Molecular systematics and evolution in an African cycad-weevil interaction: Amorphocerini (Coleoptera: Curculionidae: Molytinae) weevils on Encephalartos

Available online at www.sciencedirect.com

Molecular Phylogenetics and Evolution 47 (2008) 102–116 www.elsevier.com/locate/ympev

Molecular systematics and evolution in an African cycad-weevil interaction: Amorphocerini (Coleoptera: Curculionidae: Molytinae) weevils on Encephalartos D.A. Downie a,*, J.S. Donaldson b, R.G. Oberprieler c a

Department of Zoology and Entomology, Rhodes University, P.O. Box 94, Grahamstown, Eastern Cape 6140, South Africa b South African National Biodiversity Institute, Kirstenbosch Botanic Gardens, Claremont, South Africa c CSIRO, Black Mountain ACT 2601, Australia Received 20 April 2007; revised 21 November 2007; accepted 22 January 2008 Available online 31 January 2008

Abstract Weevils in the tribe Amorphocerini have been implicated in pollination of Encephalartos species in southern Africa. The services they render these plants and the unique attributes of the cycad-weevil interaction make them important from both conservation and evolutionary standpoints. Oberprieler [Oberprieler, R.G., 1996. Systematics and evolution of the tribe Amorphocerini, with a review of the cycad weevils of the world. Ph.D. dissertation, University of the Free State, Bloemfontein, South Africa], using morphological characters, proposed a tentative hypothesis of relationships among the Amorphocerini which is tested here using DNA sequence data. Sequences from one mitochondrial and three nuclear genes were used to infer phylogenetic relationships, levels of sequence divergence, evolution of host associations, and patterns of speciation in this tribe. The results are reasonably consistent with the morphological hypothesis of relationships and species concepts, though important differences are observed, particularly in relationships among a Porthetes hispidus Boheman species group, which is indicated to have experienced recent divergences. In general, low levels of sequence divergence among species within two of the three genera indicate a recent radiation of this tribe onto African cycads, thus while cycad–insect interactions have often been considered ancient this may not be the case for some extant interactions. A complex pattern of host shifts onto both closely related and more distantly related hosts is suggested. Ó 2008 Elsevier Inc. All rights reserved. Keywords: Africa; Coleoptera; Cycads; Host shifts; Plant–insect interactions; Pollination mutualisms; Zamiaceae

1. Introduction The observation of closely related herbivorous insects on closely related or chemically similar host plant taxa (Ehrlich and Raven, 1964; Beccera, 1997; Futuyma et al., 1995; Funk et al., 2002) suggests a causal link between plant diversity and insect diversity. Evolutionary interactions between plants and the parasitic insects that feed on them may lead to tandem diversification, or cospeciation, but more often the pattern observed has been asymmetric with insects diversifying through host shifts to related or *

Corresponding author. Fax: +27 046 622 8959. E-mail address: [email protected] (D.A. Downie).

1055-7903/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2008.01.023

chemically similar host plants (Jaenike, 1990; Percy et al., 2004). Host shifts onto more distantly related hosts may be constrained by a lack of genetic variation enabling such shifts (Futuyma et al., 1995). Host shifts occur in a geographic context as well as a taxonomic one - shifts may occur onto sympatric hosts, an event that is considered to be a potential source of ecological speciation in the face of gene flow (Schluter, 2001; Funk et al., 2002), or onto allopatric hosts. Indeed, phytophagous insects continue to play a pivotal role in the controversy over the relative importance of sympatric versus allopatric speciation. Thus, the evolutionary history of specialized herbivorous insects and their host plant associations offers an attractive arena to explore the pattern and causes of diversification.

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

The majority of studies in evolution of plant–insect interactions have justifiably involved angiosperms, but a number of extremely interesting interactions exist between insects and gymnosperms (Sequeira et al., 2000; Sequeira and Farrell, 2001; Farrell et al., 2001). One of these is the interaction between cycads and the beetles (Coleoptera), particularly weevils (Curculionoidea) that are associated with their reproductive structures. Extant cycads (Cycadales) are long-lived woody plants and descendants of a lineage that extends well into the Mesozoic (Norstog and Nichols, 1997). Feeding on cycad reproductive structures by a relatively small group of cycad-specific beetles (Curculionoidea and Cucujoidea) in several different parts of the world, coupled with fossil evidence of insect damage in cycadaeoids, initially led to the conclusion that at least some of the current associations are derived from ancient cycad–insect interactions (Crowson, 1981; Norstog and Nichols, 1997). Diversification of beetles and cycads in different centres of cycad diversity after the breakup of the Gondwanan and Laurasian supercontinents was thought to be the result of co-evolutionary processes acting on these ancient interactions. Subsequent studies of the beetles associated with cycads in the main centres of cycad diversity (South, Central, and North America; Africa; south-east Asia; Australia) indicate that cycad beetles from different centres are not closely related and that novel cycad–insect interactions have evolved independently in each region (Oberprieler, 2004). Moreover, studies of beetles and thrips associated with Australian cycads show that different insect pollinator mutualisms have evolved among apparently closely related cycads (Terry et al., 2004) suggesting that cycad insect interactions are more dynamic than was previously postulated. This study focuses on the evolution of the Amorphocerini, a tribe in the weevil family Curculionidae that is endemic to Africa and is found exclusively on cycads in the genus Encephalartos (Zamiaceae). Encephalartos is endemic to Africa where it occurs mostly along the eastern escarpment from South Africa to Sudan but also ranges into central and West Africa. There are approximately 65 described species of Encephalartos in Africa, of which 37 species occur in South Africa (30 endemics), mostly in the provinces of the Eastern Cape and KwaZulu Natal (Norstog and Nichols, 1997; Donaldson, 2003; Hill et al., 2007). In spite of retaining a morphology relatively unchanged from their ancient ancestors, extremely low levels of DNA sequence divergence among Encephalartos species suggest that the genus has undergone a recent radiation (Treutlein et al., 2005). The Amorphocerini consists of at least 25 species in two described genera; Amorphocerus Schoenherr and Porthetes Schoenherr (Oberprieler, 1995, 1996), and one formally undescribed genus (Oberprieler, 1996). The latter genus (labelled Propor in this paper) is monotypic, its single species having been collected rarely owing to its concealed location within old leaf stalks. It has only been found in two closely adjacent locations on Encephalartos

103

princeps in the Eastern Cape of South Africa. Seven species of Amorphocerus are known, all but one of which, prior to the current study, have been associated most often with the female cones of Encephalartos species in the Eastern Cape (Oberprieler, 1996). Amorphocerus setosus Boheman feeds on old leaf bases that compose the outer trunk of most cycads. Amorphocerus species have been collected to the north of this province only in NWKwaZulu Natal (one species) and in Zimbabwe (one undescribed species) (Oberprieler, 1996; R. G. Oberprieler, personal observations). Porthetes has at least 18 species (two of which have been found for the first time during the course of this study) and has been collected as far north as Kenya though most species are known from South Africa, particularly the Eastern Cape. Feeding damage typical of Porthetes, but possibly caused by another insect, has been found on three Encephalartos species in Kenya and Tanzania (E. bubalinus, E. kisambo, and E. tegulaneus ssp. tegulaneus) though the insects have not been found on these (Donaldson, 1999; D.A. Downie, personal observations). Thus the bias in the distribution is almost certainly at least in part an artifact of sampling effort and has serious implications for understanding the systematics and ecology of these weevils and the pollination biology in Encephalartos. Alternative hypotheses to explain the disjunct distributions in Porthetes are that extant species are relictual and intervening populations have become extinct, which predicts substantial divergence between the surviving species if the extinctions occurred very long ago, or that long-distance dispersal or more recent extinction is involved. Porthetes species generally develop in male cones but visit female cones and have been implicated in pollination of at least one Encephalartos species (Donaldson, 1997). In exclusion and observational experiments to determine the relative roles of wind and the suite of insects associated with E. villosus, Donaldson found both that wind played little role in pollination and that Porthetes. sp. n. 6 had a greater abundance, carried larger pollen loads, and carried pollen to more micropyles of ovules than any of the other insects found at the time of pollination, making it the most effective pollinator for this cycad. All Porthetes have similar morphologies, such as grooved elytra and a dense covering of setae that could be effective in retaining pollen, and similar life histories, i.e. developing in male cones but sometimes visiting female cones and a high degree of host specificity, that lend themselves to a pollination mutualism. In addition, most Encephalartos, in South Africa at least, have broadly similar suites of insects associated with their cones as E. villosus, though their diversity diminishes along a south to north gradient (Donaldson, 1999, D.A. Downie, J.S. Donaldson, R.G. Oberprieler, unpublished data). In a similar experiment on E. cycadifolius, a cycad on which no Porthetes have been found, though two Amorphocerus species have, Donaldson et al. (1995) found evidence that an erotylid and a boganiid beetle were likely the predominant pollinators.

