Molecular Regulation of Insulin-like Growth Factor-I and Its Principal Binding Protein, IGFBP-3

Molecular Regulation of Insulin-like Growth Factor-I and Its Principal Binding Protein, IGFBP-3 LAWRENCE S. PHILLIPS CHING-IPAO,AND BETTYC. VILLAFUERTE Division of Endocrinology and Metabolism Department of Medicine Emory University School ofMedicine Atlanta, Georgia 30322 I. Growth Hormone and the Insulin-like Growth Factors . . . . . . . . . . . . . . 11. IGFs and the Homeostatic Response to Limitations in Insulin and/or Nutrition , . . . . . , . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . , . . , . . . 111. Circulating IGFs in Conditions of Insulin Deficiency and Malnutrition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IV.Concurrent Regulation of Circulating IGFs and IGF-Binding Proteins by Insulin and Nutritional Status . . . . . . . . . . . . . . , . . . . . . . . . V. Hepatic Contributions to Circulating IGFs and IGFBPs . VI. Molecular Regulation of IGF-I . . . . . . . . . . . . . . . . . . . . . . A. Structure of the IGF-I Gene . . . . . . . . . . . . . . . . . . . . . . B. Initiation of IGF-I Gene Transcription in Exons 1 and C. Identification and Characterization of IGF-I Promoter Regions inExon1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. Molecular Regulation of' IGF-I Expression by Hormonal and Metabolic Status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E. Mechanisms Underlying Reduced IGF-I Gene Transcription in Diabetes Mellitus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VII. Molecular Regulation of IGF Binding Protein-3 . . . . . . . . . . . . . . . . . . . . A. Function of IGFBP-3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Posttranslational Regulation of IGFBP-3 . . . . . . . . . . . . . . . . . . . . . . . C. Molecular Organization of the IGFBP-3 Gene . . . . . . D. Regulation of IGFBP-3 . . . . . . . , . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E. Mechanism of Insulin Action on IGFBP-3 Gene Transcription . . . . VIII. Summary/Pe GFBP-3 . . ., .. ., ... References I

I

198

199 200 201 202 203 203 204 206 216 225 230 23 1 233 234 238 246 251 255

The insulin-like growth factors (IGFs) have diverse anabolic cellular functions, and structure similar to that of proinsulin. The distribution of IGFs and Progress in Nucleic Acid Research and Molecular Biology, Vol. 60

195

Copyright 0 1996 by Academic Press. All rights of reproduchon in any fonn reserved. 0079-6603/96$25.00

196

LAWRENCE S. PHILLIPS ET AL.

their receptors in a wide variety of organs and tissues enables the IGFs to exert endocrine, paraci-ine, and autocrine effects on cell proliferation and differentiation, caloric storage, and skeletal elongation. IGF-I exhibits particular metabolic responsiveness, and circulating IGF-I originates predominantly in the liver. Hepatic IGF-I production is controlled at the level of gene transcription, and transcripts are initiated largely in exon 1. Hepatic IGF-I gene transcription is reduced in conditions of protein malnutrition and diabetes mellitus, and our laboratory has used in vitro transcription to study mechanisms related to diabetes. We find that the presence of sequences downstream from the major transcription initiation sites in exon l is necessary for the diabetes-induced decrease in IGF-I transcription. Six nuclear factor binding sites have been identified within the exon 1 downstream region, and footprint sites 111 and V appear to be necessary for metabolic regulation; region V probes exhibit a decrease in nuclear factor binding with hepatic nuclear extracts from diabetic animals. IGFs in biological fluids are associated with IGF binding proteins, and IGFs circulate as a 150-kDa complex that consists of an IGF, an IGFBP-3, and an acid-labile subunit. Circulating IGFBP-3 originates mainly in hepatic nonparenchymal cells, where IGF-I increases IGFBP-3 mRNA stability, but insulin increases IGFBP-3 gene transcription. Regulation of IGFBP-3 gene transcription by insulin appears to be mediated by an insulin-responsive element, which recognizes insulin-responsive nuclear factors in both gel mobility shift assays and southwestern blots. Studies of mechanisms underlying the modulation of IGF-I and IGFBP-3 gene transcription, and identifcation of critical nuclear proteins involved, should lead to new understanding of the role and regulation of these important growth factors in diabetes mellitus and other metabolic disorders. 8 1998 Academic Press

The insulin-like growth factors, IGF-I and IGF-11, are single-chain polypeptides that play a diverse biological role. The tertiary structure of the IGFs resembles that of proinsulin (I),but the IGF genes appear to have diverged from the insulin genes at least 500 million years ago (2,3). Similarities and important differences between the IGFs and insulin are now well established. In man, the insulin gene is located on chromosome 11, the IGF-I gene is located on chromosome 12, and the IGF-I1gene is located on chromosome 11-contiguous to the insulin gene (4).The amino acid sequences of IGF-I and IGF-I1 are 41 and 43%homologous to that of insulin in the 01 and p chains, but differ extensively in the connecting peptide region (5).Insulin acts via a heterotetrameric receptor with particular abundance in liver, muscle, and adipose tissue. Although the Type I IGF receptor resembles the insulin receptor both in heterotetrameric structure and tyrosine kinase properties, the Type I1 IGF receptor is identical to the mannose-6-phosphate receptor, and has size, structure, and signal transduction properties that differ from those of the insulin receptor and the Type I IGF receptor (for review, see Refs. 6, 7).Insulin is produced in the p cells of the pancreas, and acts in an endocrine mode to regulate fuel metabolism predominantly in liv-

197

MOLECULAR REGULATION OF IGF-I A N D IGFBP-3

er, muscle, and adipose tissue. In contrast, the IGFs are produced in many organs and tissues, and IGF receptors are present in many organs and tissues as well-permitting the IGFs to act in autocrine and paracrine as well as endocrine modes. Appropriate to an endocrine role as the dominant regulator of fuel metabolism in the fed state, the secretion of insulin is modulated within seconds to minutes at the posttranslational level through a signal transduction system keyed to extracellular glucose concentration, and the turnover of insulin in the circulation is rapid, with a half-life of 10-15 minutes. However, consistent with a more diverse biological role, the IGFs are regulated largely at the level of gene transcription, and are present in biological fluids in association with IGF binding proteins (IGFBPs),which modulate the actions of IGFs, and prolong the half-life of circulating IGFs up to 12-15 hr (8). The endocrine mode of IGF action and negative feedback effects on the secretion of growth hormone permit a systemic role comparable to that of traditional endocrine factors such as the pituitary hormones, thyroid hormones, and adrenal hormones. However, the autocrine and paracrine modes of IGF production and action also permit a local role comparable to that of other local factors. The biological effects of the IGFs have been reviewed (9), and include promotion of growth in vivo in both hypophysectomized (10)and diabetic (11)animals, actions on bone and cartilage to promote skeletal elongation (12),anabolic insulin-like effects on fat and muscle to promote calorie storage (13),hormone-amplifymg effects in the ovary and testes (14-16), and stimulation of cell proliferation in a wide variety of organs and tissues (17,18) including vascular smooth muscle cells (19, 20). In their effects on cell growth, the IGFs are thought to act as progression factors, stimulating movement from G,/G, through S phases of the cell cycle, as opposed to competence factors, such as platelet-derived growth factor (PDGF), that facihtate early cellular commitment to G, (19, 21, 22). Before birth in mammals, both IGF-I and IGF-I1mRNAs and protein are found in multiple locations, but IGF-I1is present at much higher levels and is thought to play an important role in fetal growth (23-27). Mice with null. mutations of the IGF-I or IGF-I1genes exhibit marked deficiencies in growth and development, (28,29).Mice with Type I IGF receptor knockouts are particularly stunted and die at birth, and combined deficiency of IGF-I and IGF-I1 genes has greater impact than lack of either gene alone. After birth, IGF-I1 levels fall in many tissues except for the brain, suggesting a potential role as a neurotransmitter in this organ. In contrast, IGF-I levels rise after birth (23,24). Interestingly, such a postnatal rise in IGF-I parallels the progressive rise in relevance of growth hormone (GH) for growth after blrth; hypophysectomized animals exhibit normal gain in weight for approximately 3 weeks after birth, but exhibit slower growth thereafter (30).In combination, such observations

-

198

LAWRENCE S. PHILLIPS ET AL.

suggest that IGF-I may be important for GH-dependent growth, and that the rise in IGF-I may reflect an increase in GH secretion and/or action. As outlined below, IGF-I of hepatic origm appears to play an endocrine role as a systemic growth factor, whereas IGF-I of extrahepatic origin appears to play an autocrine/paracrine role as a local growth factor. IGF-I is also more metabolically responsive than IGF-II-decreasing further in conditions of GH, insulin, or nutritional deficiency, and rising further in conditions of GH excess (31).The remainder of this review will focus on IGF-1, and on its principal binding protein, IGFBP-3.

1. Growth Hormone and the Insulin-like Growth Factors The existence of the IGFs was first proposed by Salmon and Daughaday in 1957 (32),based on attempts to explain the action of GH on target tissues such as growing cartilage. The utility of isotopic measurement of cartilage thymidine and sulfate uptake as an index of growth activity was established by demonstrating a decrease in cartilage activity in animals rendered GH deficient by surgical hypophysectomy, with restoration to normal in animals treated with GH (32).However, although the reduced growth activity of cartilage from hypophysectomized animals could be restored to normal by treatment with GH in uiuo, similar effects were not obtained by incubation with GH in uitro. Cartilage incubated in ui&o exhibited minimal responses to the addition of serum from hypophysectomized animals, but was stimulated by the serum of GH-treated hypophysectomized animals-comparable to serum from normal animals.Accordingly,it was hypothesized that the biological impact of GH on growing cartilage was mediated by the generation of circulating factors that acted directly on growing tissues such as cartilage. Based on the original bioassay, such mediators were initially given the operational designation of “sulfation factor.” In the 1960s and 1970s, expanding interest in the anabolic properties of serum and plasma led to attempts to i d e n e the critical factors underlying such activity. Hall, Van Wyk, and others (33, 34 focused on the cartilagestimulating properties of serum, and on isolated peptides possessing “somatomedin activity”-to denote mediation of the growth-promoting properties of GH (somatotropin) (34).Froesch and others focused on the components of serum that provide insulin-like activity that cannot be suppressed by antiinsulin antibodies, and isolated factors possessing “nonsuppressible insulinlike activity” (NSILA)(35).Temin, Rechler, Nissley, and others (17,36)focused

MOLECULAR REGULATION OF IGF-I A N D IGFBP-3

199

on the ability of serum to promote the proliferation of cells in tissue culture, and isolated factors possessing “multiplaction-stimulating activity” (MSA). After partial sequencing of the different isolates revealed that activity was attributable to a common factor, Rinderknecht and Humbel(37,38) provided full sequence information for human IGF-I and IGF-I1 as single-chain polypeptides of molecular mass 7649 and 7471 Da, respectively. With the demonstration of extensive sequence homology to insulin (37, 38), and an analysis from Blundell et al. (1) suggesting that the tertiary structure of the IGFs was similar to that of proinsulin, designation as “insulin-likegrowth factors” became widely accepted. It is now appreciated that the IGFs act as both systemic and local me&ators of GH action. Administration of GH to hypophysectomized animals leads to an increase in levels of circulating IGF-I (34),due largely to increased hepatic production of IGF-I (see below). Administration of GH also leads to increased IGF-I expression in the cartilaginous zones that mediate skeletal elongation (39-41). Daughaday (42) considered the quantitative contributions of systemic versus local generation of IGFs in response to GH administration, and concluded that much of the growth response was attributable to generation of systemic IGFs. Consistent with endocrine regulation by GH, IGFs exhibit typical negative feedback effects on GH, including both direct effects on GH secretion from pituitary cells and indirect effects via stimulation of the release of somatostatin from the hypothalamus (43).

II. IGFs and the Homeostatic Response to limitations in Insulin and/or Nutrition Under conditions wherein anabolism is limited due to either insulin or nutritional deficiency, homeostatic responses include limitation of growth, reproduction, and metabolic rate-preserving metabolic fuels for more vital functions. As reviewed by Phillips (44),reproduction is limited because of decreased secretion of gonadotropins (a brain response), and metabolic rate is decreased in part because of reduced circulating levels of triodothyronine (because of decreased conversion from thyroxine in the liver and other sites), without an accompanying increase in thyroid-stimulating hormone (a brain response).The limitation in growth occurs in part because of reduced hepatic production of IGFs-despite increased secretion of GH (see below). Thus, both the liver and the brain are involved in these homeostatic processes; the combination of low levels of IGFs with high GH levels results in stimulation of lipolysis but maintenance of protein stores in times of stress, and contributes to nitrogen sparing under such conditions (45).

200

LAWRENCE S. PHILLIPS ET AL.

111. Circulating IGFs in Conditions of Insulin Deficiency and Malnutrition Initial identification of the IGFs was based in large part on attempts to understand the promotion of growth by GH; a role in GH action was supported by early studies that revealed increased circulating IGF activity in conditions of GH excess, and decreased IGF activity in conditions of GH deficiency. However, application of IGF bioassays to a spectrum of clinical conditions provided the first indication that the IGFs must also be regulated by other factors. Thus, children with diabetes or malnutrition exhibit decreased circulating IGF activity despite high levels of GH (46-48); low IGF activity parallels the low insulin levels and poor nutxition of such children. Conversely, children with obesity or who exhibit hyperphagia following hypothalamic surgery for tumors such as craniopharyngiomasmay exhibit good growth and normal IGF activity despite low levels of GH (47, 49); the normal IGF activity parallels increased insulin levels and good nutrition in such children. All of these early observations with IGF bioassays were confirmed in subsequent studies with more sensitive and specific radioimmunoassays for IGF-I.In combination, such observationsprovided evidence that the IGFs might be regulated by insulin and nutrition as well as GH. In response to such observations, our laboratory and others (50-54) utilized animal models to test the hypothesis of IGF regulation by insulin and nutrition. We found that food restriction in rats leads to decreases in cartilage growth activity and circulating IGF activity that are refractory to GH administration, but can be restored to normal by refeeding (50).Availability of protein appears to be particularly important; animals fed low-protein diets have decreases in cartilage growth activity and circulating IGF activity comparable to values found either in hypohphysectomized animals fed ad libitum or in intact animals fed diets containing one-third as many calories (55). Animals with streptozotocin-induced diabetes exhibit decreases in cartilage growth activity and circulating IGF activity comparable to changes found in hypophysectomized animals-but refractory to administration of GH (56, 57). The changes in cartilage activity and IGF activity can be prevented by administration of insulin shortly after streptozotocin is given, and the defects are restored to normal when animals with full-blown diabetes are treated with insulin, evidence that the decrease in IGF activity may be attributed specificallyto the diabetic state (56,57).In animals with a wide spectrum of diabetes severity, IGF activity is correlated with measures of metabolic control such as glucose levels or gain in body weight (57). Additional studies utilizing IGF-I radioimmunoassays have confirmed the relationship between circulating IGF-I levels and insulin and nutrition-

MOLECULAR REGULATION O F IGF-I AND IGFBP-3

20 1

a1 status in man. IGF-I levels are particularly low under conditions of diabetic ketoacidosis, but rise with insulin therapy (58).IGF-I levels in diabetic outpatients are lower than levels in subjects without diabetes (58).Circulating IGF-I values are also correlated with metabolic control of diabetes, as measured by levels of glycated hemoglobin (hemoglobin Alc) (59-61). Several laboratories have demonstrated the responsiveness of circulating IGF-I levels to nutritional status in man and animals, and the particular importance of dietary protein (62-64);because of such relationships, IGF-I measurements may be useful in the assessment of nutritional status in the clinical setting (65, 66). In combination, such observations show that IGFs are regulated by insulin and nutrition in both animals and humans.

IV. Concurrent Regulation of Circulating IGFs and IGF-Binding Proteins by Insulin and Nutritional Status In the 1970s, it was recognized that the IGFs are found in body fluids in association with high-MW carrier proteins (for recent reviews, see Refs. 67-69). At the same time, it became apparent that metabolically regulated circulating factors could modify IGF action. Early mixing experiments in our laboratory and others indicated that the serum of streptozotocin-diabetic or malnourished rats contained in excess of substances that could antagonize the ability of IGFs in normal serum to stimulate cartilage sulfate or thymidine uptake (47, 70). Later experiments showed that antagonism of IGF action extended to other tissues as well, including muscle and adipose tissue (71). In 1997, seven dfferent IGF-binding proteins (IGFBPs) have been recognized. They share cysteine-rich regons thought to be important for disulfide bond formation and preservation of tertiary structure, but differ widely in other regions (68,69).Although specific IGFBP receptors on target tissues have not been demonstrated, the interaction of IGFBPs with IGFs can either inhibit or facilitate IGF action, depending on the model system; IGFBPs may also interact with extracellular matrix, and facilitate targeting of IGFs to different tissue beds (see below). Examination of a model of progressive severity of streptozotocin-induced diabetes has revealed that at least one of the IGFBPs may be more metabolically responsive than the IGFs. Thus, animals with mild diabetes exhibit an increase in circulating IGF-antagonistic factors (72).Animals with more severe diabetes exhibit a marked rise in IGFBP-1, together with a fall in both IGFBP-3 and IGF-I (73).The separate metabolic responsiveness of IGFBPs

202

LAWRENCE S. PHILLIPS ET AL.

and IGFs leads to a fall in free IGF-I that precedes the fall in total IGF-I as diabetes becomes progressively more severe. A similar decrease in free IGF-I has also been reported in humans (74). In such interactions, the contributions of circulating IGFBP-3 and IGFBP-1 appear to be particularly important. IGFBP-3 is the major carrier protein for IGFs in the circulation; molecular regulation of IGFBP-3 is discussed below. IGFBP-1 is smaller than the mature, glycosylated form of IGFBP-3 (-25 kDa vs. -43 kDa) (69), somewhat more metabolically responsive (73), and regulated by insulin in a direction opposite to that of IGFBP-3; insulin lowers IGFBP-1 but raises IGFBP-3 (73)-both are regulated at the level of gene transcription (see below).

V. Hepatic Contributions to Circulating IGFs and IGFBPs Early liver perfusion studies by McConaghey and Sledge (75), as well as our own laboratory (76-78), showed that the liver exhibits metabolically responsive release of factor(s) with anabolic properties similar to those of the IGFs. Subsequently,we found that release of IGF activity and IGF-I by perfused livers or cultured hepatocytes was decreased by GH deficiency, malnutrition, or diabetes in uivo, and stimulated by the provision of GH, insulin, and/or essential amino acids in vitro (78-80). Perfused livers release both mature IGF-I and a form of higher MW (81),and more recent studies of liver extracts have revealed the presence of both IGFBPs and a high-MW form of IGF-I-presumably a 12- to 18-kDa prohormone (82-83). Work from a number of laboratories has demonstrated the liver of adult rats to be particularly enriched in mRNA for IGF-I, IGFBP-3, and IGFBP-1 (in malnourished or diabetic animals (84-87). The essential role of the liver as a source of circulating IGFs was shown by observations of Schwander et al. (88) that hepatic production of IGF-I is sufficient to account for IGF-I turnover in the circulation, and by observations that hepatic IGF-I expression is correlated with circulating IGF-I levels in a variety of metabolic conditions (89, 90). However, it has been difficult to study IGF-I regulation in the liver because many liver cell lines exhibit relatively low IGF-I expression (91-93). For this reason, we have used normal liver cells in primary culture as a model in which IGF-I and IGFBP-3 production can be assessed over periods of 3-6 days (80, 94-96). The remainder of our discussion will focus on the molecular regulation of IGF-I and its principal binding protein, IGFBP-3.

MOL EC U L A R REGULATION OF IGF-I AND IGFBP-3

203

VI. Molecular Regulation of IGF-I A. Structure of t h e IGF-I Gene In all of the species studied to date, IGF-I is a single-chain basic protein composed of 70 amino acid residues; the amino acid sequence and composition are remarkably well conserved. IGF-I contains an NH,-terminal B domain of 29 amino acids, a C region of 12 residues, an A domain of 21 amino acids, and a COOH-terminal D region of 8 residues (1, 97, 98). Insulin-like growth factors I and I1 share 70% identity to one another, and the A and B domains are about -50% identical to those of insulin. Structural information on the IGF-I genes is now available from several species, including humans (99, loo),rats (lo]),sheep (102),chickens (103),and salmon (104, 105).The cDNAs have been isolated and characterized from these species as well as mouse (106),pig (107),guinea pig (108), cow (109) and Xenopus (110).The gene is large, ranging from less than 20 kb in salmon (104,105),and -50 kb in the chicken (103),to 80-90 kb in the rat (101);size in humans is not yet determined, but appears to approximate that in the rat (101). The differences in the size of the IGF-I gene from salmon to humans are due largely to an increase in the size of the introns. The IGF-I molecule is similar to insulin, but unlike the insulin gene, which is translated into a single mRNA species, the structure and processing of the IGF-I gene are complex and include alternative usage of promoters and transcription initiation sites, differential RNA splicing, and variable sites of polyadenylation (111114).Salmon mRNAs appear to be a single species, whereas Xenopus, chicken, and mammalian IGF mRNAs occur as multiple species, with differences in size due primarily to the length of the 3' untranslated region and variable polyadenylation (115-117). The human and rat IGF-I genes consist of six exons (98),as shown in Fig. 1.The single IGF-I gene gives rise to a complex family of mRNAs with both size and sequence heterogeneity; splicing and processing have been reviewed by Adamo et al. (117,118)and Lund et al. (119),and are outlined here. Exons 1 and 2 contain separate promoter and 5' untranslated regions, with the beginning of the signal peptide. Transcripts initiated in exon 1or exon 2 are spliced to exon 3, which encodes the remainder of the signal peptide and the first part of the B domain. Exon 4 encodes the remainder of the B domain, together with the A, and D domain. Exon 4 encodes the remainder of the B domain, together with the C, A, and D domains, and the initial part of E domain. The presence or absence of human exon 5 sequences depends on which splice acceptor site is used in processing of particular primary transcripts (100).Lowe et al. (120)have shown that the exon 5 cassettes seen in the rodent IGF-I genes are subject to alternative splicing, and encode two dif-

c,

LAWRENCE S. PHILLIPS ET AL.

204 DNA:

Exon 1

Exon 2

Exon3 E ~ n Exon5 4

Exon 6

TRANSCRIPTS: '

, I

Class 1 del mRNA Class 2 mRNA

V

Ea mRNA

FIG.1. Diagram of the rat IGF-I gene. The top of the figure shows the structure of the gene, with exons drawn to scale. Exons are indicated by solid boxes and introns are indicated by open boxes. Protein coding regions are shown in black, and B, C, A, and D domains of the mature polypeptide are indicated. The bottom of the figure shows the alternative usage of promoters either in exon 1 or 2, alternative splicing, and multiple sites of polyadenylation in exon 6. (With permission, from Ref. 118.)

ferent carboxy-terminalprecursor peptides, generated by alternate exclusion or inclusion of a 52-bp mini exon; rat IGF-Ia cDNAs lack the mini exon and encode a 35-amino acid E domain, whereas IGF-Ib cDNAs encode a different 41-amino acid E domain due to inclusion of the mini exon. The choice of polyadenylation sites in exon 6 determines the length of the 3' untranslated region (121) and results in the different sizes of IGF-I mRNAs observed in Northern blots. The 7.5-kb species is rich in AU sequences and relatively unstable compared to the smaller species (122, 123), offering the possibility of metabolic regulation at the level of mRNA turnover (see below). The IGF-I gene also gives rise to different polypeptide prohormone forms that reflect utilization of multiple translation initiation sites; signal peptides with 48,32, and 22 amino acids are found in the rat, and with 48,32,25, and 22 amino acids in human (114, 116'). The different leader peptides could possibly determine targeting of IGF-I or its precursors to specific intracellular locations or alternative secretory pathways (117-119). The intricacies of the IGF-I gene, including alternative usage of exon 1 or 2 promoter and transcription initiation sites, differential splicing, and multiple sites of polyadenylation, provide a rich spectrum of opportunities for regulation of IGF-I production.

