Molecular phylogenetics and evolutionary history of the neotropical Satyrine Subtribe Euptychiina (Nymphalidae: Satyrinae)

MOLECULAR PHYLOGENETICS AND EVOLUTION Molecular Phylogenetics and Evolution 34 (2005) 67–80 www.elsevier.com/locate/ympev

Molecular phylogenetics and evolutionary history of the neotropical Satyrine Subtribe Euptychiina (Nymphalidae: Satyrinae) Debra Murraya,*, Dorothy Pashley Prowellb a

150S Dirac Science Library, School of Computational Science and Information Technology, Florida State University Tallahassee, FL 32306-4120, USA b Department of Entomology, Louisiana State University, USA Received 29 December 2003; revised 17 June 2004

Abstract The Euptychiina is one of the more diverse lineages of satyrine butterflies, represented by over 300 species. The first phylogenetic analyses of the subtribe is presented based on 2506 aligned nucleotide sequences obtained from 69 individuals spanning 28 ingroup genera and nine outgroup genera. Two genes were used, the mitochondrial gene cytochrome oxidase 1 (1268 bp) and the nuclear gene elongation factor-1a (1238 bp). The subtribe is never recovered as monophyletic in analyses using parsimony, maximum likelihood, or Bayesian inference. Several euptychiine genera are placed basal to the ingroup, but support is found only for Euptychia and Oressinoma. Three main lineages within the ingroup were clearly defined and many taxonomic groupings within the clades strongly supported. The majority of genera tested were paraphyletic or polyphyletic. Based on results presented here and novel host use, a close relationship of Euptychia to the Indo-Australian tribe Ragadiini is hypothesized. Origins of the group remain unclear, but the basal position of most of the Nearctic genera is discussed. Ó 2004 Elsevier Inc. All rights reserved. Keywords: COI; EF-1a; Molecular systematics; Butterflies; Euptychia; Selaginella

1. Introduction Satyrinae is the second largest nymphalid butterfly subfamily with 2500–3000 species worldwide, yet has received little attention from systematists, and many traditional taxonomic groups are untested. There has been only one comprehensive treatment of the Satyrinae (Miller, 1968), downranked here to reflect accepted classification of satyrines as a subfamily as opposed to a family (Ackery, 1984; de Jong et al., 1996; Ehrlich, 1958; Harvey, 1991; Kristensen, 1976). Miller (1968) provided few diagnostic characters for tribal and subtribal groupings, and his proposed phylogeny was not based on an explicit data matrix or cladistic analysis. Martı´n et al. (2000) investigated phylogenetic relation*

Corresponding author. Fax: +850 645 1323. E-mail address: [email protected] (D. Murray).

1055-7903/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2004.08.014

ships among European satyrines and the validity of MillerÕs (1968) classification as it related to those taxa, and although regional in scope, found paraphyly at the higher taxonomic levels. The question of monophyly of the subfamily is equally ambiguous (Harvey, 1991). Neither Miller (1968) nor authors following him were able to delineate the Satyrinae with synapomorphies (Ackery, 1984; Garcı´a-Barros and Martı´n, 1991; Harvey, 1991). The enlarged forewing costal vein and the closed hindwing discal cell are often cited as the defining characteristics, however there are numerous exceptions, and these traits are not unique to satyrines (Ackery et al., 1999). One genus has been moved from Satyrinae to Morphinae, and the placement of other genera is questioned (Ackery, 1984; DeVries et al., 1985). Recently two molecular studies found a non-monophyletic Satyrinae. Brower (2000), based on limited satyrine exemplars within a larger Nymphalidae study and using

68

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

one gene, found a polyphyletic Satyrinae, although only his successive weighting tree produced resolution among satyrine taxa. Wahlberg et al. (2003) reported similar findings based on fewer satyrine taxa but more genes. However, the authors concluded that more sampling is needed to resolve relationships among Satyrinae and its sister groups. The majority of satyrine species are found in the neotropics, represented by a small ancestral tribe, Haeterini, and two diverse Satyrini subtribes, Euptychiina and Pronophilina. Historically, the two latter subtribes were delineated in part based on geography (Miller, 1968), with euptychiines occurring in the lowlands and pronophilines in the highlands. Neither subtribe has been the subject of a published phylogenetic study. Euptychiina, the focus of this work, currently includes over 300 species grouped into 43 genera, 12 of which are monotypic. Species range from central United States to Argentina, occurring in all habitat types from lowlands to cloud forests. Like most all satyrines, euptychiine host plants are exclusively monocots with one exception found in Euptychia. The subtribe was circumscribed based on a few wing, antennal, and leg characters (Miller, 1968), but none unique to Euptychiina. Most euptychiine genera were erected by Forster (1964) in his study of the Bolivian fauna. However, he did not delineate the genera with diagnostic characters, but instead referred to line drawings of male genitalia, leaving it up to the reader to deduce generic differences. No structural detail was shown in his figures, suggesting he examined only overall gross morphology, ignoring potentially informative characters. The lack of diagnostic characters for the subtribe Euptychiina is compounded by the fact that Miller placed ForsterÕs ill-defined genera within the subtribe without examination, citing time constraints. Based on the questionable taxonomic history of the Euptychiina, some authors instead use Euptychia sensu lato or Cissia as catch-all genera (DeVries, 1987; Emmel and Austin, 1990). In addition to poorly delimited genera, no work has addressed euptychiine interrelationships. The few revisions published have focused on a single genus (Miller, 1972, 1974, 1976, 1978) or species group (Singer et al., 1983), without information on higher level classification nor the use of rigorous phylogenetic methods. In an effort to clarify euptychiine taxonomy, Lamas (unpublished), as part of a larger project on neotropical butterflies, assembled an annotated checklist of euptychiine species, synonomizing species and placing some within genera that Forster did not. However, his work was not based on intensive morphological study or phylogenetic analysis. In summary, little is known of evolutionary relationships within Euptychiina. The general goal of this work is to advance our understanding of a poorly studied, diverse group of organisms, the satyrines, with an intense study of one of the more speciose subtribes, the Euptychiina. In doing so, this paper presents the first phyloge-

netic analysis for the subtribe. DNA sequence data were used to infer relationships among euptychiine genera, investigate monophyly of the delimited genera, and test monophyly of the subtribe.

