Molecular phylogeny of methylotrophs in a deep-sea sediment from a tropical west Pacific Warm Pool

FEMS Microbiology Ecology 47 (2004) 77^84

www.fems-microbiology.org

Molecular phylogeny of methylotrophs in a deep-sea sediment from a tropical west Paci¢c Warm Pool Peng Wang a

a;b;c

, Fengping Wang

a;b

, Meixiang Xu

a;b

, Xiang Xiao

a;b;

Key Laboratory of Marine Biogenetic Resources, State Oceanic Administration, Xiamen, PR China b Third Institute of Oceanography, State Oceanic Administration, Xiamen, PR China c China Oceanic University, Qingdao, PR China Received 19 May 2003; received in revised form 26 August 2003; accepted 16 September 2003 First published online 5 November 2003

Abstract The presence and phylogeny of methylotrophs, including methanotrophs, in a deep-sea sediment of a tropical west Pacific Warm Pool site WP was investigated by molecular marker-based analysis of mxaF, pmoA and archaeal 16S rRNA genes. MxaF amino acid sequence analysis revealed that microbes belonging to the K-Proteobacteria and most related to Hyphomicrobium and Methylobacterium were the dominant aerobic methylotrophs in this deep-sea sediment ; also, a small percentage of type II methanotrophs, closely related to Methylocystis and Methylosinus, were detected in this environment. On the other hand, the use of a pmoA gene marker could not demonstrate the presence of any methanotrophs in this environment, suggesting that the mxaF gene probe is a more suitable marker in this deep-sea sediment for the detection of methylotrophs (including methanotrophs). mxaF quantitative polymerase chain reaction results showed that the west Pacific WP sediment contained approximately 3U104 5 methylotrophs per gram sediment, 10^100 times more than the samples collected from several other deep-sea Pacific sediments, but, on the other hand, about 10 times less than the amounts present in samples collected from rice and flower garden soil. Archaeal diversity as analyzed by 16S rRNA gene sequences indicated that a nonthermophilic marine group I crenarchaeote was the major archaeal group present in the west Pacific WP. 7 2003 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords : Archaeon ; Deep-sea ; Methylotroph ; mxaF; pmoA; Sediment

1. Introduction Methylotrophs are a physiological group of bacteria, which can utilize methane (methanotrophs) and/or a variety of other one-carbon (C1 ) compounds more reduced than formic acid, such as methanol and methylated amines, as their sole carbon and energy source [1]. They play an essential role in the Earth’s carbon cycling, by means of their participation in methane oxidation and C1 metabolism. Methylotrophs are widely distributed in natural habitats. Phylogenetic studies on methanotrophs in various environments have been performed, for example in soils [2], rice plant roots and soil [3,4], fresh and marine waters [5] and sediments [1,6]. Methane oxidation has been

* Corresponding author. Tel. : +86 (592) 2195236; Fax : +86 (592) 2085376. E-mail address : [email protected] (X. Xiao).

observed in both aerobic and anaerobic environments [1,7^9], although no microbe capable of methane oxidation under anaerobic conditions has been isolated so far. By using several culture-independent methods (16S rRNA gene analysis, £uorescence in situ hybridization, secondary ion mass spectrometry), it has been revealed that at least two distinct groups of archaea are involved in the anaerobic methane oxidation in anoxic environments [10,11]. Generally, open ocean deep-sea sediments are regarded as organic-poor, low-methane, low-oxygen, dark and cold (1^2‡C) environments [8,12]. Until now, only a limited number of microbial diversity analyses of deep-sea sediments have particularly focused on the hydrothermal vent areas, the methane hydrate regions [13^15]. From a deepsea water, a type I methanotroph (Methylomonas pelagica) was isolated and partly characterized [16]. Methylotrophs probably belong to the key components of this extreme biosystem, due to their essential roles in carbon cycling. However, the diversity of methylotrophs in deep-sea sediments has not been investigated so far, since the main

0168-6496 / 03 / $22.00 7 2003 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/S0168-6496(03)00252-6