104

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

Oberprieler (1996) presented a well-resolved phylogenetic hypothesis of the Amorphocerini based on 31 morphological characters (Fig. 3). The major features of this phylogeny with respect to host use are the divergence of Amorphocerus onto female cones of Encephalartos species and Porthetes onto male cones. Within Amorphocerus, A. setosus Boheman, which develops on trunks, was sister to all other species, which develop in cones. Two species were sisters on two closely related members of the ‘‘woolly-coned” Encephalartos species group (E. fridericiguilielmi and E. cycadifolius) a group that diverged early in the evolution of Encephalartos (Treutlein et al., 2005), but the positions of the relative generalist A. talpa Schoenherr and another species were unresolved. Within Porthetes divergence was indicated between a Porthetes zamiae group (P. zamiae Boheman, P. dissimilis Hesse and three undescribed species (Porthetes sp. n. 1 and P. sp. n. 3 of Oberprieler (1995)), plus one other undescribed species), and a group of highly host-specific species (P. hispidus Boheman group) primarily utilizing male cones. There was some evidence for divergence of weevils corresponding to species groups of the cycads, and some species pairs suggested cospeciation with their hosts, but finer resolution of the co-phylogenetic pattern awaits a wellresolved phylogeny for Encephalartos, a challenging prospect given the apparently recent radiation of the genus (Treutlein et al., 2005). The host specificity and tight association of these weevils’ life cycles with their host plants, as well as the possible link to the evolution of cycad pollination mutualisms makes this a particularly interesting group for the study of speciation and diversification. Moreover, the unique history and role of cycads in plant evolutionary biology and the highly threatened status of many species of Encephalartos (Donaldson, 2003) and possible extinction of associated insects, makes a better understanding of the systematics and population genetics of the group a matter of some urgency. Molecular data will be useful in validating the species concepts based on morphological characters and the phylogenetic hypothesis of Oberprieler, inferring the age of the association, and providing a framework for comparative study when a resolved phylogeny for Encephalartos becomes available. Here sequence data from four genomic regions are presented to address three compound questions: (1) Do molecular data support the validity of the species recognized by Oberprieler and his hypothesis of their relationships? (2) How much divergence is there between species? (3) What is the pattern of evolution with respect to host use? 2. Methods and materials 2.1. Sampling Cycads were surveyed for weevils in 72 populations of 31 species of Encephalartos in the Eastern Cape, KwaZulu Natal, Limpopo, and Mpumalanga provinces of South

Africa, and in Swaziland, Tanzania, and Kenya (amorphocerines were not found on cycads surveyed in Limpopo Province, or in Tanzania). Effort was made to sample from multiple populations of each host species, though often this was not possible due to absence of cones (Table 1). On the basis of morphology and/or host plant and geographic location 23 putative species of weevils in the Amorphocerini from 45 populations of 21 species of Encephalartos were included in the analysis. Identifications were made by R. G. O. and D.A.D. Two species (A. sp. n. 2 and P. sp. n. 10), known from only one or two locations could not be found. A number of species in this tribe have been described in a Ph.D. thesis (Oberprieler, 1996), but their names have not yet been validated in a formal publication (thus remain nomenclaturally unavailable) and are referred to by genus letter and numbers (see and continued from Oberprieler, 1995). Voucher specimens for the majority of samples are housed in the Department of Zoology and Entomology at Rhodes University, and at CSIRO, Canberra, Australia. The sister taxon of the Amorphocerini is uncertain, the group falling into the grey zone between the subfamilies Cossoninae (in which it was previously placed) and Molytinae (in which it is currently included). Its closest relatives are surmised to be among the palm-associated Trypetidini and Arecophaga-group (Oberprieler, 1996, 2004), also transitional between Cossoninae and Molytinae but currently again placed in the wider concept of Molytinae. Since no members of these two groups were available for sequencing, we chose a number of traditional cossonines to represent the molytine–cossonine lineage to which the Amorphocerini belong. Here outgroup sequences were taken from GenBank and included Rhynchophorus palmarum, Diocalandra frumenti (Dryophthorinae) (O’Meara & Farrell, unpublished), a Stenancylus sp., Araucarius minor, A. major (Cossoninae) (Farrell et al., 2001; Sequeira et al., 2000) and finally Brachyscapus crassirostris (Cossoninae) collected by the first author. Single gene analyses used somewhat different outgroups because of availability of sequences. No outgroup was used for the PEPCK analysis as the only fresh material available did not amplify and no suitable sequences were available from GenBank for this gene. 2.2. Molecular procedures DNA was extracted from either whole individuals, thoraces, or 2–3 legs only using the Qiagen DNeasy Kit (Qiagen Inc., Valencia, CA) and diluted in sterile water at half the recommended volume. Fragments of three nuclear genes (elongation factor 1a, EF-1a; enolase; and phosphoenolpyruvate carboxykinase, PEPCK), and one mitochondrial (cytochrome oxidase I, COI) gene were amplified by PCR under standard conditions, i.e. 1.5–3.0 mM MgCl2, 0.2 lM dNTPs and 1 unit Taq polymerase in a proprietary buffer (PCR Master Mix, Promega, Madison, Wisconsin, U.S.A.), 0.2 lM each primer and 3.0 ll of DNA template in a final volume of 20 ll. Cycling parameters were 5 min. at 94 °C followed by 30–50 cycles of 30 s at 94 °C, 1 min at

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

105

Table 1 Collection details for Amorphocerini weevils on Encephalartos species in Africa Weevil species (sample) host species

Location

Plant organ

Date

PROTOPORTHETES (MS name) Propor E. princeps

Komga, EC

Old leaf stalks

15/11/2005

AMORPHOCERUS A. setosus A. rufipes1 A. rufipes2 A. rufipes3 A. rufipes4 A. rufipes5 A. rufipes6 A. talpa1 A. talpa2 A. talpa3 A. talpa4 A. talpa5 A. talpa6 A. talpa7 A. talpa8 A. talpa9 A. talpa10 A.sp. n. 1.1 A.sp. n. 1.2 A.sp. n. 4.1 A.sp. n. 4.2

E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E.

cycadifolius friderici-guilielmi friderici-guilielmi friderici-guilielmi friderici-guilielmi ghellinckii friderici-guilielmi altensteinii trispinosus longifolius longifolius arenarius latifrons longifolius longifolius lehmanii longifolius altensteinii altensteinii cycadifolius cycadifolius

Winterberg Mountains, EC Cathcart, EC Quanti, EC Thomas River, EC Nico Malan Pass, EC Tabankulu, EC Kokstad, KZN Grahamstown, EC n. Grahamstown, EC Addo NP, Zuurberg, EC Addo NP, Kabouga, EC Woody Cape Preserve, EC Kleinemonde, EC Riebeek-East, EC Groendal Wilderness, EC Kuzuko, EC Van Staden’s Reserve, EC Thomas Baines NR, EC King William’s Town, EC Winterberg Mountains, EC Winterberg Mountains, EC

Trunk Female cone Old male cone Female cone Old male cone Male cone Old female cone Male cone Old cone peduncle Female cone, surface Female cone Old axis female cone Male cone Female cone Male cone Damaged cone Male cone Old female cone Female cone Male cone Male cone

30/11/2004 12/11/2003 07/11/2004 01/02/2004 07/06/2005 09/12/2005 0812/2005 Oct. 2003 01/04/2004 08/04/2004 07/04/2004 13/04/2004 15/07/2004 22/07/3004 23/07/2004 22/03/2005 30/06/2005 11/10/2004 07/11/2004 17/11/2004 17/11/2004

PORTHETES P. zamiae P. dissimilis1 P. dissimilis2 P. dissimilis3 P. dissimilis4 P. gedyei P. hispidus1 P. hispidus2 P. hispidus3 P. hispidus4 P. hispidus5 P. hispidus6 P.sp. n. 1.1 P.sp. n. 1.2 P.sp. n. 1.3 P.sp. n. 2.1 P.sp. n. 2.2 P.sp. n. 2.3 P.sp. n. 2.4 P.sp. n. 2.5 P.sp. n. 3.1 P.sp. n. 3.2 P.sp. n. 3.3 P.sp. n. 4.1 P.sp. n. 4.2 P.sp. n. 4.3 P.sp. n. 4.4 P.sp. n. 5.1 P.sp. n. 5.2 P.sp. n. 6.1 P.sp. n. 6.2 P.sp. n. 6.3 P.sp. n. 6.4 P.sp. n. 6.5 P.sp. n. 7.1 P.sp. n. 7.2 P.sp. n. 8 P.sp. n. 9.1