2. Materials and methods 2.1. Taxon sampling Fifty-eight species of the butterfly subtribe Euptychiina, representing 28 genera, were included in this study (Table 1). Because the taxonomic status of many euptychiine groups is questionable, more than one exemplar was included from 14 genera to explore hypotheses of monophyly. Samples suitable for DNA extraction were not obtained for some euptychiine groups, including several monotypic genera with narrowly distributed species. Species names follow Lamas (unpublished). Specimens listed as ‘‘nr’’ could not be accurately placed within known species and likely represent new species. Basic taxonomic work is lacking for most euptychiine groups, and undescribed species, synonyms, and unresolved species groups are common. Several satyrine outgroups were used in this study, representing all major groups in the subfamily. Higher level relationships within the subfamily have not been tested, and the sister group to the euptychiines is unknown. Morphological studies (Miller, 1968; Murray, 2001a) suggested that Haeterini is an ancestral satyrine tribe. Two exemplars from this tribe were used to root the tree, Cithaerias pireta and Haetera piera. The remaining outgroups were not designated as such in analyses. From the diverse Satyrini tribe, representatives of the high Andean subtribe Pronophilina and Old World subtribe Ypthimina were selected. Ypthimina was hypothesized to be closely related to the Euptychiina (Miller, 1968; Ackery, 1988). Two exemplars, one Asian (Ypthima confusa) and one African (Y. doleta), were included. Two representatives from the Pronophilina, Nelia nemyroides and Neomaneus monachus, were also selected, as both this group and the euptychiines have been separated in part due to their geographic location (Miller, 1968). Finally, representatives from two other putative ancestral tribes were included, Bicyclus madetes, B. funebris, Enodia portlandia and Lethe mekara from Elyminiini and Melanitis leda from Biini. Preliminary analyses suggested that at least two euptychiine genera, Euptychia and Oressinoma, diverged early in satyrine evolution and these outgroups were included to explore those results. 2.2. Molecular methods For most samples, field collected tissues were stored in 95% EtOH, preserving whole bodies or only abdomens and legs. DNA was extracted using a QIAGEN

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

69

Table 1 Species examined in this study, their localities, and GenBank accession numbers Tribe (Subtribe) species

Collecting locality

COI

EF-1a

Ecuador: Napo Province Peru: Madre de Dı´os Province

AY508517 AY508518

AY509045 AY509046

Australia: Queensland

AY508560

AY509086

USA: Louisiana Malaysia

AY508536 AY508550

AY509062 AY509076

Ghana: Ashanti Region Ghana: Ashanti Region

AY508520 TreeBaseb

AY509048 Treebaseb

Outgroup Haeterini (Haeterina) Cithaerias pireta (Cramer) Haetera piera (Linnaeus) Biini (Melanitina) Melanitis leda (Linnaeus) Elyminiini (Lethina) Enodia portlandia Fabricius Lethe mekaraa Moore Elyminiini (Mycalesina) Bicyclus funebrisa Gu´eria-Me´neville Bicyclus madetes Hewitson Satyrini (Ypthimina) Ypthima confusaaShirozu and Shima Ypthima doletaa Kirby Satyrini (Pronophilina) Nelia nemyroidesa (Blanchard) Neomaenas monachusa (Blanchard)

Thailand: Chiang Mai Province Ghana: Ashanti Region

AY508584 AY508585

AY509109 AY509110

Chile: Los Lagos Region Chile: Los Lagos Region

AY508562 AY508563

AY509088 AY509089

Ingroup Satyrini (Euptychiina) Caeruleuptychia nr. caerulea Caeruleuptychia coelicaa (Hewitson) Caeruleuptychia umbrosa (Butler) Caeruleuptychia sp. Cepheuptychia cephus (Fabricius) Chloreuptychia agathaa (Butler) Chloreuptychia arnaca (Fabricius) Chloreuptychia heresis (Godart) Cissia confusa (Staudinger) Cissia myncea (Cramer) Cissia penelope (Fabricius) Cissia similis (Butler) Cissia terrestris (Butler) Cissia sp. Cyllopsis gemma (Hu¨bner) Cyllopsis rogersi (Godman and Salvin) Erichthodes erichtho (Butler) Euptychia picea Butler Euptychia westwoodi Butler Euptychia sp. Euptychoides albofasciataa (Hewitson) Euptychoides nossis (Hewitson) Euptychoides eugenia (C Felder and R Felder) Forsterinaria boliviana (Godman) Forsterinaria inornata (C Felder and R Felder) Harjesia sp. Hermeuptychia harmonia (Butler) Hermeuptychia hermes (Fabricius) Hermeuptychia sosybius (Fabricius) Magneuptychia alcinoe (C Felder and R Felder) Magneuptychia fugitiva Lamas 1997 Magneuptychia nr lea Magneuptychia moderata (Weymer) Magneuptychia tiessa (Hewitson) Magneuptychia sp. Megeuptychia antonoe (Cramer) Megisto cymela (Cramer) Neonympha areolata (J.E. Smith) Oressinoma sorata Salvin and Godman Paramacera allyni L.D. Miller Parataygetis lineata (Godman and Salvini) Pareuptychia hesionides Forster

Peru: Madre de Dı´os Province Ecuador: Napo Province Ecuador: Napo Province Peru: Madre de Dı´os Province Ecuador: Napo Province Ecuador: Napo Province Ecuador: Napo Province Ecuador: Napo Province Costa Rica: Heredia Province Peru: Madre de Dı´os Province Ecuador: Napo Province Belize: Orange Walk District Peru: Madre de Dı´os Province Ecuador: Pichincha Province USA: North Carolina Costa Rica: Heredia Province Peru: Madre de Dı´os Province Ecuador: Napo Province Costa Rica: Heredia Province Ecuador: Pichincha Province Ecuador: Sucumbios Province Ecuador: Pichincha Province Ecuador: Pichincha Province Ecuador: Pichincha Province Ecuador: Pichincha Province Ecuador: Napo Province Ecuador: Pichincha Province Costa Rica: Puntarenas Province USA: Louisiana Ecuador: Pichincha Province Peru: Madre de Dı´os Province Peru: Madre de Dı´os Province Ecuador: Napo Province Ecuador: Pichincha Province Ecuador: Napo Province Ecuador: Napo Province USA: Louisiana USA: Louisiana Ecuador: Pichincha Province USA: Arizona Ecuador: Pichincha Province Ecuador: Napo Province

AY508522 AY508524 AY508523 AY508521 AY508525 AY508526 AY508527 AY508528 AY508532 AY508556 AY508530 AY508529 AY508531 AY508533 AY508534 AY508535 AY508537 AY508542 AY508543 AY508541 AY508540 AY508539 AY508538 AY508545 AY508544 AY508546 AY508549 AY508548 AY508547 AY508551 AY508552 AY508554 AY508553 AY508557 AY508555 AY508559 AY508558 AY508564 AY508561 AY508565 AY508569 AY508567

AY509050 AY509051 AY509049 AY509052 AY509053 AY509054 AY509055 AY509059 AY509082 AY509057 AY509056 AY509058 AY509060 AY509061 AY509063 AY509068 AY509069 AY509067 AY509066 AY509065 AY509064 AY509071 AY509070 AY509072 AY509075 AY509074 AY509073 AY509077 AY509078 AY509080 AY509079 AY509083 AY509081 AY509085 AY509084 AY509090 AY509087 AY509091 AY509095 AY509093 (continued on next page)

70

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Table 1 (continued) Tribe (Subtribe) species Pareuptychia metaleuca (Boisduval) Pareuptychia ocirrhoe (Fabricius) Pindis squamistrigaa R Felder Posttaygetis penelea (Cramer) Pseudodebis marpessa (Hewitson) Pseudodebis valentina (Cramer) Satyrotaygetis satyrina (H.W. Bates) Splendeuptychia ashna (Hewitson) Splendeuptychia itonis (Hewitson) Taygetis celia (Cramer) Taygetis laches (Fabricius) Taygetis puritana (A.G. Weeks) Taygetis sosis Hopffer Taygetis virgilia (Cramer) Yphthimoides erigone (Butler) Yphthimoides renata (Stoll)

Collecting locality

COI

EF-1a

Ecuador: Pichincha Province Ecuador: Napo Province Mexico: Guanajuato Ecuador: Napo Province Peru: Madre de Dı´os Province Ecuador: Napo Province Costa Rica: Puntarenas Province Peru: Madre de Dı´os Province Ecuador: Napo Province Ecuador: Pichincha Province Ecuador: Napo Province Ecuador: Pichincha Province Ecuador: Napo Province Belize: Orange Walk District Ecuador: Napo Province Belize: Orange Walk District

AY508566 AY508568 AY508570 AY508571 AY508573 AY508574 AY508575 AY508576 AY508577 AY508572 AY508581 AY508578 AY508580 AY508579 AY508583 AY508582

AY509092 AY509094 AY509096 AY509097 AY509099 AY509100 AY509101 AY509102 AY509098 AY509106 AY509103 AY509105 AY509104 AY509108 AY509107

Vouchers held by primary author except where noted. a Vouchers at Oregon State Arthropod Collection. b From Monteiro and Pierce (2001) data matrix submitted to TreeBase.

