Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

Available online at www.sciencedirect.com

ScienceDirect Rice Science, 2017, 24(1): 41í47

-OLECULAR3CREENINGOF"LAST2ESISTANCE'ENESIN2ICE 'ERMPLASMS2ESISTANTTOMagnaporthe oryzae LIANG Yan1, YAN Bai-yuan2, PENG Yun-liang3, JI Zhi-juan1, ZENG Yu-xiang1, WU Han-lin1, YANG Chang-deng1 (1State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China; 2The Seed Management Station of Jiande, Jiande 311600, China; 3Institute of Plant Protection, Sichuan Academy of Agricultural Sciences / Key Laboratory of Integrated Pest Management on Crops in Southwest China, Ministry of Agriculture, Chengdu 610066, China)

!BSTRACT Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2), in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide. +EYWORDS rice; blast resistance gene; field evaluation; marker-assisted selection

Rice (Oryza sativa L.) is one of the world’s most important crops, providing a staple food for nearly half of the global population. The demand for rice is expected to increase due to the steadily increasing population in Asia, Africa and Latin America (Wang and Li, 2005). In China, rice production will need to increase by approximately 20% by 2030 to meet the domestic demand if rice consumption per capita remains at its current level (Peng et al, 2009). However, rice production is continually threatened by disease, insects and other stress. Rice blast, one of the most damaging diseases affecting rice production worldwide, is caused by the non-obligate filamentous ascomycete Magnaporthe oryzae B. Couch (cyn. Magnaporthe oryzae). The control options for blast are adjusting planting time, spliting nitrogen fertilizer

application in two or more treatments, flooding the field as often as possible, and planting resistant varieties (www.knowledgebank.irri.org). In rice production practices, rice blast is managed primarily by the use of chemical pesticides, which are both economically and environmentally costly. Moreover, the overuse of pesticides prompts the evolution of resistance in the disease, which in turn leads to disease resurgence. Therefore, the exploitation of host plant resistance has generally been considered as one of the most economical and environmentally friendly approaches to combat the disease (Khush and Tena, 2009). Regarding the genetic basis of the resistance to M. oryzae, more than 86 dominant R genes and approximately 350 QTLs for resistance to rice blast have been identified, and 23 of them have been

Received: 4 May 2016; Accepted: 3 July 2016 Corresponding author: YANG Chang-deng ([email protected]; [email protected]) Copyright © 2017, China National Rice Research Institute. Hosting by Elsevier B.V. B V This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) Peer review under responsibility of China National Rice Research Institute http://dx.doi.org/ http://dx.doi.org/10.1016/j.rsci.2016.07.004

42

Rice Science, Vol. 24, No. 1, 2017

molecularly characterized: i.e. pb1, Pi-a, Pi-b, Pi-d2, Pi-d3, Pi-k, Pik-h/Pi-54, Pik-m, Pik-p, Pi-sh, Pi-t, Pi-ta, Piz-t, Pi-1, Pi-2/Piz-5, Pi5, Pi-9, pi-21, Pi-25, Pi-36, Pi-37, Pi-35 and Pi-64 upto date (RiceDate, 2012; Fukuoka et al, 2014; Ma et al, 2015). However, as each of these R genes usually act only against a subset of existing pathogen races, the identification of new R genes/alleles is still essential to the breeding of endurably resistant varieties by different strategies such as pyramiding of different resistance genes (Miah, 2013). Generally, R genes for M. oryzae are identified in landraces, cultivars or wild rice using differential physiological races of M. oryzae (Tanksley and McCouch, 1997). The development of improved rice cultivars has led to the replacement of landraces and traditional varieties by modern cultivars, which has resulted in a decline in the diversity of agriculturally used rice. However, the diversity lost in the elite materials is somewhat preserved in crop gene banks, wild rice collections and breeding resources, thus, these rice materials provide the basis for genetic improvement of crops for specific traits and represent rich sources of novel allelic variation. In this research, a collection of 32 rice accessions have been constructed by inoculation tests, which were taken in lab and in field evaluations in multiple locations over years, and showed complete and moderate resistance to M. oryzae. These accessions were carefully assessed with the response to M. oryzae to ensure the accuracy of phenotyping. Molecular genetic markers are now widely used to characterize gene bank collections that contain untapped resources of distinct alleles, which will remain hidden unless efforts are initiated to screen them for their potential use and function (Cho et al, 2007; RoyChowdhury et al, 2012a, b; Imam et al, 2013; Vasudevan et al, 2014; Singh et al, 2015). Little is currently known about the genetic basis of blast resistance among the collection of 32 rice germplasm. In this study, molecular screening and field evaluation were both carried out to acquire the information for 11 functional blast R genes in the selected collection, and the efforts can be utilized to develop high-yielding rice varieties with resistance to blast through markerassisted selection.

