewhat ambiguous to the naked eye when the concentration of products is low (Yan et al., 2015). In order to compensate for the disadvantages of LAMP in terms of its result display, this study has established a LAMP-LFD assay. The lateral flow dipstick (LFD), also known as lateral flow immunochromatographic assay, can form colorful detection lines on the strip and thus easily display the amplification results (Kiatpathomchai et al., 2008; Arunrut et al., 2011). Moreover, the probe can effectively avoid a false positive induced by conventional nucleic acid amplification methods, leading to more specific detection results. In this study, we designed a set of primers applicable for LAMP amplification based on the internal transcribed spacer (ITS1-5.8S-ITS2) of K. mikimotoi. This enabled a rapid and simple LAMP-LFD detection method for the harmful red tide alga, K. mikimotoi, to be established.
Table 1 Algal species for LAMP-LFD assay. Species
Algal isolates
Source
Karenia mikimotoi Prorocentrum micans Heterosigma akashiwo Prorocentrum donghaiense Karlodinium veneficum Alexandrium tamarense Prorocentrum minimum Skeletonema costatum s.s. (sensu stricto) Karenia brevis
NMBjah052 NMBjah041 NMBRah03-2 NMBjah045 NMB jah047-1 NMBjah048 NMBjah049 NMBguh004-2
Dong tou Qingdao Marine research South tajima Dong tou Dong tou Hong Kong Yu mountain Xia men
GY-DH36
Shanghai Guangyu Biological Technology Co., Ltd
centrifugation at 12,000× g for 10 min at 4 °C, and the supernatant was removed. Then genomic DNAs of all algal species were prepared in accordance with the extraction steps described in the instructions of a Takara genomic DNA extraction kit (Takara Biotechnology Co., Ltd., Dalian, China). The obtained genomic DNA was quantified using a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, USA), then preserved at −20 °C until use. 2.3. ITS cloning and sequencing The ITS (ITS1 and ITS2, including the 5.8S rDNA) region of K. mikimotoi was amplified by conventional PCR with the specific primers designed by Zhuang et al. (2001) and synthesized commercially (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd., Shanghai, China): LH2: 5’-AGGTGAACCTGCGGAAGGATC-3′; Dlam:5’-CCTGCAGTCGACA(TG)ATGCTTAA(AG)TTCAGC(AG)GG-3′. Karenia mikimotoi DNA obtained from culture was used as the template. One reaction system consisted of 25 μL of Premix×Taq, 1 μL both of all primers (final concentration 400 nM each), and 72 ng of DNA template with sterile water to a final volume of 50 μL. The reaction was conducted in an Eppendorf Mastercycler gradient PCR (Eppendorf China Ltd.) subjecting the samples to 94 °C for 5 min, followed by 35 cycles of 94 °C for 45 s, 57 °C for 45 s, and 72 °C for 60 s and then final extension at 72 °C for 7 min. The amplification products were separated using 1% agarose gel electrophoresis (AGE) (1%), and images were taken by using the gel imaging system (Bio-Rad Laboratories, Shanghai, China) for results observation. The PCR products (500 bp) were purified by quick gel extraction using a Takara MiniBEST Agarose kit. The collected products were ligated to the Takara PMD 19-T vector, transferred into Takara E. coli Competent Cells DH5α for cultivation (37 °C, 16–18 h); all of the positive clones were screened by colony PCR and sequenced by Sangon Bioengineering Co., Ltd. (Shanghai, China).
2. Materials and methods 2.4. LAMP primer design 2.1. Algae culture The sequence of the cloned PCR product (Section 2.3) was used as the target sequence, and four groups of primers were designed using the Primer Explorer V4 software (http://primerexplorer.jp/lamp) in accordance with the LAMP primer design principle. Six primers were included in each group: the outer primers (F3 and B3), inner primers (FIP and BIP), and loop primers (LF and LB). The optimal amplifier group was obtained through LAMP amplification screening and is presented in Table 2. Km-11-FIP was labeled with biotin, whereas FITC (fluorescein isothiocyanate) was added onto Km-11-LF. The relative positions of primers in the sequence are displayed in Fig. 1. The primers were synthesized by Sangon Bioengineering Co., Ltd.
