Molecular structure and functional characterization of the gamma-interferon-inducible lysosomal thiol reductase (GILT) gene in largemouth bass (Microptenus salmoides)

Fish & Shellfish Immunology 47 (2015) 689e696

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Molecular structure and functional characterization of the gamma-interferon-inducible lysosomal thiol reductase (GILT) gene in largemouth bass (Microptenus salmoides) Qian Yang a, 1, Jiaxin Zhang a, b, 1, Lingling Hu a, Jia Lu a, Ming Sang a, c, Shuangquan Zhang a, c, * a b c

Jiangsu Province Key Laboratory for Molecular and Medical Biotechnology, Life Sciences College, Nanjing Normal University, Nanjing 210046, China Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China Jiangsu Province Key Laboratory for Aquatic Crustacean Diseases, Life Sciences College, Nanjing Normal University, Nanjing 210046, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 15 July 2015 Received in revised form 7 October 2015 Accepted 12 October 2015 Available online 23 October 2015

The enzyme gamma-interferon-inducible lysosomal thiol reductase (GILT) plays a role in facilitating the processing and presentation of major histocompatibility complex (MHC) class II-restricted antigens and is also involved in MHC I-restricted antigens in adaptive immunity catalyzing disulfide bond reduction in mammals. In this study, we cloned a GILT gene homolog from largemouth bass (designated ‘lbGILT’), a freshwater fish belonging to Perciformes and known for its nutritive value. We obtained the full-length cDNA of lbGILT by reverse transcription PCR and rapid amplification of cDNA ends. This cDNA is comprised of a 5'-untranslated region (UTR) of 87 bp, a 30 -UTR of 189 bp, and an open reading frame of 771 bp. It encodes a protein of 256 amino acids with a deduced molecular weight of 28.548 kDa and a predicted isoelectric point of 5.62. The deduced protein possesses the typical structural features of known GILTs, including an active site motif, two potential N-linked glycosylation sites, a GILT signature sequence, and six conserved cysteines. Tissue-specific expression of lbGILT was shown by real-time quantitative PCR. The expression of lbGILT mRNA was obviously up regulated in spleen and kidney after induction with lipopolysaccharide. Recombinant lbGILT was produced as an inclusion body with a His6 tag in ArcticExpress (DE3), and the protein was then washed, solubilized, and refolded. The refolded lbGILT showed reduction activity against an IgG substrate. These results suggest that lbGILT plays a role in innate immunity. © 2015 Elsevier Ltd. All rights reserved.

Keywords: cDNA cloning Gamma-interferon-inducible lysosomal thiol reductase Inclusion body Lipopolysaccharide Largemouth bass Real-time quantitative PCR

1. Introduction Gamma-interferon-inducible lysosomal thiol reductase (GILT) is expressed constitutively in antigen-presenting cells (APCs), including monocytes/macrophages, B cells, and bone marrowderived dendritic cells, and can be induced by interferon-g (IFNg) in other cells such as fibroblasts and endothelial cells [1]. The enzyme is a soluble glycoprotein that is synthesized as a precursor. After delivery into the endosomal/lysosomal system via the mannose-6-phosphate (M6P) receptor the N- and C-terminal prosequences are removed [2e4].

* Corresponding author. Jiangsu Province Key Laboratory for Molecular and Medical Biotechnology, Life Sciences College, Nanjing Normal University, Nanjing 210046, China. E-mail address: [email protected] (S. Zhang). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2015.10.018 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

In the complex process of antigen presentation, natural antigen is internalized by APCs and then modified and metabolized by enzymes in lysosomes to produce highly immunogenic proteins that are displayed on the cell surface in the form of optimal MHCbound complexes which are then recognized by T cell receptors triggering an immune response. Disulfide bond reduction is also important in this process [2,5]. In mammals, it has been shown that GILT is capable of catalyzing disulfide bond reduction and unfolding native protein antigens, facilitating their hydrolysis by proteases. Outside of the endocytic MHC pathway, GILT is also involved in regulating the cellular redox state, inhibiting T cell activation, and neutralizing extracellular pathogens, suggesting that it is also a host factor for some bacterial pathogens. It has been reported that GILT inhibition of T cells might be related to superoxide dismutase (SOD), in that the mechanism of reducing cell proliferation is mainly to increase the expression and activity of SOD, reduce active oxygen content, and ultimately regulate the redox state [6e8].

