Molecular phylogenetics of tsetse flies (Diptera: Glossinidae) based on mitochondrial (COI, 16S, ND2) and nuclear ribosomal DNA sequences, with an emphasis on the palpalis group

Molecular Phylogenetics and Evolution 49 (2008) 227–239

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev

Molecular phylogenetics of tsetse flies (Diptera: Glossinidae) based on mitochondrial (COI, 16S, ND2) and nuclear ribosomal DNA sequences, with an emphasis on the palpalis group N.A. Dyer a,*, S.P. Lawton a,d,e, S. Ravel c, K.S. Choi a, M.J. Lehane a, A.S. Robinson b, L.M. Okedi g, M.J.R. Hall e, P. Solano f, M.J. Donnelly a a

Vector Group, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool, Merseyside, L3 5QA, UK FAO/IAEA Agriculture and Biotechnology Laboratory, A-2444 Seibersdorf, Austria UMR177, IRD-CIRAD, TA A17/G, Campus International de Baillarguet, 34398 Montpelllier Cedex 5, France d Institute of Biological Sciences, University of Wales Aberystwyth, UK e The Natural History Museum, London, UK f IRD/CIRDES, 01 BP 454, Bobo-Dioulasso 01, Burkina Faso g Livestock Health Research Institute, P.O. Box 96, Tororo, Uganda b c

a r t i c l e

i n f o

Article history: Received 25 March 2008 Revised 8 July 2008 Accepted 13 July 2008 Available online 22 July 2008 Keywords: Tsetse Glossina Diagnostic PCR Palpalis Cryptic species

a b s t r a c t Relationships of 13 species of the genus Glossina (tsetse flies) were inferred from mitochondrial (cytochrome oxidase 1, NADH dehydrogenase 2 and 16S) and nuclear (internal transcribed spacer 1 of rDNA) sequences. The resulting phylogeny confirms the monophyly of the morphologically defined fusca, morsitans and palpalis subgenera. Genetic distances between palpalis and morsitans subspecies suggest that their status needs revision. In particular, cytochrome oxidase 1 sequences showed large geographical differences within G. palpalis palpalis, suggesting the existence of cryptic species within this subspecies. The morphology of palpalis group female genital plates was examined, and individuals were found varying outside the ranges specified by the standard identification keys, making definitive morphological classification impossible. A diagnostic PCR to distinguish G. palpalis palpalis, G. tachinoides and G. palpalis gambiensis based on length differences of internal transcribed spacer 1 sequences is presented. Ó 2008 Elsevier Inc. All rights reserved.

1. Introduction Tsetse flies (Glossina) are the major vectors of trypanosomiasis throughout sub-Saharan Africa, causing extensive morbidity and mortality in humans and live stock (Leak, 1999). Morphological characters such as genitalia, wing size and shape and abdominal colouration have been used to resolve the phylogenetic relationships of tsetse flies. However, the division of species into the three groups, (morsitans, formally and synonymous with subgenus Glossina; palpalis, formally and synonymous with subgenus Nemorhina, and fusca, formally and synonymous with subgenus Austenina) is primarily based on the differences in structural complexity of the genitalia and is supported by patterns of body hairs and habitat choice (Gooding and Krafsur, 2005; Gooding et al., 1991). Subgenus fusca, comprised of 12 species, forms a sister group to the palpalis and morsitans subgenera, and probably inhabits the ancestral habitat of tsetse flies (Leak, 1999). With the exception of G. longipennis, fusca group flies inhabit forests or dense thickets providing heavy * Corresponding author. Fax: +44 (0) 151 705 3369. E-mail addresses: [email protected], [email protected] (N.A. Dyer). 1055-7903/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2008.07.011

shade (Leak, 1999). palpalis group flies inhabit vegetation close to water, including forests, small island forests, gallery forests, ‘‘sacred” woods, banks of lakes, ‘‘niayes” and mangroves. Some species colonise cocoa, coffee or mango plantations (Solano et al., 2008). In contrast, morsitans group flies inhabit savannah and are generally more tolerant of desiccating conditions (Bursell, 1958). Savannah vegetation appeared in sub-Saharan Africa around the Miocene to Pliocene boundary, approximately 7–8 million years ago (Cerling et al., 1997). It is postulated that the morsitans group may have evolved from within the fusca group to adapt to this new savanna habitat (Bursell, 1958). Bursell did not address the evolution of palpalis group flies, but Machado discussed speciation within the palpalis group in an earlier publication (Machado, 1954). He suggested that the fuscipes and palpalis species, within the palpalis group, underwent allopatric speciation prior to the mid Quaternary. During this period the Congo River had no outflow into the Atlantic, and formed a barrier between West Africa and the Congo Basin. The three allopatric fuscipes subspecies fuscipes, quanzensis and martinii are thought to have evolved within the Congo basin due to retractions and separations of their forest habitats during dry periods in the Pliocene (Machado, 1954).

228

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

The genus Glossina is the only genus in the family Glossinidae (Brues et al., 1954; Pollock, 1971). The Glossinidae are placed in the superfamily Hippoboscoidea, previously proposed by Hennig as Glossiniodea (Hennig, 1971). The Glossinidae are in the dipteran group Calyptratae (Nirmala et al., 2001). Within the Glossina, provisional molecular analyses using isoenzyme electrophoresis (Gooding et al., 1991) and sequencing of an autosomal ribosomal internal transcribed spacer region (ITS2) provided good support for the monophyly of the three subgenera of Glossina but did not improve the resolution within each subgenus. These molecular analyses supported the contention that the forest dwelling fusca group forms a sister group to the palpalis and morsitans subgenera. Molecular analysis has also been used to investigate the position the Glossinidae within the Hippoboscoidea, and the Hippoboicoidea within the Calyptratae. Phylogenies of nuclear 18S and mitochondrial 16S rDNA, using G. palpalis and G. morsitans to represent Glossinidae, differ according to the method of phylogenetic inference (Dittmar et al., 2006; Nirmala et al., 2001). More recently, the phylogeny of the Hippoboscoidea, including seven Glossina species was estimated using two mitochondrial (COI and 16S) and two nuclear (CAD and 28S) markers (Petersen et al., 2007). This study confirmed the monophyly of the Glossinidae, and that the fusca group species G. brevipalpis was a sister group to all the other tsetse species sampled. Carlson et al. (1993) derived phenetic relationships between 26 species and subspecies using gas chromatographic analysis of cuticular alkenes. Again the three clades were broadly supported, but species considered to be within the fusca group such as G. longipennis, G. medicorum and G. nigrofusca nigrofusca were mixed within the palpalis clade. This apportioning of species to inappropriate clades is likely to be a result of convergence due to environmental adaptation as seen in other disease vectors (Maingon et al., 2003). The taxonomic position of other species is also uncertain (Gooding and Krafsur, 2005). Glossina austeni was placed in the morsitans group based on classical taxonomy using characters of the male genitalia. However, female genital characters are shared with the fusca group and their ecology is very similar to that of palpalis group (Gooding and Krafsur, 2005). Enzyme analysis placed G. austeni as a sister group of morsitans and DNA sequence data indicate that G. austeni is more closely related to the subspecies of G. morsitans than to the species of the palpalis subgroup (Gooding et al., 1991). Although this indicates that G. austeni is more akin to the morsitans clade it does not imply that G. austeni should be placed within the morsitans subgenus. Chen et al. (1999) examined DNA sequence variation from the internal transcribed spacer 2 ribosomal region (ITS2) and concurred with the morphological classification of G. austeni and indeed the morphological phylogeny of the genus as a whole. However, Gooding and Krafsur (2005) highlighted that identification of the boundaries defining the subgenera cannot be inferred from current available genetic data. In Petersen et al. (2007), G. austeni partitioned with strong bootstrap support to the morsitans group, forming a sister clade with G. pallidipes to G. morsitans and G. swynnertoni. However, in the palpalis group, only G. fuscipes and G. palpalis were sampled, so a reliable phylogeny for the palpalis group is still lacking. In addition to the uncertainties surrounding the validity of the subgeneric groupings within the Glossina genus there are a number of taxa of uncertain taxonomic status at the level of species/subspecies. Within the palpalis group there are five taxa originally accorded subspecific status by Machado (1954) and which have not been revised since this time. Even within these subspecies there is evidence for possible cryptic species, for example the hybrid sterility and differences in head morphology of G .p. palpalis in colonies originating in Bas Zaire (present day Democratic Republic of Congo) and Nigeria (Gooding et al., 2004).

