Molecular Typing of Candida Isolates from Patients Hospitalized in an Intensive Care Unit

Journal of Infection (2001) 42, 50–56 doi:10.1053/jinf.2000.0778, available online at http://www.idealibrary.com on

Molecular Typing of Candida Isolates from Patients Hospitalized in an Intensive Care Unit G. Vrioni*1,2 and P. Matsiota-Bernard1 1

Laboratoire de Microbiologie, Hôpital Raymond Poincaré, 92380 Garches, France; 2Microbiologie Laboratory, KAT Hospital, Athens, Greece

Objectives: The aim of our study was the molecular typing of 40 clinical isolates of Candida spp. obtained from patients with burns or trauma hospitalized in the intensive care unit of a general hospital. Methods: Isolates were recovered from blood, deep trauma, urine, sputum or from environment within a short period of time (4 months). The yeasts were identified using commercial yeast identification kits as C. albicans (17 isolates), C. tropicalis (16 isolates) and C. parapsilosis (10 isolates). The epidemiological relation of the isolates was tested with the Random Amplified Polymorphic DNA assay using three or four arbitrary chosen primers. Results: All C. albicans isolates presented distinct RAPD profiles, C. tropicalis isolates presented both the same and distinct RAPD patterns and the C. parapsilosis isolates presented the same RAPD pattern. All the environmental isolates were identified as C. parapsilosis and they had the same RAPD pattern as C. parapsilosis clinical isolates. Candida parapsilosis delineation was confirmed with PFGE. Conclusions: The colonization/infection with C. albicans was endogenous, the C. tropicalis colonization/infection was both endogenous and exogenous, and the C. parapsilosis colonization/infection had an environmental origin. © 2001 The British Infection Society

Introduction Candida species can cause both local and systemic infections in hospitalized patients.1 Although C. albicans remains the most frequent cause of fungaemia and disseminated candidiasis, recent data indicate that more than 30% of nosocomial Candida infections are due to species other than albicans.1,2 Over the past 10–15 years, numerous surveys have documented an increase in infections due to Candida spp.,3 especially in patients requiring intensive care.4 ICU patients are subjected to a number of therapeutic and supportive interventions (central venous catheters, mechanical ventilations and tracheostomy) which breach physiological barriers to infection.4 Although most cases of Candida infection or colonization appear to originate from an endogenous source, there are increasing reports of nosocomial transmission.3 It is noteworthy that the crude mortality rate associated with C. albicans fungaemia is postulated to be around 70–85%, compared to 90–100% with non-albicans species.5

The yeast species are now considered important nosocomial pathogens in both immunocompetent and immunocompromised patients, but little is known of their epidemiology. Methods previously used to distinguish among C. albicans strains were biotyping, enzyme profiles, susceptibility to killer toxins, streak morphology, resistance patterns, biochemical analysis, serological agglutination reaction and immunoblotting techniques.5 The molecular DNA “fingerprinting” methods were used more recently, and included genomic sequencing, multilocus enzyme electrophoresis, restriction enzyme digestion, pulsed field gel electrophoresis and randomly amplified polymorphic DNA (RAPD) analysis.6 This latter method was used in our study for the molecular typing of Candida isolates from patients in the ICU of a large tertiary-care hospital recovered over a short period.

Materials and Methods Yeast isolates

* Please address all correspondence to: Georgia Vrioni, 14 Panagidi str., 113 63 Athens, Greece. Accepted for publication 28 November 2000. 0163-4453/01/010050;07 $35.00/0

Seventeen C. albicans, 16 C. tropicalis and 10 C. parapsilosis isolates were included in the study. The isolates were recovered from various samples from patients hospitalized in the ICU during 4 months (July 1997 to November © 2001 The British Infection Society

Molecular Typing of Candida Isolates Table I. Details of the Candida albicans isolates. Patient no.

Isolate no.