-!4%2)!,3!.$-%4(/$3 Rice materials Thirty-two rice accessions resistant to M. oryzae with different agronomic characters were selected from 347 landraces and cultivars based on the field evaluation in

multiple locations in Xuyong, Pujiang and Ya’an in Sichuan Province, China. The detail information of 32 accessions and the geographical origins are shown in Supplemental Table 1. These materials were continued investigated in 2011 in Puling in Chongqing, Enshi in Hubei Province, Pingxiang and Jinggangshan in Jiangxi Province, Jing County and Xiuning in Anhui Province, Jintan in Jiangsu Province and Lin’an in Zhejiang Province, China, and showed complete resistance except IR72903-99-2-3-2, A10 and 237, which showed moderate resistance in the Enshi nursery in Hubei Province (data not shown). Lijiangxintuanheigu (LTH), Yuanfengzao and CO39 were used as negative controls in the field evaluation, and CO39 was used as negative control in molecular screening. The positive controls in molecular screening were Digu for Pi-d2, and Chunjiangnuo for Pi-36 and Pi-37, which were conserved in the State Key Laboratory of Rice Biology, China National Rice Research Institute. The monogenetic lines, IRBLz-Fu for Pi-z, IRBLzt-T for Piz-t, IRBL9-W for Pi-9, IRBL5-M for Pi5, IRBLb-B for Pi-b, IRBLkp-K60 for Pik-p, IRBLkh-K3 for Pik-h and IRBLta2-Pi for Pi-ta2, were donated by Prof. WANG Guo-liang at Ohio State University, USA. Methods DNA isolation and DNA marker analysis Genomic DNA was isolated from 100 mg of young leaf tissue from each accession using modified cetyltrimethyl ammonium bromide method (Warude et al, 2003). The quality and quantity of extracted genomic DNA was measured according to Imma et al (2014). The PCR markers for blast resistance genes Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2 were listed in Table 1. All of them were synthesized by Dingguo Biotech. Co. Ltd, Beijing, China. The PCR analyses were conducted and templates for PCR reaction set up with modifications according to the instructions: 2.5 μL of 10× LA PCR Buffer (Mg2+ Plus), 4 μL of dNTP mixture (2.5 mmol/L), 1 μL of each primer (10 μmol/L), 50 ng of genomic DNA template, 0.25 μL of TaKaRa LA Taq DNA polymerase (5 U/μL) (Takara Bio Inc., Shanghai, China), and ddH2O water to final volume of 25 μL. PCR amplification was performed with the following profile: 94 ºC for 5 min, 35 cycles of 94 ºC for 30 s, primer annealing at different temperature for 45 s (Table 1), and 72 ºC for 2 min, and 72 ºC for 5 min. All PCR reactions for each sample were repeated three times to confirm the results. To detect polymorphisms,