Similarly within the morsitans subgroup there are three subspecific forms within the nominal taxon (Machado, 1970), although recently Krafsur and Endsley (2006) used microsatellite data to argue of the elevation of the three subspecies of G. morsitans (G. morsitans morsitans, G. morsitans submorsitans and G. morsitans centralis) to specific status. In addition to the taxonomic importance of resolving the status and inter-relationships of the species within the genus Glossina there is also a compelling public-health rationale. The flies within the morsitans and palpalis groups are the major vectors of nagana or Animal African Trypanosomiasis (AAT) and Human African Trypanosomiasis (HAT) respectively. AAT renders much of sub-Saharan Africa unsuitable for livestock production resulting in restricted agricultural development which has a profound effect on the economy of much of the continent with estimated annual losses of 4.5 Billion US$. The World Health Organisation (WHO) conservatively estimates that 60 million people are at risk in 37 countries covering 40% of Africa (11 M km2). In 2004 the WHO reported 17,000 new HAT cases (WHO, 2006). After a devastating epidemic in the early 20th century when a million people died of HAT, the disease had almost disappeared by the 1960s. But another HAT epidemic occurred through the 1990s with a disease burden of 2.05 million disability adjusted life years. At present the limited amount of tsetse control conducted is reliant upon wide scale insecticide use involving cattle pour-ons, aerial spraying or targets (Allsopp, 2001). Sterile insect release programmes are also proposed for the later stages of control campaigns (Vreysen et al., 2000). These anti-vector measures are reliant upon accurate identification of vector species (Gooding and Krafsur, 2005). In the present study, molecular phylogenies based on mitochondrial and nuclear gene sequences are used to investigate systematic and evolutionary relationship between the three tsetse groups, and particularly between species within the subgenera morsitans and palpalis. Sequence data from both mitochondrial (cytochrome oxidase 1 (COI) 16S ribosomal (16S), NADH dehydrogenase subunit 2 (ND2)) and nuclear internal transcribed spacer 1 of ribosomal DNA (ITS1) loci are presented. The aims of the study were to resolve interspecific relationships within the palpalis group of Glossina, to determine whether mitochondrial and additional nuclear markers support the elevation of the three subspecies of G. morsitans to specific status, to attempt to resolve the status of the putative subspecies within the palpalis group and to generate a diagnostic PCR to distinguish morphologically similar subspecies of palpalis. 2. Materials and methods 2.1. Taxon sampling Thirteen of the 31 species/subspecies within the Glossina genus were obtained from a variety of sources, including both wild caught flies and a number of colonies that originated from material collected in sub-Saharan Africa (Table 1). Collection efforts focussed upon the morsitans and palpalis group given their publichealth importance. 2.2. Molecular laboratory methods The Ballinger-Crabtree method was employed to extract DNA from the flies (Ballinger-Crabtree et al., 1992). Only three legs from each individual were used for analysis in order to maintain the specimen for morphological classification and to ensure that no organisms from the gut or mouthparts would contaminate the fly sequences. DNA concentration was measured using the Quant-iT PicoGreen dsDNA reagent (Invitrogen) using the manufacturer’s

229

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239 Table 1 Origin of specimens and sequences Species

Sample ID

Country

Location

COI

ND2

16S

G. austeni

austeni_RSA

RSA

Colony RSA

EU591834

EU591888

EU591929

Colony RSA

EU591869

EU591891

Colony IAEA

EU591837

EU591892

EU591828

austeni_IAEA G. brevipalpis

Colony IAEA

Collector/ donor Karin Kappmeier

EU591928

brevipalpis colony RSA brevipalpis colony IAEA_1 and 2

RSA

fuscipes_10–11, 13

Uganda

fuscipes_1–3

Uganda

fuscipes_7–8

Kenya

Buvuma Island, Busia, Tororo and Bugiri Districts Buvuma Island, Busia, Tororo and Bugiri Districts Manga island

fuscipes colony IAEA 1–3, 5

Central African Republic

International Atomic Energy Agency, colonised

EU591872 EU591873 EU591874 EU591875

G. fuscipes quanzensis

quanzensis_1, 5–7, 13

Democratic Republic of Congo

Kinshasa

G. tachinoides

tacinoides_1–4

Burkina Faso

G. tachinoides

tacinoides colony

G. medicorum

medicorum_1–3

G. morsitans centralis G. pallidipes

G. fuscipes fuscipes

ITS1

EU591923 EU591924 EU591939 EU591938

Loyce Okedi, Steve Torr

EU591901 EU591902 EU591903 EU591899 EU591900 EU591904

EU591906

EU591907 EU591908

EU591940

Alan Robinson

EU591870 EU591871

EU591893

EU591910 EU591909

EU591941 EU591942

Philémon Mansisa

Mouhoun river

EU591843 EU591844

EU591881 EU591882

EU591917

EU591936

Philippe Solano

Burkina Faso

Comoe River

EU591866 EU591867 EU591868

EU591878

z591927

EU591951

Philippe Solano

centralis_1–2

Tanzania

IAEA colonised

EU591835

EU591890

EU591921

Alan Robinson

pallidipes 5

Uganda

EU591925

Alan Robinson

pallidipes 1–4

Zimbabwe

IAEA colonised (originally Bristol?) Rekomitijie

G. morsitans morsitans

morsitans morsitans 3

Zimbabwe

G. morsitans submorsitans

submorsitans

G. pallicera pallicera

pallicera 1–3, 5–6

G. palpalis gambiensis

gambeinsis 1–3, 4, 6, 8

EU591826

Steve Torr

EU591916

EU591823 EU591845

EU591883 EU591894

EU591926

Martin Donnelly

LSTM, colonised

EU591836

EU591889

EU591920 EU591919

Mike Lehane

IAEA, colonised

EU591822

EU591879

EU591922

Alan Robinson

Liberia

Wedea, near Bong town

EU591861 EU591827 EU591862 EU591863 EU591864

EU591885 EU591886

EU591918

Guinea

(Soro, Mangue and Kassa)Magnakun (mangrove swamp near Dubreka)

EU591851 EU591852 EU591853

EU591880 EU591896

EU591911 EU591912

Colonised, origin uncertain Abuko, Banjuls area

EU591821

gambiensis_IAEA

G. palpalis palpalis

EU591876 EU591877

Alan Robinson, Karin Kappmeier

gambiensis_9–11

Gambia

gambiensis 13–16

Burkina Faso

Comoe River (comoé-folonzo)

EU591855 EU591854

palpalis 1–3

Bas Congo

palpalis_colony

Democratic Republic of Congo Nigeria

EU591840 EU591841 EU591842 EU591820

palpalis 4–6, 8, 10

Ivory Coast

Bonon Focus, on the Comoe river.

IAEA

EU591914

EU591849 EU591850

EU591846 EU591847 EU591848 EU591832 EU591833

EU591937

EU591931

EU591887

EU591915

EU591932

Robert Cheke

Mamadou Camera, Philippe Solano and Sophie Ravel Alan Robinson Philippe Solano and Sophie Ravel Dramane Kaba, Jérémy Bouyer, Issa Sidibé, Philémon Mansisa

EU591895

EU591935

Alan Robinson Philippe Solano and Sophie Ravel

(continued on next page)