Isolation date

Sampling site

RAPD pattern

N-1 N-1 N-2 N-3

1 2 3 4

22/09/97 28/09/97 20/10/97 20/10/97

a1IA a1IA a1IA b2IA

N-3 N-4 N-5 N-6 N-7 N-8

5 6 7 8 9 10

23/10/97 19/09/97 12/09/97 21/07/97 05/09/97 20/10/97

N-9 N-10 N-11 N-12

11 12 13 14

10/11/97 25/09/97 30/10/97 09/10/97

N-13 N-14 N-14

15 16 17

30/10/97 06/10/97 17/10/97

Urine Wound Urine Transtracheal aspirates Urine Blood Urine Urine Urine Transtracheal aspirates Urine Urine Urine Transtracheal aspirates Urine Abscess Wound

c2IIA d1IIIA e1IVA f2VA g2IIA h2IIA j2IA k2IA l2IA l2IIIA m3IIIB n2VA n2IA`

Table II. Details of the Candida tropicalis isolates. Patient no.

N-1 N-2 N-3 N-4 N-5 N-6 N-6 N-7 N-8 N-9 N-10 N-11 N-12 N-13 N-14 N-15

Isolate no.

Isolation date

Sampling site

RAPD pattern

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

18/08/97 21/08/97 08/09/97 18/10/97 28/08/97 14/08/97 18/09/97 01/09/97 08/09/97 14/08/97 21/08/97 09/10/97 06/10/97 25/09/97 27/10/97 21/08/97

Urine Urine Urine Urine Urine Urine Urine Urine Urine Urine Urine Urine Urine Urine Urine Urine

aI4 aI2* aI2 aI2 aI2 aI2 a*I3 bI3 aI2 bI3 aI2 aI2 aI2 aI2 aI1 aI2

51

1997). Three isolates were recovered from surfaces in the ICU during the same period. Tables I–III show the origin of the isolates. Identification was based on carbon assimilation tests using the API ID32C (bioMerieux Hellas, Athens, Greece) or semiautomatic Vitek YBC-card system (bioMerieux Hellas, Athens, Greece) and confirmed by chlamydospore formation in PCB agar (Sanofi Pasteur) and tetrazolium salt reduction in Sabouraud-TetrazoliumGentamycin-Chloramphenicol agar (bioMerieux Hellas, Athens, Greece). Preparation of DNA Candida DNA was extracted from distinct colonies with two different methods. In the first method, a rapid technique, yeast cells were grown on Sabouraud agar (Oxoid) plates for 48 h at 30 ⬚C. Colonies were suspended in distilled water and the Chelex DNA extraction reagent (Perkin Elmer, New Jersey, USA) was added; after boiling for 25 min and centrifugation, the supernatants were used for analysis.7,8 In the second method, yeast cells were cultured on YPD broth (1% yeast extract, 2% peptone, 2% dextrose) and incubated overnight at 37 ⬚C with shaking (240 rpm). The yeast cells were collected by centrifugation, suspended in 1 ml of 1 M sorbitol–50 mM phosphate buffer (pH 7.5) containing 2% ␤-mercaptoethanol and 2 mg of yeast lytic enzyme (ICN, Aurora, Ohio). After 1 h of incubation at 37 ⬚C, the suspension was centrifuged and the pellet was suspended in 0.5 ml of 50 mM EDTA (pH 8.0)– 0.2% sodium dodecyl sulfate, and incubated at 70 ⬚C for 30 min. After the addition of 5 M potassium acetate, the suspension was left at 0 ⬚C for 30 min and then centrifuged. The supernatant was treated with RNase and the DNA was extracted with an equal volume of chloroformisoamyl alcohol and precipitated with cold ethanol.9 RAPD analysis and pulsed field gel electrophoresis (PFGE)

Table III. Patient no.

N-1 N-2 N-3 N-2 N-4 N-5 N-6 N-7 N-8 N-9

Details of the Candida parapsilosis isolates. Isolate no.

Isolation date

Sampling site

RAPD pattern

1 2 3 4 5 6 7 8 9 10

06/11/97 30/10/97 06/11/97 29/10/97 06/11/97 09/10/97 24/09/97 30/10/97 20/10/97 20/10/97

Environment Wound Environment Blood Environment Blood Blood Urine Wound Urine

aI1A aI1A aI1A aI1A aI1A aI1A aI1A aI1A aI1A aI1A

Four arbitrary primers were used for the RAPD analysis of C. albicans and C. parapsilosis strains, and three primers for RAPD of C. tropicalis (Table IV). The Leg1 and Leg2 primers, which were used separately for RAPD, were combined together when we used by ourselves10 and others11 for the specific amplification of Legionella pneumophila strains. The A1245 primer (mixed with the B1245 primer) is used for the specific amplification of Mycobacterium avium complex strains by classical PCR.12 The CD16S and CD16AS primers, which were used separately for RAPD, are used in association for the Clostridium difficile specific amplification.13 The PC1 primer (mixed with the PC2 primer) is used for the specific amplification of Pneumocystis