DNeasy Tissue Kit (QIAGEN, Valencia, CA) from either the thorax or the anterior abdomen. The remaining body and wings were kept as voucher material. For a few butterflies where no fresh material was available, DNA was extracted from dried specimens. Two genes were selected, a mitochondrial gene, cytochrome oxidase I (COI) and a nuclear gene, elongation factor-1a (EF-1a). Both have been used extensively in insect molecular systematics (Caterino et al., 2000; Simon et al., 1994). COI was amplified using olgionucleotide primers as published in Simon et al. (1994) (forward Ron = CI-J-1751, reverse Nancy = CI-N-2191; forward Jerry = CI-J-2183) with the exception of Pat2 (reverse 50 TCCATTACATATAATCTGCCATATTAG). EF1a primers were taken from Cho et al. (1995) (M3, rcM51-1, M46-1, rcM4). Reactions contained 2.5 U Taq DNA polymerase, 1.5 mM MgCl2, 200 lM dNTP, 0.5 lM of each primer, and 1–5 ll of template DNA. Thermal conditions were 1 min denaturing at 95 °C, 1 min annealing at 45 °C, and 1.5 min extension at 72 °C for 26 cycles, with a 5 min final extension at 72 °C. Samples were purified using QIAGEN PCR Purification kit (QIAGEN, Valencia, CA). Cleaned products were cycle-sequenced using flourescent dye-labeled terminators (ABI Big Dye Terminator Cycle Sequencing Kit, Applied Biosystems, Perkin–Elmer) and then run on an ABI 377 sequencer. Amplification profile was 96 °C for 15 s, 50 °C for 20 s, and 60 °C for 4 min, cycled 25 times. The resulting samples were cleaned using recommended manufacturing protocol for ethanol precipitation. Samples were sequenced in both directions to minimize base calling errors and ambiguities. Aligning and editing of sequences were performed in SeqEd 1.0.3 (Applied Biosystems 1992). BLAST searches were conducted on all sequences to check for possible contamination.

For three samples extracted from dried specimens, recovered DNA material was low and sequences could not be obtained from the nuclear gene EF-1a. Samples were retained in the partitioned COI analyses and coded as missing data for combined analyses. 2.3. Phylogenetic analyses Data were analyzed using three approaches, maximum parsimony (MP), maximum likelihood (ML), and Bayesian inference. Parsimony analyses were performed in PAUP* 4.0b10 (Swofford, 2002) using heuristic searches with tree-bisection-reconnection (TBR) branch swapping and 1000 random-addition sequence replicates with 10 trees held at each step. Initially data sets were not weighted, but preliminary results and previous studies have shown potential problems with COI, including saturation and rate heterogeneity. Potential saturation in the data set was assessed visually, plotting transitions and transversions for each codon position against genetic distance. When rates curves suggested saturation at the third codon position for COI, MP searches were conducted with these sites removed and, as suggested by previous authors (Barker and Lanyon, 2000; Griffiths, 1997; Reeder, 1995), with differentially weighted transitions with respect to transversions (ti:tv), here weighted as 1:2 and 1:3. Differing rates of nucleotide substitution among the two genes and codon position were also explored using ML. Prior to maximum likelihood analyses, best-fit models of nucleotide substitution were selected with likelihood ratio tests as implemented by Modeltest (version 3.06) (Posada and Crandall, 1998). Models of evolution and parameters were estimated for data partitioned by gene and also combined. For each likelihood ratio test, Modeltest selected the general time reversible model

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

with variable sites assumed to follow a discrete gamma distribution and some sites assumed to be invariable (GTR + I + C) (Yang, 1994). ML searches were implemented in PAUP* using model parameters and the TBR branch swapping. Bayesian analyses were conducted in MrBayes (Huelsenbeck and Ronquist, 2001) under the GTR + I + C model, using four Markov Chain Monte Carlo (MCMC) chains, three heated and one cold, and a random starting tree. Parameter values were not specified but estimated as part of the analyses. To assess coverage of tree space, duplicate analyses continued for either 100,000 or 1 million generations, with trees sampled every 10 generations. Log likelihoods were viewed graphically, and all trees before stationary were discarded as burn-in. If the resulting consensus trees from duplicate analyses were in agreement, no more runs were initiated. Bootstrap support values and posterior probabilities were used to assess the robustness of the findings. Bootstrap values were computed from 1000 pseudoreplicates randomized 10 times with TBR addition sequence. Due to computational time, calculations of bootstrap values under the maximum likelihood criterion were conducted with ‘‘fast’’ heuristic searches replicated 100 times. With large replicates, fast bootstrapping produces similar results as full bootstrapping methods (DeBry and Olmstead, 2000; Mort et al., 2000). Dataset congruence between gene partitions was tested using the partition homogeneity test (Swofford, 2002), also referred to as the incongruence length difference (ILD) test (Farris et al., 1994) as implemented in PAUP*. Several recent papers have pointed out problems with this test (Cunningham, 1997; Dowton and Austin, 2002), but it can be a useful measure of incongruence for data sets of equal size, as they are in this study. The Shimodairan Hasegawa test statistic (Goldman et al., 2000; Shimodaria and Hasegawa, 1999) was used to compare alternative phylogenetic hypotheses. For each analysis all topologies obtained were compared simultaneously to statistically test whether or not they were significantly worse than the optimal ML tree. The SH tests were conducted in PAUP* using the RELL

71

(resampling estimated log-likelihood) method and 1000 bootstrap replicates.