E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E.

longifolius latifrons altensteinii altensteinii altensteinii hildebrandtii friderici-guilielmi friderici-guilielmi friderici-guilielmi friderici-guilielmi friderici-guilielmi friderici-guilielmi senticosus senticosus senticosus longifolius longifolius longifolius longifolius longifolius lehmanii horridus lehmanii trispinosus trispinosus trispinosus trispinosus horridus horridus villosus villosus villosus villosus villosus ferox ferox laevifolius altensteinii

Addo National Park, Kabouga, EC Kleinemonde, EC Grahamstown, EC King William’s Town, EC Kenton, EC Arabuku Sokoke Forest, Kenya Cathcart, EC Thomas River, EC Waterdown Dam, EC Nico Malan Pass, EC Cathcart, EC near Kokstad, KZN Siteki, Swaziland Siteki, Swaziland Siteki, Swaziland Riebeek-East, EC Riebeek-East, EC Paardepoort, EC Van Staden’s Reserve, EC Addo National Park, Kabouga, EC Paardepoort, EC n. Uitenhage, EC Kukuzo, EC Kwandwe Game Reserve, EC Manley Flats, EC n. Grahamstown, EC Salem, EC Uitenhage, EC Uitenhage, EC Mpetu, EC Mpetu, EC Umtiza Reserve, s.East London, EC Harold Johnson Nature Reserve, KZN Nkandla Nature Reserve, KZN Kosi Bay, KZN Sodwana Bay, KZN Kaapsehoop, MPM Thomas Baines Reserve, EC

Decomposed female cone 20/11/2005 Male cone 15/07/2004 Female cone, dehiscence 22/10/2004 Female cone 07/11/2004 Male cone 26/03/2005 Male cone 14/06/2006 Male cone 12/11/2003 Male cone 07/11/2004 Dried male cone 27/04/2005 Dried male cone 07/06/2005 Dried male cone 06/06/2005 Old female cone 08/12/2005 Male cone nd Male cone 22/04/2005 Old female cone 24/04/2005 Male cone 22/07/2004 Male cone 22/07/2004 Dried male cone 15/12/2004 Male cone 30/06/2005 Old male cone 20/11/2005 Crown of female plant 15/12/2004 Dried male cone 05/03/2005 Fresh female cone 22/03/2005 Old male cone 10/30/2003 Old male cone 25/01/2004 Old male cone 01/04/2004 Male cone 25/03/2005 Old male cone axis 21/11/2003 Old male cone axis 21/11/2003 Old female cone 08/11/2004 Old female cone 08/11/2004 Female cone 06/11/2004 Dried male cone 11/12/2005 Dehiscing female cone 13/12/2005 Old male cone 19/04/2005 Old male cone 20/04/2005 Old male cone 24/04/2005 Old male cone 11/10/2004 (continued on next page)

106

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

Table 1 (continued) Weevil species (sample) host species

Location

Plant organ

Date

P.sp. P.sp. P.sp. P.sp. P.sp. P.sp. P.sp. P.sp. P.sp. P.sp. P.sp.

Thomas Baines Reserve, EC Kenton, EC Southwell, EC Mlawula NR, Swaziland Mlawula NR, Swaziland Siteki, Swaziland Groendal Wilderness, EC Paardepoort, EC Grahamstown, EC Vernon Crookes Reserve, KZN Paulpietersburg, KZN

Old male cone Male cone Male cone Male cone Male cone Dried male cone Male cone Dried male cone Dried male cone Old leaf rachises Dried male cone

11/10/2004 26/03/2005 11/04/2006 21/04/2005 21/04/2005 22/04/2005 23/07/2004 15/12/2004 04/08/2005 10/12/2005 14/12/2005

n. n. n. n. n. n. n. n. n. n. n.

9.2 9.3 11 12.1 12.2 12.3 13.1 13.2 14.1 14.2 14.3

E. E. E. E. E. E. E. E. E. E. E.

altensteinii altensteinii caffer umbeluziensis umbeluziensis aplanatus longifolius longifolius altensteinii natalensis lembomboensis EF-1a

Outgroups Rhynchophorus palmarum Diocalandra frumenti Araucarius major Araucarius minor Stenancyclus sp. Brachyscapus crassirostris

Enolase

PEPCK

COI

AY131150a AY131133a AF308396b AF375264c EU310655

AY131121a AY131104a AY040285d AF375307c

AF040298 c AF375334c EU310582

EU310785

In most cases conspecific samples were collected from different host populations, samples from the same populations were collected from different host individuals. Not all samples appear in figures since some were sequenced for a subset of gene regions. Species names are followed by a sample identifier. Those species not formally described are designated by a species number and sample identifier as decimal (i.e., A.sp. n. 4.1). P. sp. n. 13 and P. sp. n. 14 were found for the first time during the course of this study. Detailed collecting data are withheld due to the danger of poaching faced by these plants. All specimens except P.sp. n. 1.1 (collected by M. Ferreira) were collected by DAD. EC, Eastern Cape; KZN, KwaZulu Natal; MPM, Mpumalanga. a O’Meara,B.C. and Farrell,B.D. (unpublished). b Sequeira et al. (2000). c Farrell et al. (2001). d Sequeira and Farrell (2001).

44–52 °C, 1.5 min at 72 °C followed by a final extension of 5 min at 72 °C. A touchdown protocol was used for some templates, decreasing annealing temperature by 1 °C every two cycles from 52 °C until reaching 47 °C for 30 cycles. Primers used for PCR amplification and sequencing are given in Table 2. In most cases PCR products were cleaned using the Qiagen MinElute Kit and sequenced in both directions using Big Dye Terminator ver. 3.1 (Applied Biosystems, Foster City, CA). A few samples were gel purified with the QIAquick Gel Extraction Kit. After sodium acetate-ethanol precipitation sequencing reactions were separated on an ABI 3100 Analyzer. Sequences are deposited at GenBank (enolase: EU310515-EU310582; EF-1a: EU310583-EU310655; PEPCK: EU310656-EU310715; COI: EU310716-EU310785). 2.3. Data analysis Traces from forward and reverse primers were assembled into contigs and edited in GeneStudio ver. 1.03.72 (GeneStudio, Inc.). Alignment of sequences was carried out with Clustal X ver. 1.83 (Thompson et al., 1997) and edited in GeneStudio by eye. Introns in EF-1a (one) and PEPCK (two) were aligned simultaneously with coding sequences. Some manual editing of introns was required but alignment was not problematic. Analyses with and without introns included showed that they improved resolution and they were retained in final analyses, except for one in PEPCK.

Table 2 Primers used in this study to amplify and sequence cytochrome oxidase I (COI), elongation factor 1-alpha (EF1-a), enolase, and phosphoenolpyruvate carboxykinase (PEPCK) Primer name

Sequence

Reference

COI Zeus C-J-1718 BEN A2771

tgakcyggaatastaggancatc ggaggatttggaaattgattagttcc gcwacwacrtaatakgtatcatg ggatartcagartaacgtcgwggtatwc

Normark et al. (1999) Simon et al. (1994) Brady et al. (2000) Normark et al. (1999) Normark et al. (1999)

EFA1106

atcgagaagttcgagaaggaggcycarg aaatggg gtatatccattggaaatttgaccnggrtgrtt

Enolase ens287 ens300 ena776

garatygaygarttyatgatyaa ttatgattaagctygacgg ttyggrttcttgaartcca

Farrell et al. (2001) This study Farrell et al. (2001)

PEPCK PEPCK-F1 PEPCK-R1 PEPCK-F2 PEPCJ-R2

agtggartgtgttggrgacgatat cgaagaagggcckcatwgcgaa ggrgacgatatygcttggat cgaabgggtcgtgcattat

This This This This

EF1-a EFS149B

Normark et al. (1999)

study study study study

All primers were used in amplification as well as sequencing but not all templates had the same combinations. Names follow those used in original studies. Primer sequences read 50 –30 .

Tests for substitution saturation were carried out using the test devised by Xia et al. (2003) in DAMBE ver.