230

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

Table 1 (continued) Species

Sample ID

Country

Location

COI

palpalis 11–12, 38

Togo

palpalis_13–15, 17

Liberia

River, Kpaza, 20Km SW of Fazao Haindi, near Bong town and Lugbe, Nimba County

palpalis_19–20, 30, 33–35

Cameroon

Fontem Focus

palpalis_21

Equatorial Guinea

Kogo

EU591838 EU591839 EU591856 EU591857 EU591858 EU591859 EU591865 EU591860 EU591829 EU591830 EU591831 EU591825

instructions. Briefly, a range of Lambda DNA standards ranging from 1 ng/ml to 1 lg/ml, and 1 ll of each DNA diluted in 99 ll of TE were pipetted into wells of a 96-well plate. One hundred microlitres of PicoGreen dsDNA reagent diluted 200-fold in TE was added to all wells and the plate was incubated for 3–5 min in the dark. Sample and standard fluorescence were measured using a Varioskan spectrophotometer and scanning software (Thermo Electron Corporation) and sample DNA concentrations were calculated from the linear equation derived from the standard curve. Morphological classification of some specimens was performed based upon the standard morphological identification keys for Glossina (Jordan, 1993). PCR was used to amplify partial sequences of COI, 16S, ND2 and ITS1 using the primer pairs given in Table 2. PCR conditions: COI: 15.95 ll double distilled water containing 2.5 ll 10 PCR buffer (Bioline), 2 ll of 10 mM dNTP (final concentration 0.8 mM), 1.25 ll of each 10 lM primer (final concentration 0.5 lM), 1.5 ll of 50 mM MgCl2 (final concentration 3 mM) was incubated with 0.25 U (0.05 ll) of BIOTaq DNA polymerase and 0.5 ll of template DNA (approximately 0.5 ng). Temperature cycles: 5 min 95 °C, 35 cycles of 93 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min, then 72 °C for 7 min. 16S: reagent concentrations as for COI except 0.5 U of BIOTaq DNA polymerase was used per reaction (0.1 ll). Temperature cycles: 5 min 95 °C, 30 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 1 min, then 72 °C for 10 min. ND2: reagent concentrations as for COI, temperature cycles: 30 cycles of 94 °C for 1 min, 54 °C for 1 min, 72 °C for 90 s. For ITS1, PCR was initially performed on G. fuscipes fuscipes, G. fuscipes quanzensis, G. pallidipes, G. p. gambiensis and G. medicorum samples using primers 5.8SCAS5p8sB1dshort and TCAS18sF1shorter, and ligated into the pGEM-TEASY

ND2

16S

EU591884

EU591897 EU591898

EU591905

EU591913

ITS1

Collector/donor

EU591933

Robert Cheke

EU591934

Robert Cheke

Philippe Solano and Sophie Ravel

Joao Pinto (DNAs already extracted)

vector (Promega) for sequencing. The resulting sequences were used to design the primers GlossinaITS1_for and GlossinaITS1_rev. PCR conditions for ITS1 were as for COI except MgCl2 was used at 3.5 mM. Temperature cycles: 5 min 95 °C, 30 cycles of 94 °C for 1 min, 62 °C for 1 min and 72 °C for 90 s, then 72 °C for 7 min. GlossinaITS1_for and ITS1_rev were used for direct sequencing. At four ambiguous positions found in both forward and reverse sequences, CodonCode Aligner (CodonCode Corporation) was used to select the majority peak automatically. Provisional analysis of ITS1 sequences revealed a 73 bp difference in the length of the ITS1 region in the closely related taxa G. p. palpalis and G. p. gambiensis, with G. tachinoides having an intermediate length. A PCR was designed that could be used to discriminate these three taxa based upon primers that were designed to anneal to the G. p. palpalis/G. p. gambiensis/G. tachinoides consensus sequence either side of the 73 bp deletion in G. p. gambiensis. PCR conditions: 16.2 ll double distilled water, 2.5 ll 10 PCR buffer (Bioline), 2 ll 10 mM dNTP (final concentration 0.8 mM), 1.25 ll of each primer (final concentration 0.5 lM each), 1.25 ll 50 mM MgCl2 (final concentration 2.5 mM) was incubated with 0.05 ll (0.25 U) of BIOTaq DNA polymerase and 0.5 ll (approximately 0.5 ng) of template DNA in a 25 ll reaction. Temperature cycles: 5 min 95 °C, 30 cycles of 95 °C for 30 s, 56 °C for 30 s and 72 °C for 30 s, then 72 °C for 7 min. The new PCR diagnostic was evaluated on a number of specimens that had been morphologically identified. Primers A10F and A10R were designed by G. Caccone from G. f. fuscipes sequences. 0.8 ng to 30 ng of DNA template were used in a 25 ll reaction. Temperature cycles: 3 min 95 °C, 40 cycles of 95 °C for 30 s, 54.5 °C for 30 s and 72 °C for 1 min, then 72 °C for 5 min.

Table 2 Summary of PCR primers used Primer name

Template

Primer sequence 50 –30

Published/designed by

COI CULR NI-J-12585 LR-N-12866 N2-J586 best guess TW-N1284 5.8SCAS5p8sB1dshort TCAS18sF1shorter GlossinaITS1_for GlossinaITS1_rev DiagFor DiagRev A10 F A10 R

COI COI 16S 16S ND2 ND2 ITS1 ITS1 ITS1 ITS1 ITS1 ITS1

TTGATTTTTTGGTCATCCAGAAGT TGAAGCTTAAATTCATTGCACTAATC GGTCCCTTACGAATTTGAATATATCCT ACATGATCTGAGTTCAAACCGG CCYTTTCATTTTTGATTYCC ACARCTTTGAAGGYTAWTAGTTT TGCGTTCAAAATGTCGATGTTCA CACACCGCCCGTCGCTACTA GTGATCCACCGCTTAGAGTGA GCAAAAGTTGACCGAACTTGA TGGACTTCGGATTAAGTACAACA TCATTATGCGCTATTAAGGTAAGC GCAACGCCAAGTGAAATAAAG TACTGGGCTCGCGTACATAAT

Simon et al. (1994) as CI-J-2195 H. Townson Simon et al. (1994) Simon et al. (1994) Modified from Simon et al. (1994) Simon et al. (1994) Modified from Ji et al. (2003) Modified from Ji et al. (2003) This work This work This work This work G. Caccone G. Caccone

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

2.3. Phylogenetic analysis For each PCR sequenced, forward and reverse sequences were aligned and traces examined using CodonCode Aligner (CodonCode Corporation). Sequences were aligned and trimmed using the ClustalW algorithm in MEGA version 4 (Tamura et al., 2007) with gap opening penalty 15, gap extension penalty 7.5, IUB weight matrix, transition weight 0.5 and delay divergent cut-off 30. For ITS1, initial alignments were rechecked and adjusted by hand. MEGA was also used to calculate the proportion of sites differing between pairs of sequences, which are quoted in the text as percentage differences. For all the following phylogenetic inference methods, positions containing gaps or missing data were not used. Multiphyl, which uses the Modelgenerator algorithm, was used before tree building for all datasets (Keane et al., 2006, 2007). Unless stated otherwise, the model of evolution favoured by the Akaike Information Criterion 1 (AIC1) was used. Distance based, maximum likelihood and Bayesian phylogenies were calculated for ND2, COI, 16S and ITS1 separately, and also for the concatenated mtDNA dataset consisting of ND2, COI and 16S sequences. For ITS1, distance and maximum likelihood-based phylogenies were calculated with the ambiguous bases encoded by ambiguity codes, as the majority peak and with ambiguous positions omitted from the alignment. PhyML online (Guindon et al., 2005) was used to calculate maximum likelihood trees with 500 bootstraps for the concatenated mitochondrial DNA dataset, and separately for COI, 16S, ND2 and ITS1. The model of evolution was specified, and the number of Ccategories was set to four, but other parameters were estimated from the data. Four C-rate categories were permitted to allow mutation rate variation among different sites along the sequence. PAUP 4.0 b10 version, (Swofford, 2002) was used to produce distance based neighbor-joining trees. PAUP was also used to implement the incongruence length difference test (partition homogeneity test), which detects incongruence based on the length difference of parsimony trees for the combined dataset and the individual datasets, using 10,000 replications and max trees set to 5000 (Farris et al., 1994). PAUP tree searches were heuristic, with default settings activated except for specifying the model of evolution and the number of bootstrap replications. The bootstrap consensus tree was inferred from 2000 replicates (Felsenstein, 1985). With default settings, the c parameter is 0.5. For the Bayesian inference of phylogeny MrBayes-3.1.2 (Huelsenbeck and Ronquist, 2001) was used. For each dataset the phylogeny was estimated using the same priors but different starting seeds at least three times. For each dataset, the analysis was stopped when the standard deviation of split frequencies was less than 0.01. The plot of log probability values of the data against generation number was then inspected by eye to confirm convergence. At convergence, there are no obvious trends in the direction of change of the log probability values as generation number increases. If convergence was not reached then the number of generations was increased until it was. Having established the number of generations for each dataset, two more replicates were performed using a minimum of the same number of generations. The three replicate trees were then inspected for any conflicts in tree topology, but there was no major conflict found. Priors, runs and burnins were as follows: COI, nst = 2, which specifies HKY85 (Hasegawa et al., 1985) 4  106 generations. The first 1000 trees (1  105 generations) were discarded as burnin, and other parameters were default. ITS1 was analysed using HKY (nst = 2) and (nst = 1) F81 (Felsenstein, 1981) models, ngen = 1  106. The first 1000 trees were discarded as burnin. ND2 + COI + 16S concatenated sequences were analysed as a partitioned dataset, with nst = 6 for ND2 and 16S, and NST = 2 for COI, with parameters being estimated separately for each partition, and calculations were run for 2  106 gen-