3. Results 3.1. Molecular characterization A 1291 bp fragment of COI and a 1263 bp fragment of EF-1a were sequenced, with 25 ambiguous sites from the fragment ends excluded from the data set. Base pair composition of COI showed a strong AT bias (71%), typical for insect mitochondrial DNA (Clary and Wolstenholme, 1985; Crozier and Crozier, 1993). Significant base composition heterogeneity was found only at the third codon position of COI. Relative rates of nucleotide substitution were greater for COI than EF-1a (Table 2), and more than two times faster at the third codon position. Second codon position nucleotides of EF-1a showed the slowest rate of substitution and had fewer informative sites than any other position for either gene. Overall average mean sequence divergence among ingroup taxa for COI was 8.9% (excluding paraphyletic taxa), with intrageneric divergences of monophyletic genera ranging from 0.05% to 7.2%. For EF-1a, sequence divergences among the ingroup range from 3% to 9% (excluding paraphyletic taxa) and 0.01–5% for intrageneric comparisons (monophyletic genera only). 3.2. Combined analyses An ILD test of the two genes failed to reject the null hypothesis of homogeneity (P = 0.30). In a combined gene data set, the subtribe Euptychiina was not found to be monophyletic (Figs. 1 and 2). Euptychia species and Oressinoma sorata were excluded from the ingroup, strongly supported in Bayesian analysis (Table 3). The unweighted MP analysis resulted in a soft polytomy at the basal ingroup node. When weighting schemes were implemented, this was resolved to paraphyly of Euptychiina with both genera basal to the remaining ingroup and nodal support of 99%. When euptychiine monophyly was constrained, the unweighted MP tree length increased by only eight steps (TL = 6581, CI = 0.243,

Table 2 Base composition and variable sites by codon position Gene

Position

A

C

G

T

v2

P

Informative sites

%

CI

Relative rate

COI

First Second Third All

0.297 0.191 0.395 0.295

0.158 0.241 0.074 0.157

0.228 0.147 0.010 0.128

0.317 0.422 0.521 0.420

22.396 5.832 527.724 102.714

1.000 1.000 0.000 1.000

100 27 352 479

23.6 6.38 83.21 38.00

0.294 0.463 0.184 0.209

0.559 0.092 3.446 1.300

EF-1a

First Second Third All

0.247 0.284 0.173 0.259

0.305 0.177 0.357 0.263

0.175 0.383 0.192 0.245

0.273 0.156 0.277 0.233

76.351 11.279 147.123 56.451

1.000 1.000 0.996 1.000

22 10 317 349

5.30 2.41 76.39 28.01

0.470 0.616 0.293 0.314

0.134 0.051 1.698 0.700

72

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Fig. 1. Phylogram of the majority rule consensus tree of 8000 trees after burn-in from a 100,000 step MCMC simulation based on combined COI + EF-1a data matrix. Bayesian posterior probabilities are given above nodes. Values below nodes are posterior probabilities when taxa with missing data are removed from analysis. Outgroup taxa shown in bold. Dark bar marks putative ingroup. Exemplars marked with (*) are paraphyletic taxa. Shaded boxes mark clades.

RI = 0.383). However, this topology and the MP tree were significantly worse explanations of the data than the others (diff
ln L = 42.48, P < 0.016; diff
ln L = 92.42, P 6 0.000 respectively). Although the non-monophyly of Euptychiina was a consistent result, relationships among outgroups, the excluded euptychiine genera, and among the most basal members of the ingroup remained poorly resolved. Because distant outgroups could be affected by long branch attraction (Felsenstein, 1978; Smith, 1994), resulting in erroneous groupings, C. pireta, H. piera, M. leda, E. portlandia, and L. mekara were sequentially removed and the data set re-analyzed. Results showed reduced resolution among basal taxa and to a lesser extent, among the ingroup taxa, but did not change the respective topologies and both O. sorata and Euptychia

species remained paraphyletic with respect to the ingroup. Distant outgroups, then, did not appear to influence erroneous pairings, but instead added phylogenetic signal to the overall results, and in particular to the basal groups. Eight of the 14 euptychiine genera represented by more than one species were polyphyletic or paraphyletic in all analyses of the combined data set (Table 4). Six species were included from a particularly large genus, Magneuptychia, and none formed a monophyletic group with any other member. Similar evidence for artificial groupings was found for the genera Cissia and Euptychoides. Five euptychiine genera were well supported as monophyletic in all analyses (Table 4). The one area of incongruence revolved around Caeruleuptychia, weakly suggested as monophyletic in MP and ML anal-

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

73

Fig. 2. Strict consensus of four most parsimonious trees (tree length = 6573, CI = 0.243, RI = 0.383) based on COI + EF-1a data matrix and unweighted analysis. Bootstrap values above 50% shown on nodes. Dark bar marks putative ingroup clade. Outgroups shown in bold. Exemplars marked with (*) are paraphyletic taxa. Shaded boxes mark clades.

Table 3 Paraphyletic taxa by partition and analysis Taxa

COI MP

COI ML

COI Bayes

EF-1a MP

EF-1a ML

EF-1a Bayes

Combine MP

Combine ML

Combine Bayes

Oressinoma sorataa Euptychia species Paramacera allynia Cyllopsis species Cissia penelopea

26 31 26 26 0b

19 29

60 100

71 71

31 31 0b

91 91 67

99c 99c

35 35

92 92

0b

60

Bootstrap and posterior probabilities percentages given for node with highest value that supports the exclusion of the taxon from the ingroup. a Tested with more than one individual. b Not found paraphyletic in bootstrap consensus tree. c From weighted analysis.

yses. Because the disagreement in gene topologies could have been affected by missing data for Caeruleuptychia umbrosa, this taxon and the other two taxa with missing data for EF-1a were removed and the data re-analyzed.

Removal of the taxa did not resolve the question of Caeruleuptychia monophyly, but did affect results under the Bayesian method. Posterior probabilities were slightly higher for many nodes, suggesting that the miss-

74

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Table 4 Assessment of monophyly of euptychiine genera where more than one species of the genus is present in data set Taxa Caeruleuptychia Chloreuptychia Cissia Cyllopsis Euptychia Euptychoides Forsterinaria Hermeuptychia Magneuptychia Pareuptychia Pseudodebis Splendeuptychia Taygetis Yphthimoides

COI MP 36 0 0 88 72 0 100 100 0 93 0 0 0 0

COI ML 16 0 0 86 72 0 100 100 0 92 0 0 0 0

COI Bayes 81 0 0 100 100 0 100 100 0 100 51 0 0 0

EF-1a MP 0 0 0 91 98 0 100 100 0 97 0 ? 0 0

EF-1a ML 0 0 0 92 92 0 100 100 0 100 0 ? 0 0

EF-1a Bayes 0 0 0 100 100 0 100 100 0 100 0 ? 0 0

Combine MP 28 0 0 93 99 0 100 100 0 100 0 0 0 0

Combine ML 0 0 0 100 96 0 100 100 0 100 0 0 0 0

a

Combine Bayes 0 0 0 95 100 0 100 100 0 100 0 0 0 0

Bootstrap percentages or posterior probabilities presented for monophyletic genera. A ‘‘0’’ indicates no support for monophyly found (i.e., paraphyletic or polyphyletic). Posterior probabilities given as percentages. A‘‘?’’ designates missing data. a Not found monophyletic in bootstrap consensus tree.

ing data contributed to some noise in the data set. Significantly, basal nodes near where Splendeuptychia itonis was placed increased to 1.00PP (Fig. 1) and the node separating Caeruleuptychia sp. + Caeruleuptychia umbrosa from the remaining Cissia clade increased from 0.78PP to 0.97PP. Topologies remained mostly unchanged except the Chloreuptychia + Cepheuptychia group was found to be sister to the Pareuptychia clade, a result that was more consistent with morphology. Conversely, removal of the taxa had no affect on MP topologies or bootstrap values. Within the ingroup three large lineages were recovered, referred to as the ‘‘Cissia,’’ ‘‘Pareuptychia,’’ and ‘‘Taygetis clades.’’ Clades contained identical members in all analyses and branching patterns were largely congruent within the clades. The Taygetis clade was most congruent and the Cissia clade most divergent, due to the variable placement of Cissia terrestris and Caeruleuptychia spp. Support for clades ranged from weak (ML analyses) to strong (Bayesian, all 1.00 PP).

neither weighted analyses nor removal of third codon position sites improved results. All analyses produced congruent well supported results for the monophyletic euptychiine genera (Table 4) except for Caeruleuptychia, monophyletic in COI but not EF-1a analyses, and Pseudodebis, weakly suggested as monophyletic only in COI Bayesian analysis. No analyses found any of the remaining seven tested euptychiine genera monophyletic. All analyses found the Taygetis, Pareuptychia, and Cissia clades monophyletic except again the COI partition under MP unweighted criteria. Differences were confined to two exemplars, Yphthimoides renata and Euptychoides eugenia (Fig. 3). The placement of both taxa was unique, especially Y. renata, typically found near the base of the ingroup clustered with Megisto cymela. Weighted trees produced a topology more consistent with ML and Bayesian analyses in this regard.