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

4.2.13 (Xia and Xie, 2001). Tests were conducted on each codon position separately as well as the full data set for each gene with 5000 jackknife replicates for each test. Tests for molecular clocklike behaviour of the four genes was tested by comparing log likelihoods of topologies constrained to the molecular clock to unconstrained topologies under the model of sequence evolution chosen in ModelTest ver. 3.7 (Posada and Crandall, 1998) for each gene with significance assessed by the critical value of two times the difference in log likelihoods of the hypotheses of clock versus non-clock like behaviour with degrees of freedom equal to the number of taxa minus two (Huelsenbeck and Rannala, 1997). Phylogeny was estimated by maximum parsimony (MP) and Bayesian methods. For MP heuristic searches were used with 100 replications of random sequence addition during tree bisection reconnection in PAUP*ver4.b10 (Swofford, 2003), excluding uninformative characters and with informative characters equally weighted as well as with 3rd codon positions of COI down weighted 1:3. Due to computing constraints in some cases searches were limited by setting MAXTREES to 100,000 and holding 1000 trees (NCHUCK = 1000) at each replicate. This was not necessary for the combined dataset. Support for nodes on the MP trees were obtained by nonparametric bootstrapping under the same search conditions as above except with 10 replicates of random sequence addition with each of 200 bootstrap replicates. The reduced stringency of the search during bootstrapping may make bootstrap values conservative estimates. Given the uncertainty of the placement of the Amorphocerini within the Curculionidae optimal outgroup choice is difficult and our dryophthorine outgroups could be too distantly related to the ingroup which could produce misleading results. To test for such an effect, in addition to analysis including outgroups a MP analysis of the combined data under the same search parameters was run excluding all outgroups and using mid-point rooting. The model of sequence evolution that best fit the data was found using ModelTest. Subsequently, Bayesian estimation was carried out with MrBayes ver. 3.1 (Huelsenbeck and Ronquist, 2001) with 6 substitution types and gamma distributed rates with shape parameter and proportion of invariant sites estimated from the data (General Time Reversible model), which was consistent with the ModelTest results for all gene regions. All other parameters used default values. In single gene analyses codon positions were defined as data partitions. For analysis of the combined data a partitioned analysis was run, allowing parameters to vary across different partitions (gene regions). All single gene analyses were run two to four times with 106 Markov Chain Monte Carlo (MCMC) generations sampling every 100 generations. For the combined analysis MCMC runs were 4  106 generations sampling every 100 generations. Stationarity was assessed by visual examination of likelihood plots and the likelihood values themselves, verification that the standard deviation of split

107

frequencies was at or close to 0.01 (Ronquist et al., 2005), and by comparison of trees and posterior probabilities from different runs after applying the burnin chosen. Convergence was reached rapidly in all cases and a conservative burnin of 200,000 generations (500,000 for the combined analysis) was applied prior to generating consensus trees and posterior probabilities. Congruence among the four gene regions was tested for by Incongruence Length Difference tests (Farris et al., 1994) in all pairwise combinations implemented in WinClada ver. 1.00.08 (Nixon, 2002). The significance of these tests was used as a heuristic and not as a criterion on whether to combine data partitions. In addition, character congruence across data partitions was examined by partitioned Bremer support (PBS) (Bremer, 1988; Baker and DeSalle, 1997) using TreeRot ver. 2b (Sorenson, 1999). There is not a clear method to combine a data set where there is a single terminal per species (Oberprieler’s morphological data set of 31 characters in this case) with one that has multiple terminals per species with polymorphism (this molecular data set). The choices seem limited to choosing a random sequence per species or the consensus sequence for each species for the polymorphic data set to combine with the morphological data (in this case). Both were attempted here but the addition of the morphological characters had no effect on the resulting phylogenetic estimate without an arbitrary weighting of the morphological characters and the results are not discussed here. 2.4. Sequence divergence Sequence divergence among species and species groups was estimated in MEGA ver. 3.1 (Kumar et al., 2004) using the model of sequence evolution that best fit the model selected in ModelTest. Intraspecific level sequence divergence was estimated in PAUP* with the best fitting model from the ModelTest results. 2.5. Evolution of host associations To understand the pattern of host shifts in this taxon it would be useful to reconstruct ancestral hosts at the species level. However, with 22 character states for host species 41,877 most parsimonious reconstructions (MPRs) are found, leaving few nodes unambiguously optimized with little confidence in those that are. Hence, only developmental tissue type is mapped here. Tissue type used (male cones, female cones, both, or other) was mapped onto the strict consensus MP tree (nearly identical to the Bayesian consensus tree, see results), after pruning redundant intraspecific terminals, as unordered characters and ancestral states were optimized in MacClade ver. 4.06 (Maddison and Maddison, 2003), as well as on the pruned Bayesian tree using Maximum Likelihood (ML) in the MultiState routine in BayesTraits ver. 1.0 (Pagel et al., 2004) which uses information on branch lengths as well as topology. Developmental tissue type was assigned based

108

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

on collecting data from this study and the study of Oberprieler (1996) which was largely based on collections by the second author. Records from cultivated hosts or hosts where only one or a few adults have been found were not included with the exception of P. sp. n. 13 which is only known from five specimens but from three sites, all on E. longifolius. Character codings are given in Supplementary Table S1.

Table 3 Transition:transversion ratios, base frequencies and significance of test for homogeneity of base frequencies across taxa

3. Results

somewhat biased for EF1a (toward C and T) and COI (toward A and T) but frequencies did not vary across taxa (Table 3). Only a single test for substitution saturation produced a positive result (Iss = Iss. c), this was for third codon positions of COI. Because there was evidence for saturation at third codon positions of COI (though this was not evident when the whole COI data set was tested) various weighting schemes were assessed for this gene: down weighting the third position (1:2, 1:3, 1:4, 1:5, 1:10 for 3rd relative to 1st and 2nd) as well as RY coding of third positions (Phillips et al., 2001). A weighting of 1:3 third to first and second positions produced the fewest number of most parsimonious trees (MPTs) and marginally better values for the consistency and retention indices and was chosen for further analyses. A molecular clock hypothesis was rejected for all four gene regions (all P < 0.001).

3.1. Sequence properties The final alignment for EF1a was 875 characters of which 232 were parsimony informative. An intron of variable length (99 bp of the alignment) is inserted between positions 557-558 of the coding sequence. The intron presented no alignment problems and provided informative characters so it was retained. The final COI alignment was 787 characters of which 296 were parsimony informative. Enolase provided a character matrix of 493 characters, 138 of these being parsimony informative. Finally, PEPCK added 646 characters with 161 of them parsimony informative. Two introns were observed in the PEPCK matrix in Porthetes, Amorphocerus had only one. Interestingly, evidence that the 30 end of these sequences contained another intron came from length variation and consequently large number of gaps in this region as well as the presence of a conserved canonical AGGT splicing sequence at the 50 end of the putative intron. Apparently the priming site is immediately flanking or overlapping the 30 splicing site. Alignment through this region was ambiguous and it was deleted from the matrix. The other two introns were retained. That the amplified copy of PEPCK might be a pseudogene is suggested by the presence of stop codons at three positions. Interestingly, at one position only Porthetes has a stop codon and it is conserved across all species, UAA in all of them. At the other position Amorphocerus has a stop codon, it is absent in all P. hispidus group species but present in all P. zamiae group species; it is UAA in the Porthetes but UAG in Amorphocerus. Two sequences have a stop at another position. At the first two positions the coding sequence is always CAA, coding for glycine. The other two samples have CAG, also coding for glycine. Since different species should accumulate mutations independently at a neutral locus such as a pseudogene, the conservation of a stop codon at a single position in 16 species (albeit closely related), and occurring only at codons coding for a particular amino acid (glycine here) suggests that this may be an example of novel codon usage, rather than a pseudogene. Since PEPCK mRNA isolated from these taxa should contain the novel codon, this hypothesis could be tested by direct sequencing of the RNA or by using rtPCR and sequencing the cDNA produced. The combined data set totalled 2801 characters, 827 of which were parsimony informative. Base frequencies were

Gene fragment

Ti:Tv

A

C

G

T

P

EF1-a Enolase PEPCK COI

1.90 2.25 2.00 2.47

0.1998 0.2848 0.2881 0.3125

0.3103 0.2544 0.2319 0.1887

0.1524 0.2444 0.2302 0.1549

0.3374 0.2163 0.2497 0.3436

0.996 1.000 1.000 1.000

3.2. Phylogenetic analyses 3.2.1. Single gene analyses There was substantial variation in resolution among the four gene regions, with COI and EF-1a producing the greatest resolution and enolase the smallest (Supplementary Figs. S2–S5). On the other hand, COI showed the greatest amount of homoplasy and PEPCK the smallest with EF-1a and enolase intermediate (Table 4). While enolase did not resolve any relationships within the tribe (except partially within the P. zamiae clade) the species concepts of Oberprieler were supported in a number of cases. Results of the ILD test suggested that there was significant incongruence among data partitions (P < 0.01 for Table 4 Tree statistics for parsimony analyses Gene fragment

#PIC

#MPT

Length

CI

RI

N

EF1-a Enolase PEPCK COI Nuclear genes 4 genes

232 138 154 296 523 827

92,000+ 100,000+ 100,000+ 19 13000+ 270

686 350 376 647 1366 2080

0.532 0.580 0.822 0.347 0.579 0.493

0.870 0.897 0.968 0.785 0.903 0.866

77 70 60 74 76 77

Third codon positions were down weighted 1:3 relative to first and second positions for COI in single gene and combined analyses. N is the number of sequences included in the analysis. PIC, number of parsimony informative characters; MPT, most parsimonious trees; CI, consistency index; RI, retention index.