B. Initiation of IGF-I Gene Transcription in Exons 1 and 2 Initiation of IGF-I gene transcription is complex. Based on primer extension, S, nuclease mapping, and ribonuclease protection assays, several laboratories (111,112,114,124,125) have identified multiple transcription initia-

205

MOLECULAR REGULATION OF IGF-I AND IGFBP-3

tion sites in exons 1and 2 in the sheep, rat, and human IGF-I genes. In exon 1,initiation of transcription involves at least four district sites, dispersed over 350 bp in the rat and human genes (Fig. 2). Although transcription in exon 2 also occurs at multiple sites, 90% of the exon 2 transcripts originate in a single cluster, with potential TATA and CCAAT-like elements present at -30 and - 80 bp, respectively, upstream of the major exon 2 initiation site. Variation in transcript initiation and processing produces mRNAs with differing 5’ untranslated regions, designated by Lowe et al. (113)as I or C (initiation in exon l),I1 or B (initiation in exon 2), and I del or A (initiation in exon 1, with a subsequent internal deletion of 186 bases (Fig. 1). 1. TISSUESPECIFICITYOF TRANSCRIPTION INITIATION In the rat, exon 1-derived transcripts (class I) are predominant in every tissue expressing the IGF-I gene, whereas exon 2-derived transcript (class 11) levels are relatively high in liver, low in extrahepatic tissues such as lung, stomach, kidney, and testes, and barely detectable in brain, heart, and muscle (121, 124). Among the exon 1 mRNAs, transcripts initiated from sites 2 and 3 are most common in the liver (211, 126), the major source of circulating IGF-1 (above).Although exon 1transcripts in extrahepatic tissues exhibit some heterogeneity, most transcription initiation occurs at site 3 (112).The pattern of transcription initiation in the rat is generally similar to that seen in less extensive observations in the pig (127),sheep (128),and human (129). 2. DEVELOPMENTAL AND METABOLIC RESPONSIVENESS OF TRANSCRIPTION INITIATION

Although IGF-I expression is highest in the liver, and most hepatic IGF-I transcripts originate in exon 1, the utilization of initiation sites varies with developmental and metabolic status. In the rat, hepatic transcripts initiated at different sites in exons 1 and 2 fall coordinately with fasting and streptozotocin-induced diabetes, and are restored with refeeding and insulin therapy (126).However, hepatic exon 1 mRNAs initiated at sites 2 and 3 increase linearly as a function of postnatal age, whereas transcripts initiated in exon 2 begin to rise more rapidly at 3 weeks of age, with the onset of GH-dependent

-..Exon I

Exon 2

FIG.2. Schematic diagram of transcription initiation sites in exons 1 and 2 of the rat IGF-I gene. The two major initiation sites in exon 1 (sites 2 and 3) are indicated by large m o w s .

206

LAWRENCE S . PHILLIPS ET AL.

linear growth (126, 130). Hepatic exon 2 transcripts rise more than exon 1 transcripts with GH treatment in hypophysectomized rats (113,131),and GH also stimulates exon 2 transcripts more than exon 1transcripts in sheep (128). The effects of nutrition and energy status on promoter usage are less clear. In sheep, provision of diets with high protein and energy content led to rises in hepatic IGF-I mRNAs initiated in both exons 1and 2, but the increase was much greater for exon 1 transcripts than those from exon 2 (128).In pigs, Weller et al. (127)found that exon 1transcripts are more abundant than exon 2 transcripts in both liver and extrahepatic tissues under normal conditions. However, a variety of conditions leading to low circulating IGF-I levels (altered diet or reduced environmental temperature) were associated with decreases in exon 2 transcripts that were relatively greater than the decreases in exon 1 transcripts. Overall, exon 1 transcripts appear to be more ubiquitous and more abundant than exon 2 transcripts. Exon 2 transcripts are found mainly in the liver, and appear more sensitive than exon 1 transcripts to GH status, and possibly to nutritional status as well.

3. SIMILARITY BETWEEN INITIATION OF TRANSCRIPTION in Vivo AND in Vitro

To determine whether initiation of IGF-I gene transcription was similar in normal liver and in hepatocyte primary culture, we utilized ribonuclease protection assays based on the probe developed by Adamo et al. (124, 126). the probe permitted identification of transcripts initiated in both exons 1and 2, and was transcribed form a 690-bp IGF-I DNA template consisting of 134 bp of sequence flanking exon 1 initiation site 1,381 bp of exon 1,and 176 bp of exons 3 and 4 sequence; protected regions 557, 520, 420, 258, 210, and 176 bp in length reflect transcripts initiated at sites 1, 2, 3, 1 and 2 spliced, and site 4 in exon 1,and exon 2, respectively. As shown in Fig. 3, the utilization of initiation sites in vitro was remarkably similar to that in vivo (124, 126, 132). Provision of insulin or GH alone produced a coordinate increases in all exon 1 transcripts, and the effect of insulin and GH was additive. Transcription initiation in exon 2 appeared to be somewhat more sensitive than initiation in exon 1to provision of insulin, and to provision of GH in the presence of insulin-generally similar to findings in vivo (above). Because the majority of IGF-I transcripts appear to be initiated in exon 1, our laboratory and those of other workers have focused on transcription-related mechanisms involving this region.

C. Identification and Characterization of IGF-I Promoter Regions in Exon 1 The 5’ flanking sequences for IGF-I genes from several species exhibit common features, including lack of a TATA box, presence of “initiator” ele-

MOLECULAR REGUL'4TION OF IGF-I A N D IGFBP-3

1

2

207

3 SPLICE 4

START SITES

FIG 3. Utilization of IGF-I exon 1 transcription initiation sites in normal rat liver and in normal rat hepatocytes in primary culture. Hepatocytes were maintained for 48 hr on collagencoated plates in serum-free medium containing 1W6 M insulin and 200 ng/ml GH. RNA was extracted from hepatocytes and liver, and quantified by ribonuclease protection assay with a riboprobe transcribed from a 690-bp IGF-I DNA template. After antoradiography and densitometq, utilization of different initiation sites was expressed as a percentage of total exon 1 transcripts. In this study, utilization of exon 1 initiation sites was comparable in vitro and in viwo. (Reproduced from Reg. 132 by permission of theJoournaZ ofEndocrinoZogy Ltd.)

ments (133,134), and bindmg sites for transcription factors such as C/EBP, HNF-1, and HNF-3 (135-137);such transcription factors also modulate expression of other hepatic export proteins, including albumin, fibrinogen, and a-fietoprotein (138-141). Transient transaction studies in neuroblastoma SK-N-MC cells ( 1 2 4 , rat fibroblasts (142),and C6 glioma cells (142)have indicated the presence of a functional promoter region in exon 1. However, such models may not identify cis-regulatory sequences that are important for regulation of IGF-I expression in the liver-the dominant source of IGF-I in vivo-and under physiologic conditions.Accordingly,we used hepatic nuclear extracts in an in vitro transcription assay to define a basic promoter region and to define the necessity of 5' flanking sequence for IGF-I gene expression, as described in detail by Pa0 et al. (143). 1. TEMPLATE CONSTRUCTION In order to avoid random initiation and to obtain a distinct signal, we developed a chimeric construct in which 5' flanking sequences upstream from the start site were subcloned into a G-free cassette reporter vector (144).Although there are four transcription initiation sites in exon l (Fig. 2), the G-free cassette was placed downstream from site 3 because this is the major initiation site in vivo (124) and there are no G residues immechately downstream from this site. The G-free construct pIGF,,,(C2AT) was prepared via polymerase chain reaction (PCR) amplification, and other 5' deletion mutants were constructed by conventional methods.

208

LAWRENCE S. PHILLIPS ET

AL.

2. In Vitro TRANSCRIPTION ASSAY Initial studies utilized both in IGF-I construct, pIGF,,,(C,AT), which contained a -370-bp G-free reporter fragment, and adenovirus major late promoter constructs containing shorter G-free reporters, pML(C,AT),go or pML(C,AT), 70, as internal controls. Hepatic nuclear extracts were prepared according to the procedures described by Gorski et al. (141)and Triezenberg et al. (145), with minor modifications (143, 146). Inclusion of 1%nonfat dry milk in the homogenization buffer appears to increase yield and limit proteolytic damage during the preparation (147).Reactions (30 p1) contained 1.0 pg of IGF-I template DNA, 50 ng of pML(C,AT),,, or pML(C,AT),,,, 60 pg of extract, 60 mMKC1,6 mMMgCl,, 0.5 mMATP and CTP, 35 pMUTP,

- + + + S L L - - - +

template extracts L a-amanitin

-

eIGF I

4dMLP

M

I

2

3

4

FIG.4. In vitro transcription of the rat IGF-I gene using chimeric promoter conshvcts placed upstream from a G-free cassette reporter fragment. The IGF-I template extended from -471 bp to +3 bp relative to the major transcription initiation site in exon 1 (site 3). Each reaction contained 60 p.g of nuclear extract either from liver (lanes 1,3, and 4)or spleen (lane 2), 1 p.g of pUC13(C2AT)(lane 1) or pIGF,,,(C,AT) (lanes 2,3, and 4).In lane 4, the reaction contained 3 p g / d of a-amanitin; 50 ng of pML(C,AT),,o was included in each reaction as an internal control. Labeled in vitro transcripts were purified and resolved on an 8 M urea, 6Yo polyacrylamide gel. pBR322 plasmid DNA hgested by Hpa I1 was used as a size marker. In uitro transcription of the TGF-I gene is directed by RNA polymerase 11, and is relatively liver-specific. (With permission, from Ref. 143.)

MOLECULAR REGULATION OF IGF-I A N D IGFBP-3

209

10 pCi [a-32P]UTP,0.1 mM 3’-O-methylGTP, 10% glycerol, 1U/p1RNasin, 0.05 mM EDTA, and 1 mM DTT as described (143).As shown in Fig. 4,the IGF-I template provided a strong 3 73-bp signal in reactions containing nuclear extracts from normal rat liver (lane 3).The IGF-I signal was abolished by use of vector [PUC13(C2AT)]as template (lane l),and both the IGF-I and AdMLP signals were abolished by addition of a-amanitin (lane 4).A nuclear extract from rat spleen was transcriptionally active as shown by a strong AdMLP signal, but provided an IGF-I signal only 10%as strong as that with extracts from liver (lane 2 vs. 3), similar to liver specificity found in vivo (84). Thus, tissue-specifictranscription was directed by RNA polymerase I1 from an authentic promoter on the rIGF-I gene, and 471 bp of 5’ flanking sequence contains cis elements sufficient to activate the IGF-I promoter in vitro. We also used construct pIGF,,,(C,AT) as a template to define optimal assay conditions, which included approximately 60 p g of nuclear extract (15-30 pg is sufficient if transcripts are quantitated by primer extension; see below), incubations for 45 min at 30”C, 60 mM KCl, and approximately 6 mMMgC1, to maximize the activities of both general and tissue-specific transcription factors; AdMLP transcripts were increased when the MgC1, concentration was raised from 2 to 6 mM, while IGF-I transcripts were decreased with MgC1, concentrations from 8 to 12 mM (143).In separate studies, we found that 50 ng of pAdMLP (C,AT),,, or pAdMLP (C,AT),,, used as an internal control did not compete with the IGF-I signal provided by 1.0 pg of IGF-I template. 3. REQUIREMENT FOR SEQUENCE UPSIREAM OF THE MAJOR TRANSCRIPTION INITIATION SITES IGF-I templates were constructed with different lengths of 5’ flanking sequence; activity was assessed by in vitro transcription and normalized to the activity provided by AdMLP templates in the same reactions (143).Relative to the major transcription initiation site in exon 1(site 3,242 bp 5’ to the 3’ end of exon l),we found that IGF-I constructs containing 54 bp of 5’ flanking sequence exhibited consistent transcriptional activity (Fig. 5), and we consider these 54 bp to be the core promoter for this initiation site. Transcriptional activity was maximal with 300 bp of 5‘ flanking sequence. Results were similar when circular plasmid DNA was used as a template, indicating that changes in promoter activity were not due to restraint effects (143). The effect of 5’ flanking sequence on IGF-I promoter activity has also been studied by other workers, using transient transfection in extrahepatic immortal cell lines. In the following discussion, we have designated the major transcription initiation site in exon 1 (site 3) as +l.Hall et ul. (121) examined rat IGF-I gene expression in SK-N-MC neuroblastoma cells, and

210

LAWRENCE S. PHaLIPs

AL.

FIG.5. The effect of 5’ deletions on rat IGF-I gene expression.(A) Assays were performed in the presence of60 d K C I , 6mMMgC4, and 60 pgof esfract at 30°C for 45 min. The IGF-I templates had 5’ tefrom -1050 bp to -54 bp, and 3’ termini at +3 bp, relative to the mahr transcrkption initiation site in exon 1 (site 3). The DNA templates were pIGFlo50(C$’), PlGF,,,(Cfl, PIGF4,1(C&T), PIGF300(C&9 PIGFme(CeAT). and PIGF,,(Cfl. (B) rIGF-I in Uift.0transcription.IGF-I signals determinedby densibmetric scanningwere normalizedto those of pMLC(C2AT),,. The signaI obtainedfiom pIGFS4(C&Tj was designated as 1. Mean 2 SEM for four dBerent nuclear extracls. Core promoter activity was provided by the -54bp conskuct, and maximal promoter activity was obtainedwith constructscontaining300 bp of 5’ sequence; the decrease in activity between -300 and -471 bp suggests involvement of a repressor(s). pith permission, from Ref. 143.)

found limited activitywith a constructextendingfrom -533 to +190 bp, and maximal activity with a constructwith a 5’ terminus at -1 kb. Kim et d.(100) reported similar findings with human IGF constructsin SK-N-MC cells, with

MOLECULAR REGULATION OF IGF-I A N D IGFBP-3

211

greatest activity with a construct extending from - 1.8 kb to + 184 bp. However, Jansen et al. (129) found greatest activity in SK-N-MC cells with a human IGF-I construct extending from -690 to +55 bp, and no increase in promoter activity was observed with an additional 1.3 kb of 5‘ flanking sequence. In rat dermal fibroblasts and rat C6 glioma cells, Lowe and Teasdale (142) found maximal promoter activity with a rat IGF-I construct extending from -550 to +224 bp; addition of -700 bp of further 5’ flanking sequence led to reduced expression. An et al. (148) recently examined rIGF-I gene expression in these cells with constructs having a 3‘ terminus at +45 bp, and noted maximal expression when 5’ flanking sequence was reduced to - 156 bp. More recently, Wang et al. (149) studied rat IGF-I constructs in a combination of C6, GH3 rat pituitary tumor, OVCAR-3 human ovarian adenocarcinoma, and CHO (Chinese hamster ovary) cell lines, and generally found maximal expression with 5’ flanking sequence between -270 and -62 bp when the 3’ terminus was +22S bp. Variation among these findings may reflect (1) our use of extracts from normal liver, as compared to other workers’ use of fibroblasts or immortal cell lines, which may have different concentrations and/or activity of transcription factors (150-152); (2) our use of a G-free cassette reporter (which prohibited inclusion of downstream sequence), as compared with the chimeric genes used for transfection-although downstream sequences may be important for expression (121, 142, 146, 148); (3) our assessment of transcripts initiated only at a defined site, compared to transfection in which transcripts may be initiated at multiple sites; and (4) assembly of initiation complexes in vitro, which may differ from that in vivo because of the use of purified DNA as a template (153).

4. DNAIPROTEIN INTERACTIONS WITHIN FLANKING REGION

THE

UPSTREAM 5’

The progressive appearance of DNase I-hypersensitive sites during developmental activation of the rat IGF-I gene indicates the involvement of trans-acting factors (154). Because transcriptional regulation depends on binding of both general and tissue-specific nuclear factors, we used DNase I protection assays to assess nuclear factor binding within the region from -300 to -54 bp (143).As shown in Fig. 6, four protected regons were identified at - 1191- 100 (I), - 1491- 126 (11),-213/- 193 (111),and -2481-238 ( N )bp. Regions I and I1 are similar to HS3A and HS3B described by Thomas et aE. (159, and the four protected sites are compatible with the locations of DNase I-hypersensitive sites described by Kikuchi et al. (154).Homologies with consensus binding sites for both ubiquitous and liver-specificfactors are summarized in Table I. Umayahara et al. (156) observed that estrogen can stimulate the chicken IGF-I promoter via an A€’-1 enhancer in HepG2 cells.

I -479 TCTAGTTTAC CATGGTCATT TABLE TCAGGGTTAA CATCATTGTG CTTTCTGGAG ATAGTCTTTC COMPARISON OF rIGF-I GENOMIC DNA SEQUENCE WITHIN DNASEI PROTECTION REGIONSI-IV wnx THE CONSENSUS SEQUENCES OF THE KNOWW TRANSCRIFTONFACTORS~ Region

-419

I (-119/-100) -359 -299 -239 I 1 (-149/-126) -179 -119

I11 (-213/-193)

-59 +2

TTCCTTTTTT AAATTTTTTC CCCCAAATTT TGTATTTGCC CTAAAATATA AACTCGCTCC Transcription factor

Consensus sequence

IGF-I sequence

TTACTCGATAACTTTGCCAG C/EBP GTGG~/,’/,~/,GATTGC gtGgTAAgaTTGC CGTGTCCCAC TTAGACCCTC TAATCCTGGT TAGGTGTATT AGCAGACAAG TGTACCTTCG AP 1 TGA~/,T"/,A TgACTCa NF1 T / , ~ ~ R / , ~ , - G ~ ~ ~ ~ CGgaAACTTTGCCAa IVHNF- 1 GTTAATNATTAAC gTTAaTCatTAAC AGCCCTGCGG AAAGTTAATC AGAGAACAGA TCCTATTTTC TATGGCAGCA TCAGTATTTA DB P At T acATAAC A / G~ TACATAA~ /

-

-

-111 ACGTCTGCTA ACCCTGTCAG AAACACACAT TCTTTTAAGG GGGGGAAAAA AAACGCCTCT TGTTATTTGTCACGGTGCCCAA?A HNF- 3 TATTGA~/,TT~/ :G TaTTgaTTtg I1 TAT TTGT HNF-5 T~/,TTTG"/ GTGCTCCAGT TTTTAAAAGC AAAGGTATGA TGTTATTTGT CACGGTGCCC AAAAAAGTCC AP 1 T GA~/,T~/ ,A TGaCtAA AP 3 TGTGG~/,~/ rA/T TGTggTTT 1 TTACTCGATA ACTTTGCCAG AAGAGGGAGA GAGAGAGAAG GCGAATGTTC CCCCAGCTGT

r

ACATTCTTTTAAGGGGGGGAA GGGGcGGAt S P l TTCCTGTCTA CAGTGTCTGT GTTTTGTAGA TAAATGTGAG GATTTTCTCT AAATCCCTCT GtGGAAA Insulin TTTTcccGG E2 F TCTGCTTGCT AAATCTCACT GTCGCTGCTA AATTCAGAGC AGATAGAGCC TGCGCAATCG

FIG.6. In uitru DNase I footprints within rIGF-I exon 1promoter and 5’ flanking regions. Summary of nuclear factor bindTCAGTATTTAAC ing sites determined by DNase I protection assay, in the region upsh-eam from the major transcription TATAAA TAT a aA initiation site in IGF-I exon (site 3). The sequence originally determined by Shimatsu and Rotwein was confirmed in our laboratory. Protected regions are shown by dark bars, and the major exon 1 transcription initiation site is indicated by an arrow. (With permission, from Ref. "Only the sequences of the message strand are shown. The nucleotides that are different from the consensus sequences are indicated by lowercase letters. The rIGF143.)

I sequence is in bold.

TABLE I COMPARISON OF rIGF-I GENOMIC DNA SEQUENCE WITHIN DNASEI PROTECTION REGIONSI-IV w r THE ~ CONSENSUS ~ SEQUENCES OF THE KNOWW TRANSCRIFTONFACTORS~ Region

I (-119/-100)

I 1 (-149/-126)

I11 (-213/-193)

Transcription factor

Consensus sequence

IGF-I sequence

C/EBP AP 1 NF1 HNF- 1 DB P

TTACTCGATAACTTTGCCAG GTGG~/,’/,~/,GATTGC gtGgTAAgaTTGC TGA~/,T"/,A TgACTCa T / , ~ ~ R / , ~ , - G ~ ~ ~ ~ CGgaAACTTTGCCAa GTTAATNATTAAC gTTAaTCatTAAC At T acATAAC A / G~ TACATAA~ /

HNF- 3 HNF-5 AP 1 AP 3

TATTGA~/,TT~/ :G T~/,TTTG"/ T GA~/,T~/ ,A rA/T TGTGG~/,~/

TGTTATTTGTCACGGTGCCCAA?A TaTTgaTTtg TAT TTGT TGaCtAA TGTggTTT

ACATTCTTTTAAGGGGGGGAA GGGGcGGAt GtGGAAA TTTTcccGG

SPl Insulin E2 F

TATAAA

TCAGTATTTAAC TAT a aA

"Only the sequences of the message strand are shown. The nucleotides that are different from the consensus sequences are indicated by lowercase letters. The rIGF-

I sequence is in bold.

214

LAWFIENCE S. PHILLIPS ET AL.

The Sussenbach laboratory (135-137) has shown that C/EBP, LAP, and HNF-1 can stimulate hIGF-I gene expression in Hep3B cells through binding 120 bp upstream, corresponding to footprint I identified by our laboratory,They also found that maximum expression requires binding of HNF-3P both upstream (-30) and downstream (+lo bp) (137).