FEMSEC 1595 22-12-03

78

P. Wang et al. / FEMS Microbiology Ecology 47 (2004) 77^84

e¡orts in deep-sea microbial study have been directed toward piezophilic bacteria [17,18]. Microbial molecular phylogenetic studies based on 16S rRNA gene sequences and/or conserved functional gene sequences have greatly expanded our knowledge of microbial diversity in nature. Conserved functional gene probes are particularly useful in aerobic methylotroph diversity investigations, as methylotrophs span very wide taxa. The most commonly used functional gene markers for methylotroph and methanotroph diversity study are mxaF and pmoA [19,20]. Almost all known methanotrophs contain a functional pmoA gene, encoding the K subunit of the particulate methane monooxygenase. The pmoA gene has been used for methanotroph diversity investigations in various environments [3,4]. However, the use of pmoA could not demonstrate the presence of a group of methylotrophs which could use C1 compounds other than methane as the sole carbon and energy source and therefore are involved in C1 metabolism in nature. The limitation of pmoA in methylotroph diversity analysis could be compensated by the use of another functional gene marker, mxaF, which is present in all methylotrophs. All known Gramnegative methylotrophs comprise the key enzyme methanol dehydrogenase (MDH), which is able to oxidize methanol to formaldehyde, the intermediate of both assimilative and dissimilative metabolism in methylotrophs [1,19]. The large subunit of MDH is encoded by the mxaF gene, being 1.8 kb in size. The conserved region of the mxaF gene has been developed as a functional gene marker for methylotroph diversity studies [3,4,19]. Combined use of pmoA and mxaF gene markers may help to address the roles of a larger group of organisms, including methanotrophs, that can assimilate C1 compounds in the environment. The tropical west Paci¢c Warm Pool (WP), with surface water temperature s 28‡C, is a geologically important area, being fundamental to the climate of the Earth, since it drives the world’s most intense atmospheric convection [21]. The tropical Paci¢c serves as a heat engine for the Earth’s climate and as a vapor source for its hydrological cycle [22]. Despite its importance, the microbial ecology of the tropical west Paci¢c WP remains unexplored. In this study, we combined the use of mxaF and pmoA gene probes for detecting aerobic methylotrophic diversity in the west Paci¢c WP. In addition, the population of archaea in this environment was assayed by 16S rRNA gene sequences, in order to detect the presence of microbes which may be involved in anaerobic methane oxidation.

2. Materials and methods 2.1. Sample collection and DNA extraction The sediment sample was taken from the tropical west Paci¢c WP site (142‡30P08QE, 8‡00P11QN, 1914 m) during

the cruise of DaYang No. 1 in 2001 by a multi-core sampler. The 12-cm sediment was transferred to sterile Falcon tubes in clean bench and stored aseptically at 320‡C. The oxygen concentration at the sediment surface was measured to be 230.87 WM (data provided by Dr. J.Y. Ni, personal communication). The top 7 cm of the sediment was used for DNA extraction. For comparison, sediment samples collected during the same cruise at a middle Paci¢c site MP (177‡42P20QW, 10‡35P06QN, 5774 m), east Paci¢c station A (153‡52P19QW, 7‡33P46QN, 5027 m), seashore soil of the Xiamen coast, £ower garden and rice ¢eld soil collected in Xiamen, China, were also used in this study. The three deep-sea sampling sites WP, MP, and A are illustrated in Fig. 1. DNA was extracted from the sediment according to Roberts et al. [23] with some modi¢cations. This procedure employs enzymatic and freeze^thawing-based lysis, which is a relatively gentle method that avoids excessive shearing of DNA. Around 30 g of sediment was suspended in 50 ml sterilized arti¢cial seawater, shaken (by Vortex) and centrifuged at 1500Ug at 4‡C for 5 min. The wash and centrifuge procedure for the sediment treatments were repeated three times, and then the supernatants were mixed and centrifuged for 30 min at 10 000Ug to get the microbial cells. The microbial pellets were then suspended in a lysozyme solution (15 mM NaCl, 100 mM EDTA pH 8, lysozyme 10 mg ml31 ) and incubated at 37‡C for 1 h. Sodium dodecyl sulfate was then added to a ¢nal concentration of 1%, followed by three cycles of freeze^thawing at 370‡C and 65‡C. Humic materials were precipitated by the addition of 0.3 volumes of 7.5 M ammonium acetate (pH5.2) and centrifuged at 6000Ug for 15 min. Nucleic acids in the supernatant were precipitated by adding 2.5 volumes of 100% ethanol and 20 Wg ml31 dextrin blue (¢nal concentration). The mixture was incubated at 380‡C for at least 2 h and then centrifuged at 12 000Ug for 30 min. The DNA pellet was washed with 70% (v/v) ethanol, left to dry for 10^15 min, and then dissolved in 100 Wl of sterile TE (pH7.4) and stored at 320‡C. 2.2. Polymerase chain reaction (PCR) ampli¢cation PCR primers targeting mxaF, pmoA and archaeal 16S rRNA gene fragments were designed according to the published data [19,20,24] : mxaF f1003 (GCGGCACCAACTGGGCTGGT), mxaF r1561 (GGGCAGCATGAAGGGCTCCC); pmoA A189 (GGNGACTGGGACTTCTGG), pmoA A682 (GAASGCNGAGAAGAASGC), pmoA A650 (ACGTCCTTACCGAAGGT), pmoA mb661 (CCGGMGCAACGTCYTTACC) ; Arch21F (TTCCGGTTGATCCYGCCGGA), Arch958R (YCCGCGTTGAMTCCAATT). The PCR reaction was set in 50 Wl reaction volume containing 50^100 ng DNA template, 10U reaction bu¡er (with 25 nM MgCl2 ), 1 mM dNTP, 10 pmol of each primer and 5 U of Taq polymerase. Reactions were carried out in a T3 thermocycler (Biometra, Germany)

