Molecular Phylogeny of Swallowtail Butterflies of the Tribe Papilionini (Papilionidae, Lepidoptera)

Molecular Phylogenetics and Evolution Vol. 12, No. 2, July, pp. 156–167, 1999 Article ID mpev.1998.0605, available online at http://www.idealibrary.com on

Molecular Phylogeny of Swallowtail Butterflies of the Tribe Papilionini (Papilionidae, Lepidoptera) Josiane Aubert,*,†,1 Luc Legal,*,1 Henri Descimon,† and Franc¸ois Michel* *Centre de Ge´ne´tique Mole´culaire du C.N.R.S., 91190 Gif-sur-Yvette, France; and †Laboratoire de Syste´matique E´volutive, Universite´ de Provence, 3 place Victor Hugo, 13331 Marseille Cedex 3, France Received February 10, 1998; revised September 23, 1998

Swallowtail butterflies of the tribe Papilionini number about 225 species and are currently used as model organisms in several research areas, including genetics, chemical ecology and phylogenetics of host plant utilization and mimicry, mechanisms of speciation, and conservation. We have inferred phylogenetic relationships for a sample of 18 species of the genus Papilio (sensu lato) and five outgroup taxa by sequencing two stretches of mitochondrial DNA that correspond to segments 12886–13370 and 12083–12545 of Drosophila melanogaster mitochondrial DNA and consist of sections of the genes for the large ribosomal RNA and subunit 1 of NADH-dehydrogenase. Our data support the monophyly of Papilio and, within it, of several traditionally recognized subgroups. Species belonging to groups that utilize primarily Rutaceae as larval foodplants form two clusters, corresponding to Old World and American taxa, respectively, while two previously recognized clades—of American and South Asian–Austronesian origin—whose members were known to feed mostly on Lauraceae and Magnoliaceae, are observed to form a clade. The sister group of Papilio is found to be the South Asian genus Meandrusa, which also happens to feed on Lauraceae. The latter plant family is therefore the probable larval host of the ancestor Papilio and the shift to Rutaceae (which four-fifths of extant Papilio species use as foodplants) is more likely to have occured only after the initial diversification of the genus. r 1999 Academic Press

INTRODUCTION The Papilionidae (Lepidoptera, Rhopalocera), commonly called swallowtail butterflies, comprise between 573 and ca 700 species (according to Collins and Morris, 1985, and Smart, 1975, respectively) and are distributed worldwide. Although they constitute the smallest of the four major subdivisions of butterflies, Papilioni-

1

Authors contributed equally to this work.

1055-7903/99 $30.00 Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

dae have been intensively studied since the last century, one reason being that many species are large and colorful and, therefore, particularly noticeable in their habitat. This trend has persisted and currently quite a number of Papilionidae species are being used as reference material for studies in mechanisms of speciation (e.g., Hagen, 1990; Thompson et al., 1990; Sperling, 1991, 1993a,b; Bossart and Scriber, 1995a,b; Tyler et al., 1994; Hagen and Scriber, 1995; Aubert et al., 1997), chemical ecology (Thompson, 1988a,b; Codella and Lederhouse, 1989; Lederhouse et al., 1992; Nishida et al., 1993), population genetics of adaptive traits and mimicry (Ritland and Scriber, 1985; Hazel et al., 1987; Watanabe, 1988; Hazel, 1990; Kukal et al., 1991; Scriber et al., 1996; Lederhouse and Scriber, 1996), biochemistry (Cohen et al., 1992), and conservation (Collins and Morris, 1985; Emmel and Garraway, 1990; New and Collins, 1991; Aubert et al., 1996). Three subdivisions of Papilionidae are generally recognized, of which Papilioninae is by far the largest. The Papilioninae in turn are subdivided into three to five tribes, depending on authors (Munroe, 1961; Smart, 1975; Hancock, 1983; Igarashi, 1984; Miller, 1986, 1987a; Tyler et al., 1994). The Papilionini, with approximately 225 species, constitute the largest of these tribes and the one within which phylogenetic relationships have proved most difficult to establish by relying on morphological and behavioral characters. In fact, no consensus could be reached about which subdivisions should be retained (see Table 1), and Miller, in his comprehensive cladistic analysis of the Papilionidae (1987a), rather chose to return to lumping all Papilionini species but two into the single genus Papilio. This situation is all the more unfortunate since the majority of recent studies of swallowtails have focused on members of the Papilionini tribe. It should also be recalled that not only Papilionini, but the entire family of swallowtail butterflies, has been at the heart of a controversy over whether or not insect species coevolve with their host plants (e.g., Ehrlich and Raven, 1964; Miller, 1987b; Becerra, 1997; Farrell, 1998), an issue

156

MOLECULAR PHYLOGENY OF SWALLOWTAIL BUTTERFLIES

which obviously cannot be settled without accurate phylogenetic information. At least in part due to the failure of traditional taxonomy to produce a coherent picture of the phylogeny of the Papilionini, there have been several attempts to resort to molecular characters in order to clarify phylogenetic relationships within this group. Allozymes were used to compare taxa within the P. glaucus subgroup (Hagen and Scriber, 1991), and in past years, several papers have been published by Sperling (1991, 1993a,b), in which endonuclease digestion of intact mitochondrial DNA (mtDNA) was utilized to establish phylogenetic trees of the P. glaucus and P. machaon subgroups (a compilation of available information, including some otherwise unpublished data, is presented in Tyler et al., 1994). DNA sequencing and the polymerase chain reaction (PCR), which can make use of even dried museum specimens (Paˆa¨bo, 1990), have revolutionized molecular systematics. By taking advantage of PCR, we have now been able to sequence sections of the mtDNA genes coding for subunit 1 of NADH-dehydrogenase (ND1) and the large subunit ribosomal RNA (LSU) from 19 Papilionini taxa that had been selected to cover the major putative subdivisions of that tribe (in addition, the sequences of four outgroup species from other Papilionidae tribes were also determined). The resulting phylogenetic trees are compared with those derived by morphological and RFLP analyses and we also take advantage of these newly obtained data to reexamine the relationships between host plant use by swallowtail butterflies and their phylogeny. MATERIALS AND METHODS Biological Materials The species of Papilionid butterflies investigated in this study are listed in Table 1, together with their taxonomic relationships according to different authors. Particulars of the 23 individuals (1 per species) whose DNA was successfully amplified are to be found in the corresponding EMBL Data Bank files. Nonextracted body parts are being kept in our laboratory either frozen or, when dried material was used for extraction (P. indra, P. laglaizei, M. payeni, and P. neophilus), in the form of mounted collection specimens. DNA Extraction Part of the abdomen (typically the anterior or middle section) of adults or pupae was dissected, the posterior part (genitalia) being avoided because of the presence of sclerified parts and, in mated females, of a spermatophore of male origin. Extraction was performed by incubating ground samples for 3 h at 37°C in 300 µl of 0.1 M Tris–HCl, pH 8.0, 10 mM Na2EDTA, 100 mM NaCl, 0.1% SDS (sodium dodecyl sulfate), 50 mM dithiothreitol, and 1.5 µg of proteinase K (Kocher et al.,