-

5. ROLEOF SEQUENCEDOWNSTREAM FROM TRANSCRIPTION INITIATION Sms

THE

MAJOR

Promoters associated with both housekeeping and growth control genes may require downstream elements to achieve full gene expression (157);in addition to regulating transcription initiation, such downstream elements may affect RNA elongation, processing, and translation (157).To evaluate the contributions of downstream regions in the rat IGF-I gene, we first utilized chimeric constructs in which IGF-I exon 1promoter sequences were placed upstream from a luciferase reporter gene (158).Although transient transfection in primary cultures of rat hepatocytes is difficult, careful attention to pH and other aspects of coprecipitation allowed us to achieve reasonable expression with modifications of the calcium phosphate method originally described by Ginot et al. (159,160). Under conditions where both insulin and growth hormone were added at high concentrations, and amino acids were provided at concentrations five times levels found in rat arterial plasma, we found that the presence of -220 bp of sequence downstream from initiation site 3 provided a three-fold increase in expression (Fig. 7). Our observations in hepatocytes are consistent with the findings of Hall et al. (161)in SK-N-MC cells, in which reporter construct containing -200 bp of sequences located downstream from start site 3 provided a four- to fivefold increase in expression. Lowe et al. (142, 148) also found that downstream sequences increased IGF-I gene expression when similar constructs were transfected into C6 glioma cells, and Wang et al. (149) obtained comparable results with C6 and GH3 cells but less striking differences in CHO cells and no change with OVCAR-3 cells. In combination, these findings indicate that IGF-I expression also depends in part on the presence of cis-regulatory sequences located downstream from the major sites of transcription initiation in exon 1. The requirement for both upstream and downstream elements to achieve full gene expression has been noted both for housekeeping genes such as ribosomal protein rpL32 (162),and for growth control genes such as osteocalcin (163).Such downstream elements may influence RNA elongation, processing, and translation, in addition to transcription initiation. Moreover, intragenic enhancers or activators have been described for numerous extrahepatic genes such as P-globin (164), aldolase B (169, and muscle creatine kinase (166).Thus, the requirement for both upstream and downstream elements to achieve fill gene expression is not unique to the IGF-I gene.

MOLECULAR REGULATION OF IGF-I AND

IGFBP-3

215

p0LUC p(4398/-32)LUC p(-I 8591-32)LUC p(-1262/32)LUC p(-1859/+55)LUC p(-I859/+180)LUC

FIG.7. IGF-I promoter activity in noimal rat hepatocytes in primary culture. Cells were transfected with rIGF-I sequences placed upstream from a luciferase reporter vector. Sequences are shown relative to the major exon 1 transcription initiation site (site 3), and promoter activity was expressed relative to activity with a basal promoter consbvct lacking IGF-I sequences. Mean 5 SEM. The presence of a downstream sequence increased expression. (With permission, from Ref. 146.)

6. D N ~ P R O T EINTERACTIONS IN DOWNSTREAM FROM MAJOR INITIATION SITESIN EXON1 DNase I protection analysis was used with rat hepatic nuclear extracts to identify loci of nuclear factor binding within a region extending -200 bp downstream from initiation site 3 in exon 1 (246).Protein-binding sites were determined on both codmg and noncoding strands, and results are summarized in Fig. 8. Region I corresponds to the major transcription initiation site in exon 1.Five additional protected regions were observed, with footprints at + 17/+25 (region11),+42/+68 (region 111),+79/+ 101(regionIV), + 129/+152 (region V),and + 155/+169 bp (region VI). These nuclear binding sites within the exon 1 downstream region are similar to those identified by Thomas et al. (155). Use of Genetics Computer Group software to screen a transcription factor binding site data base recognized homologies to a number of nuclear factors, such as AP-1,AP-2, C/EBP, and TATA-box binding proteins. However, to date neither we nor other laboratories have been able to identify nuclear factors that interact with the downstream region. Much less is known about IGF-I promoter regions in exon 2. Readers are referred to the report from the Adamo laboratory (149),in which the minimal promoter active in a combination of C6,0VCAR-3, GH3, and CHO cells appeared to be contained within a region between -79 and -36 bp of 5’ sequence and +44 bp of 3’ sequence relative to the most 5’ transcription initiation site; promoter activity increased with addition of -200 bp of 5’ sequence, but decreased with further sequence-similar to the pattern in exon 1 (above).

LAWRENCE S. PHILLIPS ET AL.

216 -239

ACGTCTGCTA ACCCTGTCAG AAACACACAT TCTTTTAAGG GGGGGAAAAA

-189

AAACGCCTCT GTGCTCCAGT TTTTAAAAGC AAAGGTATGA TGTTATTTGT

-139

CACGGTGCCC AAAAAAGTCC TTACTCGATA ACTTTGCCAG AAGAGGGAGA

-89

GAGAGAGAAG GCGAATGTTC CCCCAGCTGT TTCCTGTCTA CAGTGTCTGT

-39

GTTTTGTAGA TAAATGTGAG GATTTTCTCT AAATCCCTCT TCTGCTTGCT

12

7 1 -111 AAATCTCACT GTCGCTGCTA AATTCAGAGC AGATAGAGCC TGCGCAATCG

62

112 162 212

-

-

4-

-

IV AAATAAAGTC CTCAAAATTG AAATGTGACT TTGCTCTAAC ATCTCCCATC

V -v1 TCTCTGGATT TCTTTTTGCC TCATTATTCC TGCCCACCAA TTCATTTCCA

-

GACTTTGTAC TTCAGAAGCG ATGGGGAAAA TCAGCAGTCT TCCAACTCAA TTATTTAAGA TCTGCCTCTG TGACTTCTTG AAGGTAAATA TCTCTTACTT

FIC.8. In vitro DNase footprints within exon 1. Summary of nuclear factor binding sites in the region downskeam from the major transcription initiation site in IGF-I exon 1(site 3);DNase Iprotection assays were performedwith a 272-bp AccIiBgZII (-541219) fragment.The sequence originally determined by Shimatsu and Rohvein was confmed in our laboratory. Protected regions are underlined. The major exon 1transcription initiation (site 3) is indicated by an arrow and designated as + 1.(With permission, from Ref. 146.)

D. Molecular Regulation of IGF-I Expression by Hormonal and Metabolic Status The complex architecture of the IGF-I gene permits regulation at several levels, including changes in mRNA stability, variations in RNA splicing, alternative usage of promoter and transcription initiation sites, and modulation

M O L E C U L m REGULATION OF IGF-I AND

IGFBP-3

217

of gene transcription. Consistent with diverse biological functions, IGF-I gene expression can be either cell/tissue specific, development specific, or modulated by a variety of hormones, growth factors, and metabolic/nutritional status. In this section, we focus on mechanisms underlying altered IGF-I expression due to changes in growth hormone levels, nutritional status, and diabetes mellitus. 1. GROWTHHORMONE Growth hormone plays a central role in regulating mammalian somatic growth (167).As outlined above, circulating IGF-I levels reflect GH statuslow in GH-deficient children, and high in patients with acromegaly (168); IGF-I levels are also elevated in GH transgenic mice with increased body size (169). The response of IGF-I to GH occurs mainly through modulation of gene expression, as shown by the increase in hepatic IGF-I mRNA levels in Zit/tit GH-deficient mice treated with GH (170).In primary cultures of rat hepatocytes, GH increases IGF-I mRNA abundance with a maximal induction after a 24-hr exposure (171). Growth hormone has been found to stimulate hepatic IGF-I gene transcription both in vivo and in vitro. Administration of GH to hypophysectomized rats leads to a rapid increase in IGF-I gene transcription (172). Tollet et d. (173) showed that provision of GH can stimulate IGF-I gene transcription in primary cultures of rat hepatocytes, and Johnson et al. (174) reported that GH did not alter IGF-I mRNA stability in hepatocyte culturesconsistent with regulation at the level of gene transcription. Growth hormone can also regulate IGF-I gene expression outside the liver, as studied extensively in preadipocytes. GH has strong adipocyte differentiating effects in Ob1771, 3T3F442A, and 3T3-Ll preadipocytes (175-177), in part via the stimulation of GH receptor expression (178).In mouse Ob1771 preadipocyte cells, GH simulates IGF-I gene transcription, and IGF-I is thought to promote adipose tissue development from such cells (179). Kamai et al. (177) recently reported that both IGF-I and GH are required for differentiation of Ob17 7 1 cells to adipocytes. Moreover, IGF-I appears to act in an autocrineiparacrine fashion to induce IGF-I production and cellular differentiation in this model. Administration of GH to hypophysectomized rats induces a rapid alteration in chromatin structure, as shown by appearance of a DNase I-hypersensitive site in the second intron (172)-additional evidence for regulation by GH at the level of gene transcription. However, Thomas et al. (155)utilized an extensive series of gel mobility-shift and DNase I footprinting analyses with oligonucleotides and DNA fragments in a region extending from 1.5 kb upstream to -184 bp downstream from the major transcription initiation site in exon 1 (site 3), and found no difference in nuclear factor binding be-

-

218

LAWRENCE S. PHILLIPS ET AL.

tween hepatic extracts obtained from hypophysectomized as compared with GH-treated rats. Lack of alterations in nuclear factor binding might be due to mechanisms in which nuclear factors are bound constitutively (180),modulation of transcription factor activation rather than binding, and modifications of nuclear proteins that are not stable through in vitro reconstitutions. Several laboratories have advanced understanding of the mechanism of GH action on IGF-I gene transcription (172,173,181). Binding of GH to its receptor induces dimerization (182, 183), followed by activation of a signal transduction cascade. The GH receptor interacts with an intracellular protein kinase, JAK2 (184), stimulates the rapid tyrosine phosphorylation of JAK2 and MAP kinases (184, 189, and induces phosphorylation or dephosphorylation of other intracellular enzymes and transcription factors, including c-jun, c-myc, and others (186, 187).Hypophysectomizedrats given a single injection of GH also exhibit tyrosine phosphorylation of a number of nuclear proteins, including STAT9 1 (185).Activation of STAT9 1 by GH increased binding to an element in the c-fos promoter, although bindmg to the IGF-I promoter did not change. Thus, nuclear protein phosphorylation appears to be an early event in GH action.

2. NUTRITION The malnutrition-induced decrease in circulating IGF-I is well reflected by reductions in hepatic IGF-I expression. Uniform decreases with fasting (89, 126, 188, 189), protein restriction (64, 190-192), andtor energy restriction (193)provide strong evidence of regulation at pretranslational levels. Both transcriptional and posttranscriptional mechanisms may mediate the decrease in IGF-I expression induced by malnutrition. Straus and Takemot0 (189)examined IGF-I gene transcription in fasted and protein-deprived rats, finding that reductions in gene transcription were insufficient to account for decreases in IGF-1 mRNA, and suggested that IGF-I production might be regulated at least partially at the posttranscriptional level. However, we found that metabolic effects on IGF-I gene transcription were detected with particular sensitivity by a probe encompassing genomic DNA regions immediateIy downstream from incitation sites in exon 1 (124, whereas Straus and Takemoto (189,191)used a 3.8-kb intronic probe and a 4.2-kb probe covering exons 3 and 4, making it difficult to compare their results with ours. Both Straus and Takemoto (189,193)as well as other workers (194)have concluded that the 7.5-kb mRNA species may be more responsive than smaller species because of differences in mRNA stability. Moreover, Thissen et al. (195) reported that GH administration to protein-restricted rats restored hepatic IGF-I mRNA to control levels without changing IGF-I in liver or serum. Similarly, we found in rats that were fasted and subsequently refed that hepatic IGF-I expression began to rise prior to detectable increases in either ex-

MOLECULAR REGULATION OF 1GF-I AND IGFBP-3

219

tractable hepatic IGF-I or circulating IGF-I (89). We believe that some of these observations might be explained by a transient lag in restoration of the process of IGF-I protein synthesis, and that the predominance of evidence in our laboratory and others supports transcription as the major locus of IGF-I regulation. In order to elucidate molecular mechanisms in a well-defined system, we studied effects of amino acid concentration on IGF-I expression in primary cultures of rat hepatocytes (80). Within a broad range of amino acid concentration (0.25-6.25X rat arterial plasma levels), both IGF-I release and IGF-I expression were increased progessively by provision of amino acids. Similar results were obtained by Thissen et al. (171),who reported that provision of amino acids at reduced concentration lowered IGF-1 gene expression, expecially the 7.5-kb transcripts. We also found that deprivation of essential amino acids such as tryptophan and lysine reduced IGF-I release, whereas deprivation of nonessential amino acids such as cysteine had no effect (80).Effects of amino acids on release of IGF-I were more striking than effects on release of albumin-consistent with the observation that malnutrition in vivo reduces circulating IGF-I more than levels of other hepatic export proteins (64). We also used hepatocyte primary culture to evaluate the impact of amino acid availability on IGF-I gene transcription in nuclear run-on assays (196). In the presence of M insulin, IGF-I gene transcription fell -60% as amino acid concentration was reduced from 5x to 0.5x rat arterial plasma levels; stimulation of IGF-I gene transcription by insulin was observed only in hepatocytes cultured in high concentrations of amino acids (Fig. 9). Thus, the negative effects of decreased amino acid availability appeared to be dominant over the positive effects of insulin (196). 3. DIABETES MELLITUS AND INSULIN

The decreases in IGF-I production associated with diabetes mellitus have provoked extensive examinations aimed at underlying mechanisms. Our laboratory has utilized streptozotocin-induced diabetes as a model to study regulation of IGF-I as a gene stimulated by insulin, and our early studies included concurrent assessment of IGF binding protein-1 (IGFBP-1) as a control gene inhibited by insulin. Animals receiving streptozotocin in progressive dosage exhibited weight loss, an increase in serum glucose, reduced IGF-1 levels, and a rise in circulating IGFBP-1 (73, 125). Because these responses were reversed with insulin treatment, they were attributable to insulin deficiency rather than to streptozotocin toxicity.

a. Hepatic IGF-1 and ZGFBP-1 Gene Expression and Gene Transcription. We first examined molecular mechanisms in viuo. As shown in Fig. 10, hepatic IGF-I expression fell 40-50n/o in animals treated with streptozot-

220

LAWRENCE S. PHILLIPS ET AL.

P-Actin

pGEM-4Z IGF-1

IGFBP-I

A Acids Insulin

0.5~

HI

5x

0.5x

5x

HI

LO

LO

FIG.9. Effects of amino acids on IGF-I and IGFBP-1 gene transcription. Hepatocytes were cultured for 1day with 2 X loe7 M dexamethasone,amino acids at 5X or 0.5X rat arterial plasmalevels, and insulin at M . Transcription rates of IGF-I and IGFBP-1 genes were or determined by nuclear run-on assay using a cDNA probe for IGFBP-1 and a 3.2-kb genomic probe for IGF-I (see below). High concentrations of insulin reduced IGFBP-1 transcription and increased IGF-I transcription. However, the effect of low levels of amino acids to lower IGF-I transcription was dominant over the stirnulatory effects of insulin. w i t h permission, from Ref. 196. C.-I. Pao, P. K. Farmer, S. Begovic, B. C. Villafuerte, G.-J. Wu, D. G. Robertson, and L. S. Phillips,Mol. Endocrinol. 7,1561 (1993). OThe Endocrine Society.]

ocin in progressive dosage, whereas IGFBP-1 expression rose (125);administration of insulin restored expression of IGF-I to levels close to normal, while IGFBP-1 expression fell below normal-similar to the striking decrease in IGFBP-1 seen in humans with high insulin levels (63). Gene transcription rates were examined in nuclear run-on assays (125). With a cDNA probe for the structural protein p-actin, there was a strong signal but no change in gene transcription rates in diabetic animals, permitting use of p-actin as an internal biological control. A cDNA probe for IGFBP-1 also provided a strong signal, and identified consistent changes in transcription rate in diabetic animals. However, an IGF-I cDNA probe provided a weak signal and did not recognize differences in transcription rates with nuclei obtained from normal versus diabetic animals. Although a 9-kb EcoRI genomic fragment including both exons 1and 2 also failed to detect changes in IGF-I gene transcription in diabetic animals (Fig. ll), the signal was strong; we next tested probes containing sequences mainly downstream (-3.2-kb EcoRI/BgZIIfragment) or upstream (-5.8-kb BglIIIEcoRI fragment) from the two major transcription initiation sites in exon 1. The -5.8-kb upstream probe was not metabolically responsive, but the -3.2-kb downstream probe reproducibly distinguished alterations in IGF-I transcription rates in diabetic animals, and was used in subsequent studies to assess molecular mechanisms. The effects of streptozotocin-induced diabetes on IGF-I and IGFBP-1 gene transcription are shown in Fig. 12 (125). IGF-I gene transcription was

22 1

MOLECULAR REGULATION OF IGF-I AND IGFBP-3 DOSE-RESPONSE

INSULIN TREATMENT

-

2

0 0

0

hQ

<-

g

E

100

100 50

50

0

0

3000

400

2000

1000 0

200

CONTROL STZ

12

STZ 144

CONTROL STZ 144

0

STZ -t

- *-..

INSULIN

FIG.10. Effects of streptozotocin-induced diabetes and insulin therapy on hepatic IGF-I and IGFBP-1 expression.Total liver RNA (20 kg) was subjected to Northein blot analysis with ICF-I and ICFBP-1 cDNA as probes. mRNA abundance was quantitated by densitometric scanning, and expressed as a percentage of the mean control value (mean ? SEM; n = 4). Over a period of 2-3 days, levels of IGF-I mRNA did not change with mild diabetes, but fell with severe diabetes. In contrast, IGFBP-1 expression increased even with mild diabetes. Insulin therapy restored expression ofboth IGF-I and IGFBP-1. w i t h permission, from Ref. 125. C.4. Pao, P. K. Farmer, S. Begovic, S. Goldstein, G.-J.Wu, and L. S. Phillips, MoZ. Endocrinol. 6,969 (1992). OThe Endocrine Society.]

reduced even in animals with mild diabetes, but IGFBP-1 gene transcription rose. Administration of insulin corrected these responses, raising IGF-I gene transcription and reducing BP-1 gene transcription. Although expression of both IGF-I and IGFBP-1 was strongly correlated with rates of gene transcription-evidence for regulation at the transcriptional level-our findings provide indirect evidence for postranscriptional control as well. With both untreated and insulin-treated diabetic animals, the changes in IGF-I gene transcription rates were more exaggerated than changes in IGF-I expression, consistent with either a lag in achievement of steady-state levels of mRNA and/or some modulation of mRNA turnover. Interestingly, the opposite was the case with IGFBP-1; changes in expression tended to be more striking than changes in gene transcription.

b. ZGF-1 and IGFBP-1 Gene Expression and Gene Transcription in Primary Cultures of Rat Hepatocytes. Because the simultaneous fluctuations of fuels and hormones that occur in v i m make it difficult to delineate specific regulation, we examined gene expression in cultured hepatocytes (80, 196, 197).Northern blotting revealed IGF-I transcripts approximately 7.5,2, and 1 kb in size-similar to those found in normal liver (90).IGF-I expression was stimulated independently by provision of dexamethasone, amino acids,

. LAWRENCE S. PHILLIPS ET AL.

222 309

320

242

220

201

k 5 . 8 kb +3.2 t

E

H

P

CONTROL

STZ

E

kk-

-

Bgl II

E

BAPH

E

cDNA IGF-1 9 k b genornic DNA IGF-1 5.8 k b genomlc DNA IGF-1 3.2 kb genomic DNA

72

STZ 144

FIG.11. Selection of an IGF-I genomic DNA probe for use in nuclear run-on assays. Upper left panel: The major transcription initiation sites in exon 1 were identified by S, nuclease protection assay with an end-labeled 4.5-kb HindIII/BgZII fragment as probe. pBR322 plasmid DNA digested with HpuII was used as a size marker. Upper right panel: Transcription initiation sites are indicated by arrows, and exons 1 and 2 are shown by stippled boxes. Restriction sites: E (EcoRI),H (HindIII),P (PstI),B (BunI),and A (AccI).Lower panel: Nuclear run-on assays were performed with different portions of IGF-I genomic DNA as probes. Liver nuclei were obtained from control animals treated with 72 and 144 mgikg streptozotocin (STZ) for 2 days. Strong signals were obtained with the 9 and 5.8-kb probes, but the signal was unaffected by diabetes status. Only the 3.2-kb probe, consisting of a sequence downstream from the major transcription initiation sites in exon 1, identified metabolicallyresponsive IGF-I gene transcription. [with permission, from Ref. 125. C.4. Pao, P. K. Farmer, S. Begovic, S. Goldstein, G.-]. Wu, and L. S. Phillips, Mol. Endocrinol. 6,969 (1992). OThe Endocrine Society.]

w

FIG.12. Effects of streptozotocin-induceddiabetes on IGF-I and IGFBP-I gene transcription. (A) The dose-response effects of streptozotocin: nuclear run-on assays were performed with liver nuclei obtained from control animals and animals treated with a single injection of 72 and 144 mg/kg streptozotocin (STZ)for 2 days. (B) The impact of insulin treatment: nuclear runon assays were performed with nuclei from control animals, animals that received a single injection of 144 mgkg streptozotocin (Sn) followed by sacrifice 2 days later, and animals that received streptozotocin followed 1 day later by the administration of insulin (daily subcutaneous injection of protamine-zinc-insulin; 10 U/lOO g), with sacrifice after 2 days of insulin therapy. Data are presented as apercentage ofthe mean control values (mean 2 SEM; n = 4). IGF-I transcription fell with mild diabetes, and fell further with severe diabetes (contrast with Fig. lo), whereas IGFBP-1transcription rose progressively. Insulin therapy restored both IGF-I and IGFBP-1 transcription toward normal. w i t h permission, from Ref 125. C.-I.Pao, P. K. Farmer, S. Begovic, S. Goldstein, G.-J. Wu, and L. S. Phillips, MoZ. EndocrinoZ. 6, 969 (1992). OThe Endocrine Society.]

MOLECULAR REGULATION OF ICF-I AND IGFBP3

223

LAWRENCE S. PHILLIPS ET AL.

224

0

30

60

180

360 min

TIME AFTER INSULIN ADDITION FIG. 13. Effects of insulin on IGF-I and IGFBP-1 gene transcription in primary cultures of normal rat hepatocytes.Hepatocytes were cultured for 1day with 2 X M dexamethasone, amino acids at 5 X arterial plasma levels, and M insulin, then changed to medium with M insulin, and nuclei were harvested at the times indicated. Transcriptionrates of the IGF-I and IGFBP-1 genes were determined by nuclear run-on assay and quantitated by densitometric scanning. Addition of insulin led to a rapid fall in IGFBP-1 transcription and a slower rise in IGF-I transcription. p i t h permission, from Ref. 196. C.-I.Pao, P. K. Farmer, S. Begovic, B. C. Villafuerte, G.-J. Wu, D. G. Robertson, and L. S. Phillips, Mol. Endocrinol. 7,1561 (1993).OThe Endocrine Society.]

and insulin, and there were strong correlations between release of IGF-I and the abundance of IGF-I mRNA. Provision of insulin increased IGF-I expression when amino acids were present at 0.25 X, 1.25X, or 6.25 X levels found in arterial rat plasma, and half-maximal stimulation of IGF-I release by insulin occurred at M-within the physiologic range. A similar approach was sued to demonstrate rapid and specific inhibition of IGFBP-1 expression by insulin, again with half-maximal effects at -lop1' M (196). We then utilized nuclear run-on assays to assess regulation of IGF-I and IGFBP-1 gene transcription in hepatocytes, with a cDNA probe for IGFBP-1 and our -3.2-kb genomic DNA probe for IGF-I (containing the sequence downstream from the major initiation sites in exon 1, as described above).As outlined above, the effects of amino acid concentration were dominant over the impact of insulin on IGF-I gene transcription in this system (196).Stimulation of IGF-I gene transcription by lop6 M insulin required a minimum of 3 hr, whereas IGFBP-1 gene transcription was suppressed within 15-30 min after addition of insulin (Fig. 13);suppression of IGFBP-1 transcription by insulin was unaffected by the presence of cycloheximide. The rapidity of the IGFBP-1 response and the lack of a cycloheximide effect suggest that ongoing protein synthesis may not be required for acute modulation of IGFBP-1 gene transcription. In contrast, the slower responsiveness of IGF-I gene tran-

MOLECULAR REGULATION OF IGF-I A N D IGFBP-3

225

scription may reflect a requirement for protein synthesis, either to produce or to modify critical transcription factors. Several other laboratories, including particularly those of Grannar, Hanson, Powell, Rechler, and Unterman, have advanced understanding of the insulin-responsivesequence (IRS) in the IGFBP-1 gene (198-202). Within the rat IGFBP-1 promoter region, the IRS is palindromic and includes the sequence CAAAACAAACTTATTTTG; each half resembles the IRS in the phosphoenolpyruvate carboxylase (PEPCK) gene. Both the IGFBP-1 and the PEPCK IRS are closely involved with a glucocorticoid response element (GRE) and bind the transcription factor HNF-3 (201, 203, 204). Combinations of gel mobility-shift analyses, methylation interference, and transient transfection studies suggest that the 5’ half of the palindrome may be particularly important for regulation by insulin (201).In addition to HNF-3, C/EBP (201,209, HNF-1 (200, 206), albumin D site binding protein (207), and AP-2 (200) also appear to be involved in the modulation of IGFBP-1 expression.