231

erations. The first 1000 trees (1  105 generations) were discarded as burnin. For the statistical parsimony analysis, haplotype trees for COI data from G. p. palpalis and G. p. gambiensis were generated using the algorithm of (Templeton et al., 1992). The TCS 1.21 programme was used to estimate the haplotype tree, with the connection limit (probability of parsimony) at 95% (Clement et al., 2000). A test of neutrality, the McDonald–Kreitman test (Mcdonald and Kreitman, 1991), was implemented in DNAsp for the COI dataset (Rozas and Rozas, 1995, 1997, 1999; Rozas et al., 2003). DNAsp was also used to calculate the average number of nucleotide differences between the clades defined by the TCS analysis. 2.4. Morphological laboratory methods The morphological criteria used to distinguish G. p. palpalis from G. p. gambiensis, and G. f. fuscipes from G. f. quanzensis and G. f. martinii are ratios of length to width of the dorsal plates (Jordan, 1993). We photographed specimens of G. p .palpalis, G. p. gambiensis, G. f. fuscipes and G. f. quanzensis using a Nikon Coolpix 4500 (Nikon, Japan) camera mounted on a Meiji EM2-TR (Meiji Techno, Japan) dissecting microscope at maximum zoom. We also measured specimens of the same species plus G. fuscipes martinii from photographs of mounted genital plates published by Machado (Machado, 1954) which contains the original descriptions of the forms. Ratios were calculated using measurements taken from the digital images using ImageJ software (http://rsb.info.nih.gov/ij/) and plotted in SigmaPlot (Systat Software Inc.).

3. Results 3.1. Phylogeny estimation using mitochondrial sequence data Tsetse sequence data was obtained for mitochondrial genes ND2, COI and 16S, and nuclear ITS1. Sequence data for the mitochondrial genes ND2 (613 nucleotides), COI (622 nucleotides) and 16S (228 nucleotides) was aligned from a total of 21 individuals from 13 tsetse species, producing a concatenated alignment of 1464 nucleotides. The datasets generated for each marker are summarised in Table 3. Individual gene phylogenies and alignments are available upon request. Distance based, maximum likelihood and Bayesian methods were used to generate trees from the alignment. The model of evolution specified by AIC1 was TIM + I + C, but GTR + I + C was used as it was easier to implement, and was favoured by a likelihood ratio test. The LnL values for these two models were very similar (see Table 3). Trees were also inferred using the simpler HKY + I + C model, which resulted in the same topology. It was not possible to find sequences in the public databases from all three genes from a more closely related species to use as an outgroup, so the following sequences from Drosophila melanogaster were used, ND2 AJ400907, COI AJ400907, 16S M37275. An incongruence length difference test was performed on the ND2, COI and 16S concatenated alignment to assess whether they were in conflict (alignment available upon request) (Farris et al., 1994). The test result did not suggest that the null hypothesis of congruent datasets should be rejected (P-value 0.8501). Since the incongruence length difference test result is not significant, and there are no major conflicts between the COI, ND2 and 16S phylogenies, the sequences of all three markers were concatenated and analysed together. The resulting phylogenies are presented in Fig. 1. There were no conflicts between the phylogenies inferred using the different methods, except for a polytomy instead of two sequential bifurcations between the three field collected G. f. fuscipes individuals when the data was analysed using Bayesian methods. The trees support the monophyly of the three clades of

232

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

Table 3 Summary of the genetic markers used Gene *

Number of taxa Alignment length Model selected (AIC1) LnL of selected model Number of haplotypes* Parsimony informative sites Polymorphic sites Invariant sites Singleton variable sites

COI

16S

ND2

ND2 + COI + 16S

ITS1

13 622 HKY + I + C 4257.662 63 175 194 428 19

13 228 TrN + I + C 1071.844 24 51 73 135 22

13 613 GTR + I + C 3476.513 28 233 264 346 31

21 1464 TIM + I + C (used GTR + I + C)a 7131.007 (7129.805)a 14 415 591 853 176

6 491 HKY + C 928.0395 13 (palpalis group only) 9 33 349 24

TrN: (Tamura and Nei, 1993) model. * Excluding outgroup(s). a GTR + I + C was favoured by a likelihood ratio test.

Fig. 1. Majority rule consensus maximum likelihood tree for the concatenated ND2 + COI + 16S alignment. The first numbers at the nodes are branch support as a percentage of the 500 bootstrap replications in PhyML estimated using the GTR + I + C model of evolution, the second numbers are branch support as a percentage of the 2000 bootstrap replications for the distance based method using the HKY + C model of evolution, and the third numbers are the posterior probabilities of those nodes from the Bayesian analysis. The outgroup D. melanogaster was used to root the tree.

palpalis (bootstrap support 100%), fusca (bootstrap support 100%), and morsitans (bootstrap support 95%). However, as the bootstrap support at the node separating G. pallidipes from the morsitans species in the neighbor-joining tree is 50% (distance tree), the positions of G. austeni and G. pallidipes within the morsitans group remain ambiguous (Hillis and Bull, 1993). The morsitans subspecies were well resolved from one another, with submorsitans as the sister group to morsitans and centralis. Within the palpalis group flies, G. pallicera and G. tachinoides are the sister group to the other taxa. G. fuscipes species then branch from G. p. palpalis and G. p. gambiensis. The subspecies G. p. palpalis and G. p. gambiensis are separated with strong bootstrap support (100% in both distance and maximum likelihood trees). Within G. fuscipes, there is an area of conflict with the accepted classifications, as G. f. fuscipes specimens from a colony held at the International Atomic Energy Agency (IAEA_2 and IAEA_4), originally derived from the Central African

Republic, cluster together with G. f. quanzensis from the Democratic Republic of the Congo (DRC), and not with G. f. fuscipes from southern Uganda and Kenya (fuscipes_1, 2 and 3). 3.2. Cytochrome oxidase I (COI) indicates structuring within palpalis subspecies In order to investigate the geographical variation within the palpalis species, a more detailed survey of COI sequences was performed. The data for COI are also the most comprehensive in taxon sampling, as we were able to include additional data for G. swynnertoni (Petersen et al., 2007). Partitioned Bremer support values for the morsitans group indicated that COI was the most important contributor to node support of the four genes analysed by Petersen et al. (2007). Therefore, to permit comparison of the phylogeny with the one previously published, several other sequences from

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

Petersen et al. (2007) were included. The 30 portion of the COI sequences, from the following Genbank Accession Nos. from was used: G. austeni EF531198, G. brevipalpis EF531199, G. fuscipes EF531226, G. morsitans EF531200, G. palpalis EF531202 and G. swynnertoni EF531203. G. pallidipes was however excluded as only the 50 region of COI was available. An alignment of partial sequences from the 30 portion of the COI gene (622 bp) was analysed from 111 individuals of 13 Glossina species. There were a total of 63 haplotypes. As outgroups, we used sequences from Drosophila melanogaster AJ400907, Stomoxys calcitrans EF531216 and Dipseliopoda setosa EF531224, a member of the Nycteribiidae, one of the sister families to the Glossinidae within the Hippoboscoidea (Petersen et al., 2007). We analysed the data using both maximum likelihood and distance methods using the HKY85 model with invariant sites and rate variation among sites (HKY + I + C). There was some conflict in the results of different phylogenetic inference methods: the maximum likelihood and Bayesian methods show G. fuscipes as the sister group to other palpalis group species, whereas in the distance based tree, G. austeni is a sister taxon to the palpalis group, and then within the palpalis group G. tachinoides and G. pallicera are sister groups to the other palpalis group species. The structure of the morsitans group also varied depending on the tree building method. In the Bayesian tree G. austeni and G. pallidipes were not assigned to the morsitans group. G. swynnertoni and G. morsitans submorsitans were sister taxa in both Bayesian and maximum likelihood trees, but swynnertoni was a sister taxon to the three morsitans subspecies in the distance tree. A strict consensus tree of COI inferred by the three methods is shown in Fig. 2. Unless there is a particular reason to trust one of the tree building methods over the others, the positions of G. austeni and G. pallidipes remain ambiguous. As in the combined mitochondrial trees, morsitans submorsitans was the sister group to the other two morsitans subspecies.