690

Q. Yang et al. / Fish & Shellfish Immunology 47 (2015) 689e696

Previous studies demonstrated that mice deficient in GILT (GILT/ mice) are grossly phenotypically normal, but their T cells exhibit reduced proliferation in response to hen egg lysozyme, RNAse A, and human immunoglobulin G (IgG), all proteins with cysteine residues and disulfide bonds [9]. Later research showed a potential role for GILT in the CD4 T cell response to myelin oligodendrocyte glycoprotein [10]. Recent studies have shown that GILT expression decreases in parallel with breast cancer development from normal to primary and metastatic cancers, while GILT expression increases after drug prevention, suggesting that GILT is an independent cancer prognostic factor [11,12]. Initially, GILT was discovered as a novel gamma-interferoninducible glycoprotein, described as IP30, in the human monocytic cell line U937 [1]. Human GILT, a 35 kDa precursor enzyme, is composed of 261 amino acids with a 37 amino acid signal peptide and is processed into the 28 kDa mature form, composed of 224 amino acids [3]. GILT proteins possess typical characteristics, including the active site CXXC motif, signature CQHGX2ECX2NX2EXC sequence, more than one putative Asn-linked glycosylation site, and 10 or 11 conserved cysteines. The mature form of GILT is localized in late endosomes and lysosomes, where it catalyzes disulfide bond reduction at an optimal acidic pH of 4.5e5.5, typically [3,13]. To date, the genes encoding human and mouse GILT have been cloned, and their functions have been determined [1,14]. In recent work, GILT in lower vertebrates, including the South African clawed frog, chicken [15], and fish such as zebrafish (Danio rerio) [16], amphioxus (Branchiostoma belcheri tsingtauense) [17], orange-spotted grouper (Epinephelus coioides) [18], yellow croaker (Pseudosciaena crocea) [19], and mandarin fish (Siniperca chuatsi) [20], has been characterized. Moreover, GILT has been investigated in some invertebrates. However, little is known about the features and functions in largemouth bass, a perciform fish commonly known as weever. In this study, we first cloned GILT cDNA from largemouth bass (designated lbGILT) using rapid amplification of cDNA ends (RACE), then we detected its distribution in different tissues and assessed lbGILT expression in response to lipopolysaccharide (LPS). Through gene recombination technology, we cloned lbGILT into the expression vector pET28a. Furthermore, the spheroid protein was purified by denaturation and renaturation and its thiol reductase activity was assessed.



2. Materials and methods 2.1. Animal, cell preparation, and tissue collection A largemouth bass, weighing approximately 500 g, was purchased at Xianlin fish market (Nanjing, China). Under sterile conditions, the spleen and kidney were dissected from freshly killed fish, disrupted, and filtered through 100-mm nylon mesh. Separated spleen and kidney cells were cultured in DMEM containing 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 mg/mL streptomycin at 25  C with 5% CO2 [15,20]. Once the concentration reached 105 cells/mL, the cells were treated with 10 mg/mL of LPS for 0, 2, 4, 8, 16, and 24 h. The cells at each time point were collected and lysed in TRIzol solution at 20  C for 5 min [17,20]. The heart, liver, gills, spleen, kidneys and intestines were removed aseptically, immediately snap-frozen in liquid nitrogen, and then stored at 80  C. The use of animals in this study was approved by the scientific ethics committee of Nanjing Normal University. 2.2. RNA isolation and cloning of the lbGILT full-length cDNA Total RNA in various tissues was extracted using TRIzol reagent following the manufacturer's protocol. First-strand cDNA was

synthesized using reverse transcriptase XL (AMV; Takara, Japan) according to a standard protocol. Then, a pair of primers, F1 and R1, targeting the middle sequence (Table 1) was designed based on homologous regions in mandarin fish, large yellow croaker and orange-spotted grouper GILT, analyzed using the DNAMAN (ver. 6.0) and Oligo 7.37 softwares. First, PCR was performed using the cDNA sample in a final reaction volume of 25 mL consisting of 1 mL of single-stranded cDNA, 2.5 mL of 10  LA PCR buffer, 1.5 mL of MgCl2, 2 mL of 2.5 mM dNTPs, 1 mL of F1 and R1, 15.75 mL of sterile water and 0.25 mL of LA Taq DNA polymerase. Then, PCR was conducted with an initial denaturation at 94  C for 5 min, followed by 35 cycles of 94  C for 30 s, 55  C for 30 s, 72  C for 1 min, and an elongation step at 72  C for 10 min, followed by cooling to 4  C until collection. The preliminarily identified PCR product was purified using a gel extraction kit (Promega, USA), cloned into the pMD19-T vector (Takara, Japan), and sequenced (Invitrogen, China). To obtain the 3'-untranslated region (UTR) of the lbGILT sequence, the specific primers 30 GSP1 (F2) and 30 GSP2 (F3) (Table 1) were designed, based on the obtained middle conserved sequence. In the 30 -RACE reaction, cDNA was synthesized using the 3'-full RACE core set (ver.2.0; Takara, Japan) according to the manufacturer's protocol. The first-round PCR was carried out in a final 50-mL volume, consisting of 2 mL of 3'-cDNA, 8 mL of cDNA dilution buffer II, 2 mL of 30 RACE outer primer from the kit, 2 mL of GSP1, 4 mL of 10  LA PCR buffer, 3 mL of MgCl2, 0.5 mL of Takara LA Taq and 28.5 mL of sterile water. The PCR product (1 mL) was diluted to 100 mL, and 2 mL were used as the template in the second-round PCR. The genespecific inner primer (30 GSP1) and the 30 RACE outer primer were replaced with 30 GSP2 and 30 RACE inner primer (R3; Table 1), respectively. Both reaction conditions were 94  C for 5 min, followed by 35 cycles of 94  C for 30 s, 55  C for 30 s, and 72  C for 1 min and then 72  C for 10 min. Next, the 50 -UTR of lbGILT was obtained using the gene-specific primers 50 GSP1 (R4) and 50 GSP2 (R5) (Table 1), designed based on the obtained upstream cDNA sequence. The cDNA was synthesized using a SMARTer RACE cDNA Amplification Kit (Clontech, Japan) according to the manufacturer's protocol. The first-round PCR was performed with 2 mL of 5'-cDNA, 5 mL of UPM from the kit, 2 mL of GSP1, 5 mL of 10  LA PCR buffer, 4 mL of dNTPs, 3 mL of MgCl2, 0.5 mL of Takara LA Taq and 28.5 mL of sterile water. Similarly, the PCR product was diluted to complete the second-round PCR. NUP (F5) (Table 1) and GSP2 were the specific primers used. Both reaction conditions were similar to those of 30 -RACE other than the annealing temperature of 57  C [21]. Next, the purified PCR products were gel-purified, cloned into pMD19-T vector and sequenced. Based on the sequences obtained, the primers F6 and R6 (Table 1) were used to obtain the coding sequence (CDS) of the lbGILT gene. The PCR product was purified, cloned into the pMD19T vector, and sequenced. Ultimately, the full nucleotide sequence was derived from eight independent clones. 2.3. Bioinformatics analysis DNAstar software (ver. 7.1) was used to deduce the lbGILT amino acid sequence. Sequence similarities between the protein lbGILT and its known counterparts in GenBank were assessed using the BLAST program (http://blast.ncbi.nlm.nih.gov/). The signal peptide of the lbGILT precursor protein was deduced using the SignalP 4.1 server (http://www.cbs.dtu.dk/services/SignalP/). The isoelectric point of lbGILT was deduced using the Expert Protein Analysis System (http://www.expasy.org/). Multiple alignments of the lbGILT sequences were performed using ClustalX (ver. 1.83). A phylogenetic tree was constructed using the MEGA program (ver. 4) and the neighbor-joining method with 1000 bootstraps, based on the alignment of amino acid sequences [22]. The predicted three-