E. Mechanisms Underlying Reduced IGF-I Gene Transcription in Diabetes Mellitus 1. NECESSITYOF DOWNSTREAM SEQUENCES I N IGF-I EXON1 As noted above, exon 1is considered to be dominant because two initiation sites in exon l can account for 70-800/0 of the IGF-I transcripts in adult rat liver (124). Accordingly, we focused on exon 1 in an attempt to identify cis-regulatoryregions that mediate the decrease in IGF-I gene transcription associatedwith diabetes mellitus. Initially, we used in vitro transcription with a G-free cassette reporter template containing 471 bp upstream and 3 bp downstream from the major initiation site in exon 1 (site 3) (143).Transcriptional activity was comparable with nuclear extracts from the livers of normal and diabetic rats (Fig. 14), indicating that upstream sequences are not sufficient to mediate metabolic regulation. An IGF-I template containing 47 1bp of upstream sequence and 240 bp of downstream sequence was then incubated with normal and diabetic nuclear extracts, and in vitro transcripts were quantified by primer extension. As shown in Fig. 15,the dominant transcription initiation site in vitro was identical to that used in vivo, and the transcriptional activity of nuclear extracts from the livers of diabetic rats was reduced compared to extracts from the livers of normal rats. Because transcriptional activity for the adenovirus major late promoter template was comparable with both extracts (Fig. 14), we concluded that the diabetic extracts contained adequate transcriptional machinery, and that changes in IGF-I gene transcription were likely to be specific. In combination, these findings indicate that IGF-I downstream sequences are necessary for the decrease in

226

LAWRENCE S. PHILLIPS ET AL.

M

N

D

FIG.14. In u i h transcriptional activity of nuclear extracts from the livers of normal and diabetic rats, with templates consisting largely of upstream sequence. A genomic IGF-I fragment extending from -471 to +3 bp (relative to site 3, the major transcription initiation site in exon 1)was subcloned into pUC13(C,AT) and used as a template in in oikro transcriptionassays, with a template containing adenovims major late promoter [pML(C,AT),,,, AMLP] as an internal control. Normal and diabetic nuclear extractshad comparabletranscriptionalactivitieswith templates containing only 3 bp of IGF-I downstream sequence. (With permission, from Ref. 146.)

transcription associated with diabetes, i.e., important for metabolic regulation as well as expression (above). 2. NUCLEARPROTEIN BINDINGTO DOWNSTREAM SEQUENCES IN IGF-I EXON1

To search for regions that might be involved in metabolic regulation, the binding of hepatic nuclear factors to a 272-bp AccI/BgZII fragment (-54/ +219 bp) was first examined by gel mobility-shift analysis (146).Shifted proteiwDNA complexes were reduced with extracts from diabetic as compared with normal rats. As outlined above, nuclear protein binding downstream from the major transcription initiation sites in exon 1includes region I [correspondingto initiation site 3 (146)],along with five additional protected regions. For regions I11andV (+42/+68 and + 129/+152 bp), gel mobility-shift analysis revealed strong binding (146),as shown in Fig. 16. Binding of nuclear factors in diabetic extracts was reduced to 30-50% that of normal extracts. In contrast, nuclear factor binding to region IV (+79/+101 bp) was much weaker, although some difference in binding of normal versus diabetic extracts was observed in this region as well. With both region 111 and region V probes, two

liver

animalstatus

66 48

- - - IVT - - -

N D N D N D

IGF-I

FIG.15. ICF-I primer extension analysis. Genomic IGF-I templates containing 471 bp of upstream sequence and 240 bp of downstream sequence (relative to site 3, the major transcription initiation site in exon 1)were incubated with separate batches of hepatic nuclear extracts from normal (N; lanes 4 and 6) and diabetic (D; lanes 5 and 7) rats, and the in vitro transcripts were quantitated by primer extension; 30 pg of total liver RNA from normal (lane 2) and diabetic (lane 3) rats provided positive controls and yeast tRNA (lane 8)provided a negative control. $174 DNA digested by Hinfl was used as a size marker (lane 1).The length of transcripts initiated in vitro was identical with that in vivo, and the diabetes-induced decrease in IGF-I transcripts seen in vivo was duplicated in vifro when templates contained downstream sequence. (With permission, from Ref. 146.)

Free L probe

FIG.16. Gel mobilityshift analysis of interactions of nuclear extracts from normal (N) and diabetic (D) animals with oligonucleotides reflecting rIGF-I downstream regions 111, VI,and V. Each nuclear protein binding reaction contained 1-2 ng of probe, and different amounts of nuclear proteins as indicated. Protein/DNA complexes were visualized on a 6%polyacrylamide gel. Strong binding was seen with regions 111 and V, but much weaker binding with region IV;diabetes produced a marked reduction in DNA and protein interactions with regions I11 and V. (with permission, from Ref. 146.)

LAWRENCE S. PHILLIPS ET AL.

228

A

DIABETIC NORMAL wt +240

+I

30% 92%

d84-152 +84

+I52

68%

d42-68 +42

+68

26%

d79-101 +79 +I01

88%

d129-152 +I29

+I52

229

MOLECULAR REGULATION OF IGF-I A N D IGFBP-3

D

wt

Liver

tRNA

1

2

d(79-101)

templates

D N D animal status ___ In vnro transcripts ___ N

3

4

5

6

FIG. 17. In vitro transcription assay with ICF-1 templates containing deletions in the downstream regon. (A) Summary of rIGF-I deletion mutant constructs; regions of DNase I protection are indicated, and deleted regions are shown by thin lines. The percentages indicate the relative transcriptional activities of diabetic rat liver nuclear extracts as compared with those from nornial animals, for each template. (B) rIGF-I 3' deletion mutants; relative transcriptional activities of normal (N; lanes 3 and 5) and diabetic (D; lanes 4 and 6) nuclear extracts with both wild-type (wt) DNA (lanes 3 and 4) and a mutant template containing a deletion of regions IV and V Oanes 5 and 6).Transcripts were quantitated by primer extension, with liver RNA (lane 1) and tRNA (lane 2) as positive and negative controls, respectively. Sequencing reactions with an oligonucleotide complementary to + 4 2 to +6 1 b p as primer were electrophoresed along with primer extension products on a 6% polyAcrylamide-8 M urea gel. (C)Transcriptional activities of normal (N; lanes 1,3, and 5) and diabetic (D; lanes 2 , 4 , and 6) nuclear extracts with both wild-type DNA (lanes 1 and 2) and templates containing deletions of region 111 (lanes 3 and 4) or region V (lanes 5 and 6). Lane 7 contained 10 pg of liver RNA. A 23-bp oligonucleotide complementary to +79/+ 101 (region IV)was used as a primer to quantitate in oitro transcripts. Sequencing reactions were performed using the same primer, but with a construct lacking region 111 d(42-68) as a template. Both sequencing reactions and primer extension products were electrophoresed on a 10Yo polyacrylamide-8 M urea gel. IGF-I cDNA is indicated with arrows. (D) Transcriptional activities of normal (N; lanes 3 and 5) and diabetic (D; lanes 4 and 6) nuclear extracts with both wild-type (wt) DNA (lanes 3 and 4) and a template lacking regmn IV (lanes 5 and 6). Liver RNA (10 pg, lane 2) and yeast tRNA (lane 7 ) were used as positive and negative controls for primer extension. pBR322 plasmid DNA mgested with HpaII was used as a size marker (lane 1).A 20-bp oligonucleotide complementary to +42/+61 (region 111) was used as a primer to quantitate in vitm transcripts. IGF-I cDNA synthesized is indicated with an arrow. Deletion of regions IV and V combined produced almost full restoration of the decreased transcriptional activity seen with nuclear extracts from diabetic animals; deletion of region IV alone had little effect, deletion of region I11 produced patial restoration, and deletion of region V produced restoration almost comparable to that of deletion of regions IV and V combined. (With permission, from Ref. 146.)

230

LAWRENCE S. PHILLIPS ET AL.

major protein/DNA complexes were observed; binding was specific, but could be partially cross-competed. Cross-competition may be due to interactions of common nuclear factors with motifs such as CCTGC(G/C)CA found in both regions I11 and V (146).

3. EXON1DOWNSTREAM REGIONS I11 AND V ARE NECESSARY FOR THE DIABETES-ASSOCIATED REDUCTION IN IGF-I GENETRANSCRIPTION The importance of downstream regions I11 and V for metabolic regulation was evaluated with in vitro transcription assays using deletion mutants as templates, as shown in Fig. 17A. A template lacking regions IV and V (+84/+ 152)no longer provided reduced transcriptional activity with nuclear extracts form dabetic versus normal rats (Fig. 17B).The relative decrease in transcriptional activity in diabetic extracts was partially restored with templates lacking region I11 (+42/+68),and almost completely restored with templates lacking region V (+129/+ 152) (Fig. 17C).In contrast, a template with deletion of region IV continued to exhibit decreased transcriptional activity with nuclear extracts from diabetic versus normal rats (Fig. 17D). Interestingly, the template with deletion of region V appeared to provide both a decrease in transcription with the normal extract, and an increase in transcription with the diabetic extract (Fig. 17C), suggesting that both activators and repressors may be involved with this region. Within these regions of interest, region I11 also includes the AAATAAA silencer motif identified in the rat prolactin gene (208)and the (T/A)GATA (A/G) binding motif found in the promoters or enhancers of erythroidexpressed genes (209), the histone H-5 gene (210), and immunoglobulin genes (211,212).The nontranscribed strand sequence GGNGCAGGA in region V is similar to the silencer binding protein motif GGAGCAGGA found in the rat glutathione transferase P gene (213).Thomas et al. (214) recently reported that region I11 may mediate IGF-I promoter activation by prostaglandin E, through a CAMP-mediatedpathway in cultured osteoblasts; because mutation in region I11 reduced induction by prostaglandin E,, they proposed that region I11 contains a cyclic AMP response element (CRE). A GenBanhEMBL search indicates that there is substantial homology between region I11 and region V sequences and elements of over 50 eukaryotic and prokaryotic genes.

VII. Molecular Regulation of IGF Binding Protein-3 IGFs in serum and other extracellular fluids are complexed with highaffinity binding proteins (IGFBPs). Seven IGFBPs have been identified to

MOLECULAR REGULATION O F IGF-I AND IGFBP-3

23 1

date (IGFBPs 1-7), and each is expressed in distinct tissue-specific and developmental patterns. Four IGFBPs are present in the circulation (IGFBPs 1-4), but the IGFs are found predominantly as a 150-kDa complex that consists of IGF-I or IGF-11, IGFBP-3, and an acid-labile subunit (ALS). A variety of studies have revealed divergent regulation of IGFBP-3 protein and mRNA, indicating that the regulation of IGFBP-3 production is partly posttranslational and not exclusively at the level of gene expression. Although the regulation of IGFBP-3 has been studied widely at the protein level, and more recently at the level of gene expression, most of the specific elements involved in metabolic- and hormone-mediated activation of the IGFBP-3 promoter have yet to be identified. This review will focus on recent work delineating the role of gene expression in the regulation of hepatic IGFBP-3 production, with an emphasis on the cultured cell models developed in our laboratory; we also discuss selected aspects in other culture systems and in intact animals.

A. Function of IGFBP-3 1. IGFBP-3 IN THE CIRCULATING TERNARY COMPLEX The circulating ternary complex contains an IGF peptide (-7.5 kDa) together with acid-stable and acid-labile subunits. IGFBP-3 is the acid-stable IGF-bindmg subunit, and has a predicted molecular mass of -29 kDa deduced from the 265 amino acid residues (215).Variable N-glycosylation of the protein increases the electrophoretically determined molecular mass to 47-53 kDa, and IGFBP-3 in human, rat, and pig sera appears as a glycosylated doublet on SDS-PAGE (85,216,217).The acid-labilesubunit has a predicted molecular mass of -63 kDa based on 578 amino acid residues (218). On SDS-PAGE, the ALS appears as an 84- and 86-kDa doublet, containing asparagine-linked carbonydrate, which decreases to about 66 kDa on enzymatic deglycosylation (219).In humans and rodents, the amino acid sequence of i%S contains leucine-rich repeats of 24 residues each, a feature that facilitates protein-protein interactions (218,219).All of the components of the tertiary complex are secreted by liver cells. In the human circulation,IGF and IGFBP-3 are present at equimolar concentrations (- 120-150 nM) (220),whereas ALS circulates in excess (-290 nhf" (221).IGFBP-3 binds to the p chain of the IGF peptide and possesses a single binding site for the A L S (222).On reconstitution studies, the complex appears to be assembled sequentially, with IGF binding to IGFBP-3 first, followed by A L S (223).IGFBP-3 assists in the proper thermodynamic folding of IGF-I in uivo by maintaining the &sulfide bonds that are necessary for receptor interactions (224).Formation of the IGFBP-3 complex prevents transcapdary efflux of IGFs from the vascular space and increases the renal

232

LAWRENCE S. PHILLIPS ET AL.

threshold for clearance of IGFs (225). Thus, under normal physiologic conditions,the IGFBP-3 complex functions as a storage pool for circulating IGFs and prolongs the half-life of IGF-I from -10 min in the free, unbound state to -15 hr in the complex (8).Formation of the complex also blunts the hypoglycemic potential of circulating IGFs (226, 227). Ternary complex formation is impaired under certain conditions. In diabetic and GH-deficient dw/dw rats, models that are associated with insulin deficiency, IGF-I and IGFBP-3 appear to be limiting components for formation of the complex (228, 229). However, administration of IGF-I increases the amount of IGFBP-3 in the circulation, and administration of IGFBP-3 increases ternary complex formation within minutes (228,230), suggestingthat understanding of the synthesis and turnover of IGFs cannot be interpreted in isolation from circulating IGFBP-3, and conversely. In contrast, unbound ALS appears in excess in both diabetic and GH-deficient rats (228-230), and there are few physiologic conditions in which lack of endogenous ALS limits the formation of the complex. This review concentrates on the physiologic regulation of IGFBP-3 by insulin, which plays a critical role in modulating formation of the complex. 2. IGFBP-3 MODULATES IGF ACTION

Systemic administration of IGFBP-3 appears to potentiate IGF-I action. In GH-deficient rats, combined IGF-I and IGFBP-3 treatment increases weight gain and epiphyseal width to a greater extent than treatment with IGF-I alone (231). IGFBP-3 also potentiates the ability of IGF-I to increase trabecular bone density in ovariectomized rats (232). Moreover, combined application of IGFBP-3 and IGF-I enhances the amount of wound tissue and improves wound healing in corticosteroid-treated rats, compared to treatment with IGF-I alone (233, 234). Such anabolic effects of IGFBP-3 might be mediated by increased ternary complex formation with ALS, providing a more stable reservoir for bioactive IGF-I. IGFBP-3 has less consistent effects on IGF-I action in vitro. Because both IGFBP-3 and IGF-I are synthesized in multiple tissues and secreted into extracellular fluids, effects of added IGFBP-3 and IGF-I in different cellular systems must be considered relative to the paraciine and autocrine regulation of IGF-I in each system. Thus, depending on the tissue site and on the experimental paradigm, IGFBP-3 has been reported to either facilitate or inhibit IGF-I action in different cells. For example, cultures of osteoblasts (that secrete IGFBP-3) exhibit increased cell replication when exposed to IGF-I (235). Similarly, IGF-I and IGFBP-3 in combination increase DNA synthesis in hamster kidney cells to a greater extent than addition of IGF-I alone (236). In contrast to these potentiation effects, addition of an excess of IGFBP-3 inhibits IGF-I-stimulated DNA synthesis in skin fibroblasts (237), inhibits

MOLECULAR REGULATION OF IGF-I AND IGFBP-3

233

IGF-I-stimulated CAMPgeneration in rat granulosa cells (238),and inhibits IGF-I-stimulated collagen synthesis in cultured osteoblasts (239).An emerging theme emphasizes the impact of the ratio of IGFBP-3 to IGF-I; an optimal ratio may potentiate IGF-I action, whereas a substantial excess of IGFBP-3 might inhibit IGF-I action. Because IGFBP-3 in solution has a higher affini0.04 nM)than does the type 1IGF receptor ty for IGF-I and IGF-I1 (k, (k, 20 nM), IGFBP-3 is capable of preventing receptor interaction by sequestering IGF-I (240).However, when IGFBP-3 associateswith cell surfaces, its affinity for IGF-I and IGF-I1 is reduced 10-fold compared to IGFBP-3 in solution (241), allowing IGFs to be more available for receptor binding. Thus, cell surface association may be required for IGFBP-3 to potentiate IGF action, whereas an excess of IGFBP-3 in solution may inhibit IGF-I action.

-

-

B. Posttranslational Regulation of IGFBP-3 An important posttranslational mechanism that affects the actions of IGFBP-3 is proteolysis; partial proteolysis of IGFBP-3 decreases the affinity of the binding protein for IGFs (242).Proteolysis of IGFBP-3 was first recognized in the plasma of pregnant women (243-245). Subsequently, increased circulating IGFBP-3 protease activity has been reported in various catabolic states, including noninuslin- and insulin-dependent diabetes mellitus (246, 247), malnutrition (248),severe illness (249),malignancies (250), and after major surgery (251).Other workers have described extravascular proteolysis of IGFBP-3 in seminal and ovarian follicular fluid, and in conditioned medmm (CM) of cultured fibroblasts, osteosarcoma cells, and lung cancer cells (252-255). The proteases identified to date have included serine proteases (prostate-specific antigen and plasmin have been identified in seminal fluid and conditioned medium of osteosarcoma cells, respectively) (252,256),matrix metalloproteinases (in serum of pregnant women and rats) (257),and cathepsin D (an aspartic proteinase from conditioned medium of several cell lines) (258). Although the major proteolytic fragments of glycosylated IGFBP-3 have an estimated molecular mass of 30-33 kDa and 20-25 kDa on SDS-PAGE, proteolytic fragments as small as 16 kDa have been reported after digestion of the nonglycosylated isoform (259,260). Different fragments have varying affinity for IGF-I and IGF-11, accounting for the discrepancies in the detection of the protein by Western ligand blotting, radioirnmunoassay, and different chromatographic techniques (261, 262). Compared to native glycosylated IGFBP-3, proteolyzed fragments of IGFBP-3 also exhibit altered ability to inhibit IGF-I-induced stimulation of DNA synthesis (263).Thus, it is postulated that proteolysis of serum IGFBP-3, by diminishing its affinity for the IGFs, may facilitate the dissociation of the ternary complex, thus enhancing

234

LAWRENCE S. PHILLIPS ET AL.

the accessibility of IGF to target cells (241, 264). If this hypothesis is true, proteolysis could constitute an important process for regulating IGF bioavailability. However, we still do not know the mechanism by which IGFBP-3 proteolfic activity is induced, or the effect of proteolysis on the equilibrium of free and bound IGF-I under different conditions. In some cultured cell models, IGF-I can increase release of IGFBP-3 through mechanisms that do not involve traditional cell receptors. Such processes appear to mediate the ability of IGF-I to enhance the release of IGFBP-3 from normal and transformed fibroblasts, and from Hs5 78T breast cancer cells (265-267). By affinity cross-linkingstudies, several investigators have demonstrated that IGFBP-3 is found at the surface of different cells, and presentation of IGF-I can cause release of membrane-associated IGFBP-3 into the culture medium. Cell surface IGFBP-3 is the major binding site for IGFs in fibroblasts, but only a small fraction of IGFs bind to IGF receptors on these cells (268). Oh et al. (269) reported the presence of IGFBP-3specific cell surface association proteins on Hs5 78T breast cancer cells, but the biochemical nature of the protein has not been elucidated, and similar proteins have not been found in other cell types. It seems likely that the basic amino acids in the carboxy-terminal region of IGFBP-3 are involved in binding to the polyanionic sulfated glycosaminoglycans on the cell surface, functioning as IGFBP-3 binding sites (270). Cell surface association of IGFBP-3 appears to be a major mechanism to potentiate IGF action, because surface attachment significantlyreduces the affinity of IGFBP-3 for the IGFs, making IGFs more available for interactions with nearby receptors (271).