233

The distance, as measured by the proportion of sites differing between G. m. morsitans and G. m. centralis COI sequences was only 1.8%, but G. m. submorsitans seems to be more distant from the other two subspecies: 5% different from G. m. morsitans and 5.9% different from G. m. centralis. G. m. morsitans and G. m. centralis were 4.7% different from G. m. submorsitans. In all three trees, G. p. palpalis and G. p. gambiensis are separated with strong bootstrap support (95% in the maximum likelihood tree, 99% in the distance tree and posterior probability 0.92 in the Bayesian tree). COI data also gives strong support for subdivisions within G. p. palpalis. G. p. palpalis from Equatorial Guinea and Democratic Republic of the Congo (DRC) split from G. p. palpalis Ivory Coast, Togo, Liberia and Cameroon (with bootstrap support of 90% in the maximum likelihood tree, 98% in the distance tree and posterior probability 0.99 in the Bayesian tree). In the consensus tree for COI the only clear conflict with the accepted classifications, as opposed to instances where additional operational taxonomic units are suggested, concerns G. fuscipes. As in the trees inferred from the concatenated mitochondrial DNA, COI sequences from G. f. fuscipes specimens from the International Atomic Energy Agency (IAEA), cluster together with G. f. quanzensis from DRC, and not with G. f. fuscipes from southern Uganda and Kenya (Gff_1, 2 and 7, see Table 1 and Fig. 2). The G. fuscipes sequence from Petersen et al. (2007) surprisingly clustered with G. p. gambiensis. This could be due to the misidentification of this specimen, or to mitochondrial introgression. To investigate further the possible intraspecific subdivisions in G. p. palpalis and G. p. gambiensis, we decided to perform statistical parsimony analysis (Clement et al., 2000; Templeton et al., 1992) on an extensive collection of specimens from West Africa (Fig. 3, Supplementary Fig. S1). For the COI sequence alignment, the maximum number of mutational steps for which parsimony can

Fig. 2. The strict consensus of the maximum likelihood consensus, distance consensus and Bayesian trees inferred for the COI dataset. Maximum likelihood and distance analyses used the HKY + I + C model of evolution. Numbers shown above the branches are branch support values for the maximum likelihood tree as a percentage of 500 bootstrap replications, and for the distance tree as a percentage of 2000 bootstrap replications. Numbers below the branches are posterior probabilities from the Bayesian analysis. The outgroup D. melanogaster was used to root the tree.

234

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

Fig. 3. Location of G. p. gambiensis and G. p. palpalis sampled. Sampling sites in West Africa of individuals from which sampled haplotypes were used in the statistical parsimony analysis are shown. Black dots correspond to G. p. gambiensis, whereas grey dots correspond to G. p. palpalis.

be assumed with 95% confidence is 10. Five distinct clades were observed (Fig. S1). G. p. gambiensis specimens were contained within a single clade including specimens from Guinea, the Gambia and Burkina Faso and an individual from the G. p. gambiensis IAEA colony. The remaining four clades consisted of G. p. palpalis. The largest clade consisted of individuals from Liberia, Ivory Coast and Cameroon. The three flies collected in the Democratic Republic of the Congo formed a distinct clade (with an average of 5% nucleotides different from the main G. p. palpalis clade), as did the two individuals analysed from Equatorial Guinea (also averaging 5% nucleotides different from the main G. p. palpalis clade). The remaining clade was a divergent individual from Cameroon. The statistical parsimony analysis thus provides support for the split of G. p. palpalis from G. p. gambiensis, and also supports the existence of distinct subgroups within G. p. palpalis. 3.3. Nuclear marker: ITS1 Thirty-one individuals were sequenced from 10 species. There was a large amount of length variation in ITS1 across different Glossina species (see Table 4). The length variation made alignment between palpalis, morsitans and fusca group flies difficult: therefore this marker was only used to infer the phylogeny of the palpalis group. Due to the amount of length variation in ITS1and uncertain positional homology with ITS1 sequences from other taxa, there was no suitable non-Glossina sequence to use as an outgroup (Phillips, 2006). Analysis of palpalis group flies alone yields an alignment of 491 nucleotides. However, in comparison to the mtDNA markers, ITS1 is much less divergent between subspecies: G. p. gambiensis and G. p. palpalis have only two fixed differences, and G. f. quanzensis and G. f. fuscipes have two fixed differences. The number of parsimony informative sites was much lower than in the mitochondrial markers examined (Table 3). There was however

Table 4 Summary of ITS1 length variation in Glossina Species and specimen

Length of ITS1 PCR product

G. G. G. G. G. G. G. G. G. G.

880 778 919 633 597 618 618 543 545 618

medicorum_1 brevipalpis_1 pallidipes_2 austeni_1 tachinoides_2 fuscipes quanzensis_1, _6 fuscipes fuscipes_1, _2 palpalis gambiensis_1, _2 palpalis gambiensis_14 palpalis palpalis_4*

* The length of other G. p. palpalis individuals was not determined exactly, but there is some length variation due to indels of an AT repeat.

a length difference between G. p. gambiensis and G. p. palpalis due to a 73 bp deletion in gambiensis with respect to palpalis. Some G. p. palpalis PCR products contained heterozygous indels starting in an AT repeat region which starts at position 191 in the alignment. No polymorphic sites were found in four individuals from the G. f. fuscipes IAEA colony, but polymorphic sites and indels were detected in G. f. fuscipes field specimens from Uganda and Kenya. The level of intraindividual variation revealed by ambiguous positions by direct sequencing of PCR products was low: only four ambiguous sites were found in a total of 4555 sites sequenced directly from PCR products. Therefore ITS1 was used to infer phylogenetic trees. Trees produced from the palpalis group ITS1 sequences with ambiguous bases coded as the majority peak are shown in Fig. 4. Tree topology is sensitive to the model of evolution, method of tree inference and the alignment around the AT rich region. Tree topology is however insensitive to the inclusion or exclusion of the four positions in the alignment with ambiguous sites. G. f. fuscipes and G. f. quanzensis are robustly resolved as different taxa (boot-

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

235

Fig. 4. ITS1 trees. (a) Unrooted bootstrap consensus distance based neighbor-joining tree for ITS1 using the HKY + C model of sequence evolution. Branch support is given at the nodes as a percentage of the 2000 bootstrap replications. (b) Unrooted Bayesian tree for ITS1. This tree has the same topology as the maximum likelihood tree using the HKY + C model of evolution. Bootstrap values as a percentage of the 500 bootstrap repeats in PhyML, and the Bayesian posterior probabilities are shown at the nodes. Log likelihood for the tree topology shown is 991.

strap support 100% in distance tree, 99% in maximum likelihood tree and posterior probability 1.00 in Bayesian tree), but the unity of G. p. gambiensis is not supported by all three methods of tree inference used (compare Fig. 4a and b). G. p. gambiensis is not resolved as a distinct clade in the distance tree (Fig. 4a) although the monophyly of G. p. gambiensis has 67% bootstrap support in the maximum likelihood tree (Fig. 4b). The high frequency of indels and low frequency of replacement mutations made the ITS1 locus problematic for phylogenetic reconstruction. However it is a locus that can be utilised for design of species diagnostic PCR primers. 3.4. Morphological and molecular diagnostics The ratio of the length to width of the dorsal plates is a character used to distinguish G. f. quanzensis and G. f. martinii from G. f. fuscipes, and also to separate G. p. palpalis from G. p. gambiensis. As shown in Fig. 5, there is a large overlap in the ratios observed in these species both in the field collected and colonised flies from this study, and, in the case of the G. f. fuscipes versus G .f. quanzensis comparison, even between the specimens presented in Machado (1954). For the G. f. fuscipes versus G. f. quanzensis comparison, the field samples were collected well out of the postulated range of the alternative subspecies, so the variation seen probably represents naturally occurring intraspecific variation rather than the misclassification of specimens or hybridisation events. In the case of the G. p. palpalis versus G. p gambiensis comparison, there were also specimens well inside the known geographic ranges that showed an overlap in the dorsal plate ratio, for example G. p. palpalis from Cameroon overlapped with G. p. gambiensis from Guinea. Even in those individuals for which the COI sequence confirmed the tentative species identification, there is still considerable overlap between species in the dorsal plate ratio. Many of the specimens from Liberia, where G. p. palpalis and G. p. gambiensis both occur, were particularly difficult to classify by morphology alone. Identification of specimens in countries where G. p. palpalis and G. p. gambiensis distributions overlap would be greatly facilitated by a simple molecular diagnostic test.