157

1989). Homogenates were then extracted twice with phenol/chloroform and DNA was precipitated with ethanol after addition of 6 µl of a 0.25% solution of linear acrylamide (the latter step was included in order to improve DNA recovery from dried specimens). PCR, DNA Cloning, and Sequencing Sections of the LSU (16S rRNA) and ND1 genes were amplified by polymerase chain reaction (PCR) using the following oligonucleotide primers (which were found by one of us—F.M., unpublished data—to be suitable for many butterfly species): 58-CGCCTGTTTATCAAAAACAT and 58-CCGGTTTGAGCTCAGATCA for the 16S rRNA gene (the former is almost identical to primer LR-N-13398 and the latter closely related to primer LR12887 in Simon et al., 1994); and 58CGTAAAGTCCTAGGTTATATTCAGATTCG and 58ATCAAAAGGAGCTCGATTAGTTTC for the ND1 gene. The two sections that we had selected for sequencing are located close to one another on the butterfly mtDNA map (Martin and Pashley, 1992, and Fig. 1) and, therefore, could have been simultaneously amplified with a single set of primers. However, we chose rather to carry out two separate PCR amplifications that generated fragments of about 500 bp each (526 and 524 bp, for LSU and ND1, respectively, in the case of P. machaon). One reason for doing so was that we wished to increase the likelihood of amplifying partially damaged DNA from dried specimens by minimizing the length of DNA to be amplified. A further advantage of using two separate amplifications is that an occasional contamination by the amplification products of another taxon is most likely to be noticed, since it would result in characteristically discordant data for the two genes. PCR amplification was carried out in 50 µl of solution containing 200 µM of each dNTP, 1 mM of each primer, and 1:1000 of the crude extract. Addition to the buffer provided with commercially supplied Taq polymerase of bovine serum albumin at a final concentration of 10 to 20 µg/ml was found to greatly improve the efficiency of amplification from dried material. Reaction was initiated by adding 2.5 units of Taq polymerase (Bioprobe or Appligene) to samples that had been heated at 92°C for 2 min. The cycling program included 5 cycles consisting of 10 s at 92°C, 45 s at 42°C, and 2.5 min at 65°C (a controlled rate of heating of 7°C/min was used between 42 and 65°C), followed by 20 cycles (frozen material) or up to 40 cycles (dried material) consisting of 10 s at 92°C, 45 s at a somewhat more stringent reassociation temperature (e.g., 50°C), and 2.5 min at 65°C (a relatively low polymerization temperature was chosen because of the richness in A ⫹ T of butterfly mitochondrial DNA). Amplification products were cloned and sequenced using standard procedures (Sambrook et al., 1989). Briefly, PCR-amplified DNA was extracted with phenol/ chloroform and ethanol precipitated before being di-

158

AUBERT ET AL.

TABLE 1 Species of Papilionidae Included in This Study, Together with Their Classification According to Different Authors Species

Munroe (1961)

Smart (1975)

Hancock (1983)

Miller (1987a)

Papilionini Papilio clytia P. laglaizei

Section I

Division I

Chilasa a

Papilionini

P. anactus

Section II

Division II

Eleppone

P. alexanor P. indra P. zelicaon P. hospiton P. machaon

Papilio

P. aegeus P. memnon P. bianor P. xuthus P. demoleus

Princeps

P. dardanus P. delalandii

Division III

P. antimachusb

Druryeini

P. troilus

Section III

Division IV

Pterourus

P. cresphontes P. anchisiades

Section IV

Division V

Heraclides

P. zagreusb Unknown Meandrusa payeni Outgroups Battus philenor Parides neophilus

Section V

Pterourus

Leptocircini

Leptocircini

Leptocircini

Papilionini

Troidini

Troidini

Troidini

Troidini

Iphiclides podalirius

Leptocircini

Leptocircini

Leptocircini

Graphiini

Parnassius apollo

Parnassiinae

Parnassiinae

Parnassiinae

Parnassiinae

a Hancock’s genus Chilasa does not coincide with section I of Munroe (1961) since it includes two species (elwesi and maraho) that had been placed in section II. b PCR-amplifiable DNA could not be recovered from available individuals of these species.

gested with SacI and NspI (16S) or StyI (ND1) endonucleases and ligated to SphI–SacI or XbaI–SacI digested pTZ19U DNA (US Biochemicals). Ligation products were transformed into DH5␣ Escherichia coli competent cells, typically yielding between 100 and 1000 insert-containing colonies on IPTG- and X-Galcontaining LB plates. Liquid cultures were initiated by pooling ca 30 of those colonies; plasmid DNA was extracted (Jones and Schofield, 1990) and eventually sequenced by dideoxy-chain termination using vectormatching primers 58-AACAGCTATGACCATGATTACG and 58-CGCCAGGGTTTTCCCAGTCACGAC. A few of the DNA samples obtained from dried specimens were found to yield partially ambiguous sequences due to the presence of subpopulations carrying insertions/deletions of one or two residues within runs of more than 10 T’s. Those sequences were confirmed by sequencing several individual clones and/or (for ND1) using insertmatching primers 58-TAATCTAACTTCATATGAAATC-

GTTTG and 58-TGATTATTAATTCCTTATTATTTTAA. We also verified several times (notably, for P. alexanor) that independent PCR amplifications yielded identical sequences. In order to complete the sequence of P. machaon in between the targeted sections of the LSU and ND1 genes, the entire segment of interest (1307 bp) was amplified by PCR using the external LSU and ND1 primers and the resulting DNA was subcloned and sequenced using appropriate restriction endonuclease sites. All nucleotide sequences analyzed in this paper have been deposited in the EMBL data bank (Accession Nos. AJ224048 to AJ224068 and AJ224086 to AJ224108). Sequence Alignment Alignment of the 16S rRNA sequence (EMBL accession number pending) was achieved by manually comparing sequences both with one another and to those of

MOLECULAR PHYLOGENY OF SWALLOWTAIL BUTTERFLIES

other insects (Maidak et al., 1996) and by taking the potential secondary structure of the molecule (Fig. 1) into account, i.e., by resorting to so-called ‘comparative sequence analysis’ (reviewed by Michel and Costa, 1998). Even though this section of the LSU gene is subject to fewer insertions/deletions than the rest of the

159

ribosomal RNA genes (Maidak et al., 1996), a number of gaps had to be introduced, and whenever their location could not be ascertained, both nucleotides involved and flanking, variable sites were discarded from further analyses (the following positions were deleted, the sequence of P. machaon being used as reference: 7–10,

FIG. 1. Nucleotide sequence of a section of the mitochondrial DNA of Papilio machaon that extends over the 38 part of the LSU (large ribosomal RNA) gene, the tRNA Leucine (UAG) gene, and the 58 part of the ND1 gene. Convergent arrows under the LSU and tRNA Leucine nucleotide sequences indicate potential secondary structures (Maidak et al., 1996; relatively long-range pairings are indicated by double arrows; note that the 38 end of the LSU sequence cannot be located precisely). The potential amino acid sequence of the ND1 protein (in single letter code) is indicated below the nucleotide sequence and was deduced by using the Drosophila mitochondrial genetic code (Wolstenholme, 1992). Sections sequenced in the other Papilionidae species used in this study are indicated in bold type.