Nine common red tide algae species for LAMP specificity analysis were selected, K. mikimotoi, Alexandrium tamarense, Prorocentrum minimum, Prorocentrum donghaiense, Prorocentrum micans, Skeletonema costatum s.s. (sensu stricto), Heterosigma akashiwo, Karlodinium veneficum and Karenia brevis (Table 1). These algal species were provided by the Microalgae Collection at Ningbo University and cultured in the BG 11 liquid medium under the following conditions: temperature, 25 °C; illumination intensity, 40 μmol·m−2·s−1; light-dark cycle, L:D = 12 h:12 h; shaking 1–2 times daily (Huang et al., 2017a, 2017b). All of the cultures were grown to exponential phase under these culture conditions before being used in the experiments.
2.5. Optimization of LAMP reaction conditions and construction of LAMPLFD
2.2. Preparation of genomic DNA
Genomic DNA of K. mikimotoi was used as the template for the
Algal cells in the exponential growth phase were collected by 2
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
Table 2 Designed primers and DNA probe of K. mikimotoi used in LAMP-LFD assay. Primer
Type
length
Sequence (5′-3′)
Km-11-F3 Km-11-B3 Km-11-FIPa Km-11-BIP Km-11-LFb Km-11-LB
Forward-outer primer Backward-outer primer Forward-inner primer Backward-inner primer Loop-forward primer Loop-backward primer
18 20 39 41 17 19
AATCGCAGCCGAGTGGAT AGAGTGCAATGCGAGTTCAG CTTGCGCCCAAGAGCTTTTGC-CTGGTTGCTATGGCCCCT CGACGGATATCTTGGCTCGGG-ACGGAGTTCTGCAATTCACA CTTCAGCGGTGCCCTCA CCAATGAAGGGCGCAGCGA
a b
Km-11-FIP-bio was 5′-biotinylated at the 5’end. Km-11-LF-fitc was labeled by fluorescein isothiocyanate (FITC) at the 5’end.
2.7. Specificity To determine the specificity of LAMP-LFD, another eight common red tide algal species were selected: A. tamarense, P. micans, P. donghaiense, P. minimum, S. costatum, H. akashiwo, K. veneficum and K. brevis. Genomic DNAs (at least 72 ng per reaction) of nine algal isolates including K. mikimotoi were amplified using the constructed LAMP-LFD method and conventional PCR. LAMP-LFD products were displayed by real-time PCR (65 °C, 50 min) and LFD detection, whereas the PCR reaction products were analyzed by 1% AGE. 2.8. Sensitivity
Fig. 1. Design diagram for primers of K. mikimotoi used in LAMP-LFD assay.
The total genomic DNA (72 ng·μL−1) was extracted from K. mikimotoi cells. Then, 10-fold gradient diluted gDNA (7.2 × 101 ng·μL−1–7.2 × 10−6 ng·μL−1) was used as templates for the PCR, LAMP, and LAMP-LFD assays to determine the analytical sensitivity. Subsequently, the LAMP amplification products were analyzed by the quantitative PCR thermal cycler and by LFD as previously described. The same 10-fold serial dilutions of total genomic DNA from K. mikimotoi were also used as templates for conventional PCR with the LAMP primers (Km-11-F3 and Km-11-B3). The products were then observed by real-time PCR, LFD strip, and 1% AGE.
optimization of LAMP-LFD reaction conditions. The LAMP assay was carried out with a reaction mixture that consisted of 40 pmol of each inner primer (FIP and BIP), 5 pmol of each outer primer (F3 and B3), 20 pmol of each loop primer (LF and LB), 10 μL of buffer BQE2 (Beijing Boao Biological Company, Beijing, China), and 1 μL (72 ng/μL) of DNA template that was diluted with sterile water to 25 μL. The negative control contained distilled water instead of DNA template. The DNA reaction kit used for the LAMP method in this experiment was purchased from Beijing Boao Biological Company, Beijing, China. To determine the optimal temperature for LAMP, the reactions were conducted using the selected primers at three different temperatures (61 °C, 63 °C, and 65 °C). Real-time amplification by the LAMP assay was monitored based on the fluorescence ratio using the quantitative PCR thermal cycler (Roche Life Sciences, Shanghai, China). The reaction time was 50 min, and the optimal reaction temperature was identified based on the amplification effect (Results appeared in the shortest time). To simplify the detection of LAMP products, we established a probebased LFD (Lateral-Flow Dipstick) method and a commercially available LFD (Milenia® GenLine HybriDetect Kit, Milenia Biotec GmbH, Giessen, Germany) was applied. The optimized LAMP reaction system was adopted for amplification, and 5 μL of reaction product was added to 50 μL of buffer. The LFD strip was inserted vertically into the mixture for 3 min, after which the detection results were visualized as lines on the strips.