LIANG Yan, et al. Molecular Screening for Identification of Blast Resistance Genes

the PCR products were separated by electrophoresis on 2%–3% agarose gels in 1× TAE buffer at 150 V for 90 to 120 min, and the DNA fragment was detected with ethidium bromide, and scored as absence (0) or presence (1). Disease evaluation The 32 rice accessions were assessed in a blast nursery located at Lin’an, Zhejiang Province, China, during 2012–2014 in three replications. Briefly, moistened seeds were sown in rows together with susceptible plants LTH, Yuanfengzao and CO39. Disease responses were recorded at 25 d after sowing and continued at 5 d intervals until 40 d after sowing when the susceptible checks were completely killed as described by Imam et al (2014), and the disease scores were obtained by following a standard evaluation system, wherein scores 0–1 were highly resistant (HR), score 2 was resistant (R), score 3 was moderately resistant (MR), scores 4–6 were moderately susceptible (MS), score 7 was susceptible (S), and scores 8–9 as highly susceptible (HS) (IRRI, 1996; Latif et al, 2011). Some seedlings were also injection-inoculated following methods described by Lei et al (1996) to confirm disease reactions. Data analysis All the phenotype and genotype data were arranged by Microsoft Excel and SPSS 14.0 (http://www-01. ibm.com/software/analytics/spss) was used to perform spearman rank correlation analyses.

2%35,43 Allelic diversity of rice blast genes Eleven R gene markers were used to detect the presentence or absence of the related R genes in the

43

selected germplasm collections. All the 32 accessions possessed three or more blast resistance genes as revealed by the positive bands for different markers. Two of the accessions, 6003 and 237-2, showed positive bands for different markers associated with nine major rice blast resistance genes, Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi-b, Pik-p and Pik-h. Six germplasms were positive for seven markers, while twelve germplasms were positive for six markers and another eight germplasm were positive for five markers. Three accessions, M2-9-14UL, Huanglizhan and C5216-B-3-1-1, were positive for four markers while Zhaitang contained three R genes Pi-d2, Pi-z and Pi-ta2. All the 32 accessions were positive for Pi-d2 and Pi-z (Table 2). Out of the R genes detected in this study, Pi-d2, Pi-z, Piz-t and Pi-9 were located on chromosome 6. The R gene frequency for Pi-d2 and Pi-z were both 100.0%. Pi-9 was detected in 12 accessions and Piz-t was in 28 accessions. Twelve accessions were detected with positive bands for all the four R genes on chromosome 6 (Table 2), and they were all origin from Sichuan Province except 41, which was origin from Yunnan Province, China. The blast resistance genes Pi-36 and Pi-37 were located on chromosomes 8 and 1, respectively. The gene specific marker for Pi-36 was detected in three accessions, and Pi-37 was determined in four accessions. Two accessions, 6003 and 237-2, both origin from Sichuan Province, China, were positive for both of the two markers. Twenty-seven accessions were negative for both of the two genes (Table 2). Presence of the blast resistant gene Pi5 on chromosome 9 was detected by visualization of 594 bp positive fragments, which were determined in 11 accessions and the negative amplification of this band indicating the absence of the gene in these germplasms (Table 2). Screening of the blast

Table 1. Details of single nucleotide polymorphisms and gene based sequence-tagged site markers tightly linked to the major rice blast resistant genes. Gene

Chr

Marker

Forward (5ƍ–3ƍ)

Pi-d2 6 ttggctatcataggcgtcc Pi-36 8 caatgtgtgacttgtgcggact Pi-37 1 tcttgagggtcccagtgtac Pi5 9 tcctcctcttcggacacctc Pi-z 6 Z56592 ggacccgcgttttccacgtgtaa Piz-t 6 Zt56591 ttgctgagccattgttaaaca Pik-p 11 K3957 atagttgaatgtatggaatggaat Pik-h 11 Candi gene marker catgagttccatttactattcctc Pi-b 2 Pb28 gactcggtcgaccaattcgcc Pi-9 6 195R-1 atggtcctttatctttattg 12 YL155/YL87 agcaggttataagctaggcc Pi-ta/Pi-ta2 Chr, Chromosome; AT, Annealling temperature; ES, Expected size.