160

AUBERT ET AL.

40–43, 319–326, as well as the gaps that had been introduced following 258 and 263). In contrast to the LSU gene, no deletion or insertion event was observed over the section of the ND1 gene that was sequenced, so that the entire length of sequence (462 bases) could be kept for further analyses.

mated (the topologies of GTR- and HKY-derived trees differed only by two branch exchanges involving neighboring nodes).

Phylogenetic Analyses

Selection of Taxa

All analyses were performed with test version 4.0d59 of PAUP*, written by David L. Swofford, on an IBM–PC compatible computer with a Pentium microprocessor. All heuristic searches for optimal trees were carried out by TBR (tree bissection–reconnection) branch swapping with option MULPARS in effect. For analyses based on distance and maximum likelihood criteria, all gaps introduced at any particular position were converted to the same ‘new’ state by replacing them with a base not observed at that site (and chosen so as to bias the overall base composition of the dataset as little as possible). Parsimony-based analyses. Starting trees were obtained by stepwise addition. We checked that random addition of taxa did not lead to alternate, more parsimonious trees. For each bootstrap replicate, 10 heuristic searches were performed with random addition of taxa. A partition homogeneity test (see Results) was performed on the combined LSU and ND1 datasets (to the exclusion of 3rd codon positions of the latter) using 500 random partitions and, for each of them, 5 heuristic searches with random addition of taxa. Distance (minimum evolution)-based analyses. A log-determinant (LogDet) distance measure (Steel, 1994; Lockhart, 1994; Lake, 1994) was chosen, since this transformation is robust to changing patterns of base substitution and involves no prior assumptions on rates of substitution. Use of starting trees obtained by either neighbor joining or random addition resulted in identical final topologies. Analyses based on maximum likelihood. Starting trees were obtained by neighbor joining (using a LogDet distance option, see above), parameters (see Fig. 4) were estimated, a new optimal tree was sought, and the process was repeated until a stable topology was achieved (we checked that a number of different starting trees, including those obtained by separately analyzing the LSU and ND1 data, led to the same final topology). Rates for variable sites were always assumed to follow a gamma distribution, and both the shape of this distribution and the fraction of invariable sites were estimated. A comparative test (Frati et al., 1997) was performed using either a ‘HKY85’-2 rates of substitution model (Hasegawa et al., 1985) or a General Time Reversible (GTR)-6 rates of substitution model (Yang, 1994). With our dataset, the likelihoods of trees generated by the GTR model were systematically 6 to 10% better than those yielded by the HKY85 model, even when the transition over transversion ratio was esti-

Our choice of specimens to be analyzed was guided by the necessity to include representative taxa of all major potential subdivisions of the Papilionini (Table 1). The 20 species of Papilio that were eventually retained—18 of them were successfully extracted—included members of all five sections recognized by Munroe (1961), of the five ‘divisions’ of Smart (1975), and of the six genera of Hancock (1983). The four outgroup species consisted of one member of the Parnassiinae, the other major subfamily of the Papilionidae (the third subfamily, Baroniinae, comprises a single species), and three species belonging to the other two tribes that are generally recognized within the Papilioninae. Finally, our selection also included one member species of the small South Asian genus Meandrusa, which, depending on authors, has been grouped with either the Papilionini or the Leptocircini.

RESULTS

Phylogenetic Analyses In a first stage, the LSU and ND1 segments were analyzed separately in order to estimate the degree of compatibility of datasets generated from DNA sections with different modes of evolution. In protein-coding genes, 3rd codon positions can be singled out as a class of sites with a much higher average rate of evolution than the rest. In the present case, it is clear that except within a narrow group formed by P. machaon and its closest allies, these positions are close to saturation (Fig. 2A) and are therefore best discarded. Removal of 3rd codon positions results in proteincoding and rRNA data sets with the same fraction of variable sites (29.2 and 29.1%, respectively). Moreover, pairwise distances between taxa generated from the LSU segment correlate reasonably well with those obtained from the 1st and 2nd codon positions of the ND1 segment (Fig. 2B; this can also be checked by directly comparing distance matrices in Table 2). We next asked how similar would be phylogenetic trees derived separately from the two datasets. Figure 3 illustrates the outcome of this test in the form of optimal ‘minimum evolution’ (Swofford et al., 1996) trees. These trees were generated from log-determinant distance matrices (see Materials and Methods). Although bootstrap values are mostly low, the two trees agree on the branching together of P. apollo and I. podalirius among outgroups; on the monophyly of the genus Papilio (with the exception of P. anchisiades, which branches with M. payeni in the LSU tree) and, within Papilio, on the monophyly of the P. machaon group of species (defined as including machaon, hospi-

MOLECULAR PHYLOGENY OF SWALLOWTAIL BUTTERFLIES

161

FIG. 2. Comparison of pairwise nucleotide differences over different categories of sites for the 23 Papilionidae species listed in Table 2. (A) 3rd codon positions of the ND1 gene (154 sites) versus 1st and 2nd codon positions (308 sites; R2 ⫽ 0.195 when the three data points pertaining to distances within the P. machaon–P. hospiton–P. zelicaon subgroup are removed). (B) 473 LSU sites versus 1st and 2nd codon positions of the ND1 gene (R2 ⫽ 0.403).