2.9. Applicability of the LAMP-LFD assay A total of ten surface water samples were collected in the coastal region off the mouth of the Xiangshan Bay in the East China Sea by research vehicle“Runjiang1”in July 2016. The sampling locations were labeled NP1, NP3, NP4, NP5, NP6, NP7, NP8, NP9, NA1, and NA2 and are shown in Fig. 2. Surface water samples (500 mL) for each station were collected in polyethylene terephthalate (PET) bottles. Additionally, 200 mL of filtered water (0.45 μm cellulose acetate membrane; Millipore, USA) was used for genomic DNA extraction as described in Section 2.2. Appropriate amounts (1 × 105 cells/mL) of the each algal isolate listed in Section 2.1 were collected and mixed, after which the DNA was extracted. 75 ng of gDNA from each algal species mixed, together with K. mikimotoi DNA was used. K. mikimotoi was detected using the designed LAMP-LFD method (the total time was limited to 23 min) and PCR, with the aforementioned DNA samples and reaction conditions as the template.
2.6. PCR detection
3. Results
The LAMP outer primers designed in Section 2.4 (Km-11-F3 and Km-11-B3) were used as the PCR primers for amplification of K. mikimotoi template DNA. The reaction system consisted of 25 μL of Premix×Taq, 1 μL of all primers (final concentration 400 nM each), and 1 μL (72 ng/μL) of DNA template diluted with sterile water to 50 μL. The reaction conditions were as follows: 94 °C for 5 min followed by 35 cycles of 45 s at 94 °C, 45 s at 57 °C, and 60 s at 72 °C and then final extension at 72 °C for 7 min. The amplification products (227 bp) were separated using 1% AGE.
3.1. Establishment of LAMP reaction conditions High concentrations of K. mikimotoi gDNA (7.2 × 101 ng·μL−1) were used as the template for LAMP amplification at three different reaction temperatures of 61 °C, 63 °C, and 65 °C. Typical sigmoidal amplification curves were observed at each temperature when fluorescent LAMP was performed over 50 min (Fig. 3). As shown in the figure, amplification started at about 13 min after the start of the reaction, with the most rapid amplification observed at 65 °C, followed by 3
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
K. veneficum and A. tamarense (Fig. 4c). Taken together, these findings indicate that under the conditions tested, LAMP and LAMP-LFD had better specificity than PCR for detecting K. mikimotoi. 3.3. Sensitivity test To test the sensitivity of LAMP-LFD, 10-fold gradient diluted gDNA was used as the template for LAMP, LAMP-LFD, and PCR reactions (Fig. 5). Both LAMP and LAMP-LFD reactions could detect the lowest DNA concentration of 7.2 × 10−2 ng·μL−1. Although faint, a distinct band can be seen using the highest dilution (7.2 × 10−2 ng·μL−1) in PCR (Fig. 5c). Overall, the detection limit for conventional PCR with the LAMP primers (Km-11-F3 and Km-11-B3) was similar to the sensitivity achieved by LAMP and LAMP-LFD for detection of K. mikimotoi. 3.4. Analysis of simulated and field samples Ten groups of field samples and a group of mixed algal genomic DNA were used to evaluate the performance of the LAMP-LFD assay. All samples were used as templates for LAMP-LFD and PCR reactions, and the results of the reactions are displayed in Fig. 6. Overall, 10 groups of field samples showed negative results on LFD strips detection, whereas the mixed algal solution displayed positive amplification, and the negative control group in which sterile water was used as the template showed no amplification. The PCR results were negative in the field sample group, whereas faint amplified bands could be seen in the mixed algae solution group, the displayed positive result was not obvious. Although no naturally positive samples were available for inclusion and evaluation, LAMP-LFD was better than PCR for displaying the results using simulated samples.
Fig. 2. Geographic location of the field sampling sites (NP1, NP3, NP4, NP5, NP6, NP7, NP8, NP9, NA1, and NA2).