Reverse (5ƍ–3ƍ) atttgaaggcgtttgcgtaga tcttccatctcggatttcgtgt cgaacagtggctggtatctc cggacgagcgatagtgatcc aggaatctattgctaagcatgac atctcttcatatatatgaaggccac ctgcgccaagcaataaagtc acattggtagtagtgcaatgtca atcaggccaggccagatttg ttgctccatctcctctgtt ctaccaacaagttcatcaaa

AT (°C)

ES (bp)

Reference

55 55 55 55 60 60 60 55 60 56 55

1 057 1 036 1 149 594 292 257 148 1 500 388 2 000 1 042

Chen et al (2006) Jin et al (2011) Sun (2012) Sun (2012) Hayashi et al (2004) Hayashi et al (2006) Hayashi et al (2006) Sharma et al (2005) Hayashi et al (2006) Qu et al (2006) Jia et al (2002, 2004)

44

Rice Science, Vol. 24, No. 1, 2017

resistance gene Pi-b was determined by visualization of 388 bp positive fragments from 32 accessions using the gene specific PCR marker Pb28, and only one accession, Zhaitang selected from Guangxi Province, China is negative for Pi-b (Table 2). The markers YL155/YL87 was tightly linked to the resistance allele Pi-ta2, 11 of the 32 accessions produced positive bands of 1 042 bp for this gene (Table 2). Among them, Chang A5, Yuetai 13, A10, C3 and 1579 were original from Sichuan Province, China, IR31892-100-3-3-3, C5216-B-3-1-1 and IR76479-48-1-3-1 were original from International Rice Research Institute, the Philippine, Huanglizhan and Yebahuangzhan were original from Guangdong Province, China, while Zhaitang was original from Guangxi Province, China. PCR based screening of Pik-p and Pik-h on chromosome 11 showed that nine accessions produced positive bands of 148 bp with marker K3957 for Pik-p, and 14 accessions produced 1 500 bp with candidate

gene marker for Pik-h. Fourteen accessions amplified neither of these two genes (Table 2). Uniform blast nursery Reaction of the set of 32 germplasm to M. oryzae under UBN was evaluated at Lin’an, Zhejiang Province, China in 2012–2014. Disease reactions were scored at 35 d after sowing ranging from 0 to 9, when the susceptible spreader CO39, Yuanfengzao and LTH were completely killed. Thirty germplasms were resistant (score 0–3), one moderately resistant (N11, score = 4) and only one susceptible (Zhongle 8610, score = 8) was detected (Fig. 1). Data analysis Spearman rank correlations of genotypes of different rice resistance genes in the 32 accessions and their infection types (ITs) at Lin’an are shown in Supplemental Table 2. ITs were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and

Table 2. Single nucleotide polymorphisms and sequence-tagged site markers associated with eleven blast resistance genes in 32 rice germplasms. Pi-37

Pi5

Pi-b

Pi-ta2

Pik-p

Pik-h

Total genes

IR31892-100-3-3-3 1a 1 1 0a 0 1 M2-9-14UL 1 1 1 0 0 0 C5216-B-3-1-1 1 1 1 0 0 0 Chang B8 1 1 1 0 0 0 Chang A5 1 1 1 0 0 0 Yuetai 13 1 1 1 0 0 0 Huanglizhan 1 1 0 0 0 0 Yebahuangzhan 1 1 0 0 0 0 Taiaosimiao 1 1 1 0 0 0 Fengsizhan 1 1 1 1 0 0 0 Baitaixiangzhan 1 1 1 0 0 0 IR76479-48-1-3-1 1 1 0 0 0 0 IR72903-99-2-3-2 1 1 1 0 0 0 Zhaitang 1 1 0 0 0 0 Xuxiaoqu 10 1 1 1 1 0 0 062A1 1 1 1 0 0 0 N11 1 1 1 1 0 0 A10 1 1 1 0 0 0 C3 1 1 1 0 0 0 Yunjing 136 1 1 1 1 0 0 Zhongle 8610 1 1 1 0 0 1 41 1 1 1 1 0 0 43 1 1 1 1 0 0 488 1 1 1 0 0 0 6003 1 1 1 1 1 1 6004 1 1 1 1 0 0 6020 1 1 1 1 0 0 6021 1 1 1 1 0 0 6181 1 1 1 1 0 0 237-1 1 1 1 1 0 0 237-2 1 1 1 1 1 1 1579 1 1 1 0 1 0 R gene frequency (%) 100.0 100.0 87.5 37.5 9.4 12.5 a , ‘1’ represents presence of amplicon and ‘0’ represents absence of amplicon.