ton, zelicaon, and indra); on the grouping together of P. memnon and P. aegeus on the one hand and P. anactus and P. xuthus on the other; and, finally, on a rather close relationship between P. clytia and P. troilus. However, the overall topologies that were retrieved within the genus Papilio are highly discordant. Two data sets that generate distinct phylogenies may nevertheless be compatible. In the present case, application of the partition homogeneity test of Farris et al. (1994; see also Cunningham, 1997) to parsimonyderived trees was found to yield a high value (P ⫽ 0.246, not significant), and the LSU and ND1 datasets were therefore combined for further analysis. Figure 4 offers a comparison of phylogenetic trees obtained by parsimony, distance (LogDet), and maximum likelihood analyses over the entire sequence set (with the exclusion of 3rd codon positions). Because these methods rest on distinct assumptions, none of which is likely to be fully verified (except in unrealistic cases—see discussions in Swofford et al., 1996), comparison of their outputs for a particular data set provides an empirical measure of the robustness and, in some way, reliability of the phylogenetic inferences that may be made from that data set. In the present case, the facts are that the three trees in Fig. 4 mostly agree about the overall phylogenetic relationships of the taxa investigated, but distinct internal topologies were retrieved for the subtree corresponding to section II of Munroe (1961). Nevertheless, some groupings within this subtree—

memnon with aegeus, delalandii with dardanus, anactus with xuthus—are common to all three trees, and the same is true of the cluster formed by P. machaon, P. hospiton, P. zelicaon, and P. indra. When bootstrap analyses were performed on two of the three trees, values in excess of or close to the empirical threshold of 70% (Hillis and Bull, 1993) were consistently obtained for those groupings that are present in both the LSU and the ND1 individual trees (the clade corresponding to the genus Papilio, P. memnon, and P. aegeus, P. anactus and P. xuthus, the P. machaon group; see Fig. 3), as well as for the nodes leading to P. cresphontes and P. anchisiades and, to a somewhat lower degree, P. delalandii and P. dardanus. DISCUSSION Comparison with Morphological and Restriction Enzyme Data This work constitutes the first attempt to use nucleic acid sequencing to investigate phylogenetic relationships within the Papilionini tribe of swallowtail butterflies. It is therefore of particular interest to compare the trees presented in Fig. 4 with the classifications previously proposed for this tribe by traditional systematics (Table 1). One major point of agreement with classifications based on morphology (Munroe, 1961; Hancock, 1983; Miller, 1987a) is the monophyly of the genus

162

AUBERT ET AL.

TABLE 2 Pairwise Distances for the LSU and ND1 (1st and 2nd Codon Positions) Sections of mtDNA

25 — 39

20 28 —

44 53

40 37

44 46

49 43 36 39 43 48

41 40 38 42 40 36

42 39 36 38 40 36

43 40 44 46

38 37 39 35

32 32 35 36

45 50 50

35 38 41

38 35 38

42 50 51

33 38 34

37 39 40

48 60

43 57

37 54

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

31 33 27 35 27 30 29 25 31 30 30 30 30 32 25 29 28 26 40 36 38 41 33 39 39 35 39 38 38 36 32 39 34 41 37 39 21 24 22 27 18 21 21 17 22 21 24 22 23 21 18 24 19 25 --------------------------------------------------------------------------— 25 22 25 22 20 24 20 21 22 25 23 21 24 18 23 13 24 28 — 24 25 27 25 28 25 28 27 28 31 23 23 28 32 23 25 ------------------------------------------------------25 36 — 15 15 17 18 11 14 13 16 19 21 19 14 30 21 28 26 34 15 — 18 20 21 18 21 20 23 27 25 20 18 23 22 25 27 37 19 13 — 16 20 14 20 19 22 22 22 20 11 24 17 25 33 43 29 25 25 — 19 14 18 19 21 25 24 18 19 25 16 26 30 32 27 23 19 32 — 12 20 19 21 19 23 20 18 28 25 27 26 34 21 20 16 27 17 — 14 13 15 15 18 16 14 23 18 24 ----------------27 37 18 16 11 23 22 18 — 1 6 17 18 20 16 26 17 25 29 36 19 17 12 26 23 19 3 — 5 16 17 21 15 25 18 24 29 38 17 15 12 23 23 18 5 6 — 17 19 22 18 27 21 24 31 34 17 17 14 28 23 21 7 8 8 — 21 21 13 28 21 27 ----------------29 33 25 23 21 22 31 23 19 20 21 20 — 21 20 28 21 26 34 38 23 20 19 26 28 24 18 19 18 19 23 — 16 23 20 26 34 41 24 21 19 27 29 21 21 22 22 23 22 16 — 22 15 21 ------------------------------------------------------25 32 24 20 16 21 24 18 17 16 18 20 17 23 22 — 17 17 27 34 32 30 28 35 34 32 25 28 30 30 28 34 35 29 — 18 37 41 37 33 32 38 34 32 33 34 35 34 34 34 36 28 38 — --------------------------------------------------------------------------42 48 32 29 28 35 33 31 29 30 27 30 31 34 37 33 40 44 52 58 51 49 42 47 49 46 44 44 45 46 44 52 52 44 53 52

-----------------------------

— 49 51

5

--------------------

1 P. apollo 2 I. podalirius 3 M. payeni --------------4 P. clytia 5 P. laglaizei --------------6 P. aegeus 7 P. memnon 8 P. bianor 9 P. demoleus 10 P. anactus 11 P. xuthus --------------12 P. machaon 13 P. hospiton 14 P. zelicaon 15 P. indra --------------16 P. alexanor 17 P. delalandii 18 P. dardanus --------------19 P. cresphontes 20 P. troilus 21 P. anchisiades --------------22 B. philenor 23 P. neophilus

4

------

3

------

2

--------------------

1

-----------------------------

Taxa

22

23

17 29 17

25 34 28

24 28

32 36

23 32 23 26 23 20

38 39 32 31 26 31

27 26 26 24

32 32 32 33

25 27 22

32 35 31

28 25 26

32 30 31

— 45

22 —

Note. Numbers are observed substitutions for the LSU (bottom left) and ND1 (top right) sections of mtDNA. Taxa 12–15 correspond to the P. machaon group, 6–18 to section II of Papilio (Munroe, 1961), 4 and 5 and 19–21 to the rest of the genus Papilio, and 1–3 and 22 and 23 are outgroups.