4. Discussion Among toxic and harmful algal species, K. mikimotoi is widely distributed, and is a common red tide dinoflagellate in the coastal regions of China (Liu et al., 2015). Zheng et al. (2009) developed a PCR method for detecting K. mikimotoi by designing specific PCR primers amplifying the ribosomal ITS. The authors suggested that this method could be successfully applied to detect K. mikimotoi in samples, where other common algal species are present, because no cross-reaction was observed with other algal species. Guillou et al. (2002) determined the partial sequence of the hypervariable regions D1 and D2 on the K. mikimotoi 28S rDNA and targeted K. mikimotoi using a semi-nested PCR technique. Yuan et al. (2012) treated the K. mikimotoi ITS as the target and designed highly specific primers and TaqMan probes to develop a real-time PCR detection assay that showed high sensitivity and reliability. Vrieling et al. (1997) detected K. mikimotoi by flow cytometry, whereas Ulrich (2010) developed a method for the detection and quantification of K. mikimotoi using real-time nucleic acid sequence-based amplification with internal control RNA (IC-NASBA). These methods have achieved accurate detection of K. mikimotoi through molecular methods. However, most of these methods require a long processing time and the availability of expensive equipment. As a result, these methods are limited for large scale applications such as rapid field detection of K. mikimotoi. Zhang et al. (2009) designed specific primers using K. mikimotoi ITS2 as the target sequence and established the LAMP detection system of K. mikimotoi, which had better sensitivity and specificity than PCR. However, their experiments adopted the traditional LAMP result display method based on LAMP product detection, by including AGE, observation of the white precipitation of magnesium pyrophosphate generated in the reaction, and addition of SYBR Green I into the reaction tube to observe the color change. Among these methods, AGE must be evaluated using a gel imaging system and is subject to aerosol pollution. In addition, precipitation of magnesium pyrophosphate and color changes in the reaction can also occur. Accordingly, this method
Fig. 3. Amplification of LAMP at different temperatures (61 °C, 63 °C, and 65 °C).
63 °C and 61 °C, with extremely small differences between each one. In addition, the fluorescence values of the three temperatures reached a plateau phase after approximately 20 min. These findings indicated that an optimal amplification efficiency could be achieved at 65 °C; therefore, 65 °C and 20 min were selected as the optimal reaction temperature and time, respectively. 3.2. Specificity test To test the specificity of LAMP-LFD, K. mikimotoi and eight other common red tide algal species were tested using the established LAMP, LAMP-LFD, and PCR methods. As shown in Fig. 4, both LAMP and LAMP-LFD reactions were positive for K. mikimotoi only, whereas the remaining eight algal species were negative. Additionally, a control group in which sterile water was used as the template produced no amplification. In comparison, PCR of K. mikimotoi produced a bright and discrete band on AGE, but faint (presumably non-specific) amplicons of variable size were obtained with S. costatum, H. akashiwo, 4
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
Fig. 4. Comparison of specificity of LAMP (a), LAMP-LFD (b), and PCR (c) for detection of K. mikimotoi. Amplification was performed at 65 °C for 30 min. M: DL2000 DNA Marker. NC, negative control; No gDNA was used as the template. gDNA extracted from A. tamarense, P. micans, P. donghaiense, P. minimum, S. costatum s.s., H. akashiwo, K. mikimotoi, K. veneficum and K. brevis used as the template, respectively.
suitable for implementation in field detection of K. mikimotoi. However, the DNA extraction step restricts the application of the LAMP-LFD method in point-of-care testing (POCT). There have been some reports of the rapid extraction of nucleic acid by membrane methods (Oblath et al., 2013; Mcfall et al., 2015; Govindarajan et al., 2011; Liu et al., 2011; Zou et al., 2017). These new methods directly transfer nucleic acid from the membrane to the amplification system while omitting the steps of nucleic acid elution to simplify the purification of nucleic acid. However, further study is needed to determine how to apply cellulose membranes to nucleic acid extraction in a way to take full advantage of its materials, facilitate the operation, and smoothly connect the extraction with nucleic acid amplification.