4. Discussion 3.3. Phylogenetic analysis based on individual genes Individual gene phylogenies were generally congruent with respect to several findings. Euptychiina was recovered as polyphyletic, the majority of the euptychiine genera were not monophyletic, and the three named clades were monophyletic, with one exception discussed below (Figs. 3 and 4). Regions of notable conflict between the gene phylogenies revolved around genera excluded from the ingroup, the monophyly of Caeruleuptychia and Pseudodebis, and the placement of Yphthimoides renata and Euptychoides eugenia. All single gene analyses, except EF-1a MP analysis, found other genera in addition to Euptychia species and O. sorata excluded from the ingroup (Table 3). COI MP analysis was most incongruent (Fig. 3), and

This study represents the first phylogenetic analysis of the satyrine butterfly subtribe Euptychiina. Indeed, this is the first significant contribution to understanding neotropical satyrine evolution, where two hyperdiverse subtribes, Pronophilina and Euptychiina, compose the majority of satyrine species. Both groups were hypothesized to have moved into South America from Paleotropical origins as two independent radiations. Findings from this study suggest a more complex evolutionary history for the lowland satyrines than previously thought. Rampant paraphyly and polyphyly among euptychiine genera demonstrate the great need for a species level revision of these butterflies. Diversification of the group is found in three main lineages and these clades can serve as the basis for future systematic inquiry.

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

75

Fig. 3. Strict consensus of 25 most parsimonious trees (tree length = 4309, CI = 0.209, RI = 0.334) based on COI data matrix. Results incongruent with respect to all other analyses. Bootstrap values above 50% shown on nodes. Dark bar marks putative ingroup clade. Outgroups shown in bold. Taxa marked with (*) paraphyletic. Shaded boxes illustrate clades.

4.1. Monophyly of Euptychiina A monophyletic Euptychiina was not recovered under any optimality criteria, data partition, or weighting scheme. Moreover, a constrained monophyletic Euptychiina was a significantly worse explanation of the data. However, evidence for evolutionary relationships among basal taxa was weak, and topologies were characterized by short internodes with little branch support. The difficulty lies in resolving relationships of the euptychiine genera not found as members of the ingroup, but with unknown relationships to other satyrines. Increased outgroup sampling was included in an effort to break up long branches among these taxa, but this did not greatly increase basal phylogenetic resolution. Nonetheless, the data suggest Oressinoma and Euptychia do not share a common ancestor with the remaining subtribe. Strongest support comes from the

exclusion of the nominant genus, Euptychia, with high posterior probabilities found in all analyses. In evaluating the results, Bayesian posterior probabilities were viewed with caution as the possibility of overinflated values has been suggested in the literature (Alfaro et al., 2003; Douady et al., 2003). However, combined weighted parsimony (99%) also strongly supported these results. The Euptychia clade was typically found with only the distant outgroups the Haeterini and M. leda as more basal and are as distant from the ingroup (12%) as they are from the outgroups (12–13%), suggesting that Euptychia diverged early in satyrine evolution. Oressinoma sorata was also consistently basal to the ingroup, with more support for this result provided by the EF-1a data. Oressinoma is a small genus composed of two closely related species and is morphologically distinct from other euptychiines, and neotropical satyrines in general, by having swollen medial and sub-

76

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Fig. 4. Phylogram of the majority rule consensus tree of 8000 trees after burn-in from a 100,000 step MCMC simulation based on EF-1a data matrix. Bayesian posterior probabilities are given above nodes. Outgroup taxa shown in bold. Dark bar marks putative ingroup. Paraphyletic taxa marked with a (*). Shaded boxes illustrate clades.

medial but not costal veins on the forewing (Miller, 1968; DeVries, 1987). Results from Murray (2001a) suggested long-branch attraction between C. penelope and O. sorata in the COI data set, and problematic placement of C. penelope is seen here as well, where it clusters with either pronophiline outgroups or with other euptychiine genera, including Oressinoma, within a clade containing outgroups. Previous work has also suggested that Oressinoma is not closely related to the euptychiines. Huelsenbeck et al. (2001) applied Bayesian analysis to the data set of Brower (2000) and found a polyphyletic Euptychiina. Although the taxon sampling of euptychiines was low, Oressinoma clustered with another basal satyrine Tisiphone (0.83PP), while the remaining euptychiines were part

of a more derived clade containing other Satyrini subtribes (0.99PP). Brower (2000) found similar results in weighted parsimony analysis. Correct resolution of the basal nodes may depend on the addition of critical southern taxa. In a morphological analysis containing partial characters for representatives of several large Brazilian genera, Parythimoides, Moneuptychia, and Pharneuptychia, the genera clustered with other basal ingroup taxa (Murray, 2001a). In addition, Yphthimoides is a large genus with most species endemic to southern Brazil, as are most Pharneuptychia, Parythimoides, and Moneuptychia species. Therefore, an important biogeographical area is absent from this study, and these taxa are linked to the basal node of the subtribe where resolution is weakest.

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

4.2. Relationships within Euptychiina With one exception, all analyses recovered three major lineages containing identical members, labeled ‘‘Cissia,’’ Pareuptychia,’’ and ‘‘Taygetis clades.’’ Certain monophyletic groups were consistently recovered within these clades and were well supported with high posterior probabilities and bootstrap values. However, little can be surmised of the relationships among the clades themselves. The Taygetis clade was most often basal to the more derived Pareuptychia and Cissia clades, but internodes were extremely short and poorly supported. Branching patterns were most congruent within the Taygetis clade. All members of this clade were once included within Taygetis until Forster (1964) split them into several genera. Although many of his genera are artificial (i.e. Magneuptychia), at least some of the Taygetis clade genera appear valid based on morphological data (Murray, 2003). However, placement of Taygetis celia and T. puritana within Pseudodebis renders the genus paraphyletic. Both Taygetis and Pseudodebis are morphologically similar, supported by only a few synapomorphies (Murray, 2001b), but molecular results suggest two distinct clades. Genetic distance between the two clades is on average 6.3% and within the two clades 4.6 and 3.8%. Although Miller correctly surmised that neither T. celia nor T. puritana belong within Taygetis (Miller personal communication), his proposed new genus for these two species would still leave Pseudodebis paraphyletic by these results. One other genus formerly within Taygetis, Satyrotaygetis, is clearly not related to the remaining group, and at least the nominant species is closely related to Magneuptychia tiessa, which appears to be its South American replacement. The namesake of the Pareuptychia clade, Pareuptychia, is consistently well supported as monophyletic. Addition of other species within the genus also results in a robustly supported clade (data not shown). This genus is united morphologically by atypical black egg coloration, not known from any other satyrine group or perhaps any butterfly species. The eggs are actually translucent white as most euptychiine eggs, but darken to opaque black within 24 h and become indistinguishable from parasitized euptychiine eggs (Murray, 2001a). Support for other branching patterns within the Pareuptychia clade is weaker, with the exception of S. satyrina + M. tiessa. One surprising result was the polyphyly of the Euptychoides, a genus composed of 10 species which are superficially similar and one of the few groups which have invaded the Andean cloud forests. When preliminary results suggested non-monophyly of the original two species, a third member was included, but this species failed to form a monophyletic clade with either of the other species. E. albofasciata is most often sister to S. satyrina + M. tiessa, also found within cloud forests. However the remaining species