Q. Yang et al. / Fish & Shellfish Immunology 47 (2015) 689e696

691

Table 1 Primer sequence used in this study. Primer

Nucleotide sequence(50 -30 )

Application

F1 R1 30 GSP1(F2) 30 GSP2(F3) R3 50 GSP1(R4) 50 GSP2(R5) NUP(F5) F6 R6 QF(F7) QR(R7) F8 R8 F9 R9

CGCTCTCTCTACATGCTCCC GGCTTGGGGCCTTGTACAT GTGACCATTAATGGGGAGCACACAG GCAGTATGTACAAGGGCCCCAAGCC CGCGGATCCTCCACTAGTGATTTCACTATAGG CCCCGCACTGGATCGCTGAGTCCAGAG GGAGCACCACTGTGACGGAGGATGGGAGC AAGCAGTGGTATCAACGCAGAGT ATGAAGGTCCCCCTGCTGC TCAATCATTGTGGCAGTAGCTT CCTACCTGGGTCTTGCTGAAT ACACAGGTCTTGGCTTCCTTG CAGGATGCAGAAGGAGATCAC CTCCTGCTTGCTGATCCAC CGCGGCAGCCATATGCTCTCTACATGCTCCCATCC GTGGTGGTGCTCGAGTCAATCATTGTGGCAGTAGC

Obtain middle Sequence

dimensional (3D) structure of lbGILT was assessed by comparative protein structure modeling on the Phyre2 server (http://www.sbg. bio.ic.ac.uk/phyre2/html/), then visualized and manipulated using the Python 2.7 program [23].

2.4. Quantification of lbGILT expression in different tissues Total RNA from tissues was extracted as described above. The measured concentration of RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (Takara, Japan) for real-time quantitative PCR (qRT-PCR) according to a standard protocol. The specific primers QF (F7) and QR (R7) (Table 1), designed based on the CDS of lbGILT, were used to amplify a 230 bp fragment. In this work, largemouth bass b-actin was chosen as an internal control to verify the reliability of the results using qRT-PCR. F8 and R8 (Table 1) were used to amplify a 151 bp fragment of b-actin cDNA. Real-time qPCR was performed using SYBR Premix Ex Taq (Takara, Japan) under the following conditions: 94  C for 3 min, followed by 40 cycles of 94  C for 30 s, 60  C for 30 s, 72  C for 30 s, with a final extension step at 72  C for 10 min. All assays were performed in triplicate, and DEPC-treated water was used to replace the cDNA template as a negative control. The SYBR Green real-time qPCR assay was carried out in an ABI PRISM 7500 Sequence Detection System (Applied Biosystems, USA) to investigate the expression profile of lbGILT. Results were determined by the 2-DDCT method to quantify lbGILT expression in different tissues [20].

2.5. Construction of the pET28a-lbGILT expression vector The expression vector pET28a-lbGILT was obtained using a onestep cloning kit (Vazyme, USA). A pair of specific primers (F9 and R9) (Table 1) was designed to amplify a restriction enzymedigested PCR fragment containing the same sequence as the vector and the full-length open reading frame (ORF) without the native signal peptide. PCR was carried out using Pfu DNA polymerase. The reaction conditions were as follows: 94  C for 5 min, followed by 30 cycles of 94  C for 30 s, 55  C for 30 s, and 72  C for 1 min, and then 72  C for 10 min. Following the one-step cloning kit protocol, the expression vector was digested with NedI and XhoI, and then the PCR product was recombined with linearized pET28a using ExnaseII to express a fusion protein with a His6 tag. The recombinant plasmid was named lbGILT, and stored at 20  C for subsequent protein expression.