FEMSEC 1595 22-12-03

P. Wang et al. / FEMS Microbiology Ecology 47 (2004) 77^84

79

Fig. 1. Map for deep-sea sampling sites. The location of the deep-sea sampling sites at the tropical west Paci¢c WP station (142‡30P08QE, 8‡00P11QN, 1914 m), middle Paci¢c station MP (177‡42P20QW, 10‡35P06QN, 5774 m) and east Paci¢c station A (153‡52P19QW, 7‡33P46QN, 5027 m) are shown on the map.

with 35 cycles of 94‡C 60 s, 55‡C (or 60‡C) 90 s, 72‡C 120 s and a ¢nal extension at 72‡C for 10 min. Reaction products were checked by agarose gel electrophoresis. 2.3. mxaF DNA library construction, DNA sequencing and phylogenetic tree construction PCR products of around 550 bp for the mxaF gene fragment were cloned into the pGEM-T vector using a 2U rapid ligation kit according to the instructions of the manufacturer (Promega). Ligation mixtures were used to transform competent cells of Escherichia coli XL1 Blue according to the suggestions of the manufacturer (Promega). Approximately 300 recombinants were obtained, from which 90 clones were randomly picked for sequencing (Sangon, Shanghai, China). Nucleotide and deduced amino acid sequences retrieved from the mxaF DNA library were searched in the NCBI databank. Related sequences were aligned using the program DNAMAN (Lynnon Biosoft, version 5.1). A phylogenetic tree was constructed from a matrix of pairwise genetic distances by the maximum parsimony algorithm and the neighborjoining method using the DNAMAN program, and 1000 trials of bootstrap analysis were used to provide con¢dent estimates for phylogenetic tree topologies. 2.4. Restriction fragment length polymorphism (RFLP) analysis of archaeal 16S rDNA clones, sequencing and phylogenetic analysis

37‡C with restriction endonuclease RsaI. The reaction results were visualized by electrophoresis on a 5% agarose gel containing ethidium bromide (0.5 mg l31 ). Representative clones with di¡erent RFLP patterns were selected for sequencing (Sangon). Sequences were submitted to the CHECK-CHIMERA program at the Ribosomal Database Project II (RDP) to detect the presence of chimeric artifacts and were manually aligned to 16S rRNA gene sequence data from the RDP, GenBank, EMBL and DDBJ using the DNAMAN. A phylogenetic tree of archaea was constructed as described above. 2.5. Quanti¢cation of the mxaF gene The quantitative competitive PCR (QC-PCR) method [25] was used to determine the quantity of the mxaF gene in the environment. The extracted plasmid pWP6 from a clone of the mxaF library was digested with EcoRV. The linear plasmid pWP6 was used as the standard mxaF gene fragment template to evaluate the e⁄ciency and accuracy of the competitor template DNA. The plasmid pWP6 was digested with BstpI to get a 150bp deletion in the region between the PCR primer pair mxaF f1003 and mxaF r1056, self-ligated and then digested with EcoRV. The linear plasmid pWP6v150bp was used as the competitive template DNA. The quantities of pWP6 and pWP6v150bp were determined using a spectrophotometer (Ultrospec 2100, Amersham Pharmacia). 2.6. Nucleotide sequence accession numbers

The archaeal 16S rDNA library was constructed comparably to the mxaF gene library described above. The inserted archaeal 16S rDNA fragments of the clones were ampli¢ed and puri¢ed by ethanol precipitation. Then, the fragments were digested for 8 h or more at