is prone to extraneous or non-specific results and interpretations because of unapparent AGE bands or color changes and is therefore not sensitive enough to be applied to real-time field monitoring. Thus, Zhang et al. (2019) established rolling circle amplification (E-RCA) and double-ligation E-RCA (dlE-RCA) for the detection of K. mikimotoi. Similar to LAMP, E-RCA and dlE-RCA are relatively simple detection protocols that require no special instrumentation. In this study, LAMP was combined with LFD to detect K. mikimotoi. As shown in these experiments, LAMP results can be directly observed with LFD instead of using a PCR instrument. Therefore, LAMP results can be directly observed with LFD instead of using a PCR instrument. When compared with traditional PCR, E-RCA, and dlE-RCA, the LAMPLFD method does not require AGE for displaying the results, which saves time especially in the light of the need for fast, real-time detection. Moreover, LFD strip results are visible, rapid, specific, and convenient. As a result, when compared with the traditional LAMP, E-RCA, and dlE-RCA methods, the introduction of a LFD strip has led to higher accuracy and reliability of results while avoiding errors caused by the naked eye. In addition, the introduction of specific probes can also reduce the problem of false positives caused by fluorescent dye (Schnetzinger et al., 2013). The LAMP-LFD method established from this research can distinguish K. mikimotoi from the common red tide algal species. Notably, it shows extremely high specificity relative to PCR. In particular, LAMPLFD could detect K. mikimotoi genomic DNA at the lowest level of 7.2 × 10−2 ng·μL−1. With regard to time, LAMP amplification can be accomplished in 20 min, and the results can be observed 3 min after inserting the strip into a buffer containing the respective products. Therefore, the LAMP-LFD detection method for K. mikimotoi established in this paper can serve as a rapid detection means and should be
5. Conclusions In this study, we established a LAMP-LFD method for the rapid detection of K. mikimotoi. In addition, it had simple operation, a short detection time, and easily accessible results. Moreover, the developed method is free from dependence on experimental environments and experienced technical personnel. Therefore, applying this method to the field detection of K. mikimotoi should be useful for the early warning and prevention of red tides induced by this alga. Overall, LAMP-LFD technology has the potential to be promoted and applied on a large scale as a novel rapid field detection method of K. mikimotoi.
Declaration of competing interest There is no conflict of interest. 5
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
Fig. 5. Comparison of sensitivity of LAMP (a), LAMP-LFD (b), and PCR (c) for detection of K. mikimotoi Amplification was performed at 65 °C for 30 min. M: DL2000 DNA Marker. NC, negative control; No gDNA was used as the template. K. mikimotoi gDNA at concentrations of 7.8 × 101, 7.8 × 100, 7.8 × 10−1, 7.8 × 10−2, 7.8 × 10−3, 7.8 × 10−4, 7.8 × 10−5, and 7.8 × 10−6 ng·μL−1 as the template.
Fig. 6. Comparison of LAMP-LFD (a) and PCR (b) for detection of field samples M: DL2000 DNA Marker. NC, negative control; 1–11 gDNA extracted from NP1, NP3, NP4, NP5, NP6, NP7, NP8, NP9, NA1, NA2, and mixed algae as the template, respectively.
Acknowledgments
Science and Technology (2015GA701001), the Earmarked Fund for Modern Agro-industry Technology Research System, China (CARS-49), the Scientific Research Foundation of Graduate School of Ningbo University, the Li Dak Sum Yip Yio Chin Kenneth Li Marine Biopharmaceutical Development Fund, the National 111 Project of China; and partly supported by Laboratory of Marine Ecosystem and Biogeochemistry, Second Institute of Oceanography, China
This work was supported financially by the National Key Research and Development Program of China (2018YFD0900702), Zhejiang Provincial Public Welfare Technology Program of China (2017C33133), Ningbo Science and Technology Research Projects of China (2017C110003), China Spark Program of the National Ministry of 6
Journal of Microbiological Methods 168 (2020) 105801
H.-L. Huang, et al.
(LMEB201705); the K.C. Wang Magna Fund in Ningbo University (SS). We would like to thank LetPub (www.letpub.com) for providing linguistic assistance during the preparation of this manuscript.