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

all combinations). Most of this incongruence was at weakly supported nodes (i.e., at the intraspecific level), however some incongruence was strongly supported. For example, A. sp. n. 4 sequences were placed within A. rufipes for EF-1a (99% BS, PP = 0.99) and enolase (72% BS, PP = 0.99), together with the two sequences of A. sp. n. 1 for PEPCK (73% BS, PP = 0.97), and within A. talpa for COI (100% BS, PP = 1.00) in both MP and Bayesian results. Another example of conflict that had reasonably strong support on different gene trees was the unstable placement of sequences from specimens identified as P. sp. n. 9 and a previously uncollected P. sp. n. 14, which are suggestive of hybridization in a zone of overlap on E. altensteinii in the Eastern Cape. Conflict among data partitions can be further probed by Partitioned Bremer Support (PBS). Strong support provided by EF-1a for an unresolved clade of A. sp. n. 1 and A. talpa was conflicted by COI (Table 5, Fig. 2) which Table 5 Partitioned and total Bremer support for all nodes above the species level for the strict consensus of 270 MPTs with third codon positions of COI down weighted 1:3 Node

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36

Data partition EF-1a

enolase

PEPCK

COI

Total

0.00 4.00 0.00 1.00 10.47 2.00 0.00 16.00 0.00 1.00 1.00 0.00 4.00 2.00 1.00 0.52 1.00 1.00 3.00 11.00 0.00 1.00 11.00 3.50 0.00 3.00 0.00 0.00 15.00 1.00 0.00 0.00 4.00 1.00 0.00 3.00

0.00 2.00 0.00 2.00 2.53 2.00 0.00 0.00 1.00 0.00 0.00 0.00 3.00 3.00 1.00 0.52 1.00 3.00 1.00 0.00 0.00 10.00 2.00 7.50 0.00 0.00 0.00 0.00 3.00 0.00 0.00 2.00 0.00 2.00 1.69 1.00

0.00 0.00 0.00 12.00 0.00 3.00 4.00 1.00 1.00 1.00 0.00 0.00 6.00 3.00 0.00 1.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 1.00 0.00 0.00 0.00 0.00 2.00 1.00 0.00 0.00 10.00 0.00 2.69 3.00

1.01 0.31 2.67 3.31 3.30 4.65 14.28 4.29 1.99 6.62 3.98 14.58 7.63 3.64 5.94 1.65 0.33 1.32 0.00 5.94 7.61 8.60 0.34 5.62 1.66 1.66 0.66 0.66 1.00 0.99 0.66 0.33 1.32 0.00 2.65 0.66

1.01 1.67 2.67 16.31 9.70 11.65 18.58 12.71 3.99 6.62 2.98 14.58 20.63 4.36 7.94 0.65 0.33 5.32 2.00 16.94 7.61 19.60 12.66 15.62 1.66 1.34 0.66 0.66 17.00 0.99 0.66 1.67 15.32 3.00 1.65 7.66

Nodes at the intraspecific level are omitted. Nodes are labelled in Fig. 3.

109

resolves these as sister species (albeit with A. sp. n. 4 embedded within A. talpa). A similar situation held with respect to a clade of A. sp. n. 4 + A. rufipes, and less so for a clade of (P. sp. n. 1 + (P.dissimilis + P. zamiae)). Surprisingly weak total Bremer support was found for key internal nodes, such as the monophyly of Amorphocerini, Amorphocerus + Porthetes, the genus Amorphocerus, and the genus Porthetes. It should be noted that these values are affected by the down weighting of some characters. The two methods of analysis were largely consistent with each other, except in Bayesian analysis of COI Propor was sister to all other Amorphocerini plus the cossonine outgroup sequences creating a paraphyletic Amorphocerini, while Propor was sister to the P. zamiae clade in MP; this relationship was not supported however. 3.2.2. Combined analyses Though conflict among partitions was present a total evidence approach was preferred over discarding data or consensus methods. Comparison of the strict consensus MP trees from unweighted (of 60192 MPTs, L = 2969, CI = 0.440, RI = 0.844) and weighted (of 270 MPTs, L = 2080, CI = 0.493, RI = 0.866) analysis with COI third codon positions down weighted 1:3 showed the weighted analysis provided a better fit to the data (KH test, t = 5.048, P < 0.0001; Templeton test, z = 4.933, P < 0.0001) and inferences from parsimony are based on this tree (Fig. 1A). Bayesian analysis produced a tree (Fig. 1B) nearly identical in topology to this MP tree, differing only in minor details with respect to intraspecific relationships. Bayesian analysis also provided stronger support than MP (taking into account that posterior probabilities are interpreted more stringently than bootstrap support values (Huelsenbeck et al., 2002)) for some key nodes, notably the monophyly of the Amorphocerini (PP = 1.00 vs. BS = 61) and monophyly of Amorphocerus + Porthetes (PP = 0.99 vs. BS = 62), as well as a few more terminal nodes. Maximum parsimony analysis of the combined data excluding all outgroups produced a tree that was nearly identical to the one with outgroups included, barring a loss of bootstrap support at deeper nodes (Fig. S1). 3.2.3. Sequence divergence The model of sequence evolution that best fit the combined data set was the General Time Reversible with gamma distributed rates (a = 0.6594) and proportion of invariant sites (pinvar = 0.3909). Since this model is not offered by MEGA the Tamura-Nei (Tamura and Nei, 1993) model with gamma distributed rates and the estimated alpha value was used to estimate sequence divergence at the species level. In general, mean sequence divergence was low among all Amorphocerini (10.9% ± SE 0.5%), Porthetes (7.5% ± SE 0.5%), Amorphocerus (3.9% ± SE 0.3%), P. zamiae group species (3.1% ± SE 0.3%), and P. hispidus group species (5.2% ± SE 0.3%).

110

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

The species concepts of Oberprieler and previous authors were confirmed in all but two cases: P. zamiae was not distinguished from P. dissimilis, and P. sp. n. 12 was not distinguished from P. sp. n. 6.; in the latter case putative interspecific divergence was no greater than intraspecific divergence (GTR + I + G distances for P. sp. n. 6 range 0.35–1.62%; P. sp. n. 12 range 0.12–0.32%; P. sp. n. 6 vs. P. sp. n. 12 range 0.06–1.55%). One specimen taken from E. umbeluziensis in Swaziland differed from a specimen taken from E. villosus north of East London, South Africa (a distance of some 800 km) by only a single substitution but differed by five substitutions from a specimen taken from the same site and two substitutions from a specimen taken from E. aplanatus from another site in

Swaziland. The single P. zamiae sequence was 0.06–1.55% divergent from P. dissimilis sequences. 3.2.4. Evolution of host associations Among the extant species included in this analysis there are four species pairs that are host specific to closely related and potentially sister species of Encephalartos (Treutlein et al., 2005; Vorster, 2004): P. sp. n. 6 (not strictly host specific) on E. villosus, E. aplanatus, and E. umbeluziensis, any one of which may be sister to the host of P. sp. n. 11, E. caffer; P. sp. n. 4 and P. sp. n. 5 on E. trispinosus and E. horridus, respectively; P. hispidus and P. sp. n. 8 on E. friderici-guileilmi and E. laevifolius, respectively; and A. rufipes and A. sp. n. 4 on E. friderici-guileilmi and

Fig. 1. (A) Strict consensus of 270 MPTs from combined analysis of all four gene regions. Third codon positions were down-weighted 1:3 relative to first and second positions. Bootstrap support values are given to left of nodes. (B) Bayesian majority rule consensus tree from 4  106 generations of Markov Chain Monte Carlo sampling every 100 generations and with a burnin of 5000 trees. Posterior probabilities are given to the left of nodes. Some PP values at intraspecific nodes are omitted for clarity.