Papilio, which is supported by all sequence-based trees with the sole exception of a single species in the LSU tree. Concerning outgroups, all our trees place I. podalirius, and thus Graphiini (⫽Leptocircini), together with Parnassius in a basal position, and in doing so, they agree best with the more recent classification of Miller (1987a), based on cladistic analyses of cuticular and genitalic characters. One interesting point is the status of the South Asian genus Meandrusa, which all trees (whether derived from only the LSU or the ND1 sequences, or based on total evidence) place in a sister group position to Papilio. This is again a point of agreement with Miller (1987a), who was the only one to include Meandrusa in the Papilionini, based in part on the striking morphological similarity of late larval stages of Meandrusa payeni to those of species in sections III and V of Papilio (see also Igarashi, 1984, 1989). Within Papilio, sequence-derived trees based on total evidence reveal one major split, with one branch corresponding to section II of Munroe (1961) and the other one to the rest of the genus. The latter is further subdivided into two subgroups: one comprises the two

section IV species (P. cresphontes and P. anchisiades), whereas in the other one, P. clytia and P. laglaizei (section I, alias genus Chilasa) are pooled together with P. troilus (section III). This novel association of P. clytia with P. troilus is supported by both the LSU and the ND1 trees and is of particular interest in view of foodplant utilization within the Papilionini (see below). Regarding the section II species, some groupings are consistently observed, although their relative arrangement within phylogenetic trees is quite unstable and shows dependence on the tree-building procedure even when LSU and ND1 data are pooled together. As expected, the monophyly of holarctic P. machaon and its close allies is well supported. However, association with this subgroup of P. alexanor, a palearctic species whose caterpillar feeds on Umbellifers and closely resembles that of P. machaon and relatives, is observed only in the distance-based tree. Other groupings that are credited with reasonably high bootstrap values are those of P. memnon and P. aegeus on the one hand and the two African species P. delalandii and P. dardanus on the other. According to Hancock (1983), whose proposed phylogeny of the tribe Papilionini comprises

MOLECULAR PHYLOGENY OF SWALLOWTAIL BUTTERFLIES

163

FIG. 3. Phylogenetic trees generated from log-determinant distances using a minimum evolution criterion (Swofford et al., 1996) for A, the LSU sequences, and B, the 1st and 2nd codon positions of the ND1 sequences. Values above branches are bootstrap percentages (1000 replicates). Thick lines indicate internal branches that are shared by the two trees. See Materials and Methods for a detailed account of the tree-building process.

six genera (Table 1), the former two species are members of the same subgenus and the latter two belong to sister clades in another subgenus. It is also worth noting that P. xuthus and P. anactus were found to branch together in both the LSU and the ND1 trees. This finding is of interest inasmuch as the taxonomic position of the latter species has been much debated. It was placed in a genus of its own by Hancock and suggested to be related to Chilasa (section I of Munroe; see also Tyler et al., 1994). Attempts at tree building (Tyler et al., 1994) by parsimony analysis of 150 characters of adult and larval morphology, as well as behavioral characteristics, placed P. anactus either in close association with P. anchisiades or in a subbasal position within Papilionini, close to M. payeni, but the trees presented were characteristically unstable, being highly dependent on the particular subsets of characters and species included. Our trees may also be compared with the ones derived by Sperling (1991, 1993a; see also Tyler et al., 1994, p. 148) from restriction enzyme analyses of total mt DNA of 20 Papilio species. Although the choice of taxa differs, with section I of Munroe (1961) missing and the emphasis instead being on sections III and V, there are nevertheless 11 species in common with our own dataset. The genus Papilio was again found to be split into two major subgroups, one consisting mostly of section II of Munroe and the other one mainly of

sections III and V. Moreover, P. anchisiades was located in a sister group position relative to sections III ⫹ V, like in our trees (somewhat surprisingly, though, this taxon was found to form a clade with one of the two species, a graphiine, expected to be outgroups). On the other hand, the other section IV taxon, P. cresphontes, branched together with P. demoleus within the section II subtree. This arrangement, which is more reminiscent of our LSU tree (Fig. 3) than of the trees of Fig. 4, based on total evidence, emphasizes the fact that the placement of section IV must still be regarded as provisional. Relationships between Phylogeny and Host Plant Utilization In the ongoing debate about the extent of congruence to be expected between the phylogenies of insects and their host plants, butterflies of the Papilionidae family have occupied a central place ever since 1964, when Ehrlich and Raven published their seminal paper on the proposed coevolution of butterflies and plants. If only for this reason, there have been continuing and unusual efforts to collect as much information as possible on host plant utilization by swallowtail larvae and a tentative compendium of published records for the subfamily Papilioninae is provided in Table 3 (for relatively recent works, see in particular Berenbaum, 1981, 1983, 1995; Berenbaum and Feeny, 1981; Brower,

164

AUBERT ET AL.

FIG. 4. Phylogenetic trees generated by pooling alignable LSU sites and the 1st and 2nd codon positions of the ND1 sequence. Thick lines indicate internal branches that are shared by the three trees. (A) Maximum likelihood tree, with an estimated 0.45 fraction of variable sites, whose rates of evolution were assumed to follow a gamma distribution with shape parameter 0.79 (four rate categories represented by mean; rates of substitution were assumed to obey a six-parameter, general time-reversible model, with rAC ⫽ 0.48, rAG ⫽ 6.04; rAT ⫽ 3.22; rCG ⫽ 0.91; rCT ⫽ 1.91; rGT ⫽ 1). (B) Minimum evolution tree, generated from a log-determinant distance matrix. (C) Maximum parsimony tree (consistency index, 0.517; retention index, 0.425). Bootstrap percentages greater than 50% are indicated (1000 replicates were used). Bootstrap percentages between brackets (parsimony-derived tree) were obtained using Goloboff’s method, with k ⫽ 2, and 500 replicates (Goloboff, 1993; in this noniterative approach to homoplasy-based weighted parsimony, a tree is sought that maximizes the sum of the weights of individual sites). Numbers between square brackets correspond to decay indices (Bremer, 1994) calculated using the AutoDecay program (version 2.9.6; Eriksson, 1996).

1984; Miller, 1987b; Richard and Gue´de`s, 1983; Scriber, 1988; Scriber et al., 1995; Sperling and Feeny, 1995; Tyler et al., 1994; Weintraub, 1995). In fact, as is made clear by even a casual survey of the data, there is no simple answer to the issue raised, since concerning feeding habits of the Papilioninae, examples exist of both extreme catholicism—two sibling species, P. glaucus and P. canadensis, make use together in the wild of no less than eight different plant families that belong to several of the major clades of angiosperms (reviewed by Bossart and Scriber, 1995b)—and extreme conservatism: within Troidini (140 or so species, represented in our study by P. neophilus and B. philenor), all the species for which confirmed records exist feed on Aristolochiaceae (claims to the contrary are most likely erroneous, see Weintraub, 1995). Still, when plant families are sorted out for each subgroup of swallowtails according to the number of species that utilize them, some clear-cut patterns emerge (as is also the case for the rest of the butterflies (Janz and Nylin, 1998) or Coleoptera (Farrell, 1998)).