K., Lancaster, J., Baden, D.G., 2002. A competitive ELISA to detect breve toxins from Karenia brevis (formerly Gymnodinium breve) in seawater, shellfish, and mammalian body fluid. Environ. Health Perspect. 110 (2), 179–185. Nakamura, Y., Suzuki, S., Hiromi, J., 1996. Development and collapse of a Gymnodinium mikimotoi red tide in the Seto Inland Sea. Aquat. Microb. Ecol. 10, 131–137. Niemz, A., Ferguson, T.M., Boyle, D.S., 2011. Point-of-care nucleic acid testing for infectious diseases. Trends Biotechnol. 29 (5), 240–250. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, 63. Oblath, E.A., Henley, W.H., Alarie, J.P., Ramsey, J.M., 2013. A microfluidic chip integrating DNA extraction and real-time PCR for the detection of bacteria in saliva. Lab Chip 13 (7), 1325–1332. Oda, M., 1935. The red tide of Gymnodinium mikimotoi sp. (MS) and the effect of altering copper sulphate to prevent the growth of it. Dobutsugaku Zasshi Zoolol. Soc. Jpn. 47 (555), 35–48. Park, T.G., Kim, J.J., Kim, W.J., Won, K.M., 2016. Development of real-time RT-PCR for detecting viable Cochlodinium polykrikoides, (Dinophyceae) cysts in sediment. Harmful Algae 60, 36–44. Raine, R., O’Boyle, S., O’Higgins, T., White, M., Patching, J., Cahill, B., McMahon, T., 2001. A satellite and field portrait of a Karenia mikimotoi bloom off the south coast of Ireland, August 1998. Hydrobiologia 465, 187–193. Robin, R.S., Kanuri, V.V., Muduli, P.R., Mishra, R.K., Kumar, C.S., 2013. Dinoflagellate bloom of Karenia mikimotoi along the southeast Arabian Sea, bordering western India. J. Ecosyst. 20, 1–11. Schnetzinger, F., Pan, Y., Nocker, A., 2013. Use of propidium monoazide and increased amplicon length reduce false-positive signals in quantitative PCR for bioburden analysis. Appl. Microbiol. Biotechnol. 97 (5), 2153–2162. Seki, T., Satake, M., Mackenzie, L., Kaspar, H.F., Yasumoto, T., 1995. Gymnodimine, a new marine toxin of unprecedented structure isolated from New-Zealand oysters and the Dinoflagellate, Gymnodinium sp. Tetrahedron Lett. 36, 7093–7096. Steidinger, K.A., Tomas, C., Vargo, G.A., Tester, P.A., 1998. Bloom dynamics and physiology of Gymnodinium breve with emphasis on the Gulf of Mexico. NATO ASI Ser. G Ecol. Sci. 41, 133–153. Tanner, N.A., Evans, T.C., 2014. Loop-mediated isothermal amplification for detection of nucleic acids. Curr. Protoc. Mol. Biol. 105, 1–14. Toldrà, A., Andree, K.B., Fernández-Tejedor, M., Diogène, J., Campàs, M., 2018. Dual quantitative PCR assay for identification and enumeration of Karlodinium veneficum and Karlodinium armiger combined with a simple and rapid DNA extraction method. J. Appl. Phycol. 30 (4), 2435–2445. Ulrich, R.M., 2010. Detection and quantification of Karenia mikimotoi using real-time nucleic acid sequence-based amplification with internal control RNA (ic-nasba). Harmful Algae 9 (1), 116–122. Vrieling, E.G., Poll, W.H.V.D., Vriezekolk, G., Gieskes, W.W.C., 1997. Immuno-flow cytometric detection of the ichthyotoxic dinoflagellates Gyrodinium aureolum, and Gymnodinium nagasakiense: independence of physiological state. J. Sea Res. 37 (1–2), 91–100. Wong, Y.P., Othman, S., Lau, Y.L., Son, R., Chee, H.Y., 2017. Loop mediated isothermal amplification (LAMP): a versatile technique for detection of microorganisms. J. Appl. Microbiol. 124, 626–643. Xu, C.Y., Huang, M.Z., Du, Q., 2010. Ecological characteristics of important red tide species in Fujian coastal waters. J. Appl. Oceanogr. 29 (3), 434–441. Yan, G., Jun, L., Kangchen, Z., Yiyue, G., Yang, Y., Xiaoyu, Z., et al., 2015. Rapid and visual detection of human enterovirus coxsackie virus a16 by reverse transcription loop-mediated isothermal amplification combined with lateral flow device. Lett. Appl. Microbiol. 