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

111

Fig. 1 (continued )

E. cycadifolius, respectively. Since the latter two examples are mutually exclusive (both pairs of hosts cannot be sisters) there are three potential examples of co-speciation among extant species. The ancestral amorphocerine is inferred to have used resources other than cones. Amorphocerus colonized cones of both sexes but whether this occurred in the common ancestor or after the split with A. setosus is unresolved. The ancestral Porthetes is inferred to have specialized on male cones, but support for this inference is not strong (57% probability), nor is support for the inference that the ancestor of the P. zamiae clade used female cones. Strong support is found for the use of male cones in the ancestor of the P. hispidus clade. In this clade, inclusion of both cone types occurs now only in P. sp. n. 6. P. dissimilis and P. zamiae have specialized on female cones. The three MPRs differed only in whether the ancestor of (P. dis-

similis + P. zamiae) P. sp. n. 3) utilized female, male, or both male and female cones (Fig. 3). 4. Discussion 4.1. Species concepts There were two instances of failure to retrieve the species concepts of Oberprieler and a previous author based on morphology. As even casual observation of the morphology of P. zamiae and P. dissimilis suggests a distinction (they differ strongly in elytra color and less strongly in rostrum morphology) this result may be due to the expected paraphyly of very recent speciation (Funk and Omland, 2003). Alternatively, it could be a sampling artefact since only a single individual of P. zamiae was sequenced while four individuals of P. dissimilis were sequenced (no ‘‘syna-

112

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

Fig. 2. MP strict consensus tree of Fig. 1A with node labels corresponding to numbered nodes and Partitioned Bremer Support values in Table 5. Numbers are placed to the left or right of relevant nodes based on space considerations.

pomorphic” characters are possible). The situation is not so clear with respect to P. sp. n. 6 and P. sp. n. 12 as Oberprieler recognized only small differences between the two and suggested that more extensive sampling may reveal a cline rather than a disjunction. Samples from E. villosus (host of P. sp. n. 6) for this study ranged from around East London in the Eastern Cape up to the Nkandla Forest in northern KwaZulu Natal, closing the gap between the ranges of these putative species. To the extent that decisions on the validity of this species and its host, E. aplanatus, have reinforced each other (Vorster and Oberprieler, 1999), re-evaluation may be warranted. Indeed, sequence divergences of specimens from E. villosus were in some cases larger than those from specimens across host plant species. Such a pattern of divergence does not preclude the existence of very recently isolated species (Funk and Omland, 2003; Coyne and Orr, 2004; Little and Stevenson,

2007) but the weight of the evidence is not strong enough to support the species status of P. sp. n. 12. The molecular data thus indicate that P. sp. n. 6 is a polymorphic species that also develops on E. umbeluziensis, a cycad previously not sampled but which is part of the E. villosus species complex that includes E. villosus, E. aplanatus, and E. caffer (Vorster, 2004). 4.2. Phylogenetic analysis The relationships among amorphocerine species inferred from the molecular data set do not differ greatly from the morphological hypothesis but important differences exist (Fig. 3). At deeper nodes the two data types are completely congruent; it is only in the relationships of certain species or clades closer to the tips where incongruence is apparent. In Amorphocerus, this is seen in the relationships of A. talpa

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

113

Fig. 3. Left: Phylogenetic hypothesis of Oberprieler (1996) based on 31 morphological characters. This is the single MPT from a branch and bound search using a successive approximations approach on ordered characters. CI = 0.765, RI = 0.931. Numbers to the left of nodes are bootstrap values based on 500 replicates. Genera and species group names are given under subtending branches. Right: MP consensus tree from Fig. 1A pruned to a single terminal for each species (identical in topology to pruned Bayesian tree). P. sp. n. 12 of Oberprieler is here placed into P. sp. n. 6. Ancestral state ML reconstructions with the highest probabilities are labelled at nodes. m = male cones, f = female cones, b = both, o = other. Asterisks indicate 90% or greater probability of that ML reconstruction on Bayesian tree. States with probabilities between 50% and 90% are given in parentheses; those with less than 50% probability are omitted. MP reconstructions that differed from the ML estimates are shown in brackets.

and A. sp. n. 1, which are sister taxa in this study (Fig. 3). This makes sense as A. rufipes and A. sp. n. 4 both use species of Encephalartos from the divergent ‘‘woolly-coned” species group while A. talpa and A. sp. n. 1 both use E. altensteinii, are extremely similar morphologically, and are geographically parapatric. Unfortunately A. sp. n. 2 could not be sampled. All MPRs of host association (not shown) suggested an ancestral Amorphocerus on E. cycadifolius. If true, this would suggest evolution and rapid host range expansion of a relative generalist from a specialist ancestor in A. talpa. This is the reverse of the paradigmatic direction of evolution but has been found to be relatively common (Nosil, 2002; Stireman, 2005; Yotoko et al., 2005). In Porthetes the molecular data agree completely with Oberprieler’s hypothesis in retrieving two major clades, called the P. zamiae clade and the P. hispidus clade by Oberprieler. The relationships within the P. zamiae clade are confirmed here, though one species could not be sampled for this study. There are however some discrepancies in the P. hispidus clade, central of which is the position of P. hispidus itself, P. sp. n. 9, and P. sp. n. 6 + P. sp. n. 11. Some discrepancies may arise simply out of the slightly different taxon sample, with two species unable to be located and two additional species found in this study. P. sp. n. 13 is a bit enigmatic here. The sister species P. gedyei and P. sp. n. 7 (here and in Oberprieler) are both found in coastal or near coastal habitats, though not on related hosts, and though widely separated geographically P. sp. n. 7 is still nearest neighbour to P. gedyei of the Porthetes

species found so far. Their close genetic similarity suggests the geographic disjunction that separates them is either recent or that additional populations or closely related species of Porthetes can be expected in the intervening region. A relictual distribution of anciently diverged taxa is contraindicated. P. sp. n. 13 is found much further south (near the very tip of South Africa) on an unrelated host in a semi-arid habitat and morphologically resembles P. sp. n. 11. Indeed, since no larvae have been found it is possible that E. longifolius is not its actual host, though it has been collected from this host in three separate localities and it has not been found on the most likely alternative, E. lehmannii, which is sympatric to E. longifolius in part of its range. P. sp. n. 2, sister to the remaining Porthetes, is also found only on E. longifolius, and P. sp. n. 13 has been found in the same sites and even the same cones as this species (this study). In none of the analyses were they ever sister species. It is possible the more recently derived P. sp. n. 2 is displacing P. sp. n. 13; it is found in large numbers in these cones. In the remaining clade of Porthetes most sister species pairs in Oberprieler’s hypothesis are supported here with the exception of P. sp. n. 9 and P. sp n. 4, weakly supported by morphology (Fig. 3). P. sp. n. 4 and P. sp. n. 5 are found on closely related and potentially sister species of Encephalartos lending credence to this result (Treutlein et al., 2005). The line leading to P. sp. n. 6 and P. sp. n. 11 is here inferred to have diverged earlier than in Oberprieler’s hypothesis and the line leading to P. hispidus + P. sp. n.

114

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

8 is inferred to have been one of the more recent divergences in the tribe. 4.3. Evolution of host associations The above result is interesting as both P. hispidus and P. sp. n. 8 are found on woolly coned Encephalartos species (E. friderici-guilielmi and E. laevifolius, respectively) but no Porthetes have been found on the closely related E. cycadifolius, host to two Amorphocerus species, or another member of the group, E. ghellinckii on which A. rufipes has been found developing (this study). Thus a relatively ancient colonization of these very different cycads that form a sister group to all other Encephalartos (Treutlein et al., 2005) is suggested for Amorphocerus but only a very recent one for Porthetes. While closely related insect herbivores are often found on closely related host taxa (Ehrlich and Raven, 1964; Futuyma et al., 1995; Wahlberg, 2001) they are also often found on chemically similar host taxa (Beccera, 1997). No comparative work on the chemistry in Encephalartos has been done but it is apparent from these data that host shifts have involved both closely related hosts and more divergent hosts (this is a relative perspective; clearly all Encephalartos species are closely related (Treutlein and Wink, 2002; Treutlein et al., 2005). Four species pairs in this study are found on closely related and potentially sister species of Encephalartos. Thus the potential for co-phylogeny of insect and host exists at some nodes but the pattern is not likely to be strong, consistent with other insect-plant systems (Futuyma, 2000). A well resolved phylogenetic hypothesis for Encephalartos is needed to explore this pattern. Currently no species pairs occur sympatrically, those species that do occur sympatrically (P. sp. n. 2 and P. sp. n. 13, P. zamiae and P. sp. n. 3, P. sp. n. 4 and P. sp. n. 9; A. talpa occurs with all these species) are not sister species, suggesting that speciation has been driven less by host associated factors than geographic factors. It is interesting to note that the sister species A. talpa and A. sp. n. 1 share the same host (E. altensteinii) but have non-overlapping ranges suggesting a role for geography in speciation (though there are no obvious barriers separating them). A role for host plant structuring of the distribution of some species is suggested by the sympatric species P. sp. n. 4 and P. sp. n. 9 that use different host species, and P. zamiae and P. sp. n. 3, that share a host (E. lehmanii) but use different tissue types (female and male cones, respectively). A similar partitioning of resources by sympatric species exists with P. dissimilis (generally female cones) and P. sp. n. 9 (male cones) on E. altensteinii. The ancestral amorphocerine is inferred to have utilized tissue other than the reproductive structures. Though MPR suggested that the ancestral Amorphocerus did as well, which would indicate independent colonization of cones in Amorphocerus and Porthetes, this was not supported by ML reconstructions. Similarly, only weak confidence can be placed in the inference of colonization of and