0 0 0 1 1 1 0 1 1 1 1 0 0 0 0 1 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 0 34.4

1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 96.9

1 0 1 0 1 1 1 1 0 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 34.4

0 0 0 1 0 1 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 1 1 0 28.1

0 0 0 0 1 0 0 1 0 1 0 0 0 0 1 0 1 0 1 0 1 1 0 1 1 1 0 0 1 1 1 0 43.8

6 4 5 6 7 7 4 7 6 6 5 4 5 3 6 5 6 6 7 5 6 6 5 6 9 6 5 5 7 7 9 6

Accession

Pi-d2

Pi-z

Piz-t

Pi-9

Pi-36

LIANG Yan, et al. Molecular Screening for Identification of Blast Resistance Genes

45

Pik-p, although the correlation coefficients were very little bit.

$)3#533)/. Improvement of host plant resistance is one of the best methods to protect the yield from M. oryzae. Incorporation of major rice blast resistance genes or their variants into elite rice varieties will enhance the host plant resistance and its durability. Genotyping of the accessions with allelic related markers helped to identify major blast resistance genes from different origins. The marker-assisted selection of rice blast resistance genes will help in the breeding program in multi-diseases resistant rice varieties. In this study, the field evaluations and genotyping of the germplasm with allelic related markers were conducted to help identifying 11 major blast resistant genes Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2 with the genetic frequencies ranging from 9.4% to 100.0% in 32 rice germplasms resistant to M. oryzae. Similar results were reported by Kim et al (2010) in 84 rice accessions possessed more than three positive bands of the eight rice blast resistance genes. Imam et al (2014) reported the genetic frequency of Pi-z, Piz-t, Pi-k, Pik-p, Pik-h, Pi-ta/Pi-ta2, pi-ta, Pi-9 and Pi-b ranged from 6% to 97% in the select set of rice germplasms, and Singh et al (2015) published the genetic frequencies of Piz-5, Pi-9, Pi-tp(t), Pi-1, Pi5(t), Pi-33, Pi-b, Pi-27(t), Pik-h and Pi-ta in 192 rice accessions ranged from 19.79% to 54.69%, and only 17 accessions harbored 7–8 blast resistance genes. Interestingly, in this study, out of the 32 accessions, 2 were positive for 9 blast resistance genes, 6 were positive for 7, 12 were positive for 6, etc. Relatively, more blast R genes were detected in the 32 blast resistant germplasms, and ITs were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p. These findings imply that the main reason for high and broad spectrum blast resistance of these accessions was the numerous blast resistance genes they harbored. As a result, these accessions can be used as sources of resistance genes in designing future breeding programs, and there is good possibility of obtaining enhanced resistance through gene pyramiding by marker-assisted selection. All the 32 accessions possessed more than three blast resistant genes, which were highly in consistent with their resistant phenotype. The field evaluations in

Fig. 1. Distribution of blast disease score of 32 resistant rice germplasms.