C. Molecular Organization of the IGFBP-3 Gene 1. GENOMEORGANIZATION AND THE PROMOTER REGION OF IGFBP-3

IGFBP-3 is a single-copy gene in both human and rat genomes, localized to the 7p14-pl2 region of the human chromosome, and contiguous in location to the IGFBP-1 gene (272).The IGFBP-3 gene consists of five exons (Fig. 18).The protein-coding region is derived from the first four exons, and the fourth exon includes the stop codon and some 3’ untranslated sequence (216).The fifth exon contains the remainder of the 3’ untranslated region, including the polyadenylation signal. Sequences for both human and rat IGFBP-3 have complete retention of the 18 cysteine residues clustered at the N and C termini of the protein, which are highly conserved among the IGFBPs (273).Exons 1,3, and 4 are conserved among IGFBP-1, -2, and -3 (216,274,275).Exon 2 of the human IGFBP-3 gene encodes four potential N-linked glycosylation sites and two clusters of serine and threonine residues that represent potential O-linked glycosylation sites (217,276).This exon dis-

235

MOLECULAR REGULATION OF IGF-I AND IGFBP-3

Avall

Exon I

Exon Il-V

EcoRl

I

I

14 kb

EcpRl

Avalll

I

FIG.18. Map of the rat IGFBP-3 gene. Exons 1-5 (denotedI-V) are shown as shaded boxes, and a partial map extending from - 1060 to + 121 bp is shown above. The translation initiation site is 118 nucleotides 3' to the transcription initiation site (+l), and a consensus TATA box is located 28 bp 5' to the cap site. [(Modified,with permission, from Ref. 278.) A. L. Albiston, R. Saffery, and A. C. Herington, Endocrinology 136,699 (1995). 0The Endocrine Society.]

tinguishes IGFBP-3 from other previously sequenced IGFBPs, including IGFBP-1 and IGFBP-2, and is conserved among the IGFBP-3 genes from dfferent species. The N-glycosylation sites allow posttranslational modification of the IGFBP-3 peptide, accounting for the difference between the predicted -29-kDa size based on amino acid composition, and the range of -46-53 kDa found on electrophoretic assessment of IGFBP-3 from biological fluids. The genomic organization of both the rat and bovine IGFBP-3 genes is similar to that of the human gene, and the deduced amino acid sequence in the rat genome is 83%homologous to that in the human genome (216, 277). In the rat IGFBP-3 gene, the mRNA cap site is 118 nucleotides 5' to the translation initiation site, and the IGFBP-3 promoter is immediately 5' to the transcription initiation site (278). The organization of the IGFBP-3 promoter is typical of many promoters transcribed by RNA polymerase 11, with a consensus TATA box 28 bp 5' to the cap site. However, the rat IGFBP-3 promoter does not contain CCAAT consensus elements, but instead has a GC box -70 bp 5' to the TATA box. The promoter region, cap site, and first exon are all contained in a CpG island, a configuration recognized to influence the ability of promoter regions to regulate gene transcription (279). Similar organization of the promoter regon is observed in both human and bovine IGFBP-3 genes (217,277). Constructs containing the putative cap site, TATA box, and GC box up to the - 4 72-bp region in the rat IGFBP-3 gene provide high-level orientationdependent activation of a chloramphenical acetyltransferase (CAT) reporter

236

LAWRENCE S . PHILLIPS ET AL.

gene, consistent with function as a promoter region (278).Similar effects of the human IGFBP-3 promoter region have been demonstrated in COS cells (226).Our studies show that a short promoter region in the rat IGFBP-3 gene, containing only 99 bp of 5' flanking sequence, can direct efficient expression of linked reporter genes when transfected into hepatic cells that produce IGFBP-3 (see below). Although a sequence analysis of the promoter region can identify consensus sites for binding of factors that could mediate induction of transcription by TPA, CAMP,growth hormone, IGF-I, retinoic acid, and glucocorticoids, to date there has been little functional mapping of hormone or metabolic response regions. 2. IGFBP-3 EXPRESSION IGFBP-3 is expressed as a single mRNA species in different human, rat, porcine, and bovine tissues, and is approximately 2.4 to 2.6 kb in size (85, 216,217).However, Northern blotting analysis of the liver, decidual, and placental tissues of the baboon (Pupio unubis) revealed two IGFBP-3 mRNA transcripts of 2.4 and 1.7 kb (280);the relation of the different transcripts to the circulating immunoreactive fragments of IGFBP-3 is not clear at present, and no other species has been shown to have more than one transcript. Tissue distribution of IGFBP-3 in the adult rat is widespread, with varying expression in the liver, kidney, spleen, stomach, testis, adipose tissue, adrenal gland, and small and large intestine, with highest expression in the liver and kidney (281).Expression has not been detected in the hypothalamus or brain cortex, but cultures of anterior pituitary cells appear to secrete IGFBP-3 (282).In contrast to the distribution of IGFBP-3 expression in the adult, IGFBP-3 mRNA is most abundant in muscles and periosteal condensations of mesenchyme during embryonic stages, and is also localized in developing cerebral cortex, liver, and kidney (283). Expression of IGFBP-3 has also been identified in various cultured cells, including bovine and human fibroblasts (267, 268), porcine ovarian granulosa cells (238),testicular Sertoli cells ( 2 8 4 ,and prostatic stromal cells (285). Multiple carcinoma cell lines have also been shown to express IGFBP-3, including lung carcinoma LUDLU-I, breast carcinoma Sk-Br3 and T47D, and colon carcinoma EB1 cells, and epidermal squamous cell carcinoma and non-small-cell lung cancer lines (267, 286). Such prevalence suggests that IGFBP-3 may also play a role in oncogenesis. Cell-specificlocalization of IGFBP-3 expression in the liver and the kidney have been studied widely. In rat liver, we and others have demonstrated that IGFBP-3 is expressed in the nonparenchymal cells, as shown in Fig. 19, whereas the IGF-I and ALS components of the complex are expressed in the parenchymal cells (287,288).In further studies of hepatic nonparenchymal cells (Fig. 20), we found that IGFBP-3 (identified by Western ligand blotting

MOLECULAR REGULATION OF IGF-I A N D IGFBP-3

23 7

2.6 kbP,C

PC

NPC

NPC FIG. 19. IGFBP-3 mRNA expression in different liver cell types in culture. Rat livers were perfused with 0.05% collagenase in sib& and parenchymal cells were obtained after centrifugation at 800 g. A separate fraction of cells was incubated with 0.08% Pronase-E to obtain enriched preparations of nonparenchymal cells. Total RNA (20 Kgilane) was isolated from cocultures of parenchymal and nonparenchymal cells (PC + NPC), parenchymal cells alone (PC), and mixtures of nonparenchymal cells (NPC). Samples were hybridized with cDNA for IGFBP3. A 2.5-kb mRNA for IGFBP-3 was found in cultured hepatic nonparenchymal cells. [with permission, from Ref. 289. B. C. ViUafuerte, B. L. Koop, C.4. Pao, L. Gu, G. G. Birdsong, and L. S. Phillips, Mol. Endocrinology 134,2044 (1994). OThe Endocrine Society.]

as a 46-kDa protein) was released both by cultures of mixed parenchymal and nonparenchymal cells and by cultures of isolated Kupffer and sinusoidal endothelial cells (289). Expression of IGFBP-3 mRNA in these cells is consistent with secretion of IGFBP-3 (see below). This finding was subsequent-

46kda-

30 kda24 kdaP,C

NPC

NPC Lip Kup End

FIG.20. IGFBP release by subpopulations of cultured hepatic cells. Mixtures of nonparenchymal cells were purified by separation on discontinuous gradients containing 1.5 ml each of 15,12,8, and 6O/n arabiuogalactan (Larex International, Tacoma, Washington); lipocytes were recovered from below the 6% interface, and Kupffer and sinusoidal endothelial cells were recovered below the 8-12"/0 and 12-15"h Larex interfaces. The separated cells were cultured in serum-free media, and Western ligarid blotting was used to examine IGFBPs in conditioned medium of cocultured parenchymal and nonparenchymal cells (PC + NPC; lane l), a mixture of nonparenchymal cells (NPC; lane Z), lipocytes (Lip; lane 3), Kupffer cells (Kup; lane 4), and sinusoidal endothelial cells (End; lane 5).A 46-kDa protein, previously identified as IGFBP-3, was detected in medium conditioned by nonparenchymd cells, Kupffer cells, and sinusoidal endothelid cells. [with permission, from Ref. 289. B. C. Villafuerte, B. L. Koop, C.-I. Pao, L. Gu, G. G . Birdsong, and L. S. Phillips, Mol. Endocrinology 134, 2044 (1994). OThe Endocrine Society.]

238

LAWRENCE S. PHILLIPS ET AL.

ly confirmed in isolated human liver cells (290). In the kidney, IGFBP-3 mRNA is localized primarily to the renal cortical interstitial cells; within the reproductive organs, IGFBP-3 is expressed by spcytial trophoblasts, Sertoli cells, and thecal cells (238,284,291,292). Given the wide variety of tissues that express IGFBP-3, it is difficult to envision a common embryonic origin for IGFBP-3-expressingcells, and a common function of IGFBP-3 in each area. More likely, individual organ systems will provide a framework for &fferent IGFBP-3 functions-presumably as an autocrine, paracrine, and/or endocrine regulator of IGF action.

D. Regulation of IGFBP-3 1. PHYSIOLOGICAL AND DEVELOPMENTAL REGULATION Adult plasma concentrations of IGFBP-3 are relatively constant, measuring 3-4 kg/ml, or 120-150 nM (219, and most likely account for the stability of IGF-I concentrations throughout the day. But many variables, such as age, nutritional status, and hormone secretion, also affect serum IGFBP-3 concentrations. IGFBP-3 levels change with age, and the age-related alterations in IGFBP-3 parallel changes seen with IGF-I concentrations. Levels are low in young children, increase throughout childhood to reach a maximum at midpuberty, and begin a gradual decline after the third decade (220). In rat serum, IGFBP-3 is not detectable until postnatal day 19, after which there is a gradual increase to adult levels (293). Dietary manipulations and a number of clinical conditions change the serum levels of IGFBP-3 in humans and animals. Whereas acute dietary restriction has little impact on serum IGFBP-3 in rats and humans (294,299, chronic protein restriction in young rats or total caloric deprivation in neonatal rats reduces IGFBP-3 levels (293). The decrease in serum IGFBP-3 parallels changes in hepatic IGFBP-3 expression. Decreased IGFBP-3 concentrations have also been reported in poorly controlled diabetes (73, 296), in hypopituitarism with GH deficiency (297), and in untreated Cushings disease (298)-suggesting that IGFBP-3 may be stimulated by GH and insulin, but inhibited by glucocorticoids.Levels of IGFBP-3 are reduced in patients with cirrhosis of the liver (299), but increase in patients with chronic renal failure, probably secondary to decreased renal clearance (300). 2. HEPATICCONTRIBUTIONS TO CIRCULATING IGFBP-3 The fact that IGFBP-3 expression and peptide synthesis are found in many tissues supports the concept that IGFBP-3 acts in both autocrine/ paracrine as well as endocrine modes to modulate IGF-I action. However, there is controversy as to the relative contributions of extrahepatic versus hepatic sources to IGFBP-3 found in the circulation.

MOLECULAR REGULATION OF IGF-I AND IGFBP-3

239

The liver is the site of highest IGFBP-3 expression (85, 281), suggesting that it is a major contributor to IGFBP-3 in the circulation. Animal studies support such a hypothesis, because there are concordant changes in serum IGFBP-3 and hepatic IGFBP-3 expression in hypophysectomized, proteinderived, and diabetic rats (293, 296, 297). In both adults and children, immunoreactive IGFBP-3 levels are low in both acute and chronic liver failure. IGFBP-3 levels are correlated with the encephalopathy grade in acute liver failure (301) and with the Child's index score (299), a quantitative index of liver function during progression in cirrhosis. Moreover, orthotopic liver transplantation in patients with liver failure restores both IGF-I and IGFBP-3 levels to normal (302). Thus, the close relationship between IGF-I and IGFBP-3 levels and hepatic function suggests that the liver is the main source of both peptides. A major impediment to analysis of' modulation of systemic IGFBP-3 has been lack of a suitable in vitro liver model for study of regulation by hormonal and nutritional factors. Because rat hepatocytes in primary culture have been shown to secrete ALS and IGF-I (287, 288), whereas nonparenchymal cells, including Kupffer cells and sinusoidal endothelial cells, have been identified as sites of synthesis of IGFBP-3 (289,290), the generation of the complete IGFBP-3 complex requires secretory products from both liver cell groups. We have devised a coculture system in which liver cells are isolated in situ by collagenase/pronase digestion, and the cells are plated in proportions that approximate those of intact liver (289). This system represents an integrative and organotypical model for study of synthesis of components of the 150-kDa IGFBP-3 complex, and allows examination of hepatic IGFBP-3 production at the molecular level.

-

3. REGULATION OF IGFBP-3 BY INSULIN in Vivo AND in Vitro

Diabetes mellitus is a catabolic disorder that includes many metabolic and hormonal alterations, and is associated with abnormalities of the GH-IGF-I axis. Baxter and Martin (220)reported that adults with poorly controlled diabetes have serum IGFBP-3 concentrations 40% below normal. Batch et al. (303) showed that serum IGFBP-3 concentrations are reduced in midpubertal adolescents with diabetes compared to controls; patients with diabetes exhibit a blunted pubertal rise in IGFBP-3 levels compared to normal adolescents. Longitudinal studies by Bereket et al. (304) showed that serum IGFBP-3 concentrations are diminished by 30% in untreated children and adolescents with diabetes, but levels return to normal after 1 month of insulin treatment. In rats with streptozotocin-induced diabetes, we found that serum levels of IGFBP-3 are decreased progressively with increasing severity of metabolic decompensation (73).Zapf et al. (228) showed that infusion of either insulin or IGF-I can raise IGFBP-3 levels in streptozotocin-

240

LAWRENCE S. PHILLIPS ET AL.

diabetic rats. However, Luo and Murphy (296)have reported that in spontaneously diabetic BB/W rats, levels of hepatic IGFBP-3 mRNA and circulating IGFBP-3 are both decreased by -40% after 3 months of diabetes, and injection of insulin once a day for 3 weeks did not restore hepatic IGFBP-3 mRNA levels to normal. It is not clear whether the diabetes-induced decrease in IGFBP-3 is due to a defect in the pathway of GH action, and/or to lack of the stimulatory effects of insulin. Diabetes is associated with high GH levels but reduced GH action (305) in humans, and diabetes has been shown to decrease hepatic GH receptors (306) and GH binding protein (307) and to produce a postreceptor defect in GH action (308) in rats. Because IGFBP-3 is regulated in part by GH (297), diabetes could alter IGFBP-3 expression via such alterations in GH secretion and action as well as by a decrease in insulin secretion and insulin action. Complicating the analysis is the increase in IGFBP-3 proteolysis in sera of children with untreated diabetes (304); because proteolysis can be normalized with insulin therapy, the decreased circulating IGFBP-3 found in patients with diabetes must be due at least in part to posttranslational modulation, through destabilization of the ternary complex. To determine whether insulin can modulate hepatic production of IGFBP-3 directly, or instead requires the presence of GH, we investigated the effects of insulin on IGFBP-3 release and IGFBP-3 expression in cocultures of parenchymal and nonparenchymal cells from the livers of normal rats (95). In this system, hepatic IGFBP-3 expression was stimulated directly by provision of insulin (Fig. 21). Responses were slow, reaching maximal levels after 48 hr, consistent with the slow turnover rate of IGFBP-3 in vivo (230). The accumulation of IGFBP-3 in conditioned medium was relatively greater than the rise in cellular IGFBP-3 mRNA, suggesting additional contributions at the post-mRNA level. Nuclear run-on assays utilizing IGFBP-3 cDNA probes were then used to demonstrate that insulin enhances transcription of the IGFBP-3 gene (Fig. 22). However, insulin had no significant effect on IGFBP-3 mRNA turnover, as assessed by the decay of mRNA after inhibition of transcription with 5,6-dichloro-l-~-n-ribofuranosyl-benzimidazole (DRB). IGFBP-3 mRNA also appeared to be moderately stable in vitro, with a half-life of 13-18 hr, which is approximately the same as the half-life of the 150-kDa IGFBP-3 complex in serum (8, 225). Regulation of extrahepatic IGFBP-3 by insulin has also been described. Within the cortical interstitium of the kidney, in situ hybridization with an IGFBP-3 antisense probe revealed a modest decrease in the hybridization signal in rats with long-term diabetes (291).Insulin has also been shown to stimulate secretion of IGFBP-3 in bovine fibroblasts (309),porcine granulosa cells (310),and human epidermal squamous cell carcinoma cells (267), but insulin appears to have no effect on IGFBP-3 in human fibroblasts and breast

24 1

MOLECULAR REGULATION OF IGF-I AND IGFBP-3

IGFBP-3-

R-actin-

3000

T

2500

Insulin, M

FIG.21. Regulation of IGFBP-3 expression by insulin (Northern blot). After a 48-hr exposure to different concentrations of insulin (day 3-4), total RNA was extracted from cocultured liver cells. Northern blotting of total RNA (40 )*g/lane)separated on a 1.2% agarose/formaldehyde gel, subjected to autoradiography overnight. The same blot was reprobed with p-actin cDNA and visualized by autorachographyafter 4 hr. Top panel: Representative autorachogram. Bottom panel: Densitometric analysis of IGFBP-3 expression. Insulin caused dose-dependent stimulation of IGFBP-3 expression in cocultured liver cells. [with permission, from Ref. 95. B. C. Villafuerte,W. Zhang, and L. S. Phillips, MoZ. Endorrinol. 10,622 (1996).OThe Endocrine Society.]

cancer cells (266, 311). The response of the different cells to insulin appears to be contingent on the presence of insulin receptors, because the liver is highly enriched in insulin receptors, whereas human fibroblasts have relatively few insulin receptors (309). 4. EFFECTSOF IGF-I ON IGFBP-3 EXPRESSION IGF-I is another important factor that regulates IGFBP-3. Infusion of IGF-I induces formation of the 150-kDa complex in diabetic rats (228) and induces IGFBP-3 association in a 40-kDa complex in hypophysectomized rats (297). 40-kDa complex represents binary combination of IGF-I and IGFBP-3, because synthesis of the ALS component is dependent on GH but is not induced by IGF-I (224.1 Both in vivo studies in rodents as well as in vitro studies in cell culture support the concept that IGF-I, rather than GH, is a critical physiological regulator of IGFBP-3 (see below). However, the impact of IGF-I administration

me

LAWRENCE S. PHILLIPS ET AL.

242 IGFBP-3PGEWIGF-1-

B-ACTIN-

104

Insulin (M)

FIG.22. Effects of insulin on IGFBP-3 transcription. Cocultured liver cells were exposed to and M insulin, and nuclei were isolated by sucrose gradient centrifugation. Relative transcription rates were determined by nuclear run-on assay with cDNAs containing a 1pg insert. Transcription rates were determined by densitometric scanning of autoradiographs after a 48-hr exposure. Insuhn at 10W6Mincreased the IGFBP-3 gene transcription rate by hvoto threefold compared to 10W"’ M. [with permission, from Ref. 95.8. C. Villafuerte, W. Zhang, and L. S. Phillips, MoZ. Endorrinol. 10,622 (1996). OThe Endocrine Society.]

on IGFBP-3 in humans has not been consistent. Although 7-day administration of IGF-I in fasted patients has been reported to have little effect on serum IGFBP-3 levels (312),infusion of IGF-I in fed subjects has been variously reported to increase IGFBP-3 transiently (313) or to decrease both IGFBP-3 and ALS (322).In patients with Laron-type dwarfism, long-term infusion of IGF-I restores serum IGFBP-3 levels (314).These conflicting results may be due to the influence of IGF-I on insulin levels, because IGF-I has been reported to inhibit insulin secretion (315).Thus, responses of IGFBP-3 to IGF-I in vivo likely reflect a dynamic balance between stimulation by IGF-I, insulin, and other hormonabmetabolic factors. consistent with this concept, recent observations by Kupfer et al. (316)showed that combined administration of GH and IGF-I in normal humans maintained normal serum insulin levels and increased circulating IGFBP-3 levels, whereas treatment with IGF-I alone led to a decrease in IGFBP-3 levels. We evaluated the direct effects of IGF-I on IGFBP-3 production in cultured liver cells by adding recombinant IGF-I in vitro (95).IGF-I at physiological concentrations increased both IGFBP-3 release and IGFBP-3 expression (Fig. 23). However, the mechanism of pretranslational regulation of IGF-I appears to differ from that of insulin. IGF-I increased IGFBP-3 mRNA

243

MOLECULAR REGULATION OF IGF-I A N D IGFBP-3

7"""

3500

I

T

4 1500 1000-

500 IGF-l(nglm1)

0

20

200

400

FIG. 23. Regulation of' IGFBP-3 expression by IGF-I (Northern blot). After a 48-hr exposure to different concentrations of IGF-I, RNA was extracted and hybridized with IGFBP-3 cDNA. The same blot was reprobed with p-actin cDNA. Top panel: Representative autoradiograph after a 24-hr exposure for IGFBP-3 mRNA, and a 6-hr exposure for p-actin mRNA. Bottom panel: Densitometric analysis of' IGFBP-3 expression. Addition of IGF-I at physiologic concentrations increased IGFBP-3 expression in cocultured liver cells. [with permission, from Ref. 95. B. C. Villafuerte, W. Zhang, and L. S. Phillips, MoZ. Endocrinol. 10, 622 (1996). OThe Endocrine Society.]

stability almost twofold compared with control, as measured by decay in the presence of DRB (Fig. 24), but had no effect on the rate of IGFBP-3 gene transcription in nuclear run-on assays (Fig. 25). Thus, IGF-I increases the stability of IGFBP-3 at the peptide level in the circulation, through complex formation with the acid-labile subunit, and IGF-I also stabilizes IGFBP-3 mRNA at the pretranslational level in liver cells (95). Using IGF-I analogs with differing abilities to bind Type I IGF receptors and IGFBP-3, we found that analogs with reduced affinity for IGFBPs have increased potency to stimulate IGFBP-3 expression in liver (99, suggesting that IGF-I regulates IGFBP-3 in the liver through interaction with IGF-I receptors. Similar findings in rat A10 cells (222), murine L cells (317),and murine BALB/c 3T3 cells (318)indicate that the biologic potency of IGF-I analogs in many systems correlates with affinity for Type I IGF receptors. Interestingly, in cells wherein IGFs act via posttranslational mechanisms to fa-

244

LAWRENCE S. PHILLIPS ET AL.

100 -

w

'

.E

.-Ca

p!

2

f

-

s (3

90 80

-

70 6050 40-

-IGF-1

3020

0

+ IGF-1

~

0 20 25 0

5

10

15

30

Hours post DRE FIG.24. Effect of IGF-I on IGFBP-3 mRNA stability. The liver cells were preincubated in medium containing IGF-I (200 ng/ml) or no treatment for 24 hr (day 4 of culture), after which total RNA was extracted at zero time (as control),and 3, 6, and 24 hr after treatment with 5,6dichloro-l-p-D-ribofuranosyl-benzimidizale(DRB) (50 Fglrnl, day 5). The results were expressed relative to percent control vs. time. The estimated mRNA half-lifeincreased from 18 hr to more than 30 hr in the presence of IGF-I. [with permission, from Ref. 95. B. C. Villafuerte, W. Zhang, and L. S. Phillips, Mol. Endocrinol. 10,622 (1996). OThe Endocrine Society.]

cilitate release of IGFBP-3 from the cell surface, i.e., fibroblasts and breast cancer cells (266, 268), the most potent analogs are those that exhibit higher affinity for IGFBPs than for IGF receptors. In combination, our studies of hepatic regulation of IGFBP-3 suggest that circulating IGFBP-3 levels may fall in conditions of diabetes rnellitus because of both (1)decreased IGFBP-3 gene transcription caused by i n s u h deficiency and (2)decreased IGFBP-3 mRNA half-life caused by low levels of IGF-I in the liver, as well as (3)decreased formation of the ternary complex caused by low levels of IGF-I in the circulation and (4) increased proteolysis of IGFBP-3 in the circulation. 5. EFFECTSOF GLUCOCORTICOIDS ON IGFBP-3 EXPRESSION

Effects of glucocorticoids on IGFBP-3 have been examined in both adult rats and humans. Luo and Murphy (319) reported increases in rat serum IGFBP-3 (measured by Western ligand blotting) and hepatic IGFBP-3 ex-

245

MOLECULAR REGULATION OF IGF-I A N D ICFBP-3

IGFBP-3

-

PGEM 4 2 R-ACTIN

IGF-1 (nglrnl )

0

200

400

FIG. 25. Effects of IGF-I on IGFBP-3 tmiiscription. Cocultured liver cells were exposed to 200 and 400 ngmnl IGF-I for 48 hr, and nuclei were isolated by sucrose gradient centrifugation. Transcription was evaluated with nuclear run-on assays and quantitated by densitometric scanning of the autoradiograph after a 16-hr exposure. Addition of IGF-I did not alter the rate of IGFBP-3 gene transcription. w i t h pelmission, from Ref. 95. B. C. Villafuerte, W. Zhang, and L. S. Phdlips, MoZ. Endocrinol. 10,622 (1996).OThe Endocrine Society.]

pression after a single dose of dexamethasone. In human volunteers, Miell et al. (320)reported a slight increase in serum IGFBP-3 levels (measured by radioimmunoassay)after 4 days of oral dexamethasone, whereas Bang et al. (321) found elevated levels of immunoreactive IGFBP-3 in patients with Cushing’s syndrome. In contrast to these in vivo studies, we find that hepatic release and expression of IGFBP-3 are inhibited in vitro by exposure to glucocorticoids (94). In hepatic cell cocultures, provision of dexamethasone appears to suppress IGFBP-3 production through a decrease in the rate of gene transcription, as measured in nuclear run-on assays (Fig. 26). The difference between the responses to dexamethasone in vivo and in vitro most likely reflects the broad effects of glucocorticoids on hormone secretion and tissue metabolism in intact animals; glucocorticoidsincrease the secretion of insulin and enhance the flow of substrates to the liver (322),which may compensate for direct effects of glucocorticoids on IGFBP-3 transcription, as well as the tendency of glucocorticoids to decrease production of IGF-I (320).In extrahepatic tissues, dexamethasone has also been shown to inhibit IGFBP-3 secretion in cultures of rat osteoblasts (323),but the mechanism of inhibition has not yet been elucidated. 6. EFFECTSOF GROWTH HORMONE O N IGFBP-3

Growth hormone dependence of IGFBP-3 is suggested by increased circulating levels in patients with acromegaly (324),decreased levels in conditions of GH deficiency and in patients with the GH insensitivity syndrome (325),and restoration toward normal levels when GH-deficient subjects are treated with GH (324).However, it is not clear whether GH acts directly to regulate IGFBP-3 production, or instead acts indirectly by increasing pro-

LAWRENCE S. PHILLIPS ET AL.