The nucleotide sequences of partial mxaF genes have been deposited in the EMBL, GenBank and DDBJ nucleotide sequences databank under the following accession numbers: wp5: AJ561090 ; wp6: AJ561091 ; wp8:

FEMSEC 1595 22-12-03

80

AJ561092; AJ561095; AJ561098; AJ561101; AJ561104; AJ561107;

P. Wang et al. / FEMS Microbiology Ecology 47 (2004) 77^84

wp11: AJ561093 ; wp14: AJ561096 ; wp24: AJ561099 ; wp34: AJ561102 ; wp49: AJ561105 ; wp74: AJ561108.

wp12: wp15: wp26: wp41: wp54:

AJ561094 ; AJ561097 ; AJ561100 ; AJ561103 ; AJ561106 ;

wp13: wp19: wp30: wp45: wp66:

3. Results 3.1. Phylogeny of methylotrophs as revealed by retrieval of mxaF DNA was extracted from the sediment of tropical west Paci¢c WP and served as template for PCR ampli¢cation.

A mxaF gene fragment of 550 bp was ampli¢ed using DNA template from WP. A PCR fragment was cloned and a library of mxaF gene fragments was constructed as described above. Over 300 clones were clustered in the library, from which 90 clones were randomly selected for sequencing. The deduced conserved amino acid sequences of the mxaF gene fragments were searched in a gene databank and analyzed. All clones in the west Paci¢c sediment belong to K-Proteobacteria. Among these, ¢ve clones represent the methane oxidation type II methanotrophs, most relating to the Methylocystis and the Methylosinus genera; 11 clones are a⁄liated to the Methylobacterium genus and 74 clones are assigned to the Hyphomicrobium genus. Bacteria of the Methylobacterium and the Hyphomicrobium genera are facultative methylo-

Fig. 2. Phylogenetic tree, based on deduced partial MxaF amino acid sequences. The MxaF sequences retrieved from the sediment of the tropical west Paci¢c WP site and from the cultured representative methylotrophs, including type I and type II methanotrophs, are involved in the tree construction. Only bootstrap values above 90 from 1000 replicates are shown. The scale bar represents 0.05 substitution per amino acid site. The environmental mxaF clones from the Paci¢c WP sediment are designated as wp, the number in parentheses following the wp clone name is the number of clones with identical sequences in the 90 sequenced clones. The database accession numbers of the wp clones are listed in Section 2 ; database accession numbers of reference bacteria are: Methylosinus trichosporium U70516 ; Methylocystis sp. AAC45568; H. vulgare CAA69308; Hyphomicrobium sp. CAA69323; H. methylovorium AB004097; Methylobacterium extorquens IH4IA ; Methylobacterium rhodinum U70527; Methylococcal bacterium U85503; Methylomonas methanica U70512 ; Methylococcus capsulatus U70511.

FEMSEC 1595 22-12-03

P. Wang et al. / FEMS Microbiology Ecology 47 (2004) 77^84

81

trophs and cannot use methane, but are capable of utilizing methanol and some other C1 compounds, as well as a wide range of multicarbon substrates, as their sole carbon and energy source [26,27]. Among the 90 clones, 19 distinct representative clones were used to construct a phylogenetic tree to show the relationship of the clones with related reference methylotrophs, including methanotrophs (Fig. 2). 3.2. Detection of methanotrophs by the pmoA gene probe In addition to mxaF, a pmoA gene probe was used to speci¢cally detect the methanotrophic diversity in the environment. Three pmoA-speci¢c primer sets (A189-A682, A189-A650, and A189-mb661) were used to retrieve methanotrophs from the west Paci¢c WP sediment. However, no corresponding PCR fragments were obtained from any of the reactions using all three primer sets, although di¡erent amplifying conditions were tested (data not shown). Then, to test the e⁄ciency of the primers, DNA samples isolated from sea-shore sediment, £ower garden and rice ¢eld soil were used as templates for pmoA gene fragment ampli¢cation. Speci¢c DNA fragments were ampli¢ed from all these samples using each primer set (data not shown). By using the mxaF marker, the existence of type II methanotrophs was demonstrated, albeit with very low frequency (5.6%) in the west Paci¢c WP sediment. But, by using the pmoA marker, no methanotrophs could be detected at all, probably due to a far too low proportion of methanotrophs in the deep-sea sediments tested.