Zhejiang Province revealed the blast disease pattern of these germplasm. 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Being adapted to the locations where these germplasms originated, having coevolved with local population of the blast fungus, and using of these germplasms may have a competitive edge than other donors currently being used in the breeding programs. Field evaluation of a set of isogenic lines carrying 24 major blast resistance genes had earlier indicated that Pi-9, Pi-2, Piz-t, Pik-s, Pik-h and Pik-m were resistant, indicating their broader spectrum of resistance to pathotypes prevalent in the rice blast nursery in Zhejiang Province. Of the results of genotyping, 12, 14 and 28 accessions were positive for Pi-9, Pik-h and Piz-t, respectively. Imam et al (2014) reported that the less frequently detected R genes in germplasm accessions always be effective in pathogenicity assays. In this study, the molecular screening results of Pi-9 and Pik-h may be in consistent with that assumptions, however, Piz-t seems very common in the detected collections. Two blast resistance genes, Pi-ta and Pi-ta2, have been located at the Pi-ta locus near the centromere of chromosome 12 and are tightly linked to each other

46

(Wang et al, 2002). These two genes were interacting in terms of their resistance specificity. Pi-ta2 has a broader resistant spectrum than Pi-ta (Rybka et al, 1997; Bryan et al, 2000). In this study, 11 accessions were positive of Pi-ta2 gene using the dominant marker YL155/YL87, among which five accessions, Chang A5, Yuetai 13, A10, C3 and 1579, were original from Sichuan Province, China. The monogenetic line harbored Pi-ta2 was detected resistance in the rice blast nurseries located in Anxian, Jiange, Zhizhong, Shehong and Suining from Sichuan Province, China (data not shown). This partly indicated these five accessions could harbor the effective gene Pi-ta2, and supposed to be used in the blast breeding program in Sichuan Province, China. Many rice varieties have been developed by MAS, which have the advantage in identifying R genes, however, its power lies in the robustness of the makers used (Imam et al, 2014). The genotyping of rice blast resistance genes in this study suggests that the available DNA markers derived from or linked to the major blast resistance gene is a valuable tool in confirming, identifying and screening these specific genes among the rice germplasms (Roy Chowdhury et al, 2012a, b; Singh et al, 2015). In this study, 32 rice accessions having complete and moderate resistance to M. oryzae with different agronomic characters were selected from 347 landraces and cultivars based on the field evaluation in multiple locations over years. Genotyping of these germplasms with allele related markers helped to identify 11 major rice blast resistance genes. Some of the accessions analyzed in this study may have special properties that are important to breeding program, so that efforts can be utilized to develop high-yielding rice varieties with resistance to blast through MAS. Despite recent progress, however, we were not able to distinguish which R genes indeed effectively based only on molecular screening and the field evaluation. Virulence analyses using specific isolates would help unravel the response of the resistance genes against specific lineages. In addition, the relationship between the number of resistance gene(s) and the phenotype of blast resistance, and also the determination of whether resistance have been lost for particular R gene(s), could not be completely clarified in this study. If the alleles identified by genotyping really have the expected phenotype or different phenotypes by inoculating known races of the pathogen in control conditions also remains to be elucidated. In this regard,

Rice Science, Vol. 24, No. 1, 2017

genetic approaches based on the allelism test will be necessary in future experiments to confirm the presence of predicted or masked R gene(s).

!#+./7,%$'%-%.43 This work was supported by the National Natural Science Foundation of China (Grant No. 31221004), the Central Academy (Institute) Research Project on Public Welfare (Grant No. 2014RG001-3), the Special Fund for Agroscientific Research in the Public Interest (Grant No. 20120301400903039-5), the Sichuan Program for Major Crop, Poultry and Livestock Breeding, China (Grant No. 2012YZGG-25-3), and a fund from the Chinese Academy of Agricultural Sciences to the Scientific and Technical Innovation Team.

3500,%-%.4!,$!4! The following materials are available in the online version of this article at http://www.sciencedirect.com/science/ journal/16726308; http://www.ricescience.org. Supplemental Table 1. Detail information of the 32 rice varieties and lines resistance to blast disease at Pujiang, Sichuan Province, China. Supplemental Table 2. Spearman rank correlations between genotype score and infection types (ITs) of 32 rice germplasms detected in the field assays.