30 RACE

50 RACE

CDS of lbGILT qPCR for lbGILT qPCR for b-actin GILT for expression

2.6. Expression and purification of recombinant lbGILT The recombinant plasmid described above was transformed into Arctic Express (DE3) competent cells. A selected single colony was cultured in Luria Broth medium with vigorous shaking at 200 rpm and 37  C. Isopropyl-beta-D-thiogalactopyranoside (IPTG) was added to the medium to induce expression yields of the GILT protein. IPTG was added to a final concentration of 0.2 mM when the optical density of the culture (OD600) reached ~0.6. The bacteria were harvested by centrifugation (8000 rpm, 10 min), resuspended in phosphate-buffered saline (PBS), and recentrifuged (8000 rpm, 10 min) [24]. After ultrasonication, the supernatant and sediment were collected after centrifugation (10000 rpm, 20 min, 4  C). The target protein was determined to be in an inclusion body using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE). Next, the sediment was resuspended in washing buffer (10 mM TriseHCl, 10 mM EDTA, 8 g/L NaCl, 5‰ Triton X-100, and 2 M carbamide), and centrifuged (12000 rpm 20 min, 4  C). This procedure was repeated three times, then the sediment was washed with PBS and denatured with 8 M carbamide to ensure that the denatured protein was in the supernatant. To recover the active protein, the supernatant was added to renaturation buffer (0.6 M arginine) and incubated for 24 h at 4  C. Then, the target protein was purified using His-Bind Columns (Qiagen, Germany) according to the manual, and dialyzed in PBS plus 5% glycerin for 48 h at 4  C. The purified protein was verified by SDS-PAGE and the protein bands were visualized with Coomassie brilliant blue R-250 staining. Finally, the expression of His6-tagged lbGILT was identified by Western blotting using an anti-His6-tag mouse antibody (Invitrogen, USA) [20]. 2.7. Thiol reductase activity of the purified lbGILT protein in vitro According to a protocol for thiol reductase activity described previously, the activity of lbGILT was determined. Affinity-purified human IgG antibody (Solarbio, China) was denatured by boiling for 5 min in 0.2% SDS and then diluted in 50 mM NaCl with 0.1% Triton X-100. Purified recombinant lbGILT was added to 100 mM NaCl with 50 mM acetate and 0.1% Triton X-100 (pH 4.5) to a volume of 100 mL, and then preactivated with 25 mM freshly prepared dithiothreitol (DTT) at 37  C for 10 min. Subsequently, 10 mL of denatured IgG were co-incubated with 100 mL of previously activated lbGILT at 37  C for 1 h. Human IgG treated with DTT was used as a positive control. Following termination of the reaction by adding 5  non-reducing SDS loading buffer to the reaction system,

692

Q. Yang et al. / Fish & Shellfish Immunology 47 (2015) 689e696

the reduction of IgG into heavy (H) and light (L) chains was analyzed by non-reducing SDS-PAGE [15,19,20]. 3. Results 3.1. Identification and sequence analysis of the lbGILT cDNA A 643 bp cDNA fragment with high sequence similarity to mammalian and piscine GILTs was obtained by RT-PCR performed using the F1 and R1 primers. Then, using 30 /50 -RACE approaches, a 160 bp upstream and a 244 bp downstream fragments were obtained. The full-length cDNA of lbGILT included a 50 -UTR of 87 bp, an ORF of 771 bp, and a 30 -UTR of 189 bp. The 771 bp ORF encoded a protein of 256 amino acids, with a calculated with a molecular mass of 28.548 kDa and a predicted isoelectric point of 5.62. Sequence analysis indicated that all of the main characteristics of known GILTs were represented in the deduced lbGILT amino acid sequence, including an active site CXXC motif at residues 73e76, the signature sequence CQHGX2ECX2NX4C spanning residues 118e133, and six conserved cysteines at residues 147, 161, 178, 231, 242, and 253 that formed disulfide bonds. Prediction results indicated that the deduced lbGILT had two potential N-linked glycosylation sites, NFT and NMT. There was also a putative signal peptide consisting of 21 amino acids at the N-terminus, which is considered necessary for transportation of GILT to the lysosomal system (Fig. S1). 3.2. Sequence comparison and phylogenetic analysis Using the ClustalX (ver. 1.83), the multiple alignment result showed that the deduced lbGILT had strong amino acid conservation with other known GILT amino acid sequences (Fig. 1). To further determine the homology between the deduced lbGILT and the sequences of other species, amino acid sequences were analyzed using BLASTX. The BLASTX results showed that GILT of largemouth bass had the highest identity to that of mandarin fish (86%), barred knifejaw (84%), orange-spotted grouper (77%), and large yellow croaker (74%), and shared 31e68% identity with other known GILT sequences (Table S1). Additionally, to evaluate the genetic evolutionary relationship among species, a phylogenetic tree was constructed using MEGA4.0. The tree demonstrated the evolutionary position of lbGILT with respect to 18 known GILTs (Fig. 2). The 3D structures of GILT of several species were predicted by comparative modeling using the crystal structures of disulfide oxidoreductase BdbD (PDB no. 3GHA) as a template. The predicted 3D structure revealed similarities between lbGILT and its human, mouse, and mandarin fish counterparts (Fig. S2), further suggesting that lbGILT has similar biological functions to mandarin fish GILT in vivo. The crystal structure of functional lbGILT revealed that it has hydrophobic plot functional regions (signature sequence and CXXC motif) similar to human, mouse, and mandarin fish GILT, and that the important structural amino acids were conserved in the same spatial positions [23]. Some differences among the 3D structures were also noted, including non-functional domains and signal peptide domains. 3.3. Expression analysis of lbGILT by real-time qPCR The expression of lbGILT in heart, gill, liver, spleen, kidney and intestine was analyzed by quantitative real-time PCR. Amplification of b-actin was performed as an internal control in all reactions. Real-time quantitative PCR showed high-level expression in the spleen (11.7-fold) and kidney (7.2-fold), and relatively lower levels in the heart, liver, intestine, and gill. These data indicated that