246 IGFBP-1IGFBP-3 cDNAIGFBP-3 gDNA-

!-ACT1

N

1 0-o

1 0-e

Dexornethoaone (M)

FIG.26. Effect of dexamethasoneon IGFBP-3 gene transcription. Run-on assays were perM dexamethformed with nuclei isolated from cocultured liver cells exposed to 10V9and asone. Transcription rates were determined by densitometric scanning of autoradiographs after a 24-hr exposure. High-dose dexamethasone decreased the IGFBP-3 gene transcription rate. [with permission, from Ref. 94. B. C. Villaherte, B. L. Koop, C.-I. Pao, and L. S. Phillips, Endocrinology 136,1928 (1995). OThe Endocrine Society.]

duction of both insulin (326)and IGF-I (88).In cultured liver cells, we found that GH added alone had no significant effects on release of IGFBP-3, but GH added in combination with insulin and/or IGF-I did provide a further increase in IGFBP-3 expression and release (289).In rat calvaria cell cultures (enriched in osteoblasts),GH has been shown to enhance IGFBP-3 production at both pre- and posttranslational levels, through stimulation of IGFBP-3 expression and inhibition of IGFBP-3 proteolysis (327).However, such cultures also secrete IGF-I, making it difficult to rule out actions of GH mediated via production of IGF-I; the action of GH to increase release of IGFBP-3 from human osteosarcoma Saos-2/B-lOcells and rat PyMS cells does appear to be mediated through IGF-I (235). A further level of complexity results from the stimulatory effects of GH on production of ALS; because the long half-life of the circulating ternary complex appears to be conferred mainly by ALS (218),GH may stabilize IGFBP-3 in the circulation by providing other components that, by mass action, favor formation of the ternary complex.

E. Mechanism of Insulin Action on IGFBP-3 G e n e Transcription As outlined above, insulin appears to modulate IGFBP-3 production at the level of gene transcription. In an attempt to advance understanding of the mechanisms of insulin action, we have identified cis-regulatory sequences that appear to mediate effects of insulin on IGFBP-3 gene transcription.

247

MOLECULAR REGULATION OF 1CF-I A N D IGFBP-3

In cultures of hepatic nonparenchymal cells, insulin increases IGFBP-3 gene transcription by two- to threefold (9S). To identify the sequences involved, we used the rat IGFBP-3 promoter region cloned by Albiston et al. (278),and developed a series of 5' deletions. All plasmids were attached to a luciferase reporter gene and evaluated by transient transfection (96). As shown in Fig. 27, i n s d n increased luciferase activity by 160% with IGFBP-3 plasmids that spanned -1600/+34 and -1201/+34 bp, but had no effect on luciferase activitywithplasmids that spanned - 1061/+34 and -734/i34 bp. However, insulin increased luciferase activity modestly with plasmids that

-1600 to +34 -1201 to +34 -1061 to +34

-734 to +34 -99 to +34

I

0

20

I

I

I

40

60

80

I

I

I

I

I

I

100 120 140 160 180 200 220

M insulin

-6

% increase with 10

FIG.27. Deletion mapping of regions memating the stimulation of rat IGFBP-3 promoter activity by insulin. IGFBP-3 promotel- fragments with 5' ends at nucleotides -1600, -1201, - 1061, - 734, and -99 and a common 3' end at +34 bp were ligated upstream of a luciferase reporter gene, and then transfected by lipofection into liver nonparenchymal cells on day 3 of culture. The cells were incubated for an additional 24 hr in serum-free mehum with or without added insulin (1V6M) on day 4, and harvested on day 5. Luciferase activity from treated and untreated cells was compared for each construct after subtracting the background activity of the vector plasmid. Background activity of the vector was 10.6 arbitrary light units, and basal IGFBP-3 promoter activity for the various constructs ranged from 650 to 750 units. The addition ofinsulin increased activity of the - 1201/+31construct to 1400-1700 light units. The percentage increase in luciferase activity is shown as the mean t SEM for six experiments. (With permission, from Ref. 96.)

248

LAWRENCE S . PHILLIPS ET AL.

spanned -99/+34 bp, presumably representing effects on the basal promoter. These results localized the 140-bp region between - 1201 and - 1061 bp as necessary for the response to insulin. DNkprotein interactions involving the - 12011- 106l-bp region were then evaluated by DNase I footprinting with nuclear extracts from hepatic nonparenchymal cells, revealing four protected regions: - 11851- 1179, -1150/-1137, -1135/-1126, and -11001-1096 bp. However, nuclear extracts from cultures with and without added insulin provided the same pattern of protection (not shown). Comparison of the sequences of these four protected regions with known insulin-responsive elements (IREs) revealed limited homology between the second and third protected regions (- 1148 to - 1117bp) and IREs identified for glucagon, glyceraldehyde-3-phosphatedehydrogenase (GAF’DH), phosphoenolpyruvate carboxykinase (PEPCK),prolactin, and amylase genes, as shown in Table I1 (160, 328-332). The 5’ end of the protected regons of the IGFBP-3 sequence seems more homologous with IREs identified for glucagon and prolactin, whereas the 3’ end seems more homologous with the IREs from amylase and PEPCK. Three tandem repeats of the IGFBP-3 promoter region between - 1150 and -1117 bp were then inserted upstream of the SV40 promoter in a luciferase reporter gene, and then studied by transient transfection. As shown in Fig. 28, presence of the IGFBP-3 sequence conferred responsiveness to insulin, indicating that the region is active in a heterologous promoter, and sufficient for regulation by insulin. Because insulin responsiveness was independent of orientation, the 34-bp region appears to function as an enhancer. To evaluate the interactions of nuclear factors with the IGFBP-3 IRE, we incubated the 34-bp oligonucleotide (- 1150 to - 1117 bp) with nuclear extracts from hepatic nonparenchymal cells, and examined binding by gel mobility-shift analysis. As shown in Fig. 29, one major DNA-protein complex was formed, with threefold higher binding activity when nuclear extracts were obtained from insulin-treated compared to control cultures. We then assessed the physiologic relevance of such DNA-protein complex formation by evaluating hepatic nuclear extracts from normal and streptozotocin-diabetic rats. As shown in Fig. 30, DNA-protein binding activity decreased by three- to fourfold with extracts obtained from diabetic compared with normal rat liver, indicating that decreased binding to this region may contribute to the reduction in IGFBP-3 expression in conditions of diabetes mellitus. We characterized the size and hormone responsiveness of proteins associated with the IGFBP-3 IRE by Southwestern blotting, as shown in Fig. 3 1. The multimerized probe detected proteins with apparent molecular mass of

249

MOLECULAR REGULATION OF IGF-I A N D IGFBP-3

TABLE I1 COMPARISON OF IGFBP-3 PROTECTED REGIONSWITH KNOWNIRES"

GAPDH Glucagon Amylase IGmp-1 ~~~~

PEPCK Prolactin

~

........AA

. . . . . . . .GT . . . . . .CAGT . . . . . . . .GT ........TG .......ATC

1 ~ m p - 3 AATTCAAGGG

CTTTCCCGCC

TTTTCACGCC

TCTCAGCCTT

TGAAAG..

TGACTGAGAT TGAGAGTTTC

TGAAAGGG TAAAA...

GTGTTTTGAC A A C . . . . . . . TATTTCCGTC ATTAAGATA.

........ ........

TTATTTTGCG

TTGTTTTGAC AGT. . . . . . . . . . . . . . .

TATCCAGGAA

AGTCTCCTTC

T U G . . ..

"The IGFBP-3 sequences shown match the second and third protected regions of Fig. 2. This is a computer-generated comparison created by the PILEUP program from the Wisconsin Genetics Computer Group. Abbreviations: IRE, insulin-response element; GAPDH, glyceraldehyde-3-phosphatedehydrogenase; PEPCK, phosphoenolpyruvate carboxykinase.

90 and 70 kDa in both hepatic nonparenchymal cell and rat liver extracts. The 90-kDa protein appeared to be hormone responsive, increasing 2- to 2.5fold with insulin treatment in cultured cells, and increasing 1.8-fold in hepatic extracts from normal compared with diabetic animals. Metabolic responsiveness of the 70-kDa protein was not consistent with different preparations of nuclear extracts. We then constructed a series of mutations through the 34-bp IGFBP-3 IRE region to identify bases most critical to insulin-responsiveDNA-protein interactions and gene transcription (Table 111).As shown in Fig. 32, oligonucleotides with mutations 1 and 2 competed poorly in gel mobility-shift analyses with wild-type probes. Constructs with mutations 1and 2 also exhibited limited responses to insulin in transient transfection studies, as shown in Fig. 33. The consistency of such observations indicates the importance of base pairs -1148 through -1139 for the response to insulin. However, when a - 1157/- 1139-bp oligonucleotide was used as a probe for gel mobility-shift analysis and Southwestern blotting, the same proteins were detected but the strength of DNA-protein interactions was considerably lower, suggesting that other proteins or DNA contact of proteins with the base pair region -1138 to -1129 immemately downstream may act synergistically with the contiguous 5' region to enhance transcription factor binding. Such findings also indicate that there may not be a simple one-to-one correspondence between the 10-bp IRE DNA-binding motif and the DNA-protein interface; the adjacent bases are probably also important for site-specific recognition.

LAWRENCE S. PHILLIPS ET AL.

250

T

T

SV40 promoter

-11501-11i7

-11501-1117 R

SV40 promoter

SV40 promoter

FIG.28. Effects of insulin on the expression of a -1150- to - 1117-bp rat IGFBP-3 fragment in a heterologouspromoter. The pGL3 promoter vector (containingan SV40 promoterhciferase reporter gene insert without the SV40 enhancer) was used to develop a chimeric DNA construct with three tandem copies of the -1150- to -1117-bp region of IGFBP-3 promoter. Nonparenchymal cells were transfected with 2.5 p,g of plasmids containing the concatemer of the -1150/-1117-bp region upstream from the SV40 promoter in a 5’ 3’ orientation (-11501-1117 SV40 promoter) or in a 3’ --* 5 ’ orientation (-1150/-1117 R SV40 promoter). The plasmid without the IGFBP-3 region (SV40 promoter) served as control. After transfection, insulin at 10V6 M was added to half of the cultures and luciferase activity was measured 24 hr later. The percentage increase in luciferase activity is shown after subtracting the background activity of the vector plasmid. Background activity of the SV40 promoter construct was 24 arbitrary light units, basal activity of the -11501-1117 SV40 promoter was 510-650 units, and insulin increased activity to 950-1030. The - 1150-to -1117-bp region conferred orientationindependent responsiveness to insulin in a heterologous promoter. (With permission, from Ref. 96.) -+

Thus, we suspect that the major DNA binding domain requires neighboring regions to facilitate folding and docking of the binding protein (333).Alternatively, multiple DNA binding domains may be required for complete sitespecific recognition, as could occur if the binding protein acts as a homodimer or heterodimer.

251

MOLECULAR REGULATION OF ICF-I AND IGFBP-3

l(r6M insulin Nuclear protein (pg)

0

without insulin

1 H 5

10 20 m

5

10 20 -

9

Free probe

FIG.29. Binding of nuclear proteins from nonparenchymal cells to the - 1150/-1117-bp fragrrient of IGFBP-3. Gel mobility-shift experiments were conducted using 3”P-labeled oligonucleotides with various protein concentration as indicated, analyzed on a 6% polyacrylamide gel. Nuclear proteins were obtained from nonparenchyrnal cells cultured in the presence or absence of lop6M insulin for 48 hr prior to extraction. Treatment with insulin increased nuclear protein binding to the IGFBP-3 insulin-responsive element. (With permission, from Ref. 96.)

VIII. Summary/ Perspective on Molecular Regulation of IGF-I and IGFBP-3 IGF-I has broad anabolic effects in a wide variety of tissues and organs, and appears to function in autocrine and paracrine as well as endocrine modes. Such a complex biological role is paralleled by the complexity of the gene, and by the difficulty in studying its molecular regulation; IGF-I is most abundant in the liver, but most liver cell lines do not express IGF-I well. Hepatic IGF-I gene transcription is decreased under conditions of reduced availability of essential amino acids or regulatory hormones, due presumably to differences in nuclear factors that either bind directly to the IGF-I gene, or interact with other transcription factors involved in the formation of tran-

LAWRENCE S. PHILLIPS E X AL.

252

Nuclear protein (pg)

Free probe

FIG.30. Binding of nuclear proteins from rat liver to the -1150/-1117 fragment of IGFBP-3. Hepatic nuclear extracts were isolated from normal and diabetic rats, and binding reactions were performed with 32P-labeledIGFBP-3 oligonucleotideswith the indicated concentrations of protein. The autoradiograph of a 6Vo polyacrylamide gel is shown. Decreased nuclear protein binding to the IGFBP-3 insulin-responsiveelement was observed with hepatic nuclear extracts from diabetic rats. (With permission, from Ref. 96.)

Nonparenchymal cells extract

Liver extract

FIG.31. southwestern blot identification of proteins associated with the IGFBP-3 insulinresponsive element. Nuclear proteins (20 pgilane) from hepatic nonparenchymal cells incubated with (+)or without (-) 10W6M insulin, and from the livers of normal (NL)and diabetic (DM) rats, were electrophoresed,blotted onto nitrocellulose,and hybridized with 32P-labeledIGFBP-3 oligonucleotides (- 1150/- 1117 bp). The filter was then washed, dried, and subjected to autoradiography for 24 hr.Two proteins, 90 and 70 kDa, were identified by the IGFBP-3 insulinresponsive element; the 90-kDa protein was increased with insulin treatment of nonparenchymal cells, and decreased with induction of diabetes. (With permission, from Ref. 96.)

TABLE 111 SEQUENCES OF THE SCLSC STR~ N OF D OLIGONUCLEOTIDES USEDO Oligonucleottde

Sequence

IGFBP-3 IRE -1150 A A T T C A A G G G T A T C C C T C C T T C T A A G -1117 Mutant 1 AAcctggGGGTATCCCTCCTTCTAAG Mutant 2 AATTCAAaaacgTCCAGGAAAGTCTCCTTCTAAG Mutant 3 AATTCAAGGGTActtgaGAAAGTCTCCTTCTAAG Mutant 4 AATTCAAGGGTATCCAGa=aTCTCCTTCTAAG Mutant 5 AATTCAAGGGTATCCctcttTTCTAAG

AATTCAAGGGGGTATCCAGGAAAGTCTCCcctcqAG

Mutant 6 ~~~

~

“Sequences are numbered relative to the transcription initiation site of the rat IGFBP-3 gene. Underlined bases (lowercase) are mutated.

FIG.32. Competition for insulin-responsive element binding proteins by IGFBP-3IRE mutants. The mutant oligonucleotides in Table I11 were tested by gel-shift assay for the ability to compete for complexes formed by the wild-type IGFBP-3 IRE (labeled probe) with nuclear extracts from hepatic nonparenchymd cells. Unlabeled competitors were added at a 100-fold molar excess and analyzed nn @/a polyacrylamide gel, Oligonucleotides with substitution of sequences corresponding to mutants 1 and 2 could not compete away the DNA-protein complexes, suggesting that sequences between - 1148 and - 1139 b p are essential for nuclear factor binding to the IGFBP-.3IRE. (With permission, from Ref. 96.)

254

LAWRENCE S. PHILLIPS ET AL.

140 120

20

0

Mutants

0

5

2

1

2

3

4

5

6

FIG.33. Effect of substitution mutations of bp - 1148 to -1119 on stimulation of the rat IGFBP-3 promoter by insulin. Substitution mutants were prepared from 5' primers shown in Table 111. All of the mutants have IGFBP-3 promoter sequence starting from position -1201 and extending to +34, but with 5-bp substitutions inserted within the - 1148 to - 1119 region. Culture and transfection conditions were as described in Fig. 27. The insulin-induced increase in IGFBP-3 promoter activity of the control plasmid was expressed as 100%, and the response of the mutants was expressed relative to that of the control plasmid. Mutation of the region from -1148 to -1139 bp reduced the response to insulin by 80-90% whereas mutation of the region from -1138 to -1124 b p reduced the response to insulin by SO-60%.

scription initiation complexes. Our results suggest that changes in concentration or activity of nuclear factors bound to sequences downstream from the major initiation sites in exon 1may lower IGF-I gene transcription in conditions of diabetes mellitus. Identification of the critical factors involved wiU be the next step to advance understanding of the molecular mechanisms that mediate metabolic regulation of IGF-I expression. IGFBPs are important modulators of IGF action, and IGFBP-3 is the major IGF carrier protein. Results from our laboratory and others reveal IGFBP-3 to be present in a wide variety of tissues and organs and to be responsive to both nutritional and hormonal factors. Although circulating levels of IGFBP-3 generally fluctuate in parallel with changes in IGF-I, regulation of IGFBP-3 is complex, and includes both posttranslational processes involving cell surface interactions or proteolysis, which decreases affinity for

MOLECULAR REGULATION OF IGF-I AND IGFBP-3

255

IGFs, and modulation of expression, as emphasized in this review. In the liver, the probable major source of IGFBP-3 in the circulation, regulation is both at the level of mRNA stability (effects of IGF-I) and at the level of gene transcription (effects of glucocorticoids and insulin). We have identified in the IGFBP-3 gene an insulin-responsive element that appears to recognize insulin-responsive nuclear binding proteins. Because insulin regulates both IGF-I and IGFBP-3, studies of the mechanisms of IGF-I and IGFBP-3 gene transcription and identification of common transcription factors that regulate both genes should enhance our understanding of the metabolic, cellular, and molecular processes that medate decreased expression of these important growth factors in diabetes mellitus. ACKNOWLEDGMENTS This work was supported in part by research awards from the National Institutes of Health, Grants DK-02215 (BCV) and DK-33475 (LSP).We thank Sharon Ann DePeaza and Mary Lou Mojonnier for assistance in preparing this manuscript. We also thank our associates Juan-li Zhu, Edward Hunter, Kai-wei M. Lin, Uzma Hasan, Weidong Zhao, and Eric Ellis for helpful dlscussions and experimental contributions to this work.

REFERENCES 1 , T. L. Blundell, S. Bedarkar, and R. E. Humbel, Fed. Proc., Fed. ,4m. Soc. Exp. Bid. 42,2592

(1983). 2. S. J. Chan, Q:P. Cao, and D. F. Steiner, Proc. Natl. Acad. Sci. U.S.A. 87, 9319 (1990). 3. S. Nagamatsu, S. J. Chan, S. Falkner, and D. F. Steiner,J. Biol. Chem. 266, 1319 (1991). 4. G. I. Bell, D. S. Gerhard, N. M. Fong, R. Sanchez-Pescador, and L. B. Rall, Proc. Natl. Acud. Sci. U.S.A. 82, 6450 (1985). 5. J. Zapf, and E. R. Froesch, Honrione Res. 24, 121 (1986). 6. S. P. Nissley, J. F. Haskell, N. Sasaki, M. A. DeVroede, and M. M. Rechler,J. Cell. Sci. 3,39 (1985). 7. M. P. Czech, C. L. Oppenheimer, and J. MassaguB, Fed. Proc., Fed. Am. SOC. Exp. Biol. 42, 2598 (1983). 8. H. Guler, J. Zapf, C. Schmid, and E. R. Froesch, Acta Endocrinol. 121,753 (1989). 9. L. S. Phillips and R. Vassilopoulou-Sellin,N . EngZ.J. Med. 302,371,438 (1980). 10. E. Schoenle, J. Zapf, R. E. Humbel, and E. R. Froesch, Nature (London) 296,252 (1982). 11. E. Scheiwiller, H. Guler, J. Menyweather, C. Scandella, W. Maerki, J. Zapf, and E. R. Froesch, Nature (London) 323, 169 (1986). 12. W. D. Salmon, Jr., and M. R. DuVall, Endom’nology 86,721 (1970). 13. E. R. Froesch, C. Schrnid, J. Schwander, and J. Zapf, Annu. Reu. Physiol. 47,443 (1985). 14. J. B. Davoren and A. J. W. Hsueh, Endorrinology 118,888 (1986). 15. J. B. Davoren, A. J. W. Hsueh, and C. H. Li, Am. 1.Physiol. 249, E26 (1985). 16. B. G. Kasson and A. J. W. Hsueh, Mol. Cell Endocrinol. 52, 27 (1987). 17. M. M. Rechler, J. M. Podskalny, and S. P. Nissley, Nature (London)259, 134 (1976).

256

LAWRENCE S . PHILLIPS ET AL.