G. Vrioni and P. Matsiota-Bernard

52

Table IV. Primers tested to generate RAPD profiles with DNA from Candida isolates. Primer

Sequence (5⬘ to 3⬘)

Candida species

CD16S

CCGTCAATTCMTTTRAGTTT

Leg2

CTGGCTTCTTCCAGCTTCA

LeptoPatho

GSTTTTTCGGGTAAAGATTCATT

CD16AS A1245 Leg1 PC1

CTCTTGAAACTGGGGAGACTTGA GCCGCCGAAACGATCTAC GTCATGAGGAATCTCGCCTG TCACGATGCA

C. albicans, C. tropicalis C. albicans, C. tropicalis, C. parapsilosis C. albicans, C. tropicalis C. albicans C. parapsilosis C. parapsilosis C. parapsilosis

carinii strains.14 The LeptoPatho primer represents a specific sequence of Leptospira pathogenic species.15 The PCR conditions have been described elsewhere.7,8 Briefly, PCR amplification was performed in a total volume of 50 ␮l. The PCR mixture consisted of 50 mM Tris-HCl (pH 8.5), 17 mM (NH4)2SO4, 2 mM MgCl2, 6.7 mM EDTA, 10 mM ␤-mercaptoethanol, 0.1 mg of bovine serum albumin per ml, 0.01% gelatin, 200 mmol of each deoxynucleotide triphosphate, and 0.5 U of Taq DNA polymerase (Perkin-Elmer Cetus) per reaction mixture. Ten microlitres of the eluted DNA were then added. The primers were used at a concentration of 100 pmol. The reaction mixtures were overlaid with 100 ␮l of paraffin oil and incubated for 5 min at 94 ⬚C. A total of 36 cycles (92 ⬚C for 1 min, 35 ⬚C for 1 min, and 72 ⬚C for 2 min) were used. The final cycle was followed by an elongation step of 7 min at 72 ⬚C. The DNA fragments were then separated by 2% agarose gel electrophoresis and were visualized by ethidium bromide staining. The gels were photographed, and the band patterns were compared visually. As there are no specific rules for RAPD,16 the criteria for the results evaluation were as follows: band staining intensity was not considered as a discriminatory factor, and profiles were considered unrelated if they differed by more than one band. The RAPD patterns obtained with the different primers were used to compare the isolates. All isolates were typed twice to assess the reproducibility of the technique. In the case of C. albicans, patterns obtained with primer CD16S are indicated by lowercase letters, those obtained with primer Leg2 by numbers, those obtained with primer LeptoPatho by latin numerals, and those obtained with primer CD16AS by uppercase letters. For C. tropicalis, the pattern labelling system was as follows: Leg2, lowercase letters; CD16S latin numerals; and LeptoPatho, numbers, and for C. parapsilosis: Leg2, lowercase letters; A1245, latin numerals; Leg1, numbers; and PC1, uppercase letters. PFGE was used to type C. parapsilosis strains with a standardized system known as the GenePath strain typing

system (BioRad S.A., France).17 The preparation of agarose-embedded DNA for Candida typing was performed with the GenePath Group 4 Reagent kit according to the method described in the package insert provided by the manufacturer. In brief, yeast cells were grown in YPD broth for 18–24 h. A total of 1
108 cells/ml were harvested and resuspended in cold cell suspension buffer. Lyticase was added to the cell suspension prior to addition of 2% (w/v) CleanCut agarose. The mixture was distributed into plug moulds. Solidified plugs were pushed into lysis buffer II containing lyticase and incubated at 37 ⬚C for 1 h. Lysis buffer II was aspirated and proteinase K buffer containing proteinase K added and incubated overnight at 50 ⬚C. Finally, the plugs were washed with 1
wash buffer and stored at 4 ⬚C. DNA samples were separated on pulsed field gels with run parameters pre-programmed on the GenePath sustem for Candida species; in 1% (BioRad Molecular Biology Certified) agarose at 14 ⬚C in BioRad 1.0
TBE buffer with fields of 4V/cm for 48 h with a linear pulse interval ramping from 90 s to 325 s.