61, 531–537. Yang, Z.B., Takayama, H., Matsuoka, K., Hodgkiss, I.J., 2000. Karenia digitata sp. nov. (Gymnodiniales, Dinophyceae), a new harmful algal bloom species from the coastal waters of West Japan and Hong Kong. Phycologia 39 (6), 463–470. Yang, Y., Li, Q., Wang, S., Chen, X., Du, A., 2016. Rapid and sensitive detection of babesia bovis and babesia bigemina by loop-mediated isothermal amplification combined with a lateral flow dipstick. Vet. Parasitol. 219, 71–76. Yao, W.M., Lu, Y.B., 2005. Red tide and red tide plankton in the center and south coastal area of Zhejiang. J. Wenzhou Univ. 26 (5), 59–62. Yao, W.M., Li, C., Gao, J.Z., 2006a. Red tide plankton along the south coastal area in Zhejiang province. Mar. Sci. Bull. 25 (3), 87–91. Yao, W., Li, C., Gao, J., 2006b. Red tide plankton along the south coastal area in Zhejiang province. Mar. Sci. Bull. 25 (3), 87–91. Yao, W.M., Pan, X.D., Hua, D.D., 2007. Preliminary studies on the formation cause of red tide by Karenia mikimotoi in the Zhejiang sea area. J. Hydroecol. 27 (6), 57–58. Yuan, J., Mi, T., Zhen, Y., Yu, Z., 2012. Development of a rapid detection and quantifcation method of Karenia mikimotoi by real-time quantitative PCR. Harmful Algae 17, 83–91. Zhang, F.Y., Ma, L.B., Xu, Z.L., Zheng, J.B., Shi, Y.H., Lu, Y.A., Miao, Y.P., 2009. Sensitive and rapid detection of Karenia mikimotoi (Dinophyceae) by loop-mediated isothermal amplification. Harmful Algae 8 (6), 839–842. Zhang, C.Y., Sun, R., Wang, Y.Y., Chen, G.F., Guo, C.L., Zhou, J., 2019. Comparative detection of Karenia mikimotoi by exponential rolling circle amplification (E-RCA) and double-ligation E-RCA. J. Appl. Phycol. 31, 505–518. Zheng, J.B., Zhang, F.Y., Ma, L.B., Lu, Y.N., Ma, C.Y., 2009. PCR identification of two alien invasive species of Red Tide Algae. Mar. Fish. 31 (3), 325–329. Zhu, P., Huang, H.L., Zhou, C.X., Xu, J.L., Qiao, L.L., Dang, C.Y., Pang, J.H., Gao, W.F., Yan, X.J., 2019. Sensitive and rapid detection of Prymnesium parvum (Haptophyceae) by loop-mediated isothermal amplification combined with a lateral flow dipstick. Aquaculture 505, 199–205. Zhuang, L., Chen, Y., Li, Q., Qu, L., 2001. Sequence determination and analysis of 18S rDNA and internal transcribed spacer regions of red tide – related Creratium furca. Oceanol. Limnol. Sin. 32 (2), 148–154. Zou, Y., Mason, M.G., Wang, Y., Wee, E., Botella, J.R., 2017. Nucleic acid purification from plants, animals and microbes in under 30 seconds. PLoS Biol. 15 (11), 96–104.
Author statement I have made substantial contributions to the conception or design of the work; I have approved the final version to be published; I agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All persons who have made substantial contributions to the work reported in the manuscript, including those who provided editing and writing assistance but who are not authors, are named in the Acknowledgments section of the manuscript and have given their written permission to be named. References Aoki, K., Kameda, T., Yamatogi, T., Ishida, N., Hirae, S., Kawaguchi, M., Syutou, T., 2017. Spatial-temporal variations in bloom of the red tide Dinoflagellate Karenia mikimotoi in Imari Bay, Japan, in 2014: factors controlling horizontal and vertical distribution. Mar. Pollut. Bull. 43, 1–10. Arunrut, N., Seetang-Nun, Y., Phromjai, J., Panphut, W., Kiatpathomchai, W., 2011. Rapid and sensitive detection of Laem-Singh virus by reverse transcription loopmediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 177, 71–74. Brand, L.E., Campbell, L., Bresnan, E., 2012. Karenia: the biology and ecology of a toxic genus. Harmful Algae 14, 156–178. Chen, X.F., Zhou, Q.J., Wang, R.N., Duan, W.J., Miao, L., Chen, J., 2015. Rapid