Thus, as reviewed by Tyler et al. (1994), Munroe’s Papilio sections III and V, the rather close relationship of which is illustrated by the ability of some of their member species to hybridize fruitfully in the laboratory (Scriber et al., 1991) and confirmed by molecular phylogenies (see above), both utilize primarily Lauraceae and Magnoliaceae and only occasionally other families (even though the group includes such polyphagous species as P. glaucus). Interestingly, especially in view of the connection revealed by our phylogenetic trees between the american P. troilus (section III, a Lauraceae feeder) on the one hand and the asiatic P. clytia and P. laglaizei (section I) on the other, the few members of section I whose foodplant has been determined also feed on Lauraceae (and Magnoliaceae, in the case of P. elwesi; Igarashi, 1984). In contrast to sections I, III, and V, a large majority of species of both sections II and IV feed primarily on Rutaceae. In fact, even some of the taxa that utilize other plant families, such as the Umbelliferae (the P. machaon group, P. demoleus and its African relative P.

165

MOLECULAR PHYLOGENY OF SWALLOWTAIL BUTTERFLIES

TABLE 3 Distribution and Larval Host-Plants of Papilioninae Subdivisions Host plant families Groups

Distribution

Major

Secondary

Others — Hernandiaceae Rosaceae and others — — Araliaceae Compositae Leguminosae Salicaceae Rosaceae and others Umbelliferae Hernandiaceae

Troidini Graphiini

Mostly tropical, world-wide Mainly tropical, world-wide

Aristolochiaceae Annonaceae

Meandrusa Papilio Section I Section II

South-East Asia

Lauraceae

— Lauraceae Magnoliaceae —

Indo-Australian Old World and North America

Lauraceae Rutaceae

Magnoliaceae Umbelliferae

North and Central America Americas Central and South America

Lauraceae Rutaceae Lauraceae

Magnoliaceae Piperaceae Magnoliaceae

Section III Section IV Section V

Note. Division of the genus Papilio into sections is according to Munroe (1961). Host plant families are arranged into ‘major,’ ‘secondary,’ and ‘others’ according to the fraction of species within a group that utilize them in the wild.

demodocus in section II; P. paeon in section IV) and the Piperaceae (P. thoas and P. hectorides in section IV), retain the ability to feed on Rutaceae both in the laboratory and in the wild (Tyler et al., 1994). Furthermore, no species is recorded from Lauraceae or related plant families (with the exception of African P. nobilis and its close relatives). The Ancestral Swallowtail Host Plant How well do these data correlate with the phylogenetic trees presented in Fig. 4 and is it possible to guess at ancestral host plant utilization in swallowtails? Key pieces of information in this respect are, first, that the larvae of Graphiini feed mostly on Annonaceae, with some American species feeding on Magnoliaceae and Lauraceae (reviewed by Tyler et al., 1994; these three families and the Aristolochiaceae belong to the same assemblage, Magnoliidae, within the angiosperms; Chase et al., 1993), and second, that M. payeni, which, according to both Miller (1987a) and our own phylogenetic analyses, would constitute the sister group of Papilio, was found by Igarashi (1989) to use Litsea cubeba, a member of the Lauraceae, as a food plant. These data, together with the fact that utilization of Rutaceae seems confined to Papilio within the Papilionidae, imply that the preferred use of Lauraceae by sections I, III, and V of Papilio should best be regarded as a primitive character. Only after the initial diversification of the genus had taken place would the shift to Rutaceae have been responsible for an evolutionary radiation that was undoubtedly a major one (over 80% of extant Papilio species use members of this plant family as larval hosts) and most probably a rapid one, as attested to by our inability to reconstruct a consistent internal phylogeny for section II of Papilio. (Still, the adoption of a new family of host plants is unlikely to

have been accompanied by major extensions of the geographical range of the Papilio genus as a whole, except perhaps in Africa, for although the use of Rutaceae may have offered the group a foothold in some temperate regions, such as the Mediterranean area— both P. machaon and the Corsican P. hospiton consume native Rutaceae among other plants—and the North of Japan, invasion of markedly higher latitudes had to await the more recent colonizations of Umbelliferae, Rosaceae, Salicaceae, and Betulaceae by the P. machaon and P. glaucus groups.) How Many Shifts to Rutaceae Feeding? One question that remains to be settled is how many times did the shift to Rutaceae occur? The answer suggested by the trees in Fig. 4 is at least twice, once in the Old World (section II) and once in the Americas (section IV; it should be added that P. glaucus and several of its close relatives in section III use, among other hosts, Ptelea trifoliata, a Rutaceae; Scriber, 1988; Scriber et al., 1995), which would make it equally parsimonious to assume that Rutaceae feeding was ancestral in Papilio and ascribe the use of Lauraceae and related plant families by sections I, III, and V species to character reversal. However, it must be recalled that the branch shared by sections I and III (P. clytia, P. laglaizei, and P. troilus) on the one hand and IV (P. cresphontes and P. anchisiades) on the other is a rather short one, the existence of which is not well supported by bootstrap analyses (moreover, P. cresphontes was included within the section II subtree in the LSU tree). Inclusion of additional Papilio species and/or sequencing of other sections of mtDNA may settle this and other issues pertaining to the phylogeny and evolutionary diversification of Papilio and related genera.

166

AUBERT ET AL.

ACKNOWLEDGMENTS We are especially grateful to David Swofford for allowing one of us (F.M.) to participate in the testing of prerelease versions of the PAUP4 package; to Torsten Eriksson for helping us to use AutoDecay; to M. Caterino, F. Sperling, and R. DeSalle for critical comments on our manuscript; and to J. Michel and J. C. Weiss for providing us with valuable material.