77

are sister to lowland groups, suggesting multiple invasions into the more atypical higher altitude habitats. The Cissia clade encompasses some of the more speciose Euptychiina genera. The clade is characterized by numerous short internodes and poor support for internal branching, especially basal nodes, indicative most likely of rapid diversification within the clade and/or the inadequate amount of sampling and genes to correctly resolve relationships. The clade does not contain any monophyletic genera except possibly Caeruleuptychia, where monophyly is not resolved by the results. All other genera have exemplars found outside the clade. Therefore, they may be only distantly related to other members of their respective genera, an indication of the complex taxonomic problems within the group. Cissia is perhaps not the most apt name for this clade, given that the type species for the genus Cissia, C. penelope, is not a member of the clade, but until the genera are taxonomically revised, the name will hold as many of the members of this clade are generally ‘‘Cissia-like.’’ Singer et al. (1983) recognized several sub-groups within Cissia based on larval data. Although they did not discuss whether or not the genus was monophyletic, they separated C. penelope from other Cissia species, results corroborated here. The robustly supported C. confusa + Cissia sp. + C. myncea + M. fugitiva clade corresponds to one of their other sub-groups. C. pseudoconfusa also falls within this clade (data not shown). As mentioned, basal relationships within the ingroup are unclear, but there are a few well supported clades. Cyllopsis + Paramacera is consistently well supported and placed most often as sister to the remaining ingroup. M. cymela is often sister to Y. renata + C. penelope, but support for this is much weaker. Hermeuptychia, a well supported monophyletic genus, is also often basal within the ingroup, sister to the rest of the ingroup or sister to the Taygetis clade. However, support is lacking and placement is not consistent. Placement of other non-clade members is even more variable. These include species of Chloreuptychia, Cepheuptychia, Magneuptychia, and Splendeuptychia. Splendeuptychia itonis is often linked with Pindis squamistriga, a surprising result morphologically, but this relationship is not supported. However, S. itonis is clearly not closely related to S. ashna, a result supported by morphological evidence (Murray, 2001a). Splendeuptychia is the most speciose Euptychiina genus, with an estimated 50 species (Lamas, unpublished), and appears composed of two disparate groups, represented here by S. itonis and S. ashna. Splendeuptychia ashna is well supported as a member of the Cissia clade, but the placement of S. itonis is uncertain. Although both are specialized feeders on bamboo, S. ashna is a detritivore on dead bamboo leaves on the forest floor (Murray, 2001a). A detritivorous feeding habit is not known among other satyrine butterflies.

78

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

4.3. Evolutionary history Currently our knowledge of satyrine relationships is sketchy, and hypotheses on the evolutionary origins of neotropical satyrines remain highly speculative (Viloria, 2003). Satyrines are thought to have originated in the Neotropics during the Cretaceous (Miller, 1968), based largely on the endemic distribution of the purported ancestral satyrine tribe, Haeterini, in the neotropics and the neotropical distribution of close relatives the Brassolinae and Morphinae. Grasses, an important host for satyrines, are also thought to have originated during the Cretaceous period and then diversified in the early Tertiary, 65–25 mya (Clark et al., 1995; Judziewicz et al., 1999). Although grasses may have played a vital role in the subsequent diversification of satyrines, early groups such as the Haeterini utilize other monocots which arose earlier than grasses. Few satyrine fossils are known, but the fossil record suggests that by the Oligocene, satyrines had become well established. The earliest known satyrine, an undescribed species near the tribe Elyminiini, dates from the lower middle Eocene, 48–51 mya (Durden and Rose, 1978). Satyrines from the subtribe Lethina are well represented in eastern Europe from the upper Oligocene (Nel et al., 1993). However, lacking a phylogenetic analysis of the subfamily and resolution of satyrine monophyly, a neotropical origin for the group cannot be evaluated. What are the likely origins for euptychiine butterflies? Miller (1968) hypothesized that the group colonized the neotropics from distant relatives in the Paleotropics, or more specifically, from the earliest Ypthimina butterflies. Support for a sister relationship of the euptychiines and ypthimines was not found in this study, although sampling among satyrines other than the focal group was sparse. Surprisingly, pronophilines were suggested as sister to the remaining ingroup, although results were complicated by inconsistent placement of paraphyletic taxa, i.e., P. allyni + pronophilines. A close relationship between euptychiines and pronophilines has not been given consideration in the literature and is not supported by morphology (Miller, 1968; Viloria, 2003). Most likely this sister relationship is an artifact of inadequate sampling. However, both Brower (2000) and Huelsenbeck et al. (2001) in a reanalysis of BrowerÕs data, found a euptychiine + pronophiline clade. The data do suggest an interesting pattern among the more ancestral members of the ingroup. Basal taxa are overwhelmingly Nearctic in distribution. The Nearctic euptychiine genera are represented by Neonympha, Megisto, Paramacera, Pindis, Cyllopsis, and Hermeuptychia. The latter two speciose genera have broad distributions into Central and South America, but the majority of Cyllopsis species are found in northern Central America. In the combined analyses, Cyllopsis + Paramacera are