The length variation in ITS1 of 73 nucleotides between G. p. gambiensis and G. p. palpalis, and the 20 nucleotide difference between G. tachinoides and G. p. palpalis facilitated the design a PCR-based species diagnostic test. 176 individuals were tested using the DiagFor DiagRev primer pair (28 G. tachinoides, 64 G .p. gambiensis and 84 G. p. palpalis). In all successful reactions (n = 174) the PCR product size distinguished morphologically identified G. p. gambiensis from G. p. palpalis and G. tachinoides (Fig. 6). All G. p. gambiensis individuals had a product size of 168 bp. For G. p. palpalis two product sizes were observed: one product of 241 bp, which was produced by individuals from Ivory Coast, Liberia, Cameroon and Togo and a larger fragment of around 320 bp which was observed in individuals from Democratic Republic of Congo. Eight individuals from Equatorial Guinea produced both 241 and 320 bp fragments, suggesting intraindividual length polymorphism in ITS1. Individuals from Equatorial Guinea and Democratic Republic of Congo were also the most divergent groups on the basis of mitochondrial COI sequences (Fig. 2, S1). G. tachinoides produced bands of 221 bp. A total of 91 G. p. palpalis and G. p. gambiensis were cross-checked against the microsatellite marker A10, including 59 specimens collected at locations near the border of their ranges in Liberia, and 32 specimens collected inside the known ranges. A10 primers amplified G. p. gambiensis DNA, resulting in a product of 194 bp but no product was produced in G. p. palpalis. Of the specimens tested in both diagnostics the results agreed in 97% of the cases. It could be useful to distinguish G. tachinoides from G. p. gambiensis in some locations where they cooccur, such as on the Mouhoun river, Burkina Faso, especially if specimens are damaged and thus difficult to distinguish by morphology (Bouyer et al., 2007).

4. Discussion The analysis of mitochondrial and nuclear DNA sequences presented in this paper support the previously proposed fusca, morsitans and palpalis sub genera within the genus Glossina. Both mitochondrial and nuclear DNA sequences support the same

236

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

Fig. 5. Dorsal plate measurements. (a) Photograph of dorsal plates of G. p. palpalis to demonstrate measurement method. Length and width measurements for the left plate are indicated. (b) The ratio of dorsal plate length/dorsal plate width plotted for individual dorsal plates, grouped by species and sample location. Abbreviations: Gfm, G. fuscipes martinii; Gff, G. f. fuscipes; Gfq, G. f. quanzensis; Gpg, G. p. gambiensis; Gpp, G. p. palpalis.

phylogeny within the palpalis sub group, with G. tachinoides and G. pallicera being the sister taxa to G. fuscipes, G. p. palpalis and G. p. gambiensis. The phylogeny of the morsitans group has not been fully resolved with the markers used here or in previous studies. Inclusion of the missing taxon G. longipalpis as well as the use of multiple markers will help to resolve morsitans group phylogeny in the future. Do the molecular markers examined in this study support the elevation of the morsitans subspecies to specific status? DNA barcoding is a method proposed to classify specimens to the species level using a fragment of mitochondrial DNA, usually from the 50 region of COI (Hebert et al., 2003a). 98% of cogeneric species pairs have greater than 2% sequence divergence in COI (Hebert et al., 2003b). Intraspecific divergences are generally less than 2%. More recently, the general usefulness of DNA barcoding has been called

into question: the use of DNA barcoding does not extend to all taxa, for example there were high identification error rates when barcoding was used to identify dipteran species (Meier et al., 2006) and simplistic distance based separation of sequences may lead to artefacts (DeSalle et al., 2005). Some caution should be exercised in interpreting pairwise sequence divergences, as the region used in this study was the 30 region of COI, not the 50 barcoding region. However, in a wide taxon sampling, the average sequence divergence of the 50 barcoding region of COI was observed to be 97.7% of that observed in the 30 region, (Hebert et al., 2003b), which is the region used in this study, so the pairwise sequence divergences should be largely comparable with the 2% threshold rule. The morsitans subspecies centralis and morsitans were only 1.8% divergent in their COI sequences. However, using either COI alone or the concatenated mitochondrial data, the three subspecies were separated

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

237

Fig. 6. Species diagnostic PCR. Representative PCR products amplified using the Diagfor Diagrev primer pair, for G. p. palpalis, G. p. gambiensis, G. tachinoides and a negative (no DNA) control, electrophoresed on a 3% agarose gel and visualised using ethidium bromide under UV light. The sizes of the standard DNA ladder bands are indicated.

with strong bootstrap support. When considering the present data together with that of Krafsur and Endsley (2006) the distances between COI sequences suggest that G. m. submorsitans is the most divergent, whereas microsatellite analysis suggests that G. m. centralis is the most divergent (Krafsur and Endsley, 2006). There appears to be an increasing body of evidence that these subspecies are in fact valid species, but that their renaming should be delayed until there are additional morphological and nuclear markers. Similar evidence also seems to be accumulating for the recognition of G. p. gambiensis and G. p. palpalis as valid specific taxa. G. p. gambiensis was described by Vanderplank, with the type specimen coming from Gambia, and G. p. palpalis from Nigeria was also described (Vanderplank, 1949). Analysis of the concatenated mitochondrial DNA dataset gives strong support to the separation of the two G. palpalis subspecies with an overall divergence of 5.7%. This split is also confirmed by the nuclear marker ITS1. This split was not evident from earlier analysis of ITS2 sequences by Chen et al. (1999). The species diagnostic PCR presented is simple to perform, and will be particularly useful in regions where G. p. palpalis and G. p. gambiensis distributions overlap each other, such as in Liberia and Ivory Coast. The COI sequences examined here are suggestive of significant structuring, and possible subspecies within G. p. palpalis. This is in agreement with previous mating experiments in which G. p. palpalis from colonies originating in Nigeria and Bas Zaire produced male sterile progeny (Gooding et al., 2004). The COI data and ITS1 length polymorphism suggest a possible north-western group consisting of flies from Liberia, Ivory Coast and Cameroon and Togo and a south eastern group of flies from DRC and Equatorial Guinea. However, there is a need for more crossing experiments between G. p. palpalis populations from across the range of this species before reaching conclusions about the distributions of potential subspecies. There is some evidence that marked genetic differentiation also occurs in G. p. gambiensis between Senegalese and Burkinabe populations (Solano et al., 1999). More sampling across this apparent discontinuity and from G. p. palpalis populations from DRC will be required before specific status can be conferred. With the exception of G. f. fuscipes and G. f. quanzensis, the COI sequences were sufficient to resolve the species and subspecies of Glossina examined in this study. For example, the average genetic distance between the palpalis subspecies, G. p. palpalis and G. p. gambiensis COI sequences was 6.6%, which is well over the threshold of 2% divergence for inter species comparisons (Hebert et al., 2003b). The two fuscipes subspecies were not separated in the manner predicted by their morphological classification by any of