Results and Discussion We performed RAPD analysis to obtain the DNA profile of each isolate. This method had previously been used by other investigators to type Candida isolates and proved to be discriminatory and reproducible.18–21 PFGE was used to confirm our results. During a 4-month period we isolated three different species of Candida from our hospital ICU: C. albicans, C. tropicalis and C. parapsilosis. We used four different primers for C. albicans typing. A comparison of the results obtained showed that all the isolates were different, except firstly for two isolated at different sites from the same patient (N-1: urine and wound), and secondly for two isolated from two different patients (N-1, N-2) (Fig. 1a–d, Table I). These results suggest that the 17 C. albicans isolates had an endogenous origin. Candida albicans, the most frequent Candida species isolated from clinical samples, is a frequent commensal of the gastrointestinal tract and oropharynx in normal subjects, but changes in host defences can lead to C. albicans overgrowth. ICU hospitalization is associated with C. albicans colonization, which is probably a prerequisite for invasive infection such as candidaemia,4,21 which occured in one of our patients. Even though application of molecular methods has confirmed that the majority of C. albicans colonization/infection originates from an endogenous source, there are many reports of nosocomial transmission of a single strain from patient to patient.3 Possibly this is the explanation for the same RAPD pattern between patients N-1 and N-2 in our study (Table I).

Molecular Typing of Candida Isolates

Figure 1.

53

Candida albicans RAPD patterns with the four different primers: CD16S (a), Leg2 (b), LeptoPatho (c) and CD16AS (d).

As regards the 16 C. tropicalis strains, six different pattern combinations were generated by the three primers. We also observed a cluster of 10 isolates with the same pattern (aI2) (Fig. 2a–c, Table II). These results suggested that C. tropicalis infection was both endogenous and nosocomial. Candida tropicalis is the second most frequent Candida species isolated from various sites,22 but in our study it was isolated only from urine. Candiduria was due to catheterization, and its incidence is known to be directly related to the duration of catheterization, hospitalization, and antibiotic use.23 Although most cases of colonization/infection due to C. tropicalis appear to originate from the patient’s endogenous flora and to involve patientunique strains, nosocomial transmission of a single strain has been reported.1,22 The fact that 10 isolates in our study had the same aI2 profile and two others the same bI3 profile (Table II) points to nosocomial transmission, while the other four isolates were patient-unique strains. Finally, the seven clinical isolates of C. parapsilosis (three from blood cultures) and the three environmental

isolates were identical, indicating that this was a nosocomial strain (Fig. 3a–d, Table III). Over the past decade, C. parapsilosis has been identified as an important nosocomial pathogen, and is the fourth most common Candida species in most series, accounting for 7–10% of bloodstream infections by this yeast.1 In our study, three of the four positive blood cultures yielded C. parapsilosis. This yeast proliferates in glucose-containing solutions and is a frequent skin commensal, characteristics which may explain outbreaks due to contaminated solutions24 and intravascular catheters.1 Candida parapsilosis is associated with a significantly larger proportion of documented or possible catheter-related infections than any other Candida species.25 Also, C. parapsilosis is the most frequent fungal colonizer of the subungual space of healthy volunteers, and is the isolate most frequently recovered from the hands of care providers.26 Data from a multicentre study of Candida epidemiology indicate that hand culturepositive rates among care workers in ICUs ranges between 15 and 45%.2,3 In our study we isolated C. parapsilosis

54

Figure 2.

G. Vrioni and P. Matsiota-Bernard

Candida tropicalis RAPD patterns with the three different primers: Leg2 (a), CD16S (b) and Lepto Patho (c).

only from ICU surfaces but not from nurses’ hands, and we found that the isolates from the patients and the surfaces had the same pattern. The ability of Candida spp. to survive on environmental surfaces,3 and the particular affinity of C. parapsilosis for synthetic materials,25,27 may explain its nosocomial transmission and its isolation 7 days after the last case of patient infection/colonization. Application of scrupulus infection control measures in our ICU was associated with a failure to isolate C. parapsilosis in ensuing months. This suggests, as do the available data,3 that C. parapsilosis may be considered an exogenous pathogen and be introduced via contaminated intravenous fluids or biomaterials. However, its nosocomial transmission from patients to patients or from patients to their environment cannot be excluded. It is noteworthy that the PFGE results also suggested that all C. parapsilosis isolates obtained from the patients and the environment were epidemiologically related (data not shown). As we have not managed to isolate any other