suggested to be the sister clade to the remaining ingroup. Only Neonympha occupies a more derived placement in the phylogeny, clustered with other members of the Pareuptychia clade where species are neotropical in distribution. Although extensive floral and faunal exchange from South America across the isthmus began after the Pliocene (Marshall, 1985; Stehi and Webb, 1985), euptychiines likely had already diversified by this time. Among these genera, secondary invasion of the Nearctic with the connection of the land bridge may have occurred only within Neonympha. The nominant genus, Euptychia, was found basal to the ingroup. Robustly supported as monophyletic in this study, the genus is also supported by larval synapomorphies and a highly unusual host (DeVries, 1987; Murray, 2001a; Singer et al., 1983). All known hosts for satyrines are monocots, except for Euptychia species and members of a small Indo-Australian tribe, Ragadiini. The majority of hosts for these groups are members of Selaginellaceae, with a few Euptychia species also recorded from Bryopsida (mosses) (DeVries, 1985, 1987; Fukuda, 1983; Murray, 2001a; Singer et al., 1971; Singer and Mallet, 1985). Lycopsida is an archaic plant order dominant from the late Devonian to late Carboniferous periods and represented today primarily by Selaginella. Although many insect orders were present during the Carboniferous period and some are thought to have fed on lycopsids (Kukalova´-Peck, 1991), few species are recorded on them today (Mound et al., 1994). Satyrines are the only Lepidoptera recorded using Selaginella as larval food plants. Miller (1968) pointed out several distinctive features of ragadiines that ‘‘set them apart’’ from other satyrines, but was unsure of their systematic placement, believing the group was intermediate between more ancestral satyrines, the Elymniini, and the Satyrini, and felt that Euptychiina (including Euptychia) was only distantly related to Ragadiini. Considering that the data suggest Euptychia is only distantly related to the remaining subtribe, the intriguing hypothesis can be proposed of a close relationship between the euptychiines and the ragadiines based on novel host use. There is some support for this from larval morphology. Satyrines worldwide are conserved not only in gross morphology, but also in mouthparts and setal arrangements (Garcı´a-Barros, 1987; Murray, 2001a,b, 2003; Sourakov, 1996), therefore the presence of large tubercles on the dorsum in both Euptychia and Ragadia species is striking. Other shared traits include the extremely large stemma 3 and the shape of the adfrontal suture and mandibles. However, these similarities could be explained by convergences associated with a unique diet and not due to common ancestry. A close relationship of the ragadiines and Euptychia species would involve a more complex biogeographical scenario to the colonization of the tropical Americas than is currently hypothesized, and this

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

pattern may represent a deep gondwanian relationship. However, a better understanding of the biogeographical history of Euptychia must await a comprehensive study of higher level satyrine relationships.

Acknowledgments We appreciate the assistance and support from numerous colleagues. We thank Chris Carlton, Fred Sheldon, and Andy Brower for comments on an earlier draft of the manuscript. The Organization of Tropical Studies, Rı´o Bravo Research Station, Yasuni Biological Station, and Maquipucuna Research Station provided excellent support during field collecting trips. We thank Lee Miller and Gerardo Lamas for useful discussion on satyrine taxonomy and evolution. This project was supported by funds from the Department of Entomology at Louisiana State University, the Rice Endowment at Oregon State University, the Organization for Tropical Studies, American Women in Science, Sigma Xi, and the US Peace Corps. Many people also provided DNA material and we are grateful to Jim Tuttle, Dan Lang, Andy Brower, Susan Pell, Chris Carlton and Victoria Moseley. Murray also greatly appreciates the generosity of Andre´ Freitas for allowing her to examine his collection of larvae.

References Ackery, P.R., 1984. Systematic and faunistic studies on butterflies. In: Vane-Wright, R.I., Ackery, P.R. (Eds.), The Biology of Butterflies. Princeton University Press, Princeton, pp. 9–21. Ackery, P.R., 1988. Hostplants and classification: a review of nymphalid butterflies. Biological Journal of the Linnean Society 33, 95–203. Ackery, P.R., de Jong, R., Vane-Wright, R.I., 1999. The butterflies: Hedyloidea, Hesperioidea and Papilionoidea. Handbook of Zoology 4, 263–300. Alfaro, M.E., Zoller, S., Lutzoni, F., 2003. Bayes or bootstrap? A Simulation study comparing the performance of Bayesian Markov Chain Monte Carlo sampling and bootstrapping in assessing phylogenetic confidence. Molecular Biology and Evolution 20, 255–266. Barker, F.K., Lanyon, S.M., 2000. The impact of parsimony weighting schemes on inferred relationships among toucans and neotropical barbets (Aves: Piciformes). Molecular Phylogenetics and Evolution 15, 215–234. Brower, A.V.Z., 2000. Phylogenetic relationships among the Nymphalidae (Lepidoptera) inferred from partial sequences of the wingless gene. Proceedings of the Royal Society of London, Series B 267, 1201–1211. Caterino, M.S., Cho, S., Sperling, F.A.H., 2000. The current state of insect molecular systematics: A thriving tower of babel. Annual Review of Entomology 45, 1–54. Cho, S., Mitchell, A., Regier, J.C., Mitter, C., Poole, R.W., Friedlander, T.P., Zhao, S., 1995. A highly conserved nuclear gene for low-level phylogenetics: elongation factor-1a recovers morphology-based tree for Heliothine moths. Molecular Biology and Evolution 12, 650–656.

79

Clark, L.G., Zhang, W., Wendel, J.F., 1995. A phylogeny of the grass family (Poaceae) based on ndnF sequence data. Systematic Botany 20, 436–460. Clary, D.O., Wolstenholme, D.R., 1985. The mitochondrial DNA molecule of Drosophila yakuba: Nucleotide sequence, gene organization, and genetic code. Journal of Molecular Evolution 22, 252– 271. Crozier, R.H., Crozier, Y.C., 1993. The mitochondrial genome of the honeybee Apis mellifera: Complete sequence and genome organization. Genetics 133, 97–117. Cunningham, C.W., 1997. Can three incongruence tests predict when data should be combined?. Molecular Biology and Evolution 14, 733–740. DeBry, R.W., Olmstead, R.G., 2000. A simulation study of reduced tree-search effort in bootstrap resampling analysis. Systematic Biology 49, 171–179. de Jong, R., Vane-Wright, R.I., Ackery, P.R., 1996. The higher classification of butterflies (Lepidoptera): problems and prospects. Entomologica Scandinavica 27, 65–101. DeVries, P.J., 1985. Hostplant records and natural history notes on Costa Rican butterflies (Papilionidae, Pieridae & Nymphalidae). Journal of Research on the Lepidoptera 24, 290–333. DeVries, P.J., 1987. The butterflies of Costa Rica and their natural history, vol. I: Papilionidae, Pieridae, and Nymphalidae. Princeton University Press, Princeton. DeVries, P.J., Kitching, I.J., Vane-Wright, R.I., 1985. The systematic position of Antirrhea and Caerois, with comments on the classification of the Nymphalidae (Lepidoptera). Systematic Entomology 10, 11–32. Douady, C.J., Delsuc, F., Boucher, Y., Doolittle, W.F., Douzery, E., 2003. Comparison of Bayesian and maximum likelihood bootstrap measures of phylogenetic reliability. Molecular Biology and Evolution 20, 248–254. Dowton, M., Austin, A.D., 2002. Increased congruence does not necessarily indicate increased phylogenetic accuracy. The behavior of the incongruence length difference test in mixed-model analyses. Systematic Biology 51, 19–31. Durden, C.J., Rose, H., 1978. Butterflies from the Middle Eocene: the earliest occurrence of fossil Papilionoidea. Pierce-Sellards Series of the Texas Memorial Museum 29, 1–25. Ehrlich, P.R., 1958. The comparative morphology, phylogeny and higher classification of the butterflies (Lepidoptera: Papilionoidea). University of Kansas Science Bulletin 39, 307–370. Emmel, T.C., Austin, G.T., 1990. The tropical rain forest butterfly fauna of Rondonia, Brazil: Species diversity and conservation. Tropical Lepidoptera 1, 1–12. Farris, J.S., Ka¨llersjo¨, M., Kluge, A.G., Bult, C., 1994. Testing significance of incongruence. Cladistics 10, 315–320. Felsenstein, J., 1978. Cases in which parsimony or compatibility methods will be positively misleading. Systematic Zoology 27, 401– 410. Forster, V.W., 1964. Beitra¨ge zur Kenntnis der Insektenfauna Boliviens XIX. Vero¨ffentlichungen der Zoologischen Staatssammlung, Mu¨nchen 8, 51–188. Fukuda, H., 1983. Life histories of two satyrid butterflies feeding on selaginellas. Tyoˆ to Ga 33, 132–144. Garcı´a-Barros, E., 1987. Morphology and chaetotaxy of the first larvae of six species of the Satyrus series (Lepidoptera: Nymphalidae). Systematic Entomology 12, 332–344. Garcı´a-Barros, E., Martı´n, J., 1991. Immature stages of Hipparchia Fabricius and the systematics of the ÔSatyrus seriesÕ (Lepidoptera: Nymphalidae: Satyrinae). Systematic Entomology 16, 407–426. Goldman, N., Anderson, J., Rodrigo, A., 2000. Likelihood-based tests of topologies in phylogenetics. Systematic Biology 49, 652–670. Griffiths, C.S., 1997. Correlation of functional domains and rates of nucleotide substitution in cytochrome b. Molecular Phylogenetics and Evolution 7, 352–365.