2%&%2%.#%3 Bryan G T, Wu K S, Farrall L, Jia Y L, Hershey H P, McAdams S A, Faulk K N, Donaldson G K, Tarchini R, Valent B. 2000. A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pita. Plant Cell, 12: 2033–2045. Chen X W, Shang J J, Chen D X, Lei C L, Zou Y, Zhai W X, Liu G Z, Xu J C, Ling Z Z, Cao G, Ma B T, Wang Y P, Zhao X F, Li S G, Zhu L H. 2006. A B-lectin receptor kinase gene conferring rice blast resistance. Plant J, 46(5): 794–804. Cho Y C, Kwon S W, Choi I S, Lee S K, Jeon J S, Oh M K, Roh J H, Hwang H G, Yang S J, Kim Y G. 2007. Identification of major blast resistance genes in Korean rice varieties (Oryza sativa L.) using molecular markers. J Crop Sci Biotechnol, 10(4): 265–276. Fukuoka S, Yamamoto S I, Mizobuchi R, Yamanouchi U, Ono K, Kitazawa N, Yasuda N, Fujita Y, Nguyen T T T, Koizumi S, Sugimoto K, Matsumoto T, Yano M. 2014. Multiple functional polymorphisms in a single disease resistance gene in rice enhance durable resistance to blast. Sci Rep, 4: 4550. Hayashi K, Hashimoto N, Daigen M, Ashikawa I. 2004. Development of PCR-based SNP markers for rice blast

LIANG Yan, et al. Molecular Screening for Identification of Blast Resistance Genes resistance genes at the Pi-z locus. Theor Appl Genet, 108(7): 1212–1220. Hayashi K, Yoshida H, Ashikawa I. 2006. Development of PCR-based allele specific and InDel marker sets for nine rice blast resistance genes. Theor Appl Genet, 113(2): 251–260. Imam J, Alam S, Variar M, Shukla P. 2013. Identification of rice blast resistance gene Pi-9 from Indian rice land races with STS marker and its verification by virulence analysis. Proc Natl Acad Sci Ind Sec B: Biol Sci, 83(4): 499–504. Imam J, Alam S, Mandal N P, Variar M, Shukla P. 2014. Molecular screening for identification of blast resistance genes in north east and eastern Indian rice germplasm (Oryza sativa L.) with PCR based markers. Euphytica, 196(2): 199–211. International Rice Research Institute (IRRI). 1996. Standard Evaluation System. Manila, the Philippines: IRRI: 52. Jia Y L, Wang Z H, Singh P. 2002. Development of dominant rice blast Pi-ta resistance gene markers. Crop Sci, 42(6): 2145–2149. Jia Y L, Redus M, Wang Z H, Rutger J N. 2004. Development of a SNLP marker from the Pi-ta blast resistance gene by tri-primer PCR. Euphytica, 138(1): 97–105. Jin C P, Sun G, Liu J L, Li G H, Zhang S H, Pan H Y. 2011. Identification of rice varieties resistant to rice blast in Jilin Province. Agta Agric Boreali-Sin, 26(3): 214–218. (in Chinese with English abstract) Khush G S, Jena K K. 2009. Current status and future prospects for research on blast resistance in rice (Oryza sativa L.). In: Wang G L, Valent B. Advances in Genetics, Genomics and Control of Rice Blast Disease. New York, USA: Springer: 1–10. Kim J S, Ahn S N, Kim C K, Shim C K. 2010. Screening of rice blast resistance genes from aromatic rice germplasms with SNP markers. Plant Pathol J, 26: 70–79. Latif M A, Badsha M A, Tajul M I, Kabir M S, Rafii M Y, Mia M A T. 2011. Dentification of genotypes resistant to blast, bacterial leaf blight, sheath blight and tungro and efficacy of seed treating fungicides against blast disease of rice. Sci Res Essays, 6(13): 2804–2811. Lei C L, Wang J L, Mao S H, Zhu L H, Ling Z Z. 1996. Genetic analysis of blast resistance in indica variety Zhaiyeqing 8 (ZYQ8). Chin J Genet, 23: 287–293. Ma J, Lei C L, Xu X T, Hao K, Wang J L, Cheng Z J, Ma X D, Ma J, Zhou K N, Zhang X, Guo X P, Wu F Q, Lin Q B, Wang C M, Zhai H Q, Wang H Y, Wan J M. 2015. Pi-64, encoding a novel CC-NBS-LRR protein, confers resistance to leaf and neck blast in rice. Mol Plant-Microbe Inter, 28(5): 558–568. Miah G, Rafii M Y, Ismail M R, Puteh A B, Rahim H A, Islam K N, Latif M A. 2013. A review of microsatellite markers and their applications in rice breeding programs to improve blast disease