the mitochondrial markers examined here, by either distance or character-based (maximum likelihood) approaches. Failure of COI barcoding methods to resolve species in the Diptera has been observed previously, with some species even having identical sequences in the 50 bar coding region (Meier et al., 2006). Low sequence divergence between a putitative species pair might indicate specimen misidentification, a short history of reproductive isolation, mitochondrial introgression or non-neutral evolution of COI. Non-neutral evolution of mitochondrial genes including cytochrome oxidase 1 has been observed previously (Jobson et al., 2004; Tarjuelo et al., 2004; Van Leeuwen et al., 2008). Substitutions observed in Glossina in COI seem to be selectively neutral as the McDonald Kreitman test produced no significant P-values to reject the null hypothesis of neutrality for species comparisons after a sequential Bonferroni correction. In the case of mitochondrial introgression, species pairs not resolvable using mtDNA sequences should still be distinguishable using nuclear genes. We sequenced nuclear ITS2 from several Glossina species including G. f. quanzensis (EU591946) and G. medicorum (EU591951). In contrast to several other insect genera (Di Muccio et al., 2000; Hackett et al., 2000), nuclear ITS2 sequences are not useful for separating Glossina species beyond the subgeneric level (Chen et al., 1999 and data not shown). ITS1 was a more useful marker, at least within the palpalis subgenus, and resolved all the palpalis specimens sequenced here to subspecies level, including G. fuscipes quanzensis and G. fuscipes fuscipes. However, the separation of these subspecies is based on rather few character differences, and length polymorphisms make the use of ITS1 more problematic in the cases where there is intraindividual length polymorphism, and for more distantly related species of Glossina. Following this study, the status of the G. fuscipes subspecies remains uncertain. The mitochondrial sequences for field collected G. f. fuscipes from Kenya and Uganda, and G. f. fuscipes from the IAEA colony, which originated in the Central African Republic are very distinct, with 1.9% sequence divergence over the 1464 bp mitochondrial alignment. Field collected G. f. fuscipes are also distinct from G. f. quanzensis with 2.0% sequence divergence. However, G. f. quanzensis and colonised G. f. fuscipes, although differing in morphology, origin of collection and ITS1, have only 0.4% sequence divergence. This might suggest an introgression event from G. f. quanzensis into G. f. fuscipes in the Central African Republic, or that the fuscipes subspecies are currently misclassified. As well as gathering additional molecular evidence, ecological and biological data such as evidence for reproductive isolation should be taken into account when defining species. To our knowledge, there are no

238

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239

documented crossing experiments between G. f. fuscipes and G. f. quanzensis, or G. f. quanzensis and G. f. martinii. Crossing experiments were carried out between G. f. fuscipes and G. f. martinii (Vanderplank, 1948), in which male G. f. fuscipes successfully inseminated a proportion of female G. f. martinii, with a fraction of the matings resulting in progeny. However, mating between male G. f. martinii and female G. f. fuscipes resulted in the death of most of the females, a considerable physiological barrier to reproduction. In the current study we were unfortunately unable to obtain any specimens of G. f. martinii, but it would be useful to analyse sequences from G. f. martinii, if suitable specimens can be obtained in the future. The present analysis suggests that there may have either been mitochondrial introgression between G. f. quanzensis and G. f. fuscipes, or there may be more than one subspecies within G. f. fuscipes. It is now necessary to reassess what the true subspecies are within fuscipes. To do this, sampling of G. f. martinii, G. f. fuscipes and G. f. quanzensis from across the ranges of these subspecies, and the analysis of further nuclear markers will be essential. A complete set of fuscipes species might allow us test Machado’s hypothesis on the speciation of the fuscipes species being caused by the changing river systems and historical forest contraction and expansion. To resolve with greater confidence the phylogeny of the genus Glossina there is an urgent need for better nuclear markers. Mitochondrial DNA is useful, but could be misleading due to possible introgression events. The marker of choice should be neutral, have a higher mutation rate than ITS1, and not suffer from too much length polymorphism. With the aid of the cDNA and genomic sequences now becoming available (Aksoy et al., 2005) we are currently developing nuclear DNA markers for Glossina. Acknowledgments We thank Robert Cheke, Karin Kappmeier, Steve Torr, Philémon Mansisa, Mamadou Camera, Jérémy Bouyer, Issa Sidibé, Dramane Kaba, Patrick Abila, Rogers Azabo, Andreia Furtado and João Pinto for provision of field collected and colony reared specimens or extracted DNAs. We are grateful to Elliot Krafsur and Gerardo Marquez for sharing unpublished Haematobia irritans and Stomoxys calcitrans 16S sequences with us, and to Keith Steen and Laetitia Gardes for technical assistance. We are grateful to Alistair Darby, Jarek Krzywinski, Jenny Lindh, David Weetman and Craig Wilding for fruitful discussions during the preparation of this manuscript. This work was funded by an EU INCO grant. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ympev.2008.07.011. References Aksoy, S., Berriman, M., Hall, N., Hattori, M., Hide, W., Lehane, M.J., 2005. A case for a Glossina genome project. Trends in Parasitology 21, 107–111. Allsopp, R., 2001. Options for vector control against trypanosomiasis in Africa. Trends in Parasitology 17, 15–19. Ballinger-Crabtree, M.E., Black, I.W.C., Miller, B.R., 1992. Use of genetic polymorphisms detected by the random-amplified polymorphic DNA polymerase chain reaction (RAPD-PCR) for differentiation and identification of Aedes aegypti subspecies and populations. American Journal of Tropical Medicine and Hygiene 47, 893–901. Bouyer, J., Ravel, S., Dujardin, J.P., de Meeus, T., Vial, L., Thevenon, S., Guerrini, L., Sidibe, I., Solano, P., 2007. Population structuring of Glossina palpalis gambiensis (Diptera: Glossinidae) according to landscape fragmentation in the Mouhoun river, Burkina Faso. Journal of medical Entomology 44, 788– 795. Brues, C.T., Melander, A.L., Carpenter, F.M., 1954. Classification of Insects. Harvard University Press, Cambridge, MA. p. 917. Bursell, E., 1958. The water balance of tsetse pupae. Philosophical Transactions of the Royal Society B Biological Sciences 144, 179–210.