lbGILT is expressed in a tissue-specific manner (Fig. 3). Previous studies have shown that GILT is gamma-interferoninducible in mammals, and LPS obtained from Gram-negative bacteria acts as a mitogen, inducing IFN-g gene expression. Thus, LPS can induce the expression of lbGILT indirectly. In this study, the spleen and kidney cells of largemouth bass were incubated with LPS for 0, 2, 4, 8, 12, 16, and 24 h in vitro. lbGILT expression was significantly up regulated compared with the control group after LPS stimulation (Fig. 4). The results show that treatment with LPS for 16 h induced the expression of lbGILT by 44.1-fold and 25.1-fold in the spleen and kidney, respectively (Fig. 4). These results suggest that lbGILT is involved in the immune response to a bacterial challenge in largemouth bass. 3.4. Construction, expression and purification of recombinant lbGILT lbGILT cDNA without the signal peptide was cloned into the NdeI and XhoI sites of the pET28a plasmid. The obtained pET28a-lbGILT construct is shown in Fig. S3. To express the lbGILT recombinant protein, the pET28a-lbGILT plasmid obtained above was transformed into Escherichia coli Arctic Express (DE3) cells, and then the recombinant protein was efficiently expressed and purified under optimal conditions. By SDS-PAGE analysis, a 26.4 kDa band, corresponding to the presumptive size of the recombinant protein, was clearly observed after IPTG induction (Fig. 5, lane 2). The recombinant protein was found mostly in the precipitate (Fig. 5, lane 4). The purified protein was observed at ~26.4 kDa. The identity of the purified protein was determined using an anti-His6 mouse monoclonal antibody (Invitrogen, USA). Western blot analysis indicated that the protein expressed in bacteria corresponded to a predominant band with a predicted molecular weight of 26.4 kDa (Fig. 5, lane 5). 3.5. Identification of lbGILT activity The thiol reductase activity of lbGILT was evaluated using IgG H and L chains as a substrate. The obtained lbGILT protein and DTT as a positive control were incubated with denatured IgG at 37  C for 1 h. The sample without lbGILT or DTT served as a negative control. The reduction of IgG into H and L chains was analyzed by nonreducing SDS-PAGE. lbGILT could reduce IgG into H and L chains, and the reduction occurred at pH 4.5 (Fig. 6, lane 3). The result indicates that lbGILT exhibits thiol reductase activity in an acidic environment. 4. Discussion Previous studies have reported the gene structure and function of GILT in vertebrates, especially fishes such as large yellow croaker, orange-spotted grouper, zebrafish, mefugu [25], rainbow trout [26], mandarin fish, and goldfish. Although studies on invertebrate GILTs are limited, an echinoderm GILT gene from the sea cucumber (Stichopus monotuberculatus) has been cloned [27,28]. To learn more about fish family genes, the cDNA sequence of GILT from largemouth bass was determined in this study. The full-length cDNA of lbGILT consisted of 1047 bp, with a 771 bp ORF encoding a protein of 256 amino acids. According to our analysis, many typical structural features of GILTs are present in the deduced lbGILT amino acid sequence, including a GILT active site CXXC motif, a signature sequence (CQHGX2ECX2NX4C), and six conserved cysteines in the C-terminus. It has been reported that the active site, determined by mutagenesis, consists of a pair of cysteine residues separated by

Q. Yang et al. / Fish & Shellfish Immunology 47 (2015) 689e696

693

Fig. 1. Alignment of the deduced amino acid sequence of lbGILT with other known GILTs. Amino acids identical among all sequences are shown by “*”, while those with high or low similarity are indicated by “:” and “.” respectively. The active site motif of CXXC and the GILT signature sequences are boxed. The six conserved cysteine residues are marked by gray shading. The abbreviations are largemouth bass, lb; mandarinfish, mf; orange-spotted grouper, os; large yellow croaker, ly; nile tilapia, nt; zebrafish, ze; goldfish, go; african clawed frog, ac; amphioxus, am; human, hu; mouse, mo.