Fig. 3. Quantitative detection of the mxaF gene of the west Paci¢c WP sediment. DNA isolated from weighed sediment was mixed with di¡erent amounts (101 , 102 , 103 , 104 , 105 , 106 molecules) of competitor (linear plasmid pWP6v150bp), the mixed DNAs were then used as PCR templates for mxaF gene ampli¢cation as described in Section 2. Sediment DNA could amplify the 550-bp fragment, whereas the competitor could amplify the 400-bp fragment. When the quantity of competitor was 10 times less as compared to the mxaF copy number in the sediment, only the 550-bp fragment could be ampli¢ed; in contrast, when the quantity of the competitor was 10 times higher than that of the tester, only the 400-bp fragment could be ampli¢ed. When the quantities of tester and competitor were in the same range, both the 550-bp and the 400-bp fragments could be ampli¢ed. More details can be found in the text. Lane M: molecular size marker (100-bp DNA ladder Plus, Biolab); lanes 1^6: 101 , 102 , 103 , 104 , 105 , 106 molecules of competitive DNA templates.

3.3. Quantitative analysis of mxaF To determine the methylotroph quantity in the sediment of tropical west Paci¢c WP, a quantitative PCR reaction for mxaF was designed as described in Section 2. The sensitivity and accuracy test showed that as little as 10 molecules of the mxaF fragment could be tested and the quantity of the competitor could properly re£ect the amount of the standard tester (data not shown). Therefore, the quantitative PCR reaction could be used to quantify mxaF in the environment (Fig. 3). Fig. 3 shows that WP contained 3U104 5 molecules of the mxaF gene copy per gram sediment. The distribution and quantitative analysis of methylotrophs in the two other deep-sea sediments (MP, A), in sea-shore soil, £ower garden and rice ¢eld soil were determined for comparison by the same QC-PCR method. From all the samples tested, the corresponding speci¢c mxaF gene fragment could be ampli¢ed, indicating

the vast distribution of methylotrophs in diverse environments, including deep-sea sediments. The quantities of methylotrophs in the environments are summarized in Table 1, showing that rice plant soil contained the highest quantity of methylotrophs with 5U105 6 copies per gram sediment ; the WP locus comprised 10^100 times more methylotrophs than the two other deep-sea loci MP and A and the sea-shore sediment. 3.4. Archaeal diversity analysis To detect the presence of anaerobic methanotrophs in the west Paci¢c WP sediment, an archaeal 16S rRNA gene

Table 1 The mxaF copy numbers in di¡erent environments Sample source

WP sediment

MP sediment

A sediment Sea-shore soil Rice ¢eld soil Flower garden soil

mxaF copy number (copies per gram sediment)

3U104

3U103

3U103

5

FEMSEC 1595 22-12-03

5U102

3

5U105

6

1U105

6

82

P. Wang et al. / FEMS Microbiology Ecology 47 (2004) 77^84

Fig. 4. Phylogenetic tree based on archaeal 16S rDNA sequences. Archaeal 16S rDNA clones retrieved from the Paci¢c WP sediment were named MBWPA. Clones with sequence identity of more than 98% are regarded as from the same species. Thirty-seven clones of which the 16S rDNA sequences had less than 98% identity were picked for dendrogram construction. Only bootstrap values above 60 from 1000 replicates are shown. The scale bar represents 0.05 substitution per amino acid site.

fragment library was constructed. The library contained 180 clones and could be divided into nine RFLP types by RsaI enzyme digestion. According to the RFLP types, 42 clones were selected for sequencing. The sequences of the clones were checked and analyzed and a phylogenetic tree was constructed as shown in Fig. 4. From this, it can be concluded that all the clones obtained belong to the non-thermophilic marine group I crenarchaeotes.

4. Discussion Methylotrophs, including methanotrophs, have been found and cultivated in several extreme environments with high or low pH, temperature or salinity [1,28]. The

deep-sea habitat is an extreme environment with normally high hydrostatic pressure and low temperature. Until recently, however, only one methanotroph had been isolated from deep-sea waters, no methylotrophs were isolated from deep-sea sediments and even no report about investigating the ecology of methylotrophs in this extreme environment could be found, despite their possible importance concerning the carbon cycling in this environment. In our study, we focused on the west Paci¢c WP deep-sea sediment of 1914 m (temperature : 1.4‡C; salinity : 3.5%; sediment surface oxygen level: 230.9 WM) for aerobic and anaerobic methylotroph/methanotroph investigation using established molecular markers. The functional gene probes pmoA and mxaF were chosen to detect the presence and diversity of aerobic methylotrophs and methanotrophs,