C. A. Conover, R. L. Hintz, and R. G. RosenfeldJ Cell. Physiol. 122,133 (1985). N. K. Banskota, R. Taub, K. Zellner, and G. L. Lng, Mol. Endocrinol. 3,1183 (1989). P. Delafontaine and H. Lou, J. Biol. Chem. 268, 16866 (1993). C. D. Stiles, G. T. Capone, C. D. Scher, H. N. Antoniades, J. J. Van Wyk, and W. J. Pledger, Proc. Natl. Acad. Sci. U.S.A. 76,1279 (1979). 22. H. Rothstein, J. J. Van Wyk, J. H. Hayden, S. R. Gordon, and A. Weinsieder, Science 208, 410 (1980). 23. V. R. Sara, K. Hall, P. E. Lins, and L. Fryklund, Endocrinology 107,622 (1980). 24. G. Van m e t , D. M. Styne, S. L. Kaplan, and M. M. Grumbach, Endocrinology 113, 1716 (1983). 25. A. L. Brown, D. E. Graham, S. P. Nissley, D. J. Hill, A. J. Sbain, and M. M. Rechler,]. Biol. Chem. 261,13144 (1987). 26. V. K. M. Han, P. K. Lund, D. C. Lee, and A. J. DErcole,J. Clin.Endowinol. Metab. 66,422 (1988). 27. G. Norstedt, A. Levinovitz, C. Moller, L. C. Eriksson, and G. Andersson, Curcinogenesis 9, 209 (1988). 28. J.-P, Liu, J. Baker, A. S. Perkins, E. J. Robertson, and A. Efstratiams, Cell 75,59 (1993). 29. J. Baker, J.-P. Liu, E. J. Robertson, and A. Efstratiadis, Cell 75, 73 (1993). 30. M. E. Simpson, C. W. Asling, and H. M. Evans, YaleJ.Biol. Med. 23,2 (1950). 31. K. C. Copeland, L. E. Underwood, and J. J. Van Wyk, J. Clin. Endocrinol. Metub. 690, (1980). 32. W. D. Salmon, Jr,, and W. H. Daughaday,]. Lab. Clin.Med. 49,825 (1957). 33. K. Hall, A. Holmgren, and U. Lindahl, Biochim. Biophys. Actu 20l, 398 (1979). 34. J. Van Wyk, L. Underwood, R. Hintz, D. Clemmons, S. Boina, and R. Weaver, Recent Prog. H m .Aes. 30,259 (1974). 35. E. R. Froesch, J. Zapf, T. K. Audhya E. Ben-Porath, B. J. Segen, and K. D. Gibson, Proc. Natl. Acad. Sci. U.S.A. 73,2904 (1976). 36. N. C. Dulak and H. M. Temin,]. Cell. Physiol. 8 4 153 (1973). 37. E. Rinderknecht and R. E. Humbel,]. Biol. Chem. 253,2769 (1978). 38. E. Rinderknecht and R. E. Humel, FEBS Lett. 89,283 (1978). 39. 0. G. P. Isakkson, S. E d h , and J.-0. Jansson, Annu. Rezj. Physiol. 47,483 (1985). 40. A. Nilsson, J. Isgaard, A. Lindahl, A. Dahlstrom, A. Skottner, and 0.G. P. Isaksson, Science 233, 571 (1986). 41. N. L. Schlechter, S. M. Russell, E. M. Spencer, and C. S. Nicoll, Proc. Natl. Acad. Sci. U.S.A. 83, 7932 (1986). 42. W. H. Daughaday, Perspect. Biol. Med. 32, 194 (1989). 43. M. Berelowitz, M. Szabo, L. A. Frohman, et at., Science 212,1279 (1981). 44. L. S. Phillips, Metabolism 35,78 (1986). 45. A. Y. Krishna and L. S. Phillips, in “Growth Factors and Wound Healing: Basic Science and Potential Clinical Applications” (T. R. Ziegler, D. R. Hemdon, and G. F. Pierce, eds.). In press. Springer-Verlag,Berlin and New York, 1997. 46. D. B. Grant, J. Hambley, D. Becker, and B. L. Pimstone, Arch. Dis. Child. 48,596 (1973). 4 7. J. L. Van den Brande and M. V. L. Du Caju, in “Advancesin Human Growth Hormone Research (S. Raiti,ed.), p. 98. US. Department of Health and Welfare, Washington, D.C., 1974. 48. R. L. Hintz,R. Suskind, K. Amatayakul, 0. Thanangkul, and R. Olson,J. Pediatr. 92,153 (1978). 49. G. Costin, M. D. Kogut, L. S. Phillips, and W. H . Daughaday,J. Clin.Endocrinol. Metab. 42,370 (1976). 50. L. S. Phillips and H . S. Young, Endocrinology, 99,304 (1976). 18. 19. 20. 21.

MOLECULAR REGULATION OF ICF-I AND IGFBP-3

257

51. B. Shapiro and B. L. Pimstone,]. Endocrinol. 77,233 (1978). 52. K. Takano, N. Hizuka, K. Kawai, and K. Shizume, Acta Etdocrinol. 87,485 (1978). 53. D. A. Price, J. M. Wit, S. van Buitl-Offers,-4.M. K. van Male, A. K. M. van Rooyen-Wehmeijer, C. Hoogerbrugge, and J. L. Van den Brande, Endocrinology 105,851 (1979). 54. R. D. Reeves, L. Dickinson, J. Lee, B. Kilgore, B. Branham, and M. J. Elders, J. Nutr. 109, 613 (1979). 55. L. S . Phillips, A. T. Orawski, and D. C. Belosky, Endocrinology 103,121 (1978). 56. L. S. Phillips and H. S. Young, Diabetes 25,516 (1976). 57. L. S. Phillips and A. T. Orawski, Diahetes 26,864 (1977). 58. E. W. Glaser, S. Goldstein, and L. S. Phillips, Diabetes 36,1152 (1987). 59. R. J. Winter, L. S. Phillips, M. N. Klein, 0. C. Green, and H. S. Traisman, Diabetes 28,952 (1979). 60. S. L. Blethen, D. T. Sargeant, M. G. Whitlow, and J. V. Santiago, Diabetes 30,868 (1981). 61. B. Strasser-Vogel,W. F. Blum, R. Past, U. Kessler, A. Hoeflich, B. Meiler, and W. Kiess, j . Clin.Endocrinol. Metab. 80, 1207 (1995). 62. W. L. Isley, L. E. Underwood, and D. R. Clemmons,J. Clin.Znuest. 71, 175 (1983). 63. V. C. Musey, S. Goldstein, P. K. Farmer, P. B. Moore, and L. S. Phillips, Am. J. Med. Sci. 305, 131 (1993). 64. J.M. Ketelslegers, D. Maiter, M. Maes, L. E. Underwood, and J. P. Thissen, Metabolism 44, 50 (1995). 65. T. G. Unterman, R. M. Vazquez, A. J. Salas, P. A. Martyn, and L. S. Phillips, Am. j . Med. 78, 228 (1985). 66. S . P. Donahue, and L. S. Phillips, Am. J. Clin. Nu&. 50,962 (1989). 67. R. C. Baxter and J. L. Martin, Prog. Growth Factor Res. 4 4 9 (1989). 68. R. C. Baxter, H o w . Res. 42, 140 (1994). 69. L. E. L. Katz, R. G. Rosenfeld, and S. P. Cohen, Endocrinologist 5,36 (1995). 70. L. S. Phillips, D. Belosky, and L. Reichard, Endocrinology 104, 1513 (1979). 71. L. S. Phillips and T. Scholz, Diabetes 3 1 97 (1982). 72. L. S. Phillips, A. C. Fusco, and T. G. Unterman, Metabolism 34,765 (1985). 73. M. G. Graubert, S. Goldstein, and L. S. Phillips, Diabetes 40,959 (1991). 74. A. Bereket, C. H. Lang, S. L. Blethen, L. C. Ng, and T. A. Wilson, Clin. Endocrinol. 45, 321 (1996). 75. P. McConaghey and C. B. Sledge, Nature (London) 225,1249 (1970). 76. L. S. Phillips, A. C. Herington, I. E. Karl, and W. H. Daughaday, Endocrinology 98,606 (1976). 77. W. H. Daughaday, L. S. Phillips, and M. C. Mueller, Endocrinology 98,1214 (1976). 78. R. Vassilopoulou-Sellin,L. S. Phillips, and L. A. Reichard, Endocrinology 106,260 (1979). 79. R. Vassilopoulou-Sellin,L. S. Phillips, C. 0.Oyedeji, and N. A. Samaan,]. Endom'nol. l O l , 257 (1984). 80. J. B. Harp, S. Goldstein, and L. S. Phillips, Diabetes 40,95 (1991). 81. S. Goldstein and L. S. Philhps, Metabolism 38,745 (1989). 82. A. M. Acquaviva, C. B. Bruni S. P. Nissley, and M. M. Rechler, Diabetes 31,656 (1982). 83. S. Goldstein and L. S. Phillips,J. Bid. Chem. 266, 14725 (1991). 84. L. J. Murphy, G. I. Bell, and H C. Friesen, Endocrinology 120, 1279 (1987). 85. S. Shimasaki, A. Koba, M. Mercado, M. Shimonaka, and N. LIng, Biochem. Biophys. Res. Commun. 165,907 (1989). 86. G. T. Ooi, C . C. Orlowski, A. L. Brown, R. E. Becker, T. G. Unterman, and M. M. Rechler, Mol. Endocrinol. 4,321 (1990). 87, L. J. Murphy, C. Seneviratne, P. Moreira, and R. E. Reid, Endocrinology 128,689 (1991). 88. J. Schwander, C. Hauri, J. Zapf, and E. Froesch, Endocrinology 113,297 (1983).

258

LAVVRENCE S. PHILLIPS ET AL.

89. S. Goldstein, J. B. Harp, and L. S. Phillips,]. Mol. Endocrinol. 6 , 3 3 (1991). 90. S. Goldstein, G. Sertich, K. R. Levan, and L. S. Phillips, Mol. Endocrinol. 2, 1093 (1988). 91. V. P. Kulik, V. M. Kavsan, F. M. A. van Schaik, L. A. Nolten, P. H. Steenbergh, and J. S. Sussenbach,J. Biol. Chem. 270,1068 (1995). 92. C. A. Conover, B. K. Baker, L. K. Bale, J. T. Clarkson, F. Liu, and R. L. Hintz, Regulat. Peptides 48, 1 (1993). 93. T. Su, W. Liu, S. Han, M. Jansen, and T. L. Yang-Fen, Cancer Res. 49, 1773 (1989). 94. B. C. Villafuerte, B. L. Koop, C.-I. Pao, and L. S. Phillips, Endocrinology 136, 1928 (1995). 95. B. C . Villafuerte, W. Zhang, and L. S. Phillips, Mol. Endowinol. 10,622 (1996). 96. B. C. Villafuerte, W. Zhao, A. C. Herington, R. Saffery, and L. S. Phillips,J. Bid. Chem. 272,5024 (1997). 97. W. H. Daughaday and P. Rotwein, Endocrinol. Rev. 10,68 (1989). 98. P. Rotwein, Growth Factors 5 , 3 (1991). 99. P. Rotwein, K. M. Pollock, D. K. Didier, and G. G. Krivi,]. Biol. Chem. 261,4828 (1986). 100. S.-W. Kim, R. Lajara, and P. Rotwein, Mol. Endocrinol. 5,1964 (1991). 101. A. Shimatsu and P. Rotwein,J. Biol. Chem. 262,7894 (1987). 102. M. C. Dickson, J. C. Saunders, and R. S. Gilmour, J. Mol. Endocrinol. 6,17 (1991). 103. Y. Kajimoto and P. Rotwein, J. Biol. Chem. 266, 9724 (1991). 104. S. J. Duguay, L. K. Park, M. Samadpour, and W. W. Dickhoff, Mol. Endocrinol. 6, 1202 (1992). 105. V. M. Kavsan, A. P. Koval, V. A. Grebenjuk, S. J. Chan, D. F. Steiner, C. T. Roberts, Jr., and D. LeRoith, DNA CeZl. Biol. 12, 729 (1993). 106. G. I. Bell, M. Stempien, N. M. Fong, and L. B. Rall, Nucleic Acids Res. 14,7873 (1986). 107. M. Muller and G. Brem, Nucleic Acids Res. 18,364 (1990). 108. G. I. Bell, M. M. Stempien, N. M. Fong, and S. Seino, Nucleic Acids Res. 18,4275 (1990). 109. T. Fotsis, C. Murphy, and F. Cannon, Nucleic Acids Res. 3, 676 (1989). 110. A. R. Shuldiner, A. Nirula, L. A. Scott, and J. Roth, Biochem. Biophys. Res. Commun. 166, 223 (1990). 111. M. L. Adamo, H. Ben-Hur, D. LeRoith, and C. T. Roberts, Jr., Biochem. Biophys. Res. Commun. 176,887 (1991). 112. J. Shemer, M. L. Adamo, C. T. J. Roberts, and D. LeRoith, Endocrinology 131, 2793 (1992). 113. W. L. Lowe, Jr., C. T. Roberts, Jr., S. R. Lasky, and D. LeRoith, Proc. Natl. Acad. Sci. U.S.A. 84, 8946 (1987). 114. J. G. Simmons, J. J. Van Wyk, E. C. Hoyt, and P. K. Lund, Growth Factors 9 , 2 0 5 (1993). 115. M. Adamo, .W L. Lowe, Jr., D. LeRoit, and C. T. Roberts, Jr., Endocrinology 124, 2737 (1989). 116. P. K. Lund, J. E. Hepler, E. C. Hoyt, and J. G. Simmons, in “Modern Concepts of InsulinLike Growth Factors” (E. M. Spencer, ed.), p. 111. Elsevier, Amsterdam, 1991. 117. M. L. Adamo, A. Koval, D. LeRoith, and C. T. Roberts, Jr., in “The Insulin-like Growth Factors and their Regulatory Proteins” (R. C. Baxter, P. D. Bluckman, and R. G. Rosenfeld, eds.),p. 23. Excerpta Medica, New York, 1994. 118. M. L. Adamo, Diubetes Rev. 3 , 2 (1995). 119. P. K. Lund, Recent Prog. H m .Res. 49,125 (1994). 120. W. L. Lowe, Jr., S. R. Lasky, D. LeRoith, and C. T. Roberts, Jr., Mol. Endocrinol. 2 , 5 2 8 (1988). 121. L. J. Hall, Y. Kajimoto, D. Bichell, S. Kim, P. L. James, D. Counts, L. J. Nixon, G. Tobin, and P. Rotwein, DNA Cell. Bid. 11, 301 (1992). 122. H. L. Foyt, D. LeRoith, and C. T. Roberts, Jr.,J. Biol. Chem. 266,7300 (1991). 123. J. E. Hepler, J. J. Van Wyk, and P. K. Lund, Endocrinology 127,1550 (1990). 124. M. L. Adamo, H. Ben-Hur, D. LeRoith, and C. T. Roberts, Biochem. Biophys. Res. Comman. 176,887 (1991).

MOLECULAR REGULATION OF IGF-I 4 N D IGFBP-3

259

125. C.4. Pao, P. K. Farmer, S. Begovic, S. Goldstein, G.-J. Wu, and L. S. Phillips, Mol. Endocrinol. 6, 969 (1992). 126. M. Adamo, H. Ben-Hur, C. T. Robeits, Jr., and D. LeRoith, Mol. Endocrinol. 5,1677 (1991). 127. P. A. Weller, M. C. Dickson, N. S. Huskisson, M. J. Dauncey, P. J. Buttery, andR. S. Gilmour, J. Mol. Endocrinol. 11201 (1993). 128. J. M. Pell, J. C. Saunders, and R. S. Gilmour, Endocrinology 132, 1797 (1993). 129. E. Jansen, P. H. Steenbergh, F. M. A. van Schaik, and J. S. Sussenbach, Biochem. Biophys. Res. Commun. 187, 1219 (1992). 130. E. C. Hoyt, J. J. Van Wyk, and P. K. Lund, Mol. Endocrinol. 2, 1077 (1988). 131. H. L. Fop, F. Lanau, M. Woloschak, D. LeRoith, and C. T. Roberts, Jr., Mol. Endocrinol. 6, 1881 (1992). 132. A. Y. Krishna, C.-I. Pao, P. M.Thule, B. C. Villafuerte, and L. S. Phillips,]. Endocrinol. 15I, 215 (1996). 133. S. T. Smale and D. Baltimore, Cell 57,103 (1989). 134. J. Carcamo, L. Buckbinder, and D. Reinberg, Roc. Nutl. Acad. Sci. U.S.A.88,8052 (1991). 135. L. A. Nolten, F. M. A. van Schaik, P. H. Steenbergh, and J. S. Sussenbach, Mol. Endocrinol. 8, 1636 (1994). 136. L. A. Nolten, P. H. Steenbergh, and J. S. Sussenbach, MoZ. Endocrinol. 9, 1488 (1995). 137. L. A. Nolten, P. H. Steenbergh, and J. S. Sussenbach,]. Biol. Chem. 2 7 6 31846 (1996). 138. P. Maire, J. Waurin, and U. Schibler, Science 244,343 (1989). 139 M. Jose-Estanyol,A. Poliard, D. Foiret, and J. Danan, Eur. J. Biochem. 18l, 761 (1989). 140. G. Courtois, J. G. Morgan, L. A. Campbell, G. Fourel, and G. R. Crabtree, Science 238, 688 (1987). 141. K. Gorsh, M. Carneiro, and U. Schibler, Cell 47,767 (1986). 142. W. L. J. Lowe and R. M. Teasdale, Biochem. Biophys.Res. Commun. 189,972 (1992). 143. C.-I. Pao, K. W. M. Lin, J. L. Zhu, G. J. Wu, P. K. Farmer, and L. S. Phillips,J. Biol. Chem. 271,8667 (1996). 144. M. Sawadogo and R. G. Roeder, Proc. Natl. Acud. Sci. U.S.A. 82,4394 (1985). 145. S. J. Triezenberg, K. L. LaMarco, and S. L. McKnight, Genes Deu. 2, 730 (1988). 146. C.-I. Pao, J. L. Zhu, D. G. Robertson, K. W. M. Lin, P. K. Farmer, S. Begovic, G. J. Wu, and L. S. Phillips,]. Biol. Chem. 270,24917 (1995). 147. F. Sierra. “A Laboratory Guide to In Vitro Transcription.” Birkhaser Verlag, Basel, Boston, Berlin, 1990. 148. M. R. An and W. L. Lowe, Jr., Mol. Cell. Endocrinol. 114, 77 (1995). 149. X. Wang, Y. Yang, and M. L. Adamo, Endocrinology 138,1528 (1997). 150. L. E. Babiss, R. S. Herbst, A. L. Bennett, and J. E. Darnell, Jr., Genes Dev. 1, 256 (1987). 151. S. Cereghini, M. Blumenfeld, and M. Yaniv, Genes Dev. 2,957 (1988). 152. N. Katz, S. Immenschuh, U. Gebracht, E. Eigenbrodt, W. Follmann, and E. Petzinger, Eur. J. Cell Biol. 57, 117 (1992). 153. A. P. Wolffe, CUT. @in. Genet. Deu. 4, 245 (1994). 154. K. Kikuchi, D. P. Bichell, and P. Rotwein,]. Biol. Chem. 267,21505 (1992). 155. M. J. Thomas, K. m u c h i , D. P. Bichell, and P. Rotwein, Endocrinology 135, 1584 (1994). 156. Y. Umayahara, R. Kawamori, H. Watada, E. Imano, N. Iwama, T. Morishima, Y. Yamasaki, Y. Kajimoto, and T. Kamada,]. Biol. Chem. 269, 16433 (1994). 157. W. S. Dynan, Trends Genet. 2, 196 (1986). 258. S. Huang, P. M. Thul6, and L. S. Phillips, Biochem. Biophys. Res. Commun. 206, 279 (1995). 159. F. Ginot, J. Decaux, M. Cognet, T. Berbar, F. Levrat, A. Kahn, and A. Weber, Eur. J. Biochem. 180,289 (1989). 160. D. G.Robertson, E. M. Mariono, P. M. Thul6, C. K. Seneviratne, and L. J. Murphy, Biochem. Biophys. Res. Commun. 200,226 (1994).

260

LAWRENCE S . PHILLIPS ET AL.

161. C. Schmid, I. Schlaper, M. Waldvogel, J. Zapf, and E. R. Froesch, J. Bone Minw. Res. 7, 1157 (1992). 162. S. Chung and P. Perry, Mol. Cell. Biol. 9,2075 (1989). 163. Y. P. Li, W. Chen, and P. Stashenko, Nucleic Acids Res. 23, 5064 (1995). 164. P. Collis, Antoniou, M. and F. Grosveld, EMBO]. 9,233 (1990). 165. C. Gregori, F. Ginot, J. Decaus, A. Weber, T. Berbar, A. Kahn, and A. L. Pichard Biochem. Biophys. Res. Commun. 176,722 (1991). 166. E. A. Sternberg, G. Spizz, W. M. Perry, D. Vizard, T Weil, and E. N. Olson, Mol. Cell. Bid. 8,2896 (1988). 167. P. A. Kelly, J. Djiane, M.-C. Postel-Vinay, and M. Ederly, Endocrinol. Reu. 12,235 (1991). 168. B. Shapiro, K. Waligora, and B. L. Pimstone,J. Endocrinol. 79,369 (1978). 169. L. S. Mathews, R. E. Hamer, R. L. Brinster, and R. D. Palmiter, Endocrinology 123, 433 (1988). 170. L. S. Mathews, G. Norstedt, and R. D. Palmiter, Proc. Natl. Acad. Sci. U.S.A. 83, 9343 (1986). 171. J.-P. Thissen, J. B. Pucilowska and L. E. Underwood, Endocrinology 134,1570 (1994). 172. D. P. Bichell, K. Kikuchi, and F.Rotwein, MoZ. Endocrinol. 6,1899 (1992). 173. P. Tollet, B. Enberg, and A. Mode, Mol. Endocrinol. 4, 1934 (1990). 174. T. R. Johnson, B. K. Blossey, C. W. Denko, and J. Ilan, MoZ. Endocrinol. 3,580 (1989). 175. H. Hauner and G. Loffler, Int. J. Obesity 10,323 (1986). 176. J. Schwartz, C. Carter-Su, C. M. Foster, and J. A. Shafer, in “Advancesin Growth Hormone and Growth Factor Research” (E. E. Miiller, D. Cocchi, and V. Locatelli, eds.), p. 85. P y h gora Press, Roma-Milano, and Springer-Verlag,Berlin, and New York, 1989. 177. Y. Kamai, S. Mikawa, K. Endo, H. Sakai, and T. Komano,J. Biol. Chem. 2 7 1 9883 (1996). 178. K. Vikman, B. Carlsson, H. Billig, and S. EdBn, Endocrinology 129,1155 (1991). 179. A. Doglio, C. Dani, G. Fredrikson, P. Grimaldi, and G . Ailhaud, EMBOJ. 6,4011 (1987). 180. T. E. Meyer and J. F. Habener, Endocrinol. Rev. 14,269 (1993). 181. P. Rotwein, M. J. Thomas, A. G. Gronowski, D. P. Bichell, and K. Kikuchi, in “The Insulinlike Growth Factors and Their Regulatory Proteins” (R. C. Baxter, P. D. Gluckman, and R. G. Rosenfeld, eds.), p. 13. Excerpta Medica, New York, 1994. 182. G. Fuh, B. C. Cunningham, R. Fukunaga, S. Nagata, D. V Goeddel, and J. A. Wells, Science 256,1677 (1992). 183. J. A. Wells, B. C. Cunningham, G. Fuh, H. B. Lowrnan, S. H. Bass, M. G. Mulkerrin, M. Ultsch, and A. M. deVos, Recent Prog. Horn. Res. 48,253 (1993). 184. L. S. Argetsinger, G. S. Campbell, X. Yang, B. A. Withuhn, 0. Silvennoinen,J. N. lhle, and C. Carter-Su, Cell 74,237 (1993). 185. A. M. Gronowski andP. Rotwein,]. Biol. Chem. 269,7874 (1994). 186. T. Cuttan and B. R. Franza, Jr., Cell55,395 (1988). 187. J. Schwartz, C. Carter-Su, D. Meyer, E. Stephenson, L. Argetsnger, and G. Campbell, in “The Insulin-like Growth Factors and their Regulatory Proteins” (R. C. Baxter, P. D. Gluckman, and R. G. Rosenfeld, eds.), p. 3. Excerpta Medica, New York, 1994. 188. W. L. Lowe, Jr., M. Adamo, H. Werner, C. T. Roberts, Jr., and D. LeRoith, J. CZin. Invest. 84,619 (1989). 189. D. S. Straus and C. D. Takemoto, MoE. EndomkoZ. 4,91 (1990). 190. C. A. Emler and D. S. Schalch,, Endocrinology 120,832 (1987). 191. D. S. Straus and C. D. Takemoto, Endohnology 127,1849 (1990). 192. J. Thissen, S. Triest, B. M. Moats-Statts, L. E. Underwood, T. Mauerhoff, D. Maiter, and J. M. Ketelslegers, Endocrinology 129,429 (1991). 193. D. S. Straus and C. D. Takernoto,]. NuCrit. 121,1279 (1991). 194. J. E. Hepler, J. J. Van Wyk, and P. K. Lund, Endocrinology 127,1550 (1990).