80

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Harvey, D.J., 1991. Higher classification of the Nymphalidae. In: Nijhout, H.F. (Ed.), The Development and Evolution of Butterfly Wing Patterns. Smithsonian Institution Press, Washington DC, pp. 259–274. Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Huelsenbeck, J.P., Ronquist, F., Nielsen, R., 2001. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294, 2310–2314. Judziewicz, E.J., Clark, L.G., London˜o, X., Stern, P., 1999. American Bamboos. Smithsonian Institution Press, Washington D.C. Kristensen, N.P., 1976. Remarks on the family-level phylogeny of butterflies. Zeitschrift fuer Zoologische Systematic und Evolutionsforschung 14, 25–33. Kukalova´-Peck, J., 1991. Fossil history and the evolution of hexapod structures. In: The Insects of Australia. Melbourne University Press, Melbourne, pp. 141–179. Marshall, L.G., 1985. Geochronology and land-mammal biochronology of the trans-American faunal interchange. In: Stehli, F.G., Webb, S.D. (Eds.), The Great American Biotic Interchange. Plenum Press, New York, pp. 49–85. Martı´n, J.F., Gilles, A., Descimon, H., 2000. Molecular phylogeny and evolutionary patterns of the European satyrids (Lepidoptera: Satyridae) as revealed by mitochondrial gene sequences. Molecular Phylogenetics and Evolution 15, 70–82. Miller, L.D., 1968. The higher classification, phylogeny and zoogeography of the Satyridae (Lepidoptera). Memoirs of the American Entomological Society 24, 1–174. Miller, L.D., 1972. Revision of the Euptychiini (Satyridae): 1. Introduction and Paramacera Butler. Bulletin of the Allyn Museum 8, 1–18. Miller, L.D., 1974. Revision of the Euptchiini (Satyridae): 2. Cyllopsis R. Felder. Bulletin of the Allyn Museum 20, 1–98. Miller, L.D., 1976. Revision of the Euptychiini (Satyridae): 3. Megisto Hubner. Bulletin of the Allyn Museum 33, 1–23. Miller, L.D., 1978. Revision of the Euptychiini (Satyridae): 4. Pindis R. Felder. Bulletin of the Allyn Museum 50, 1–12. Mort, M.E., Soltis, P.E., Soltis, D.E., Mabry, M.L., 2000. Comparison of three methods for estimating internal support on phylogenetic trees. Systematic Biology 49, 160–171. Mound, L.A., Martin, J.H., Polaszek, A., 1994. The insect fauna of Selaginella (Pteridophyta: Lycopsida), with description of three new species. Journal of Natural History 28, 1403–1415. Murray, D.L., 2001. Systematics of euptychiine butterflies (Nymphalidae: Satyrinae: Euptychiina) based on larval morphology and DNA sequence data and the evolution of life history traits. Ph.D. dissertation, Louisiana State University, Baton Rouge, LA. Murray, D.L., 2001b. Immature stages and biology of Taygetis Hu¨bner (Lepidoptera: Nymphalidae). Proceedings of the Entomological Society of Washington 103, 932–945.

Murray, D.L., 2003. Immature stages and biology of Posttaygetis penelea Cramer (Lepidoptera: Nymphalidae: Satyrinae). Proceedings of the Entomological Society of Washington 105, 548–554. Nel, A., Nel, J., Balme, C., 1993. Un nouveau Lepidoptere Satyrinae fossile de lÕOligocene du Sud-Est de la France (Insecta, Lepidoptera, Nymphalidae). Linneana Belgica 14, 20–36. Posada, D., Crandall, K.A., 1998. Modeltest: Testing the model of DNA substitution. Bioinformatics 14, 271–275. Reeder, T.W., 1995. Phylogenetic relationships among Phrynosomatid lizards as inferred from mitochondrial ribosomal DNA sequences: Substitutional bias and information content of transitions relative to transversions. Molecular Phylogenetics and Evolution 4, 203– 222. Shimodaria, H., Hasegawa, M., 1999. Multiple comparisons of loglikelihoods with applications to phylogenetic inference. Molecular Biology and Evolution 13, 964–969. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87, 651–701. Singer, M.C., Mallet, J., 1985. Moss-feeding by a Satyrinae butterfly. Journal of Research on the Lepidoptera 24, 392. Singer, M.C., Ehrlich, P.R., Gilbert, L.E., 1971. Butterfly feeding on lycopsid. Science 172, 1341–1342. Singer, M.C., DeVries, P.J., Ehrlich, P.R., 1983. The Cissia confusa species-group in Costa Rica and Trinidad (Lepidoptera: Satyrinae). Zoological Journal of the Linnean Society 79, 101–119. Smith, A.B., 1994. Rooting molecular trees: Problems and strategies. Biological Journal of the Linnean Society 51, 279–292. Sourakov, A., 1996. Notes on the genus Calisto with descriptions of the immature stages (Part 1) (Lepidoptera: Nymphalidae: Satyrinae). Tropical Lepidoptera 7, 91–112. Stehi, F.G., Webb, S.D., 1985. A kaleidoscope of plates, faunal and floral dispersals, and sea level changes. In: Stehi, F.G., Webb, S.D. (Eds.), The Great American Biotic Interchange. Plenum Press, New York, pp. 3–6. Swofford, D.L., 2002. PAUP* Phylogenetic analysis using parsimony and other methods. Test version 4.0b5. Sinauer, Sunderland, MA. Viloria, A., 2003. Historical biogeography and the origins of the satyrine butterflies of the tropical Andes (Lepidoptera: Rhopalocera). In: Morrone, J.J., Bousquets, J.L. (Eds.), Una Perspectiva Latinoamericana de la Biogeografı´a. Las Prensas de Ciencias, Facultad de Ciencias Mexico City, pp. 247–261. Wahlberg, N., Weingartner, E., Nylin, S., 2003. Towards a better understanding of the higher systematics of Nymphalidae (Lepidoptera: Papilionoidea). Molecular Phylogenetics and Evolution 28, 473–484. Yang, Z., 1994. Estimating the pattern of nucleotide substitution. Journal of Molecular Evolution 39, 105–111.