C. parapsilosis since then, it was impossible to analyse unrelated isolates. However for the obtained strains we can be certain, because the PFGE gave the same results. It should be borne in mind that PFGE has successfully differentiated C. parapsilosis strains which seemed to be identical using other molecular methods.28 Apart from that, the sensitivity test gave identical phenotyping resistance profile for C. parapsilosis isolates but not for C. albicans and C. tropicalis (data not shown). The patterns of C. albicans, C. tropicalis and C. parapsilosis isolates obtained with the RAPD method were identical using the Chelex reagent and the longer extraction method (data not shown). As the extraction method using the Chelex reagent is more rapid, we currently use it in our laboratory to type Candida strains. Our results suggest that the RAPD method can be used for the epidemiology of Candida infection, and this fact has also been supported by others.18–21,29 This method is rapid, cost-effective and reproducible, and when we

Molecular Typing of Candida Isolates

Figure 3.

55

Candida parapsilosis RAPD patterns with the four different primers: Leg2 (a), A1245 (b), Leg1 (c) and PC1 (d).

performed the RAPD method twice we obtained comparative results. We think that the results obtained in the same series of this method can be compared and used to determine whether the isolates are related or unrelated. As a conclusion, the results obtained in this study with the RAPD method demonstrated that the C. albicans colonization/infection was endogenous, with two exceptions (isolates 1–3), that the C. parapsilosis colonization/infection had an environmental origin, and that the C. tropicalis colonization/infection was both endogenous and exogenous. Also, the RAPD method might be used for the typing of Candida infections, even though the use of several subtyping methods (for example PFGE) is sometimes needed to differentiate fully among isolates of the same species.17,30

References 1 Pfaller MA. Nosocomial candidiasis: emerging species, reservoirs and modes of transmission. Clin Infect Dis 1996; 22 (Suppl 2): S89–S94.

2 Diekema DJ, Messer SA, Hollis RJ, Wenzel RP, Pfaller MA. An outbreak of Candida parapsilosis prosthetic valve endocarditis. Diagn Microbiol Infect Dis 1997; 29: 147–153. 3 Pfaller MA. Epidemiology of candidiasis. J Hosp Infect 1995; 30 (Suppl): 329–338. 4 Vincent J-L, Anaissie E, Bruining H et al. Epidemiology, diagnosis and treatment of systemic Candida infection in surgical patients under intensive care. Intensive Care Med 1998; 24: 206–216. 5 Vazquez JA, Beckley A, Donabedian S, Sobel JD, Zervos MJ. Comparison of restriction enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for Torulopsis glabrata and Candida species other than Candida albicans. J Clin Microb 1993; 31: 2021–2030. 6 Welsh J, McClelland M. Characterization of pathogenic microorganisms by genomic fingerprinting using arbitrarily primed PCR. In: Persing DH, Smith TF, Tenover FC, White TJ (eds). Diagnostic molecular microbiology: principles and applications. Washington DC, 1993: 595–602. 7 Matsiota-Bernard P, Vasseur S, Tassios PT, Kyriakopoulos A, Legakis NJ. Rapid discrimination of Mycobacterium avium strains from AIDS patients by arbitrarily primed PCR analysis. J Clin Microbiol 1997; 35: 1585–1588. 8 Matsiota-Bernard P, Vrioni G, Marinis E. Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Greece. J Clin Microbiol 1998; 36: 20–23.