FEMSEC 1595 22-12-03

P. Wang et al. / FEMS Microbiology Ecology 47 (2004) 77^84

since the combined use of both markers may enable us to detect a large group of organisms participating in C1 metabolism. Archaeal 16S rRNA gene probes were used to investigate the archaeal diversity, especially to detect the presence of anaerobic methanotrophs, since it has been shown that groups of archaea are involved in anaerobic methane oxidation and, besides that, no data other than the 16S rDNA sequence information on these anaerobic methanotrophs were available at present. From the mxaF clone library we constructed, containing about 300 clones, it may be possible to select representative clones for sequencing by RFLP analysis. However, previous studies have pointed out that this method is not successful in di¡erentiating the clones, due to the high level of sequence conservation within the mxaF sequences and the restricted size of the PCR product, which allows less sequence variation [19]. Thus, we randomly chose 90 clones to sequence. In fact, we applied RFLP analysis to 144 clones using MspI, which only resulted in ¢ve RFLP types. All ¢ve RFLP types were found in the 90 clones when we did RFLP in these 90 clones later, just as expected. By amino acid sequence analysis of mxaF gene products, methylotrophs related to Hyphomicrobium and Methylobacterium, which could use methanol and some other C1 compounds as the sole carbon source, were found as prevailing methylotrophs in the west Paci¢c WP, while type II methanotrophs, most closely related to Methylocystis and Methylosinus, only constitute a small percentage (V5.6%) of the methylotroph community. No type I methanotrophs were detected. Our results support the hypothesis that type I methanotrophs are predominant in environments that allow rapid growth of methanotrophic bacteria, while type II methanotrophs are more abundant in environments where growth rates are restricted [3]. The fact that the pmoA gene fragment could not be ampli¢ed from WP suggests that the percentage of methanotrophs in the bacterial community may be too low to be detected by this marker. By microscopic bacterial enumeration based on acridine orange staining, the bacterial number in the sediment of the west Paci¢c WP was estimated to be around 1.6U107 per gram sediment (Pei et al., personal communication). Thus, the percentage of methylotrophs (number determined by mxaF gene copy number) in the bacterial community is about 0.2^2%, the methanotrophs constituting only about 5.6% of the methylotroph community. This low percentage of methanotrophs in the environment is most likely the reason for the fact that detection by PCR ampli¢cation of the pmoA gene target was not successful. For our west Paci¢c deep-sea sediment sample, it seems that mxaF is a more sensitive DNA marker than pmoA. This is in contradiction with a previous study, in which Horz et al. [3] found that use of the mxaF gene probe could only retrieve limited methanotroph diversity compared to the use of pmoA on roots of submerged rice plants. Using mxaF, they could

83

only detect the presence of methanotrophs corresponding to pmoA cluster I, belonging to type I methanotrophs, thus suggesting that the mxaF gene marker should be applied with other gene markers to assess the methanotroph diversity in the environment [3]. In contrast, we detected the presence of type II methanotrophs in the deep-sea sediment by MxaF sequence analyses. Our results suggest that the e⁄ciency of the functional gene markers pmoA and mxaF on methanotroph diversity investigation largely depends on the environment studied. Therefore, we assume that pmoA and mxaF may be applied to di¡erent environments, pmoA may be more suitable in methanerich environments with high methane-oxidizing activities, whereas mxaF could be more e¡ectively used in growth rate-limiting environments such as the deep-sea sediments in this study. In our study, we demonstrated the presence of methylotrophs, including methanotrophs, in a deep-sea sediment environment. This group of microbes might play an important role in marine carbon cycling. The C1 compounds in the deep-sea sediments may be derived either from the degradation of compounds descending from the marine surface or from the activity of subsurface microorganisms. By quantitative PCR analysis, it has been shown that the west Paci¢c WP sediment contains 10^100 times more mxaF molecules than the east Paci¢c and middle Paci¢c sediment. The higher quantity of methylotrophs retrieved from the west Paci¢c WP suggests a higher rate of metabolic activity and carbon cycling in this WP area. No isolation of methylotrophs from deep-sea sediments had been reported yet, the methylotrophs that thrive in these extreme environments may be new species or known species evolving in order to adapt to the high hydrostatic pressure and cold environment. Both aerobic and anaerobic methane oxidation was reported. At least two groups of archaea, named ANME1 and ANME2 [11], were reported to be involved in the anaerobic methane oxidation activity. The sediment core we studied is aerobic on the surface, whereas moving down the sediment, oxygen is typically depleted within millimeters below the surface by aerobic respirers and diffusional limitation of oxygen transport from above [29]. Thus, in addition to the detection of the presence of aerobic methylotrophs by using the functional gene markers mxaF and pmoA, we used archaeal 16S rRNA gene sequence analysis to study the diversity of archaea in our deep-sea sediment core, ultimately in order to ¢nd out the possible existence of any archaea capable of anaerobic methane oxidation. The archaeal 16S rDNA sequence analysis results showed that the non-thermophilic marine group I crenarchaeote was the only group of archaea detected in this environment; no archaea related to ANME1 or ANME2 were detected by the method we used. However, it is still possible that ANME1- or ANME2-related archaea may exist in this environment, although they could not be detected due to their low percentage in the