694

Q. Yang et al. / Fish & Shellfish Immunology 47 (2015) 689e696

Fig. 2. Phylogenetic tree showing the relationship between the lbGILT amino acid sequence and other known GILT sequences. The tree was constructed by the neighborjoining method using the MEGA4.0 program. The GenBank accession numbers used are listed in Supplement Table.S1.

two amino acids, similar to other enzymes of the thioredoxin family. Previous research has shown that the cysteines in human GILT are essential for the maintenance of structure and function. The mutation of either or both cysteines in the active-site CXXC will abolish the thiol reductase activity of GILT [2]. Moreover, lbGILT, like other known species, possesses two potential N-linked glycosylation sites, implying that it could be derivatized with M6P which has been considered essential for the transportation of GILT to lysosomes. Finally, lbGILT also has a predicted signal peptide consisting of 21 amino acids at the N-terminus. As shown in Fig. 1, sequence

Fig. 3. Expression of lbGILT gene in different tissues. Mean mRNA levels were analyzed by real-time qPCR to show the difference in heart (1-fold), gill (4.1-fold), liver (2.7fold), spleen (11.7-fold), kidney (7.2-fold) and intestine (3.0-fold) expression levels. Data are presented as 2-DDCT levels calculated relative to levels in the tissue with lowest expression (heart), set to 1, and normalized to b-actin mRNA levels. Vertical bars indicate the mean SD (n ¼ 3).

alignments indicated that lbGILT is highly conserved in amino acid sequence between bony fish and mammals; in particular, largemouth bass GILT, mandarin fish GILT, and barred knifejaw GILT are highly similar, suggesting that they have similar functions in immunology. To further understand the role of lbGILT in phylogenetic and molecular evolution, a phylogenetic tree was constructed using other known GILT amino acid sequences (Fig. 2). The 3D protein structures indicated that the functional domains of largemouth bass, mandarin fish, mouse, and human GILT are similar. Other experiments verified that lbGILT has a similar function to GILTs from other animals. GILT is expressed significantly in active APCs, such as B lymphoblastoid cell lines, monocytic cell lines and primary human monocytes, colocalizing with intracellular MHC class II molecules. Previous studies showed that GILT mRNA was detected in heart, liver, gill, spleen, kidney and intestine in some bony fish (large yellow croaker, orange-spotted grouper, zebrafish, mefugu, rainbow trout, mandarin fish and goldfish) and in chicken. Real-time qPCR analysis showed that lbGILT was constitutively expressed in all tissues examined, with high mRNA levels observed in fish-related immune organs (spleen and kidney) and lower levels in other tissues (Fig. 3), indicating that the expression pattern of the GILT gene is well conserved in bony fish and mammals. Additionally, it has been reported that GILT is induced by IFN-g via signal transducer and activator of transcription. In this study, LPS was used to induce IFN-g gene expression and found to directly upregulate the mRNA levels in spleen and kidney, consistent with the role of GILT in the MHC class II antigen processing pathway. These results indicate that lbGILT may be involved in the immune response against an intracellular bacterial challenge in largemouth bass. To obtain recombinant lbGILT protein, we ligated the ORF of lbGILT into pET28a plasmid, with the signal peptide removed, and expressed the construct in E. coli. The localization of lbGILT in inclusion bodies was determined by SDS-PAGE. Then, Western blot analysis revealed that lbGILT purified from E. coli corresponded with a band having an estimated molecular mass of 26.4 kDa. Recent findings have revealed that GILT is capable of catalyzing the reduction of the interchain disulfide bonds of intact IgG, and mutation of either or both of the two putative active-site cysteines abolishes this activity. Thus, IgG was used to detect the activity of lbGILT protein. As shown in Fig. 6, lbGILT could reduce IgG (150 kDa) into H (55 kDa) and L (25 kDa) chains, and the reduction occurred at pH 4.5 (lane 2). However, the lbGILT band was observed below that corresponding to the L chains; the cause of this decrease in mass may be the dissociation of individual amino acids from a nonfunctional area. Simultaneously, IgG treated with DTT was used as a positive control. Previous experiments reported that the reducing power of DTT is limited at pH values above 7 because only the thiolate form is reactive [20,23]. Compared with thioredoxin, which is more efficient at neutral pH, GILT has maximal reductase activity at an acidic pH, consistent with its function being mediated in late endocytic compartments and lysosomes. This purified recombinant lbGILT will allow for further investigation into the role of this key enzyme in the MHC class II-restricted antigen processing pathway. To date, studies have demonstrated that GILT is an essential part of the immune system. Recent studies have shown that GILT plays a key role in several malignant diseases, such as breast cancer. Related experiments demonstrated that the absence of GILT was positively correlated with adverse characteristics of breast cancers, such as histological type, tumor size, lymph node status, and pTNM stage [12]. Other studies identified a novel association between GILT expression and clinical outcome in lymphoma [29]. Also, a new report demonstrated that a sea cucumber extract could prevent intestinal tumorigenesis by increasing innate immunity in mice, which involved increased GILT mRNA expression [11].