47

resistance. Int J Mol Sci, 14(11): 22499–22528. Peng S B, Tang Q Y, Zou Y B. 2009. Current status and challenges of rice production in China. Plant Prod Sci, 12(1): 1–6. Qu S H, Liu G F, Zhou B, Bellizzi M, Zeng L R, Dai L Y, Han B, Wang G L. 2006. The broad-spectrum blast resistance gene Pi-9 encodes a nucleotide-binding site-leucine-rich repeat protein and is a member of a multigene family in rice. Genetics, 172: 1901–1914. RiceDate. 2012. http://www.ricedata.cn/gene/gene_pi.htm. 2012-6-20. RoyChowdhury M, Jia Y, Jackson A, Jia M H, Fjellstrom R, Cartwright R. 2012a. Analysis of rice blast resistance gene Pi-z using pathogenicity assays and DNA markers. Euphytica, 184(1): 35–46. RoyChowdhury M, Jia Y, Jia M H, Fjellstrom R, Cartwright R. 2012b. Identification of the rice blast resistance gene Pi-b in the national small grains collection. Phytopathology, 102: 700–706. Rybka K, Miyamoto M, Ando I, Saito A, Kawasaki S. 1997. High resolution mapping of the indica-derived rice blast resistance genes: II. Pi-ta2 and Pi-ta and a consideration of their origin. Mol Plant-Microbe Inter, 10(4): 517–524. Sharma T R, Madhav M S, Singh B K, Shanker P, Jana T K, Dalal V, Pandit A, Singh A, Gaikwad K, Upreti H C, Singh N K. 2005. High-resolution mapping, cloning and molecular characterization of the gene of rice, which confers resistance to rice blast. Mol Genet Genom, 274(6): 569–578. Singh A K, Singh P K, Arya M, Singh N K, Singh U S. 2015. Molecular screening of blast resistance genes in rice using SSR markers. Plant Pathol J, 31(1): 12–24. Sun G. 2012. Distirbutinon of resistance genes in rice and avirulence genes in rice blast fungus and molecule detection of Magnaporthe oryzae. Jinlin, China: University of Jinlin. (in Chinese with English abstract) Tanksley S D, McCouch S R. 1997. Seeds banks and molecular maps: Unlocking genetic potential from the wild. Science, 277: 1063–1066. Vasudevan K, Vera Cruz C M, Gruissem W, Bhullar N K. 2014. Large scale germplasm screening for identification of novel rice blast resistance sources. Front Plant Sci, 5: 505. Wang C, Hirano K, Kawasaki S. 2002. Cloning of Pi-ta2 in the centromeric region of chr12 with HEGS: High efficiency genome scanning. In: Third International Rice Blast Conference: 25. Wang Y H, Li J Y. 2005. The plant architecture of rice (Oryza sativa). Plant Mol Biol, 59(1): 75–84. Warude D, Chavan P, Joshi K, Patwardhan B. 2003. DNA isolation from fresh and dry plant samples with highly acidic tissue extracts. Plant Mol Biol Rep, 21(4): 467. (Managing Editor: LI Guan)