56

G. Vrioni and P. Matsiota-Bernard

09 Gruber F, Visser J, Kubicek CP, DeGraaf L. Cloning of the Trichoderma reesei pyrG gene and its use as a homologous marker for a highfrequency transformation system. Curr Genet 1990; 18: 447–451. 10 Matsiota-Bernard P, Pitsouni E, Legakis N, Nauciel C. Evaluation of commercial amplification kit for the detection of Legionella pneumophila in clinical specimens. J Clin Microbiol 1994; 32: 1503–1505. 11 Starnbach MN, Falkow S, Tompkins LS. Species-specific detection of Legionella pneumophila in water by DNA amplification and hybridization. J Clin Microbiol 1989; 27: 1257–1261. 12 Thierry D, Vincent V, Clement F, Guesdon J-L. Isolation of specific DNA fragments of Mycobacterium avium and their possible use in diagnosis. J Clin Microbiol 1993; 31: 1048–1054. 13 Gumerlock PH, Tang YJ, Meyers FJ, Silva J Jr. Use of the polymerase chain reaction for the specific and direct detection of Clostridium difficile in human feces. Rev Infect Dis 1991; 13: 1053–1060. 14 Wakefield AE, Pixley FJ, Banerji S, Sinclair K, Miller RF, Moxon ER, Hopkin JM. Detection of Pneumocystis carinii with DNA amplification. Lancet 1990; 336: 451–453. 15 Merien F, Amouriaux P, Perolat P, Baranton G, Saint Girons I. Polymerase chain reaction for detection of Leptospira spp. in clinical samples. J Clin Microbiol 1992; 30: 2219–2224. 16 Michael D, Bean P. Principles and applications of methods for DNA-based typing of microbial organisms. J Clin Microbiol 1999; 37: 1661–1669. 17 Holmberg K Feroze F. Comparative study of the GenePath group 4 reagent system and other CHEF systems for karyotype analysis of Candida spp. J Clin Lab Anal 1995; 9: 184–192. 18 Arif S, Barkham T, Power EG, Howell SA. Techniques for investigation of an apparent outbreak of infection with Candida glabrata. J Clin Microbiol 1996; 34: 2205–2209. 19 Bougnoux ME, Robert F, Beria S, Cassinat B, Nicolas MH, DupouyCamet J. Use of randomly amplified polymorphic DNA markers to distinguish strains of Candida. J Mycol Med 1994; 4: 3–8. 20 Lehmann PF, Lin D, Lasker BA. Genotypic identification and characterization of species and strains within the genus Candida by using random amplified polymorphic DNA. J Clin Microbiol 1992; 30: 3249–3254.

21 Robert F, Leberton F, Bougnoux ME et al. Use of random amplified polymorphic DNA as a typing method for Candida albicans in epidemiological surveillance of a burn unit. J Clin Microbiol 1995; 33: 2366–2371. 22 Joly S, Pujol C, Schroppel K, Soll DR. Development of two speciesspecific fingerprinting probes for broad computer-assisted epidemiological studies of Candida tropicalis. J Clin Microbiol 1996; 34: 3063–3071. 23 Warren JW. Catheter-associated urinary tract infections. Infect Dis Clin North Am 1997; 11: 609–622. 24 Deresinski SC, Clemons KV, Kemper CA, Roesch K, Walton B, Stevens DA. Genotypic analysis of pseudoepidemic due to contamination of Hanks’ balanced salt solution with Candida parapsilosis. J Clin Microbiol 1995; 33: 2224–2226. 25 Abi-Said D, Anaissie E, Uzum O, Raad I, Pinzcowski H, Vartivarian S. The epidemiology of hematogenous candidiasis caused by different Candida species. Clin Infect Dis 1997; 24: 1122–1128. 26 Strausbaugh LJ, Sewell DL, Ward TT, Pfaller MA, Heitzman T, Tjoelker R. High frequency of yeast carriage on hands of hospital personnel. J Clin Microbiol 1994; 32: 2299–2300. 27 Pfaller MA, Jones RN, Messer SA, Edmond MB, Wenze RP, the SCOPE participant group. National surveillance of nosocomial blood stream infection due to species of Candida other than Candida albicans: frequency of occurrence and antifungal susceptibility in the scope program. Diagn Microbiol Infect Dis 1998; 30: 121–129. 28 Carruba G, Pontieri E, De Bernadis F, Martino P, Cassone A. DNA fingerprinting and electrophoretic karyotype of environmental and clinical isolates of Candida parapsilosis. J Clin Microbiol 1991; 29: 916–922. 29 King D, Rhine-Chalberg J, Pfaller MA, Moser SA, Merz WG. Comparison of four DNA-based methods for strains delineation of Candida lusitaniae. J Clin Microbiol 1995; 33: 1467–1470. 30 Odds PC, Brawner DL, Staudinger J, Magee PT, Soll DR. Typing of Candida albicans strains. J Med Vet Mycol 1991; 30(Suppl 1): 87–94.