Q. Yang et al. / Fish & Shellfish Immunology 47 (2015) 689e696

695

Fig. 4. Expression of lbGILT gene in spleen and kidney after LPS and PBS stimulation. (a) Temporal expression level of lbGILT in spleen after LPS stimulation; (b) Temporal expression level of lbGILT in kidney after LPS stimulation. Values are presented as means (vertical bars) (n ¼ 3).

In conclusion, we report for the first time the full-length cDNA of largemouth bass GILT and analyzed its sequence and structure. Additionally, the amino acid sequence alignment, tissue-specific upregulation of lbGILT expression in response to LPS and enzymatic activity suggest that lbGILT is a functional homolog of other GILTs. Moreover, we described the expression pattern, purification method, and bioactivity of lbGILT. The results presented here will be helpful for elucidating the MHC class II-restricted antigen processing pathway in bony fish, and largemouth bass may be useful as an animal model for further study to investigate the role of GILT in vivo, especially its antitumor activity.

Fig. 6. Largemouth bass GILT exhibits thiol reductase activity in vitro. The samples were resolved on 15% SDS-PAGE under reducing conditions and stained with Coomassie brilliant blue R-250. M, protein MW marker; lane 1, denatured purified human IgG as negative control; lane 2, human IgG treated with DTT as positive control;lane 3, preactivated lbGILT incubated with human IgG at pH 4.5; lane 4, purified lbGILT.

Conflicts of interest Fig. 5. SDS-PAGE analysis of the recombinant lbGILT protein expressed in E. coli ArcticExpress (DE3). Protein was resolved on 12% SDS-PAGE under reducing conditions and stained with Coomassie brilliant blue R-250. M, protein MW marker; lane 1, lysates of transformed bacteria without induction; lane 2, lysates of transformed bacteria after induction with 0.2 mM IPTG; lane3, supernatant after ultrasonication; lane 4, sediment after ultrasonication. lane 5, purified protein by Ni-NTA affinity chromatography; lane 6, Western blot analysis of recombinant lbGILT using anti-His6 tag mouse antibody.

The authors declare no conflicts of interest. Acknowledgments This work was funded by grants from the National Natural Science Funds, P.R. of China (No. 30270193), the Research Fund for the

696

Q. Yang et al. / Fish & Shellfish Immunology 47 (2015) 689e696

Doctoral Program of Higher Education (RFDP) (No. 200803160002), and the Sciences Foundation of Jiangsu province (No. BK2005140). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.10.018. References [1] A.D. Luster, R.L. Weinshank, R. Feinman, J.V. Ravetch, Molecular and biochemical characterization of a novel gamma-interferon-inducible protein, J. Biol. Chem. 263 (1988) 12036e12043. [2] D.S. Collins, E.R. Unanue, C.V. Harding, Reduction of disulfide bonds within lysosomes is a key step in antigen processing, J. Immunol. 147 (1991) 4054e4059. [3] B. Arunachalam, U.T. Phan, H.J. Geuze, P. Cresswell, Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferoninducible lysosomal thiol reductase (GILT), Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 745e750. [4] R.L. Lackman, A.M. Jamieson, J.M. Griffith, H. Geuze, P. Cresswell, Innate immune recognition triggers secretion of lysosomal enzymes by macrophages, Traffic 8 (2007) 1179e1189. [5] K.T. Hastings, GILT: shaping the MHC class II-restricted peptidome and CD4(þ) T cell-mediated immunity, Front. Immunol. 4 (2013) 429. [6] B. Bogunovic, M. Stojakovic, L. Chen, M. Maric, An unexpected functional link between lysosomal thiol reductase and mitochondrial manganese superoxide dismutase, J. Biol. Chem. 283 (2008) 8855e8862. [7] W.S. Huang, L.P. Duan, B. Huang, L.H. Zhou, Y. Liang, C.L. Tu, et al., Identification of three IFN-gamma inducible lysosomal thiol reductase (GILT)-like genes in mud crab Scylla paramamosain with distinct gene organizations and patterns of expression, Gene 570 (1) (2015) 78e88. [8] Rausch MP,Hastings KT, Diverse cellular and organismal functions of the lysosomal thiol reductase GILT, Mol. Immunol. (2015) pii: S0161-5890(15) 00432e0. [9] M. Maric, B. Arunachalam, U.T. Phan, C. Dong, W.S. Garrett, K.S. Cannon, et al., Defective antigen processing in GILT-free mice, Science 294 (2001) 1361e1365. [10] C.M. Bergman, C.B. Marta, M. Maric, S.E. Pfeiffer, P. Cresswell, N.H. Ruddle, A switch in pathogenic mechanism in myelin oligodendrocyte glycoproteininduced experimental autoimmune encephalomyelitis in IFN-gammainducible lysosomal thiol reductase-free mice, J. Immunol. 188 (2012) 6001e6009. [11] N.B. Janakiram, A. Mohammed, T. Bryant, S. Lightfoot, P.D. Collin, V.E. Steele, et al., Improved innate immune responses by Frondanol A5, a sea cucumber extract, prevent intestinal tumorigenesis, Cancer Prev. Res. 8 (2015) 327e337. [12] Y.J. Xiang, M.M. Guo, C.J. Zhou, L. Liu, B. Han, L.Y. Kong, et al., Absence of gamma-interferon-inducible lysosomal thiol reductase (GILT) is associated with poor disease-free survival in breast cancer patients, PloS One 9 (2014) e109449. [13] U.T. Phan, B. Arunachalam, P. Cresswell, Gamma-interferon-inducible lysosomal thiol reductase (GILT). Maturation, activity, and mechanism of action, J. Biol. Chem. 275 (2000) 25907e25914. [14] U.T. Phan, M. Maric, T.P. Dick, P. Cresswell, Multiple species express thiol