Carlson, D.A., Milstrey, S.K., Narang, S.K., 1993. Classification of tseste flies Glossina spp. (Diptera, Glossinidae) by gas chromatographic analysis of cuticular components. Bulletin of Entomological Research 83, 507–515. Cerling, T.E., Harris, J.M., Ambrose, S.H., Leakey, M.G., Solounias, N., 1997. Dietary and environmental reconstruction with stable isotope analyses of herbivore tooth enamel from the Miocene locality of Fort Ternan, Kenya. Journal of Human Evolution 33, 635–650. Chen, X., Li, S., Aksoy, S., 1999. Concordant evolution of a symbiont with its host insect species: molecular phylogeny of genus Glossina and its bacteriomeassociated endosymbiont, Wigglesworthia glossinidia. Journal of Molecular Evolution 48, 49–58. Clement, M., Posada, D., Crandall, K.A., 2000. TCS: a computer program to estimate gene genealogies. Molecular Ecology 9, 1657–1659. DeSalle, R., Egan, M.G., Siddall, M., 2005. The unholy trinity: taxonomy, species delimitation and DNA barcoding. Philosophical Transactions of the Royal Society B Biological Sciences 360, 1905–1916. Di Muccio, T., Marinucci, M., Frusteri, L., Maroli, M., Pesson, B., Gramiccia, M., 2000. Phylogenetic analysis of Phlebotomus species belonging to the subgenus Larroussius (Diptera, psychodidae) by ITS2 rDNA sequences. Insect Biochemistry and Molecular Biology 30, 387–393. Dittmar, K., Porter, M.L., Murray, S., Whiting, M.F., 2006. Molecular phylogenetic analysis of nycteribiid and streblid bat flies (Diptera: Brachycera, Calyptratae): implications for host associations and phylogeographic origins. Molecular Phylogenetics and Evolution 38, 155–170. Farris, J.S., Kallersjo, M., Kluge, A.G., Bult, C., 1994. Testing significance of incongruence. Cladistics 10, 315–319. Felsenstein, J., 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. Journal of Molecular Evolution 17, 368–376. Felsenstein, J., 1985. Confidence-limits on phylogenies—an approach using the bootstrap. Evolution 39, 783–791. Gooding, R.H., Krafsur, E.S., 2005. Tsetse genetics: contributions to biology, systematics, and control of tsetse flies. Annual Review of Entomology 50, 101–123. Gooding, R.H., Moloo, S.K., Rolseth, B.M., 1991. Genetic variation in Glossina brevipalpis, G. longipennis and Glossina pallidipes, and the phenetic relationships of Glossina species. Medical and Veterinary Entomology 5, 165–173. Gooding, R.H., Solano, P., Ravel, S., 2004. X-chromosome mapping experiments suggest occurrence of cryptic species in the tsetse fly Glossina palpalis palpalis. Canadian Journal of Zoology 82, 1902–1909. Guindon, S., Lethiec, F., Duroux, P., Gascuel, O., 2005. PHYML Online—a web server for fast maximum likelihood-based phylogenetic inference. Nucleic Acids Research 33, W557–W559. Hackett, B.J., Gimnig, J., Guelbeogo, W., Costantini, C., Koekemoer, L.L., Coetzee, M., Collins, F.H., Besansky, N.J., 2000. Ribosomal DNA internal transcribed spacer (ITS2) sequences differentiate Anopheles funestus and An. rivulorum, and uncover a cryptic taxon. Insect Molecular Biology 9, 369–374. Hasegawa, M., Kishino, H., Yano, T., 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22, 160– 174. Hebert, P.D., Cywinska, A., Ball, S.L., deWaard, J.R., 2003a. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London. Series B, Biological Sciences 270, 313–321. Hebert, P.D., Ratnasingham, S., deWaard, J.R., 2003b. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London. Series B, Biological Sciences 270 (Suppl. 1), S96–S99. Hennig, W., 1971. Neue Untersuchungen über die Familien der Diptera Schizophora (Diptera: Cyclorrhapha). Stuttgarter Beiträge zur Naturkunde 226, 1–76. Hillis, D.M., Bull, J.J., 1993. An empirical-test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systematic Biology 42, 182–192. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics (Oxford, England) 17, 754–755. Ji, Y.J., Zhang, D.X., He, L.J., 2003. Evolutionary conservation and versatility of a new set of primers for amplifying the ribosomal internal transcribed spacer regions in insects and other invertebrates. Molecular Ecology Notes 3, 581–585. Jobson, R.W., Nielsen, R., Laakkonen, L., Wikstrom, M., Albert, V.A., 2004. Adaptive evolution of cytochrome c oxidase: infrastructure for a carnivorous plant radiation. Proceedings of the National Academy of Sciences of the United States of America 101, 18064–18068. Jordan, A.M., 1993. Tsetse-flies (Glossinidae). In: Lane, R.P., Crosskey, R.W. (Eds.), Medical Insects and Arachnids. Chapman and Hall, pp. 333–361. Keane, T.M., Creevey, C.J., Pentony, M.M., Naughton, T.J., McLnerney, J.O., 2006. Assessment of methods for amino acid matrix selection and their use on empirical data shows that ad hoc assumptions for choice of matrix are not justified. BMC Evolutionary Biology 6, 29. Keane, T.M., Naughton, T.J., McInerney, J.O., 2007. MultiPhyl: a high-throughput phylogenomics webserver using distributed computing. Nucleic Acids Research 35, W33–W37. Krafsur, E.S., Endsley, M.A., 2006. Shared microsatellite loci in Glossina morsitans sensu lato (Diptera: Glossinidae). Journal of Medical Entomology 43, 640–642. Leak, S.G.A., 1999. Tsetse biology and ecology: their role in the epidemiology and control of trypanosomosis. CAB International. Machado, A.d.B., 1954. Révision systématique des glossines du groupe palpalis (Diptera). Museo do Dundo, Companhia de Diamantes de Angola Lisboa, 22. Machado, A.D.B., 1970. Les races géographiques de Glossina morsitans. In: Tsetse Fly Breeding under Laboratory Conditions and its Practical Application. In:

N.A. Dyer et al. / Molecular Phylogenetics and Evolution 49 (2008) 227–239 Azevedo, E.J.d. (Ed.), First Int. Symp. 11–23 April 1969. Junta Invest. Ultramar, Lisbon, pp. 471–486. Maingon, R.D., Ward, R.D., Hamilton, J.G., Noyes, H.A., Souza, N., Kemp, S.J., Watts, P.C., 2003. Genetic identification of two sibling species of Lutzomyia longipalpis (Diptera: Psychodidae) that produce distinct male sex pheromones in Sobral, Ceara State, Brazil. Molecular Ecology 12, 1879–1894. Mcdonald, J.H., Kreitman, M., 1991. Adaptive protein evolution at the Adh locus in Drosophila. Nature 351, 652–654. Meier, R., Shiyang, K., Vaidya, G., Ng, P.K., 2006. DNA barcoding and taxonomy in Diptera: a tale of high intraspecific variability and low identification success. Systematic Biology 55, 715–728. Nirmala, X., Hypsa, V., Zurovec, M., 2001. Molecular phylogeny of Calyptratae (Diptera: Brachycera): the evolution of 18S and 16S ribosomal rDNAs in higher dipterans and their use in phylogenetic inference. Insect Molecular Biology 10, 475–485. Petersen, F.T., Meier, R., Kutty, S.N., Wiegmann, B.M., 2007. The phylogeny and evolution of host choice in the Hippoboscoidea (Diptera) as reconstructed using four molecular markers. Molecular Phylogenetics and Evolution 45, 111–122. Phillips, A.J., 2006. Homology assessment and molecular sequence alignment. Journal of Biomedical Informatics 39, 18–33. Pollock, J.N., 1971. Origin of tsetse flies—new theory. Journal of Entomology Series B Taxonomy 40, 101–109. Rozas, J., Rozas, R., 1995. DnaSP, DNA sequence polymorphism: an interactive program for estimating population genetics parameters from DNA sequence data. Computer Applications in the Bioscience 11, 621–625. Rozas, J., Rozas, R., 1997. DnaSP version 2.0: a novel software package for extensive molecular population genetics analysis. Computer Applications in the Bioscience 13, 307–311. Rozas, J., Rozas, R., 1999. DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics (Oxford, England) 15, 174–175. Rozas, J., Sanchez-DelBarrio, J.C., Messeguer, X., Rozas, R., 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics (Oxford, England) 19, 2496–2497. Simon, C., Frati, F., Bechenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87, 651–701.

239

Solano, P., Bouyer, J., Itard, J., Cuisance, D., 2008. In: Lefèvre, P., Chermette, J., Blancou, R., Uilenberg, G. (Eds.), Infectious and Parasitic Diseases of Livestock. Lavoisier Tec&Doc, pp. 153–181. Solano, P., de La Rocque, S., Cuisance, D., Geoffroy, B., De Meeus, T., Cuny, G., Duvallet, G., 1999. Intraspecific variability in natural populations of Glossina palpalis gambiensis from West Africa, revealed by genetic and morphometric analyses. Medical and Veterinary Entomology 13, 401–407. Swofford, D.L., 2002. PAUP: Phylogenetic Analysis using Parsimony ( and Other Methods). Sinauer Associates, Sunderland, MA. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10, 512–526. Tarjuelo, I., Posada, D., Crandall, K.A., Pascual, M., Turon, X., 2004. Phylogeography and speciation of colour morphs in the colonial ascidian Pseudodistoma crucigaster. Molecular Ecology 13, 3125–3136. Templeton, A.R., Crandall, K.A., Sing, C.F., 1992. A cladistic-analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping and DNA-sequence data. 3. Cladogram estimation. Genetics 132, 619–633. Vanderplank, F.L., 1948. Experiments in cross-breeding tsetse-flies (Glossina species). Annals of Tropical Medicine and Parasitology 42, 131–152. Vanderplank, F.L., 1949. The classification of Glossina palpalis, including the descriptions of new subspecies and hybrids. Proceedings of the Royal Entomological Society of London, Series B: Taxonomy 18, 69–77. Van Leeuwen, T., Vanholme, B., Van Pottelberge, S., Van Nieuwenhuyse, P., Nauen, R., Tirry, L., Denholm, I., 2008. Mitochondrial heteroplasmy and the evolution of insecticide resistance: non-Mendelian inheritance in action. Proceedings of the National Academy of Sciences of the United States of America 105, 5980–5985. Vreysen, M.J., Saleh, K.M., Ali, M.Y., Abdulla, A.M., Zhu, Z.R., Juma, K.G., Dyck, V.A., Msangi, A.R., Mkonyi, P.A., Feldmann, H.U., 2000. Glossina austeni (Diptera: Glossinidae) eradicated on the island of Unguja, Zanzibar, using the sterile insect technique. Journal of Economic Entomology 93, 123–135. WHO WER, 2006. Human African Trypanosomiasis (Sleeping Sickness): Epidemiological Update. Weekly epidemiological record/Health Section of the Secretariat of the League of Nations (Releve epidemiologique hebdomadaire/ Section d’hygiene du Secretariat de la Societe des Nations), vol. 81, pp. 71–80.