REFERENCES Aubert, J., Descimon, H., and Michel, F. (1996). Population biology and conservation of the Corsican Swallowtail butterfly, Papilio hospiton Ge´ne´ (Lepidoptera: Papilionidae). Biol. Cons. 78: 247– 255. Aubert, J., Barascud, B., Descimon, H., and Michel, F. (1997). Ecology and genetics of interspecific hybridization in the swallowtails, Papilio hospiton Ge´ne´ and P. Machaon L., in Corsica (Lepidoptera: Papilionidae). Biol. J. Linn. Soc. 60: 467–492. Becerra, J. X. (1997). Insects on plants: Macroevolutionary chemical trends in host use. Science 276: 253–256. Berenbaum, M. R. (1981). Effect of linear furanocoumarins on an adapted specialist insect (Papilio polyxenes). Ecol. Entomol. 6: 345–351. Berenbaum, M. R. (1983). Coumarins and caterpillars: A case for coevolution. Evolution 37: 163–179. Berenbaum, M. R. (1995). Chemistry and oligophagy in the Papilionidae. In ‘‘Swallowtail Butterflies: Their Ecology and Evolutionary Biology’’ (J. M. Scriber, Y. Tsubaki, and R. C. Lederhouse, Eds.), pp. 27–38. Scientific Publ., Gainesville, FL. Berenbaum, M. R., and Feeny, P. (1981). Toxicity of angular furanocoumarins to swallowtails: Escalation in the coevolutionary arms race. Science 212: 927–929. Bossart, J. L., and Scriber, J. M. (1995a). Maintenance of ecologically significant genetic variation in the swallowtail butterflies through differential selection and gene flow. Evolution 49: 1163–1171. Bossart, J. L., and Scriber, J. M. (1995b). Genetic variation in oviposition preference in tiger swallowtail butterflies: Interspecific, interpopulation and interindividual comparisons. In ‘‘Swallowtail Butterflies: Their Ecology and Evolutionary Biology’’ (J. M. Scriber, Y. Tsubaki, and R. C. Lederhouse, Eds.), pp. 183–194. Scientific Publ., Gainesville, FL. Bremer, K. (1994). Branch support and tree stability. Cladistics 10: 295–304. Brower, L. P. (1984). Chemical defense in butterflies. In ‘‘The Biology of Butterflies’’ (R. I. Vane-Wright and P. R. Ackery, Eds.). pp. 109–134, Academic Press, London. Chase, M. W., et al. (1993). Phylogenetics of seed plants: An analysis of nucleotide sequences from the plastid gene rbcL. Ann. Missouri Bot. Gard. 80: 528–580. Codella, S. G., and Lederhouse, R. C. (1989). Intersexual comparison of mimetic protection in the black swallowtail butterfly, Papilio polyxenes: Experiments with captive blue jay predators. Evolution 43: 410–420. Cohen, M. B., Schuler, M. A., and Berenbaum, M. R. (1992). A host-inducible cytochrome P450 from a host-specific caterpillar: Molecular cloning and evolution. Proc. Natl. Acad. Sci. USA 89: 10920–10924. Collins, N. M., and Morris, M. G. (1985). ‘‘Threatened Swallowtail Butterflies of the World: The IUCN Red Data Book,’’ IUCN, Gland, Switzerland. Cunningham, C. W. (1997). Can three incongruence tests predict when data should be combined? Mol. Biol. Evol. 14: 733–740.

Delorme, M. O., and He´naut, A. (1988). Merging of distance matrices and classification by dynamic clustering. CABIOS 4: 453–458. Eriksson, T. (1996). ‘‘AutoDecay,’’ v. 2.9.6. (Hypercard stack distributed by the author). Botaniska Institutionen, Stockholm University, Stockholm. Ehrlich, P. R., and Raven, P. H. (1964). Butterflies and plants: a study in coevolution. Evolution 18: 586–608. Emmel, T. C., and Garraway, E. (1990). Ecology and conservation biology of the Homerus swallowtail in Jamaica (Lepidoptera: Papilionidae). Trop. Lepid. 1: 63–76. Farrell, B. D. (1998). ‘‘Inordinate fondness’’ explained: Why are there so many beetles? Science 281: 555–559. Farris, J. S., Ka¨llersjo¨, M., Kluge, A. G., and Bult, C. (1994). Testing significance of incongruence. Cladistics 10: 315–319. Frati, F., Simon, C., Sullivan, J., and Swofford, D. L. (1997). Evolution of the mitochondrial cytochrome oxidase II gene in Collembola. J. Mol. Evol. 44: 145–158. Goloboff, P. A. (1993). Estimating character weights during tree search. Cladistics 9: 83–91. Hagen, R. H. (1990). Population structure and host use in hybridizing subspecies of Papilio glaucus (Lepidoptera: Papilionidae). Evolution 44: 1914–1930. Hagen, R. H., and Scriber, J. M. (1991). Systematics of the Papilio glaucus and P. troilus species groups (Lepidoptera: Papilionidae): Inferences from allozymes. Ann. Entomol. Soc. Am. 84: 380–395. Hagen, R. H., and Scriber, J. M. (1995). Sex chromosomes and speciation in tiger swallowtails. In ‘‘Swallowtail Butterflies: Their Ecology and Evolutionary Biology’’ (J. M. Scriber, Y. Tsubaki, and R. C. Lederhouse, Eds.), pp. 211–227. Scientific Publ., Gainesville, FL. Hancock, D. L. (1983). Classification of the Papilonidae (Lepidoptera): A phylogenetic approach. Smithersia 2: 1–48. Hasegawa, M., Kishino, H., and Yano, T. (1985). Dating of the human–ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 21: 160–174. Hazel, W. N., Brandt, R., and Grantham, T. (1987). Genetic variability and phenotypic plasticity in pupal color and its adaptive significance in the swallowtail butterfly Papilio polyxenes. Heredity 59: 449–455. Hazel, W. N. (1990). Sex-limited variability and mimicry in the swallowtail butterfly, Papilio polyxenes Fabr. Heredity 65: 109–114. Hillis, D. M., and Bull, J. J. (1993). An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 42: 182–192. Igarashi, S. (1984). The classification of the Papilionidae mainly based on the morphology of their immature stages. Tyo To Ga 34: 41–96. Igarashi, S. (1989). On the life history of Meandrusa payeni (Boisduval) in Malaysia (Lepidoptera, Papilionidae). Tyo To Ga 40: 93–116. Janz, N., and Nylin, S. (1998). Butterflies and plants: A phylogenetic study. Evolution 52: 486–502. Jones, D. S., and Schofield, J. P. (1990). A rapid method for isolating high quality plasmid DNA suitable for DNA sequencing. Nucleic Acids Res. 18: 7463–7464. Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Paabo, A., Villablanca, F. X., and Wilson, A. C. (1989). Dynamics of mitochondrial evolution in animals: Amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA 86: 6196–6200. Kukal, O., Ayres, M. P., and Scriber, J. M. (1991). Cold tolerance of pupae in relation to the distribution of swallowtail butterflies. Can. J. Zool. 69: 3028–3037. Lake, J. A. (1994). Reconstructing evolutionary trees from DNA and protein sequences: Paralinear distances. Proc. Natl. Acad. Sci. USA 91: 1455–1459.