subsequent specialization on male cones at the base of the Porthetes clade, the inference is much stronger for this event at the base of the P. hispidus clade. Amorphocerus now use and are collected from both male and female cones but development in female cones is more common and dispersal to male cones to collect pollen to return to female cones would seem to make these inefficient pollinators. Specialized development in male cones in contrast, would only require a relatively small sample of individuals with heavy pollen loads to be attracted to female cones to effect pollination of a crop of seeds. Indeed, Terry et al. (2005) showed that two Tranes weevils could pollinate up to 85% of Macrozamia machinii ovules. In addition, the timing and magnitude of cone thermogenesis has been shown to be sexually dimorphic in two species of Macrozamia, in a pattern consistent with female attraction of pollinators emerging from male cones (Roemer et al., 2005). Similar studies on Encephalartos are needed. The origin of the Encephalartos-Amorphocerini pollination mutualism may have occurred at the base of the Porthetes clade, but it may have been much more recent. More exclusion experiments similar to those of Donaldson et al. (1995) and Donaldson (1997), as well as others on other continents (Tang, 1987; Wilson, 2002; Terry et al., 2005) would be extremely useful to test the hypothesis that amorphocerine pollinators come primarily from the P. hispidus clade, as predicted if specialization on male cones occurred at the base of this clade and is a key event in the evolution of the mutualism. 4.4. Age of associations Since cycad–insect pollination mutualisms have been claimed to be ancient (Farrell, 1998; Norstog and Nichols, 1997; Stevenson et al., 1998) it is of considerable interest to estimate the age of the Amorphocerini-Encephalartos interaction, particularly the Porthetes-Encephalartos interaction. The earliest known fossil attributed to Encephalartos dates to the Cretaceous, putting a maximum age on this association at some 135 MYA (Pant, 1987) but the Curculionidae were just beginning to diversify around or after that time (Crowson, 1981; Kuschel et al., 1994; Farrell, 1998). The origin of the Amorphocerini was almost certainly much more recent, post-dating the break up of Gondwana. Indeed, the available molecular data indicate that Encephalartos itself has undergone a recent radiation (Treutlein et al., 2005) rendering an ancient association unlikely. It is of course possible that an old association of two species poor taxa predates a recent radiation, or that rapid turnover of species results in a collection of young extant species, possibilities not contradicted by these data. None of the gene regions assayed here conformed to a molecular clock model and there are no fossils or reliably dated geological events to calibrate date estimates for this taxon in any case. The best that can be offered in terms of dating the age of the pollination mutualism of amorphocerines and Encephalartos would be to

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

use the often cited and perhaps overworked general measure of 2.3% sequence divergence per million years for insect COI (Brower, 1994). Other estimates of the rate of evolution in insect mtDNA have emerged recently (Stireman et al., 2005) which differ from this ‘‘general” rate and the failure to accept a molecular clock hypothesis makes this an unattractive approach. However, it is clear from the low levels of sequence divergence among most Porthetes as well as Amorphocerus species, and the apparent young age of most Encephalartos species, that the radiation onto Encephalartos and development of the pollination mutualism has been recent. 5. Conclusions The data suggest a complex pattern of speciation in some cases being mediated by host plant factors but more generally influenced by geography and vicariance. Host shifts have been onto close relatives as well as distant relatives (within Encephalartos). The ancestral amorphocerine is inferred to have utilized tissue other than cones, with colonization of cones possibly occurring independently in Amorphocerus and Porthetes. Specialization onto male cones most likely occurred relatively recently in the evolution of the tribe, at the base of the P. hispidus clade. The large geographic distances separating sister taxa may be influenced by the declining status and shrinking ranges of most cycad species and intervening populations and species are likely to have gone extinct. It is clear as well though, that additional amorphocerine species and host plant associations are still to be discovered. Low levels of sequence divergence among species within the major clades indicate that radiation onto Encephalartos has been recent, and is perhaps ongoing. Knowledge and conservation of their unique host plants, and probability of persistence of this interaction, will benefit from continued exploration for these weevils. Acknowledgments Funding for this research was provided by the National Research Foundation, Rhodes University Joint Research Committee Grants and a grant from the Bressler Foundation to J.S. Donaldson. Collecting permits were acquired from the Department of Economic Affairs and Tourism, Ezemvelo KZN Wildlife, the Mpumalanga Parks Board, Limpopo Tourism and Parks, the Swaziland National Trust Commission, the Tanzania Commission for Science and Technology, and the Kenyan Ministry of Science and Technology. P.J. Gullan, N. Hardy, and two anonymous reviewers made suggestions that substantially improved the manuscript. Thanks go to the farmers and rangers who graciously gave of their time and resources to assist in the collection of weevils. Special thanks to Geoffrey Mungai of the National Museums of Kenya and especially Frank Mbago of the University of Dar es Salaam for

115

indispensable assistance in the field, and for introducing D.A. Downie to Tanzanian rumba music. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ympev.2008. 01.023. References Baker, R.H., DeSalle, R., 1997. Multiple sources of character information and the phylogeny of Hawaiian drosophilids. Syst. Biol. 46, 654–673. Beccera, J.X., 1997. Insects on plants: macroevolutionary chemical trends in host use. Science 276, 253–256. Brady, S.G., Gadau, J., Ward, P.S., 2000. Systematics of the ant genus Camponotus (Hymenoptera: Formicidae): a preliminary analysis using data from the mitochondrial gene cytochrome oxidase I. In: Austin, A.D., Dowton, M. (Eds.), Hymenoptera, Evolution, Biodiversity, and Biological Control. CSIRO Publishing, Collingwood, Victoria, Australia, pp. 131–139. Bremer, K., 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42, 795–803. Brower, A.V.Z., 1994. Rapid morphological radiation and convergence among races of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proc. Nat. Acad. Sci. 91, 6491–6495. Coyne, J., Orr, H.A., 2004. Speciation. Sinauer, Sunderland, Mass. Crowson, R.A., 1981. The Biology of the Coleoptera. Academic Press, London. Donaldson, J.S., 1997. Is there a floral parasite mutualism in cycad pollination? The pollination biology of Encephalartos villosus. Am. J. Bot. 84, 1398–1406. Donaldson, J.S., 1999. Insects associated with the cycads of Zimbabwe, Kenya, and Zanzibar with comparisons to cycad insects in South Africa. Excelsa 19, 34–39. Donaldson, J.S., 2003. Regional overview: Africa. In: Donaldson, J.S. (Ed.), Cycads: status survey and conservation action plan. IUCN – The World Conservation Union, Cambridge, UK, pp. 9–19. Donaldson, J.S., Na¨nni, I., Bosenberg, J.D., 1995. The role of insects in the pollination of Encephalartos cycadifolius. In: Vorster, P. (Ed.), Proceedings of the Third International Conference on Cycad Biology. Cycad Society of South Africa, Stellenbosch, pp. 423–434. Ehrlich, P.R., Raven, P.H., 1964. Butterflies and plants: a study in coevolution. Evolution 18, 586–608. Farrell, B.D., 1998. ‘‘Inordinate fondness” explained: why are there so many beetles? Science 281, 555–559. Farrell, B.D., Sequeira, A.S., O’Meara, B.C., Normark, B.B., Chung, J.H., Jordal, B.H., 2001. The evolution of agriculture in beetles (Curculionidae: Scolytinae and Platypodinae). Evolution 55, 2011– 2027. Farris, J.S., Kallerjo, M., Kluge, A.G., Bult, C., 1994. Testing significance of congruence. Cladistics 10, 315–319. Funk, D.J., Filchak, K.E., Feder, J.L., 2002. Herbivorous insects: model systems for the comparative study of speciation ecology. Genetica 116, 251–267. Funk, D.J., Omland, K.E., 2003. Species-level paraphyly and polyphyly: frequency, causes, and consequences, with insights from animal mitochondrial DNA. Ann. Rev. Ecol. Evol. Syst. 34, 397–423. Futuyma, D.J., Keese, M.C., Funk, D.J., 1995. Genetic constraints on macroevolution: the evolution of host affiliation in the leaf beetle genus Ophraella. Evolution 49, 797–809. Futuyma, D.J., 2000. Some current approaches to the evolution of plant– herbivore interactions. Plant Species Biol. 15, 1–9. Hill, K.D., Stevenson, D.W., Osborne, R., 2007. The world list of cycads. In: Vovides, A., Stevenson, D.W., Osborne, R. (Eds.), Proceedings of