oxidoreductases related to GILT, Immunogenetics 53 (2001) 342e346. [15] L. Yang, X. Cao, X. Ji, H. Liu, H. Wu, W. Gu, et al., Molecular structure, tissue distribution and functional characterization of interferon-gamma-inducible lysosomal thiol reductase (GILT) gene in chicken (Gallus gallus), Veterinary Immunol. Immunopathol. 153 (2013) 140e145. [16] X.W. Cui, C.B. Ji, X.G. Cao, Z.Y. Fu, S.Q. Zhang, X.R. Guo, Molecular and biological characterization of interferon-g-inducible-lysosomal thiol reductase gene in zebrafish (Danio rerio), Fish Shellfish Immunol. 33 (5) (2012) 1133e1138. [17] N. Liu, S. Zhang, Z. Liu, S. Gaowa, Y. Wang, Characterization and expression of gamma-interferon-inducible lysosomal thiol reductase (GILT) gene in amphioxus Branchiostoma belcheri with implications for GILT in innate immune response, Mol. Immunol. 44 (2007) 2631e2637. [18] W.B. Dan, F. Ren, C. Zhang, S.Q. Zhang, Molecular cloning and expression analysis of interferon-gamma-inducible-lysosomal thiol reductase gene in orange-spotted grouper, Epinephelus coioides, Fish Shellfish Immunol. 23 (2007) 1315e1323. [19] W. Zheng, X. Chen, Cloning and expression analysis of interferon-gammainducible-lysosomal thiol reductase gene in large yellow croaker (Pseudosciaena crocea), Mol. Immunol. 43 (2006) 2135e2141. [20] J. Song, H. Liu, L. Ma, L. Ma, C. Gao, S. Zhang, Molecular cloning, expression and functional characterization of interferon-gamma-inducible lysosomal thiol reductase (GILT) gene from mandarin fish (Siniperca chuatsi), Fish Shellfish Immunol. 38 (2014) 275e281. [21] J.X. Zhang, R. Song, M. Sang, S.Q. Sun, L. Ma, J. Zhang, S.Q. Zhang, Molecular and functional characterization of BAFF from the Yangtze alligator (Alligator sinensis, Alligatoridae), Zoology (Jena) 118 (5) (2015) 325e333. [22] K. Tamura, J. Dudley, M. Nei, S. Kumar, MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0, Mol. Biol. Evol. 24 (8) (2007) 1596e1599. [23] J.F. Li, J. Li, Z.G. Wang, H.Z. Liu, Y.L. Zhao, J.X. Zhang, et al., Identification of interferon-gamma-inducible-lysosomal thiol reductase (GILT) gene in goldfish (Carassius auratus) and its immune response to LPS challenge, Fish shellfish Immunol. 42 (2015) 465e472. [24] V. Babaeipour, S. Khanchezar, M.R. Mofid, M. Pesaran Hagi Abbas, Efficient process development of recombinant human granulocyte colony-stimulating factor (rh-GCSF) production in Escherichia coli, Iran. Biomed. J. 19 (2015) 102e110. [25] M. Liu, H. Ai, W. Xiao, Y. Shen, Y. Shen, X. Cui, et al., Identification of interferon-g-inducible-lysosomal thiol reductase (GILT) gene from Mefugu (Takifugu obscures) and its immune response to LPS challenge, Dev. Comp. Immunol. 41 (2) (2013) 120e127. [26] M. Liu, H. Liu, X. Guan, H. Ai, H. Wu, P. Liu, et al., Characterization and expression of gamma-interferon-inducible lysosomal thiol reductase (GILT) gene in rainbow trout (Oncorhynchus mykiss) with implications for GILT in innate immune response, Immunogenetics 65 (12) (2013) 873e882. [27] K. Kongton, K. McCall, A. Phongdara, Identification of gamma-interferoninducible lysosomal thiol reductase (GILT) homologues in the fruit fly Drosophila melanogaster, Dev. Comp. Immunol. 44 (2) (2014) 389e396. [28] C. Ren, T. Chen, X. Jiang, X. Luo, Y. Wang, C. Hu, The first echinoderm gammainterferon-inducible lysosomal thiol reductase (GILT) identified from sea cucumber (Stichopus monotuberculatus), Fish Shellfish Immunol. 42 (2015) 41e49. [29] H. Phipps-Yonas, H. Cui, N. Sebastiao, P.S. Brunhoeber, E. Haddock, M.J. Deymier, et al., Low GILT expression is associated with poor patient survival in diffuse large B-cell lymphoma, Front. Immunol. 4 (2013) 425.