MOLECULAR PHYLOGENY OF SWALLOWTAIL BUTTERFLIES Lederhouse, R. C., Ayres, M. P., Nitao, J. K., and Scriber, J. M. (1992). Differential use of Lauraceous hosts by swallowtail butterflies, Papilio troilus and P. palamedes (Papilionidae). Oikos 63: 244–252. Lederhouse, R. C., and Scriber, J. M. (1996). Intrasexual selection constrains the evolution of the dorsal color pattern of male black swallowtail butterflies, Papilio polyxenes. Evolution 50: 717–722. Lockhart, P. J., Steel, M. A., Hendy, M. D., and Penny, D. (1994). Recovering evolutionary trees under a more realistic model of sequence evolution. Mol. Biol. Evol. 11: 605–612. Maidak, B. L., Olsen, G. J., Larsen, N., Overbeek, R., McCaughey, M. J., and Woese, C. R. (1996). The Ribosomal Database Project (RDP). Nucleic Acids Res. 24: 82–85. Martin, J. A., and Pashley, D. P. (1992). Molecular systematic analysis of butterfly family and some subfamily relationships (Lepidoptera: Papilionoidea). Entomol. Soc. Am. 85: 127–139. Michel, F., and Costa, M. (1998). Inferring RNA structure by phylogenetic and genetic analyses. In ‘‘RNA Structure and Function’’ (R. W. Simons and M. Grunbberg-Manago, Eds.), pp. 175–202. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Miller, J. S. (1986). ‘‘Phylogenetic Systematics and Chemical Constraints on Host-Plant Associations in the Papilioninae’’ PhD thesis, Cornell University, Ithaca, NY. Miller, J. S. (1987a). Phylogenetic studies in the Papilioninae (Lepidoptera: Papilionidae). Bull. Am. Mus. Nat. Hist. 186: 385–512. Miller, J. S. (1987b). Host-plant relationships in the Papilionidae (Lepidoptera): Parallel cladogenesis or colonization? Cladistics 3: 105–120. Munroe, E. G. (1961). The classification of the Papilionidae (Lepidoptera). Can. Entomol. Suppl. 17: 1–51. New, T. R., and Collins, N. M. (1991). ‘‘Swallowtail Butterflies: An Action Plan for Their Conservation,’’ IUCN, Gland, Switzerland. Nishida, R., Weintraub, J. D., Feeny, P., and Fukami, H. (1993). Aristolochic acids from Thottea spp. (Aristolochiaceae) and the osmeterial secretions of Thotthea-feeding troidine swallowtail larvae (Papilionidae). J. Chem. Ecol. 19: 1587–1594. Pa¨a¨bo, S. (1990). Amplifying ancient DNA. In ‘‘PCR Protocols’’ (M. A. Innes, D. H. Gelfand, J. J. Sninsky, and T. J. White, Eds.), pp. 159–166. Academic Press, San Diego. Richard, D., and Gue´de`s, M. (1983). The Papilionidae (Lepidoptera): Co-evolution with the angiosperms. Phyton 23: 117–126. Ritland, D. B., and Scriber, J. M. (1985). Larval development rates of three putative subspecies of tiger swallowtail, Papilio glaucus, and their hybrids in relation to temperature. Oecologia 65: 185–193. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). ‘‘Molecular Cloning: A Laboratory Manual,’’ 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Scriber, J. M. (1988). Tale of the tiger: Beringial biogeography, binomial classification, and breakfast choices in the Papilio glaucus complex of butterflies. In ‘‘Chemical Mediation of Coevolution’’ (K. C. Spencer, Eds.), pp. 241–301, Academic Press, San Diego. Scriber, J. M., Lederhouse, R. C., and Brown, K. (1991). Hybridization of Brazilian Papilio (Pyrrhosticta) (Section V) with the North American Papilio (Pterourus) (Section III). J. Res. Lepid. 29: 21–32. Scriber, J. M., Hagen, R. H., and Lederhouse, R. C. (1996). Genetics of mimicry in the tiger swallowtail butterflies Papilio glaucus and P. canadensis (Lepidoptera: Papilionidae). Evolution 50: 222–236.

167

Scriber, J. M., Lederhouse, R. C., and Dowell, R. V. (1995). Hybridization studies with North American swallowtails. In ‘‘Swallowtail Butterflies: Their Ecology and Evolutionary Biology’’ (J. M. Scriber, Y. Tsubaki, and R. C. Lederhouse, Eds.), pp. 269–281. Scientific Publ., Gainesville, FL. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., and Flook, P. (1994). Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87: 651–701. Smart, P. (1975). ‘‘The Illustrated Encyclopedia of the Butterfly World,’’ Salamender, London. Sperling, F. A. H. (1991). ‘‘Mitochondrial DNA Phylogeny, Speciation, and Host-Plant Coevolution of Papilio Butterflies,’’ PhD dissertation, Cornell University, Ithaca, NY. Sperling, F. A. H. (1993a). Mitochondrial DNA phylogeny of the Papilio machaon species group (Lepidoptera: Papilionidae). Mems. Entomol. Soc. Canada 165: 233–242. [In ‘‘Systematics in Support of Entomology’’ (G. E. Ball & H. V. Banks, Eds.)] Sperling, F. A. H. (1993b). Mitochondrial DNA variation and Haldane’s Rule in the Papilio glaucus and Papilio troilus species group. Heredity 71: 227–233. Sperling, F. A. H., and Feeny, P. (1995). Umbellifer and composite feeding in Papilio: Phylogenetic frameworks and constraints on caterpillars. In ‘‘Swallowtail Butterflies: Their Ecology and Evolutionary Biology’’ (J. M. Scriber, Y. Tsubaki, and R. C. Lederhouse, Eds.), pp. 299–306. Scientific Publ., Gainesville, FL. Steel, M. (1994). Recovering a tree from the Markov leaf colourations it generates under a Markov model. Appl. Math. Lett. 7: 19–23. Swofford, D. L., Olsen, G. J., Waddell, P. J., and Hillis, D. M. (1996). Phylogenetic inference. In ‘‘Molecular Systematics’’ (D. M. Hillis, C. Moritz, and B. K. Mable, Eds.), pp. 407–514. Sinauer, Sunderland, MA. Thompson, J. N. (1988a). Variation in preference and specificity in monophagous and oligophagous swallowtail butterflies. Evolution 42: 118–128. Thompson, J. N. (1988b). Evolutionary genetics of oviposition preference in swallowtail butterflies. Evolution 42: 1223–1234. Thompson, J. N., Wehling, W., and Podolsky, R. (1990). Evolutionary genetics of host use in swallowtail butterflies. Nature 344: 148– 150. Tyler, H., Brown, K. S., and Wilson, K. (1994). ‘‘Swallowtail Butterflies of the Americas.’’ Scientific Publ., Gainesville, FL. Weintraub, J. D. (1995). Host plant association patterns and phylogeny in the tribe Troidini (Lepidoptera: Papilionidae). In ‘‘Swallowtail Butterflies: Their Ecology and Evolutionary Biology’’ (J. M. Scriber, Y. Tsubaki, and R. C. Lederhouse, Eds.), pp. 307–316. Scientific Publ., Gainesville, FL. Watanabe, M. (1988). Multiple matings increase the fecundity of the yellow swallowtail butterfly, Papilio xuthus L., in summer generations. J. Insect Behav. 1: 17–29. Wolstenholme, D. R. (1992). Animal mitochondrial DNA: Structure and evolution. Int. Rev. Cytol. 141: 173–216. Yang, Z. (1994). Estimating the pattern of nucleotide substitution. J. Mol. Evol. 39: 105–111.