MOLECULAR REGULATION OF 1GF-I A N D IGFBP-3

261

195. J. P. Thissen, S. Triest, L. E. Uudenvood, et al., Endocrinology 126,908 (1990). 196. C.-I. Pao, P. K. Farmer, S. Begovic, B. C. Villafuerte, G.-J. Wu, D. G. Robertson, and L. S.

Phillips, Mol. Endowinol. 7,1561 (1993). 1Y7. L. S. Phillips, S. Goldstein, and C.-I.Pao, Diabetes 40, 1525 (1991). 198. A. Suwanichkul, S. L. Moms, and D. R. Powel1,J. Biol.Chem. 268, 17063 (1993). 199. J. E. Friedman, J. S. Yun, Y. M. Patel, M. M. McGrane, and R. W. Hanson, ]. Biol. Clzem.

268,12952 (1993). 200. D.-S. Suh, Y. Zhou, G . T. Ooi, and M. M. Rechler, Bog. Growth Factor Res. 6,131 (1995). 201. T. Untennan, D. Oehler, H. Nguyen, P. Sengupta, and R. Lacson, Prog. Grot& Factor Res. 6, 119 (1995). 202. R. M. O’Brien, E. L. Noisin, A. Suwanichkul, T. Yamasaki, P. C. Lucas, J.-C. Wang, D. R. Powell, and D. K. Granner, Mol. Cell. B i d . 15, 1747 (1995). 203. T. G. Unterman, A. Fareeduddin, M. A. Harris, R. G. Goswami, A. Porcella, R. H. Costa, and R. G. Lacson, Biochem. Biophys. Res. Commun. 203,1835 (1994). 204. D. R. Powell, P. D. K. Lee, and A. Suwanichkul, in “The Insulin-like Growth Factors and their Regulatory Proteins” (R. C. Baxter, P. D. Gluckman, and R. G. Rosenfeld, eds.),p. 141. Excerpta Mehca, Amsterdam and New York, 1994. 205. R. M. O’Brien, P. C. Lucas, T. Yamaski, E. L. Noisin, and D. K. Granner,]. Biol. Chem. 269, 30419 (1994). 206. S. Babijko, E Tronche, and A. Groyer, Proc. Natl. Acad. Sci. U.S.A. 90, 272 (1993). 207. E. Neau, D. ChambBry, G. Schweizer-Groyer,F. Cadepond, N. Fibard, and A. Groyer, Prog. Growth Factor Res. 6, 103 (1995). 208. Z.-H. Zhang, V. Kumar, R. T. Rivera, J. Chisholm, and D. K. Biswas, J. Biol. Chem. 265, 4785 (1990). 209. M. Plumb, J. Frampton, H. Wainwright. M. Walker, K. Macleod, G. Goodwin, and P. Harrison, Nucleic Acids Res. 17, 73 (1989). 210. S. Rousseau, M. Asselin, J. Renaud, and A. Ruiz-Canillo, Mol. Cell. B i d . 13,4904 (1993). 211. I.-C. Ho, P. Vorhees, N. Marin, B. K. Oakley, S.-F.Tsai, S. H. Orkin, and J. M. Leiden, EMBO J. 10, 1187 (1991). 212. S.-F. Tsai, E. Strauss, and S. H. Orkin, Genes Deu. 5,919 (1991). 213. M. Imagawa, S. Osada, A. Okuda, and M. Muramatsu, Nucleic Acid7 Res. 19,5 (1991). 214. M. J. Thomas, Y. Umayahara, H. Shu, M. Centrella, P. Rotwein, and T. L. McCarthy,J. Biol. Chem. 271,21835 (1996). 215. J. L. Martin and R. C. Baxter, J. Biol. Clzem. 261,8754 (1986). 216. M. L. Cubbage, A. Suwanichkul, and D. R. Powell,]. B i d . Chem. 265,12642 (1990). 217. A. L. Albiston and A. C. Herington, Biochem. Biophys. Res. Commun. 166, 892 (1990). 218. R. C. Baxter and J. Dai, Endociiiiology 134,848 (1994). 219. S. R. Leong, R. C. Baxter, T. Camerato, J. Dai, and W. I. Wood, Mol. Endocrinol. 6, 870 (1992). 220. R. C. Baxter and J. L. Martin,]. Clin. Inuesst. 78, 1504 (1986). 221. R. C. Baxter,J. CZin. Endocrinol. Metab. 70,1347 (1990). 222. M. A. Cascieri, and M. L. Bayne, Hoirtz Res. 41 (Suppl. 2), 80 (1994). 223. R. C. Baxter and J. L. Martin, Proc. Natl. Acad. Sci. U.S.A. 86,6898 (1989). 224. S. Hober, A. Hansson, M. UhlPn, and B. Nilsson, Biochemistry 33,6758 (1994). 225. J. Zapf, C. Hauri, M. Waldvogel, and E. R. Froesch,]. Clin. lnoest. 77,1768 (1986). 226. F. J. Ballard, S. E. Knowles, P. E. Walton, K. Edson, P. C. Owens, M. A. Mohler, and B. L. Ferraiolo,]. Endocrinol. 128, 197 (1991). 227. R. C . Baxter and W. H. DaughadayJ. Clii7. Endocrinol. Metab. 73,696 (1991). 228. J. Zapf, C. Hauri, M. Waldvogel, E. Futo, H. Hasler, K. Binz, H. P. Guler, and C. Schmid, Proc. Natl. Acud. Sci. U.S.A. 86,3813 (1989).

262

LAWRENCE S. PHILLIPS ET AL.

229. M. S. Lewitt, H. Saunders, J. L. Phuyal, and R. C. Baxter, Endocrinology 134,2404 (1994). 230. M. S. Lewitt, H. Saunders, and R. C. Baxter, Endocrinology 133,1797 (1993). 231. R. G. Clark, D. Mortensen, D. Reifsynder, M. Mohler, T. Etcheverry, and V. Mukku, Growth Reg. 3,50 (1993). 232. K. J. Ibbotson, C. M. Orcutt, S. M. DSouza, C. L. Paddock, J. A. Arthur, M. L. Jankowsky, and R. W. Boyce,J. Bone. Miner. Res. 7,425 (1992). 233. G. A. Hamon, T. K. Hunt, and E. M. Spencer, Growth Reg. 53 (1993). 234. A. Sommer, C. A. Maack, S. K. Spratt, D. Mascorenhas, T. J. Tressel, E. T. Rhodes, R. Lee, M. Roumas, G . P. Tatsuno, J. A. Flynn, N. Gerber, J. Taylor, H. Cudny, L. Nanney, T. I(. Hunt, and E. M. Spencer, in “Modem Concepts of Insulin-like Growth Factors” (E. M. Spencer, ed.), p. 715. Elsevier, Amsterdam, 1991. 235. M. Emst and G. A. Rodan, Endocrinology 127,807 (1990). 236. W. F. Blum, E. W. Jenne, F. Reppin, K. Kietzmann, M. B. R d e , and J. R. Bierich, Endocrinology 125,766 (1989). 237. J. S. M. DeMellow and R. C. Baxter, Biochern. Biophys. Res. Commun. 156,199 (1988). 238. Bicsak, T. A. Shimonaka, M. Malkowski, M. and Ling, N. Endocrinology 126,2184 (1990). 239. C. Schmid, J. Rutishauser, I. Schlapfer, E. R. Froesch, and J. Zapf, Biochern. Biophys. Res. Comrnun. 179,5 79 (1991). 240. R. M. White, S. P. Nissley, A. C. Moses, M. M. Rechler, and R. E. Johnsonbaugh, J. Clin. Endocrinol. Metab.53,49 (1981). 241. R. H. McCusker, C . Camacho-Hubner, M. L. Bayne, M. A. Cascieri, and D. R. Clemmons, J. Cell Physiol. 144, 244 (1990). 242. F. Liu, R. C. Baxter, and R. L. Hintz,J. Clin. Endocrinol. Metab. 75, 1261 (1992). 243. P. Hossenlopp, B. Segovia, C. Lassarre, M. Roghani, M. Bredon, and M. Binow,J. Clin.Endocrinol. Metabl. 7 4 797 (1990). 244. L. C . Giudice, E. M. Farrell, H. Pham, G. Lamson, and R. G. Rosenfeld,J. Clin. Endocrinol. Metab. 71,806 (1990). 245. C. Lasarre and M. Binoux, Endocrinology 134,1254 (1994). 246. P. Bang, K. Brismar, and R. G. Rosenfeld,J. Clin.Endocrinol. Metab. 78,1119 (1993). 247. A. Bereket, C . H. Lang, S. L. Blethen, J. Fan, R. A. Frost, and T. A. Wilson, J. Clin.Endocrinol. Metabl. 80,2282 (1995). 248. J. B. F’ucilowska, M. L. Davenport, and I. Kabir,]. Clin.Endocrinol. Metab. 77,1516 (1993). 249. S. C. Davies, J. A. H. Wass, R. J. M. Ross, A. N. Cotterill, C. R. Buchanan, V. J. Coulson, and J. M. P. Holly,J. Endocrinol. 130,469 (1991). 250. H. L. Muller, Y. Oh, S. E. Gargosky, T. Lehmbecher, R. L. Hintz, and R. G. Rosenfeld, J. Clin.Endocrinol. Metabl. 77,1113 (1993). 251. M. L. Davenport, W. L. Isley, J. B. Pucilowska, L. B. Pemberton, B. Lyman, L. E. Underwood, and D. R. Clemmons, J. CZin. Endocrinol Metab. 75,590 (1992). 252. P. Cohen, H. C. B. Graves, D. M. Peehl, M. Kamarei, L. C. Giudice, and R. Rosenfeld,J. Clin. Endocrinol. Metab. 75, 1046 (1992). 253. R. W. Grimes and J. M. Hammond, Endocrinology 134,337 (1994). 254. J. L. Fowlkes, D. M. Serra, C. K. Rosenberg, and K. M. ThrailkiU,J. B i d . Chem. 270,27481 (1995). 255. K. NoU, B. R. Wegmann, K. Havemann, and G. Jaques,J. Clin.Enclocrinol. Metab. 8%2663 (1996). 256. C. Lalou, C. Silve, R. Rosato, B. Segovia, and M. Binoux, Endocrinology 135,2318 (1994). 257. J. L. Fowlkes, K. Suzuki, H. Nagase, and K. M. Thrailkill, Endocrinology 135,2810 (1994). 258. C. A. Conover and D. D. DeLeon,J. Bid. Chem. 269,7076 (1994). 259. Y. Hasegawa, T. Hasegawa, H. Koni, T. Aso, N. Tanaka, S. Kotoh, M. Yamada, and Y. Tsuchiya, EndocrineJ. 42,569 (1995).

MOLECULAR REGULATION OF IGF-I AND IGFBP-3

263

260. C. Lalou and M. Binou, Regul. P q t . 48, 179 (1993). 261. S. E. Gargosky, H. M. Pham, K. F. Wilson, F. Liu, L. C. Giudice, and R. G. Rosenfeld, Endocrinology 134 3051 (1992). 262. C . L. Young and M. M. Rechler, Endocrinology 136,668 (1995). 263. C . Blat, J. Villaudy, and M. Binoux,J. Clin. Invest. 93,2226 (1994). 264. R. H. McCusker, W. H. Busby, M. H. Dehoff, C. Camacho-Hubner, and D. R. Clemmons, Endocrinology 129, 939 (1991). 265. C. A. Conover, Endocrinology 129,3259 (1991). 266. Y. Oh, H. L. Miiller, G . Lamson, and R. G. Rosenfeld, J. Biol. Chem. 268, 14964 (1993). 267. E. Neely and R. G. Rosenfeld, Endocrinology 130,985 (1992). 268. C. A. Conover,]. Clin. Inuest. 88, 1354 (1991). 269. Y.Oh, H. L. Miiller, H. Pham, and R. G. Rosenfeld,J . Biol. Chern. 268,26045 (1993). 270. T. Arai,A. Parker, W. Busby, Jr., and D. R. Clemmons, J. Biol. Chein. 269,20388 (1994). 271. C. A. Conover and D. R. Powell, Endocrinology 129,710 (1991). 272. E. Ehrenborg, C. Larsson, I. Stern, M. Janson, D. R. Powell, and H. Luthman, Genomics 12, 497 (1992). 273. S. L. S. Drop, A. G. P. Schuller, D. J. Lindenbergh-Kortleve, C. Groffen, A. Brinkman, and E. C. Zwarthoff, Growth Reg. 2, 69 (1992). 274. M. T. Brewer, G. L. Stetler, C. H. Squires, R. C. Thompson, W. H. Busby, and D. R. Clemmons, Biochem. Biophys. Res. Ch?rimun. 152,1289 (1988). 275. A. L. Brown and M. M. Rechler, Mol. Endocrinol. 4,2039 (1990). 276. W. I. Wood, G. Cachianes, W. J. Hanzel, G. A. Winslow, S. A. Spencer, R. Hellmiss, J. L. Martin, and R. C. Baxter, Mol. Enrlocrinol. 2, 1176 (1988). 277. N. E. Erondu, B. Toland, 0. M. Bols, B. Dake, D. R. Moser, and R. S. Bar, “78th Annual Meeting of the Endocrine Society” (abstract).San Francisco, California, 1996. 278. A. L. Albiston, R. Saffery, and A. C. Herington, Endocrinology 136,696 (1995). 279. M. Gardiner-Garden and M. Frommer,]. Mol. Bid. 196,261 (1987). 280. S. E. Gargosky, L. C. Giudice, R. G. Rosenfeld, and A. T. Fazleabas,]. Endocrinol. 147,449 (1995). 281. A. L. Albiston and A. C. Herington, Enducrinology 130,497 (1992). 282. I. Ocrant, C . T. Fay, H. Pham, and R. G. Rosenfeld, Endocrinology 131,221 (1992). 283. E. Chin, J. Zhou, J. Dai, R. C. Baxtger, and C. A. Bondy, Endocrinology 134, 2498 (1994). 284. E. P. Smith, B. A . Dickson, and S. D. Chernausek, Endocrinology 127,2744 (1990). 285. M. K. Tennank, J. Thrasher, P. A. Twomey, R. S. Bimbaum, and S. R. Plymate, J. Clin. Endocrinol. Metub. 84 411 (1996). 286. J. G. Reeve, L. B. Kirby, A. Brinkman, S. A. Hughes, J. Schwander, and N. M. Bleehen, Int. J. Cancer 5 1,818 (1992). 287. L. van Neste, B. Husman, C. Moller, G. Andersson, and G. Norstedt,J. Endocrinol. 119,69 (1988). 288. J.-G. Scharf, W. Schmidt-Sandte, S. A. Pahemik, H.-G. Koebe, and H. Hartmann, J. Hepatol. 23, 424 (1995). 289. B. C. Villafuerte, B. L. Koop, C.-I. Pao, L. Gu, G. G. Birdsong, and L. S. Phillips, Endocrinology 134,2044 (1994). 290. E. Army, S. Afford, A. J. Straiii, P. J. Winwood, M. J. P. Arthur, and D. J. HilLJ. Clin. Endocrinol. 79, 1871 (1994). 291. D. Landau, E. Chin, C. Bondy, H. Domene, C. T. Roberts, Jr., H. Gronbaek, A. Flyvbjerg, and D. LeRoith, Endocrinology 136,1835 (1995). 292. D. Kleiman, M. Karas, C. T. Roberts, Jr., D. LeRoith, M. Phillip, Y.Segev, J. Levy, and Y. Sharoni, Endocrinology 136,2531 (1995).

264

LAWRENCE S. PHILLIPS ET AL.

293. S. M. Donovan, L. C. Atilano, R. L. Hintz, D. M. Wilson, and R. G. Rosenfeld, Endocrinology 129, 149 (1991). 294. A. Phillips, K. Drakenberg, B. Person, B. Sjogren, A. N. Eklof, K. Hall, and V. Sara, Pedia f t Res. 26, 128 (1989). 295. Y. W. H. Yang, J. Wang, C. C. Orlowski, S. P. Nissley, and M. M. Rechler, Endocrinology 125, 1540 (1989). 296. J. Luo and L. J. Murphy,]. Mol. Endon-inol. 8, 155 (1992). 297. M. A. Gosteli-Peter, K. H. Winterhalter, C. Schmid, E. R. Froesch, and J. Zapf, Endocrinology 135,2558 (1994). 298. M. Gourmelen, F. Girard, and M. Binoux,J. Clin.Endominol. Metab. 54,885 (1982). 299. J. Kratzsch, W. F. Blum, E. Schenker, and E. Keller, Exp. Clin.Endocrinol. 103,285 (1995). 300. W. F. Blum, M. B. Ranke, K. Kietzmann, B. Tonshoff, and 0. Mehls, in “Insulin-like Growth Factor Binding Proteins” (S. L. S. Drop and R. L. Hintz, eds.). Elsevier, Amsterdam, 1989. 301. N. Potau, R. Clopent, D. Infante et al. Growth Regul. 4 (suppl.), 9 1 (abstract) (1994). 302. R. I. G. Holt, J. S. Jones, N. M. Stone, A. J. Baker, and J. P. Miell,]. Clin., Endocrinol. Metub. 81, 160 (1996). 303. J. A. Batch, R. C. Baxter, and G. Werther.1. Clin.Endocrinol. Metub. 73,964 (1992). 304. A. Bereket, C. H. Lang, S. L. Blethen, M. C. Gelato, J. Fan, R. A. Frost, and T. A. Wilson, J. Clin.Endocrinol. Metub. 80, 1312 (1995). 305. R. L. Jackson, Pediah-. Clin.31,545 (1984). 306. G. P. Frick, J. L. Leonard, and H. M. Goodman, EndocrinoEogy 125,3076 (1990). 307. H. Domene, K. Krishnamurthi, R. Eshet, I. Gilad, Z. Laron, I. Koch, B. Stannard, F. Cassorla, C. T. Roberts, Jr., and D. LeRoith, Endocrinology 133,675 (1993). 308. M. Maes, J. M. Ketelslegers, and L. E. Underwood, Diabetes 3260,1060 (1983). 309. C. Conover, Endocrinology 126,3139 (1990). 310. J. S. Mondschein, S. A. Smith, and J. M. Hammond, Endocrinology 127,2298 (1990). 311. W. S. Cohick and D. R. Clemmons, Endom’nology 129,1347 (1991). 312. R. C. Baxter, N. Nizuka, K. Takano, S. R. Holman, and K. Asakawa, Acta Endocrinol. 128, 101 (1993). 313. J. Zapf, C. Schmid, H. P. Guler, M. Waldvogel, C. Hauri, E. Futo,P. Hossenlopp, M. Binoux, and E. R. Froesch,J. Clin.Znoest. 86,952 (1990). 314. Z. Laron, B. Klinger, W. F. Blum, A. Silbergeld, and M. B. Ranke, Clin.Endocrinol. 36,301 (1992). 315. N. Mauras, F. E Horber, and M. W. Haymond, J. Clin.Enclocrinol. M&ab. 75,1192 (1992). 316. S. R. Kupfer, L. E. Undeiwood, R. C. Baxter, and D. R. CIemmons,]. Clin. Znuest. 91,391 (1993). 317. D. R. Clemmons, M. A. Cascieii, C. Camacho-Hubner, R. H. McCusker, and M. L. Bayne, I. Biol. Chem. 265,12210 (1990). 318. M. A. Cascieri, N. S. Hayes, and M. L. Bayne,]. Cell. Physiol. 139, 181 (1989). 319. L. Luo and L. J. Murphy, Mol. Cell. B i d . 74,213 (1990). 320. J. P. Miell, A. M. Taylor, J. Jones, J. M. P. Holly, R. C. Gaillard, F. P. Pralong, R. J. M. Ross, and W. F. Blum, J. Endocrinol. 136,525 (1993). 321. P. Bang, M. Degerblad, M. Thoren, J. Schwander, W. Blum, and K. Hall, Acta Endocrinol. 128,397 (1993). 322. E. Thompson, A. Venetianer, T. D. Gebharter, G. Hager, D. K. Granner, M. R. Norman, T. J. Schmidt, and J. M. Harmon, in “Gene Regulation by Steroid Hormones” (A. K. Roy and J. H. Clark, eds.), p. 126. Springer-Verlag,Berlin and New York, 1980. 323. T. L. Chen, L. Y. Chang, R. L. Bates, and A. Perlman,J. Endocrinol. 128,73 (1991). 324. J. P. Thissen, J. M. Ketelslegers, and D. Maiter, Growth Reg. 6,222 (1996).

MOLECULAR REGULATION OF IGF-I AND IGFBP-3

265

325. W. F. Blum, M. B. R a k e , K. Kietzmann, E. Gauggel, H. J. Zeisel, and J. R. Biench, 1.Clin. Endominol. Metub. 70, 1292 (1990). 326. M. Hu, D. G. Robertson, and L. J. Murphy, Endocrinology 137,3702 (1992). 327. C. Schmid, I. Schlapfer, M. Peter, M. Boni-Schnetzler, J. Schwander, J. Zapf, and E. R. Froesch, Am. J. Physiol. 267, E226 (1994). 328. J. Phikpe, Proc. Natl. Acad. Sci. U.S.A. 88, 7224 (1991). 329. M. C. Alexander, M. Lomanto, N. Nasrin, and C. Ramaika, Proc. Nutl. Acad. Sci. U.S.A. 85, 5092 (1988). 330. T. M. Johnson, M. D. Rosenberg, and M. H. Meisler,J. Bid. Chem. 268,464 (1993). 331. R. M. O’Brien, P. C. Lucas, C. D. Forest, M. A. Magnuson, and D. K. Granner, Science 249, 533 (1990). 332. K. K. Jacob and F. M. Stanley,]. B i d . Chem. 269, 25515 (1994). 333. V. DeSimone and R. Cortese, Biochim. Biophys. Acta Gene Struct. Express. 1132, 119 (1992).