116

D.A. Downie et al. / Molecular Phylogenetics and Evolution 47 (2008) 102–116

the Seventh International Conference on Cycad Biology, Xalapa, Veracruz, Mexico. Press, pp. 454–483. Huelsenbeck, J.P., Rannala, R., 1997. Phylogenetic methods come of age: testing hypotheses in an evolutionary context. Science 276, 227–232. Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogeny. Bioinformatics 17, 754–755. Huelsenbeck, J.P., Larget, B., Miller, R.E., Ronquist, F., 2002. Potential applications and pitfalls of Bayesian inference of phylogeny. Syst. Biol. 51, 673–688. Jaenike, J., 1990. Host specialization in phytophagous insects. Ann. Rev. Ecol. Evol. Syst. 21, 243–273. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Kuschel, G., Oberprieler, R.G., Rayner, R.J., 1994. Cretaceous weevils from southern Africa, with description of a new genus and species and phylogenetic and zoogeographical comments (Coleoptera: Curculionoidea). Ent. Scand. 25, 137–149. Little, D., Stevenson, D.W., 2007. A comparison of algorithms for the identification of specimens using DNA barcodes: examples from gymnosperms. Cladistics 23, 1–21. Maddison, W.P., Maddison, D.R., 2003. MacClade. Version 4.06. Sinauer Associates, Sunderlands, Massachusetts. Nixon, K.C., 2002. WinClada, version 1.00.08. (Published by the author: Ithaca, NY, USA.). Available online at: www.cladistics.com. Normark, B.B., Jordal, B.H., Farrell, B.D., 1999. Origin of a haplodiploid beetle lineage. Proc. Roy. Soc. Lond., Ser. B 266, 2253–2259. Norstog, K.J., Nichols, T.J., 1997. The Biology of the Cycads. Comstock Publishing Associates, Ithaca, NY. Nosil, P., 2002. Transition rates between specialization and generalization in phytophagous insects. Evolution 56, 1701–1706. Oberprieler, R.G., 1995. The weevils associated with cycads 1. classification, relationships, and biology. In: Vorster, P. (Ed.), Proceedings of the Third International Conference on Cycad Biology, Cycad Society of South Africa, Stellenbosch, pp. 335–378. Oberprieler, R.G., 1996. Systematics and evolution of the tribe Amorphocerini, with a review of the cycad weevils of the world. Ph.D. dissertation, University of the Free State, Bloemfontein, South Africa. Oberprieler, R.G., 2004. ‘‘Evil weevils”—the key to cycad survival and diversification? In: Lindstrom, A. (Ed.), Proceedings of the 6th International Conference on Cycad Biology. Nong Nooch Tropical Garden, Chonburi, Thailand, pp. 170–194. Pagel, M., Meade, A., Barker, D., 2004. Bayesian estimation of ancestral character states on phylogenies. Syst. Biol. 53, 673–684. Pant, D.D., 1987. The fossil history and phylogeny of the Cycadales. Geophytology 17, 125–162. Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics 14, 817–818. Percy, D.M., Page, R.D.M., Cronk, Q.C.B., 2004. Plant–insect interactions: double-dating associated insect and plant lineages reveals asynchronous radiations. Syst. Biol. 53, 120–127. Phillips, M.J., Lin, Y-.H., Harrison, G.L., Penny, D., 2001. Mitochondrial genomes of a bandicoot and a brushtail confirm the monophyly of australidelphian marsupials. Proc. R Soc. Lond. B 268, 1533–1538. Roemer, R., Terry, I., Chockley, C., Jacobsen, J., 2005. Experimental evaluation and thermo-physical analysis of thermogenesis in male and female cycad cones. Oecologia 144, 88–97. Ronquist, F., Huelsenbeck, J.P., van der Mark, P., 2005. MrBayes 3.1 Manual. Schluter, D., 2001. Ecology and the origin of species. T.R.E.E. 16, 372–380. Sequeira, A.S., Normark, B.B., Farrell, B.D., 2000. Evolutionary assembly of the conifer fauna: distinguishing ancient from recent associations in bark beetles. Proc. Roy. Soc. Lond. Ser. B 267, 2359–2366.

Sequeira, A.S., Farrell, B.D., 2001. Evolutionary origins of Gondwanan interactions: how old are Araucaria beetle herbivores? Biol. J. Linn. Soc. Lond. 74, 459–474. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, 651–701. Sorenson, M.D., 1999. TreeRot, version 2. Boston University, Boston, MA, USA. Stevenson, D.W., Norstog, K.J., Fawcet, P.K.S., 1998. Pollination biology of cycads. In: Owens, S.J., Rudall, P.J. (Eds.), Reproductive Biology. Royal Botanic Gardens, Kew, pp. 277–294. Stireman, J.O., 2005. The evolution of generalization? Parasitoid flies and the perils of inferring host range evolution from phylogenies. J. Evol. Biol. 18, 325–336. Stireman, J.O., Nason, J.D., Heard, S.B., 2005. Host-associated genetic differentiation in phytophagous insects: general phenomenon or isolated exceptions? Evidence from a goldenrod-insect community. Evolution 59, 2573–2587. Swofford, D.L., 2003. PAUP* phylogenetic analysis using parsimony (*and other methods). Version 4.0. Sinauer, Sunderland, Mass. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512–526. Tang, W., 1987. Insect pollination in the cycad Zamia pumila. Am. J. Bot. 74, 90–99. Terry, I.L., Moore, C., Walter, G.H., Forster, P.I., Roemer, R.B., Donaldson, J.S., Machin, P., 2004. Association of cone thermogenesis and volatiles with pollinator specificity in Macrozamia cycads. Plant Syst. Evol. 243, 233–247. Terry, L.I., Walter, G.H., Donaldson, J.S., Snow, E., Forster, P.I., Machin, P., 2005. Pollination of Australian Macrozamia cycads (Zamiaceae): effectiveness and behavior of specialist vectors in a dependent mutualism. Am. J. Bot. 92, 931–940. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res. 25, 4876–4882. Treutlein, J., Wink, M., 2002. Molecular phylogeny of cycads inferred from rbcL sequences. Naturwissenschaften 89, 221–225. Treutlein, J., Vorster, P., Wink, M., 2005. Molecular relationships in Encephalartos (Zamiaceae, Cycadales) based on nucleotide sequences of nuclear ITS 1 & 2, rbcL, and genomic ISSR fingerprinting. Plant Biol. 7, 79–90. Vorster, P., Oberprieler, R.G., 1999. Entomological evidence for and against taxonomical decisions in Encephalartos sp. In: Chen, C.J. (Ed.), Biology and Conservation of Cycads—Proceedings of the Fourth International Conference on Cycad Biology, Panzhihua, China. International Academic Publishers, Beijing, China, pp. 198–207. Vorster, P., 2004. Classification concepts in Encephalartos (Zamiaceae). In: Walters, T., Osborne, R. (Eds.), Cycad Classification: Concepts and recommendations. CABI Publishing, pp. 69–83. Wahlberg, N., 2001. The phylogenetics and biochemistry of host-plant specialization in Melitaeine butterflies (Lepidoptera: Nymphalidae). Evolution 55, 522–537. Wilson, G.W., 2002. Insect pollination in the cycad genus Bowenia (Stangeriaceae). Biotropica 34, 438–441. Xia, X., Xie, Z., 2001. DAMBE: data analysis in molecular biology and evolution. J. Hered. 92, 371–373. Xia, X., Xie, Z., Salemi, M., Chen, L., Wang, L., 2003. An index of substitution saturation and its application. Mol. Phylogenet. Evol. 26, 1–7. Yotoko, K.S.C., Prado, P.I., Russo, C.A.M., Solferini, V.N., 2005. Testing the trend towards specialization in herbivore–host plant associations using a molecular phylogeny of Tomoplagia (Diptera:Tephritidae). Mol. Phyl. Evol. 35, 701–711.