FEMSEC 1595 22-12-03

84

P. Wang et al. / FEMS Microbiology Ecology 47 (2004) 77^84

archaeal population. In conclusion, however, we showed that the marine group I archaea are the predominant group of archaea in this deep-sea environment, and that archaeal groups capable of anaerobic methane oxidation are not prominent components of the total archaeal community in the open ocean deep-sea sediment, dissimilar to the situation in the methane seep environments, where they comprise a high proportion of the archaeal population [9].

Acknowledgements

[12]

[13]

[14]

[15]

We would like to thank Dr. J.Y. Ni for providing data on sediment surface oxygen concentration and Mr. Y.W. Pei for bacterial enumeration. Also thanks to the crews on DaYang No. 1 for assisting in collecting the samples. This work was partly supported by National ‘973’ Program G2000078500, COMRA Foundation DY105-4-2-1.

[16]

[17]

[18]

References

[19]

[1] Hanson, R.S. and Hanson, T.E. (1996) Methanotrophic bacteria. Microbiol. Rev. 60, 439^471. [2] Dun¢eld, P.F., Liesack, W., Henckel, T., Knowles, R. and Conrad, R. (1999) High-a⁄nity methane oxidation by a soil enrichment culture containing a type II methanotroph. Appl. Environ. Microbiol. 65, 1009^1014. [3] Horz, H.P., Yimga, M.T. and Liesack, W. (2001) Detection of methanotroph diversity on roots of submerged rice plants by molecular retrieval of pmoA, mmoX, mxaF, and 16S rRNA and ribosomal DNA, including pmoA-based terminal restriction fragment length polymorphism pro¢ling. Appl. Environ. Microbiol. 67, 4177^4185. [4] Henckel, T., Friedrich, M. and Conrad, R. (1999) Molecular analyses of the methane-oxidizing microbial community in rice ¢eld soil by targeting the genes of the 16S rRNA, particulate methane monooxygenase, and methanol dehydrogenase. Appl. Environ. Microbiol. 65, 1980^1990. [5] McDonald, I.R., Kenna, E.M. and Murrell, J.C. (1995) Detection of methanotrophic bacteria in environmental samples with the PCR. Appl. Environ. Microbiol. 61, 116^121. [6] Auman, A.J., Stolyar, S., Costello, A.M. and Lidstrom, M.E. (2000) Molecular characterization of methanotrophic isolates from freshwater lake sediment. Appl. Environ. Microbiol. 66, 5259^5266. [7] Pancost, R.D., Damste, J.S.S., Lint, S., Maarel, M.J.E.C. and Gottschal, J.C. (2000) Biomarker evidence for widespread anaerobic methane oxidation in Mediterranean sediments by a consortium of methanogenic archaea and bacteria. Appl. Environ. Microbiol. 66, 1126^1132. [8] Hondt, D.S., Rutherford, S. and Spivack, A.J. (2002) Metabolic activity of subsurface life in deep-sea sediments. Science 295, 2067^ 2070. [9] Orphan, V.J., Hinrichs, K.U., Ussler, W., Paull, C.K., Taylor, L.T., Sylva, S.P., Hayes, J.M. and Delong, E.F. (2001) Comparative analysis of methane-oxidizing archaea and sulfate-reducing bacteria in anoxic marine sediments. Appl. Environ. Microbiol. 67, 1922^1934. [10] Thomsen, T.R., Finster, K. and Ramsing, N.B. (2001) Biogeochemical and molecular signatures of anaerobic methane oxidation in a marine sediment. Appl. Environ. Microbiol. 67, 1646^1656. [11] Orphan, V.J., House, C.H., Hinrichs, K.U., Mckeegan, K.D. and