detection of Ulva compressa by loop-mediated isothermal amplification combined with a lateralflow dipstick. Oceanol. Limnol. Sin. 46 (4), 819–827. Daugbjerg, N., Hansen, G., Larsen, J., Moestrup, O., 2000. Phylogeny of some of the major genera of Dinoflagellates based on ultrastructure and partial LSU rDNA sequence data, including the erection of three new genera of unarmoured Dinoflagellates. Phycologia 39 (4), 302–317. Fang, H., Tang, S., 2009. Comparative study of hydrographic conditions for algal bloom formation in the coastal waters of east and west of Hong Kong during 1998. Chin. J. Oceanol. Limnol. 27 (1), 13–21. Godhe, A., Otta, S.K., Rehnstam-Holm, A.S., Karunasagar, I., 2001. Polymerase chain reaction in detection of Gymnodinium mikimotoi and Alexandrium minutum in field samples from Southwest India. Mar. Biotechnol. 3, 152–162. Govindarajan, A.V., Ramachandran, S., Vigil, G.D., Yager, P., Böhringer, K.F.B., 2011. A low cost point-of-care viscous sample preparation device for molecular diagnosis in the developing world; an example of microfluidic origami. Lab. Chip 12 (1), 174–181. Guillou, L., Nézan, E., Cueff, V., Erard-Le, D.E., Cambon-Bonavita, M.A., Gentien, P., Barbier, G., 2002. Genetic diversity and molecular detection of three toxic dinoflagellate genera (Alexandrium, Dinophysis, and Karenia) from french coasts. Protist 153 (3), 223–238. Guo, H., Ding, D.W., Lin, F.A., Guan, C.J., 2015. Characteristics and patterns of red tide in China coastal waters during the last 20a. Adv. Mar. Sci. 33, 547–558. Huang, H.L., Zhu, P., Zhou, C.X., He, S., Yan, X.J., 2017a. The development of loopmediated isothermal amplification combined with lateral flow dipstick for detection of Karlodinium veneficum. Harmful Algae 62, 20–29. Huang, H.L., Zhu, P., Zhou, C.X., Yan, X.J., Zou, Y.X., Lv, P.W., 2017b. Detection of Skeletonema costatum, based on loop-mediated isothermal amplification combined with lateral flow dipstick. Mol. Cell. Probes 36, 36–42. Huang, H.L., Shao, Q.W., Zhu, X.J., Luo, J., Meng, R., Zhou, C.X., Zhu, P., Zhu, Y.F., Yan, X.J., 2019. Distribution of Karlodinium veneficum in the coastal region of Xiangshan Bay in the East China Sea, as detected by a real-time quantitative PCR assay of ribosomal ITS sequence. Harmful Algae 17, 83–91. Kiatpathomchai, W., Jaroenram, W., Arunrut, N., Jitrapakdee, S., Flegel, T.W., 2008. Shrimp taura syndrome virus detection by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 153, 214–217. Lin, F.A., Guan, C.J., Lu, X.W., 2012. Effects of red tide events monitoring, existence questions and suggestions in coastal areas in recent years in China. Mar. Environ. Sci. 29 (1), 148–151. Liu, C.C., Geva, E., Mauk, M., Qiu, X.B., Abrams, W.R., Malamud, D., Curtis, K., Owen, M., Bau, H., 2011. An isothermal amplification reactor with an integrated isolation membrane for point-of-care detection of infectious diseases. Analyst 136 (10), 2069–2076. Liu, G.Y., Ge, K., Song, L., Zang, Y.Y., Wang, N.B., 2015. Distribution of Karenia mikimotoi and rules of its causing red tide. Territ. Nat. Resour. Study 1, 38–41. Long, H., Du, Q., 2005. Primary research on Karenia mikimotoi bloom in Fujian coast. J Fujian Fish 4, 22–26. Mcfall, S.M., Wagner, R.L., Jangam, S.R., Yamada, D.H., Hardie, D., Kelso, D.M., 2015. A simple and rapid DNA extraction method from whole blood for highly sensitive detection and quantitation of HIV-1 proviral DNA by real-time PCR. J. Virol. Methods 214, 37–42. Mori, Y., Kanda, H., Notomi, T., 2013. Loop-mediated isothermal amplification (LAMP): recent progress in research and development. J. Infect. Chemother. 19 (3), 404–411. Naar, J., Bourdelais, A., Tomas, C., Kubanek, J., Whitney, P.L., Flewelling, L., Steidinger,
7