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

Delong, E.F. (2002) Multiple archaeal groups mediate methane oxidation in anoxic cold seep sediments. Proc. Natl. Acad. Sci USA 99, 7663^7668. Kato, C. (1999) Barophiles (piezophiles). In: Extremophiles in Deepsea Environments (Horikoshi, K. and Tsujii, K., Eds.), pp. 91^111. Springer-Verlag, Tokyo. Moyer, C.L., Dobbs, F.C. and Karl, D.M. (1995) Phylogenetic diversity of the bacterial community from a microbial mat at an active, hydrothermal vent system, loihi seamout, Hawaii. Appl. Environ. Microbiol. 61, 1555^1562. Bidle, K.A., Kastner, M. and Bartlett, D.H. (1999) A phylogenetic analysis of microbial communities associated with methane hydrate containing marine £uids and sediments in the Cascadia margin (ODP site 892B). FEMS Microl. Lett. 177, 101^108. Takai, K. and Horikoshi, K. (1999) Genetic diversity of archaea in deep-sea hydrothermal vent environments. Genetics 152, 1285^1297. Sieburth, J.M., Johnson, P.W., Eberhardt, M.A., Sieracki, M.E., Lidstrom, M. and Laux, D. (1987) The ¢rst methane-oxidizing bacterium from the upper mixing layer of the deep ocean: Methylomonas pelagica sp. nov. Curr. Microbiol. 14, 285^293. Delong, E.F., Franks, D.G. and Yayanos, A.A. (1997) Evolutionary relationships of cultivated psychrophilic and barophilic deep-sea bacteria. Appl. Environ. Microbiol. 63, 2105^2108. Wirsen, C.O. and Molyneaux, S.J. (1999) A study of deep-sea natural microbial populations and barophilic pure cultures using a high-pressure chemostat. Appl. Environ. Microbiol. 65, 5314^5321. McDonald, I.R. and Murrell, J.C. (1997) The methanol dehydrogenase structural gene mxaF and its use as a functional gene probe for methanotrophs and methylotrophs. Appl. Environ. Microbiol. 63, 3218^3224. Bourne, D.B., McDonald, I.R. and Murrell, J.C. (2001) Comparison of pmoA PCR primer sets as tools for investigating methanotroph diversity in three Danish soils. Appl. Environ. Microbiol. 67, 3802^ 3809. Visser, K., Thunell, R. and Stott, L. (2003) Magnitude and timing of temperature change in the indo-Paci¢c Warm Pool during deglaciation. Nature 421, 152^155. Stott, L., Poulsen, C., Lund, S. and Thunell, R. (2002) Super ENSO and global climate oscillations at millennial time scales. Science 297, 222^226. Roberts, M.A. and Crawford, D.L. (2000) Use of randomly ampli¢ed polymorphic DNA as a means of developing genus- and strain-speci¢c Streptomyces DNA probes. Appl. Environ. Microbiol. 66, 2555^ 2564. Vetriani, C., Jannasch, H.W., Macgregor, B.J., Stahl, D.A. and Reysenbach, A.L. (1999) Population structure and phylogenetic characterization of marine benthic archaea in deep-sea sediments. Appl. Environ. Microbiol. 65, 4375^4384. Laurie, A.D. and Johes, G.L. (2000) Quanti¢cation of phnAc and nahAc in contaminated New Zealand soils by competitive PCR. Appl. Environ. Microbiol. 66, 1814^1817. Green, P.N. (1992) The genus Methylobacterium. In: The Prokaryotes. A Handbook on the Biology of Bacteria : Ecophysiology, Isolation, Identi¢cation, Application (Balows, A., Tru«per, H.G., Dworkin, M., Harder, W. and Schil¢er, K.H., Eds.), pp. 2343^2349. Springer-Verlag, New York. Layton, A.C., Karanth, P.N., Lajoie, C.A., Meyers, A.J., Gregory, I.R., Stapleton, R.D., Taylor, D.E. and Sayler, G.S. (2000) Quanti¢cation of Hyphomicrobium populations in activated sludge from and industrial wastewater treatment system as determined by 16S rRNA analysis. Appl. Environ. Microbiol. 66, 1167^1174. Trotsenko, Y.A. and Khmelenina, V.N. (2002) Biology of extremphilic and extremotolerant methanotrophs. Arch. Microbiol. 177, 123^131. Fenchel, T. (2002) Microbial behavior in a heterogeneous world. Science 296, 1068^1071.

FEMSEC 1595 22-12-03